Primer Design

(in this case the word Primer means an oligonucleotide)

115

Introduction to Primer Design for PCR

Jayme Olsen

Oligonucleotides, also referred to as primers, are short single strands of nucleic acids that are synthesized from either DNA or RNA in order to bind to a complementary strand. Primers have a target area where they bind and act as the starting point for polymerase to extend from, and thus determine what segment of DNA gets amplified. DNA consists of a double stranded helix. One strand of the DNA is named the sense strand and the other strand is the anti-sense strand. These two DNA strands are complements of each other. During PCR, the denaturing step will break the hydrogen bonds, separating the two strands. This allows the primers to anneal to the target region on the DNA during the annealing step. One primer is designed to anneal to the sense strand and the other primer needs to bind to the anti-sense strand. When designing primers for PCR it is necessary to take into consideration things like: how many primers are needed, the length of the primer, the 5 and 3end, the mutation location in primer, the primer melting/annealing temperature, the G-C content, primer dimmer and the distance between the forward and reverse primers. How Many Primers? When ordering oligonucleotides for your particular CFTR mutation 3 or 4 primers should be used. Since experiments often fail you cannot design a good PCR diagnostic test where failing (a negative result) is considered a dependable diagnosis. You dont want to tell the parents with a baby who might have CF: We didnt get a band on the gel so she maybe doesnt have CF, or we just screwed up the gel. Your goal is to design an assay that can diagnose either: (i) if the mutation *is* present by seeing a band on the gel (ie getting a positive result) or (ii) if the normal DNA sequence is present you can see a different band on the gel. If you attempt to make only 3 primers: The wild-type primer could anneal to the anti-sense strand if the mutation is not present on the DNA. The mutant primer could be identical to the wild-type primer, annealing to the antisense strand, but with the mutation sequence that will allow it to only anneal if the mutation is present in the DNA. The reverse primer could then be the same for both the wild-type and mutant primer. It will anneal downstream in the opposite direction on the sense strand. With three primers the bands are the same size on the gel, if you use 4 primers you can also design the experiment so two bands of different lengths/sizes show up on the gel. Length The length of the primers need to between 15 and 30 base pairs so that they are long enough for adequate specificity and short enough for them to anneal to the DNA template. The 5 and 3end The primers need to be designed so that the 3 end of the forward primer will extend toward the reverse primer. The 3 end of the reverse primer need to also extend toward the forward primer. The 3 ends of the forward and reverse primers should be facing each other from opposite DNA strands. This will facilitate the continued replication of the desired strand of DNA. If, for instance, the 3 ends do not elongate in opposite directions (i.e., toward each other) replication will not work and a PCR product will not be obtained.

117

Mutation Location The best way to distinguish the genotype is to put the mutation on the 3 end of the primer. Placing the mutation closer to the 5 end of the primer may allow for hairpins to occur, where the primer skips over the mutant base pair and will re-anneal around it. Primer Melting Temperature (pretty much the same as the annealing temperature) The Primer Melting Temperature (Tm) is important for the annealing phase of PCR. Preferred temperatures should be between 50C and 65C. The forward and reverse primer melting temperatures should be no more than 2 different. To calculate the Tm see the next page on Calculating Annealing Temperatures. G-C Content The G-C content of the primer sequence should be relatively high as it has a direct relationship with the Tm. There should be a base composition of G-C of about 50%-60%. The 3 end of the primer should finish with at least one G or C to promote efficiency in annealing due to the stronger bonding. Distance between the Forward and Reverse The forward primer and the reverse primer should be between 300 and 2,000 base pairs apart. This distance determines how big the band will be in your gel. Larger bands are easier to see. If they are too close, the amplified region the product will be too small and run off the gel and if they are too big, the product will not make it out of the well. Refer to Ch. 20 in your book. Beware of Primer Dimer Primer Dimer is an artifact of PCR where primers bind to each or to themselves other instead of the template DNA and thus act as their own template to make a small PCR product and appear faintly on an electrophoresis gel. To avoid primer dimers, be sure there are not many complementary areas in the base sequence of your forward and reverse primers where the primer strands would be able to bind to each other instead of the gene. Things to Avoid To avoid non-specific binding, design the primers with high annealing temperatures. To make sure the primers designed will only bind to the target area submit the sequence to the BLAST website. The MgCl2 and pH conditions can also be adjusted for improved amplified product. Watch out for runs of singles bases of Gs, Cs, As, and Ts when developing primers because they can allow mis-priming. Keep in mind that the more nucleotide bases that the primer is made up of, the more expensive they are. The shorter the primers are, the less specificity they have in PCR.

118

Introduction to Calculating PCR annealing temperatures of oligonucleotide primers The most crucial factors that need to be optimized in a PCR reaction are the magnesium concentration, enzyme concentration, DNA concentration and annealing temperature of the primer. The G+C content of the primers should generally be 40-60% and care should be taken to avoid sequences that produce internal secondary structures as well as primer dimer where primers bind to each other. The annealing temperature for a PCR cycle is generally 3-5 degrees Celsius below the melting temperature (Tm) of the primer. There are several formulas for calculating melting temperatures. In all cases these calculations will give you a good starting point for determining appropriate annealing temperatures for PCR primers. The exact optimum annealing temperature must be determined empirically, however. There are numerous websites that help with primer design and annealing temperature calculations, search for them. Here's Promegas website at http://www.promega.com/BioMath. Basic Melting Temperature Calculations 1) The simplest "rule of thumb" formula is as follows: Tm=4C x (#Gs + Cs in the primer) + 2C x (# As + Ts). 2) This formula is valid for oligos of less than 14 bases and assumes that the reaction is carried out in 50mM monovalent cations. For longer primers the formula is modified. Tm= 64.9C + 41C x (number of Gs and Cs in the primer -16.4)/N Where N is the length of the primer. For example, Promegas T7 promoter primer (TAATACGACTCACTATAGGG) is a 20-mer that has 5 Ts, 7 As, 4 Cs, and 4 Gs. Thus, its melting temperature would be: 64.9C + 41C x (8-16.4)/20= 47.7 C 3) A third formula calculates the Tm with salt concentrations taken into consideration: Tm = 81.5 +16.6 (log10[Na+]) + 0.41 (%G+C) 675/n Where [Na+] is the molar salt concentration ; [K+] = [Na+] and n = number of bases in the oligonucleotide primer. Other useful formulae are: Nanogram of primer = picomole of primer x 0.325 x # bases MicroMolar concentration of primer = picomoles of primer/ volume (!L) in which the primer is dissolved.

119

ADVANCED APPROACH: Mutation Construction through Site-Directed Mutagenesis

Mitchell Wood

Introduction: PCR is a powerful tool in molecular biology, specifically for genotypic identification of a given sample of DNA. Some novel mutations in the CFTR gene have only been noticed in a few patients; therefore the number of DNA samples with that genotype is limited. Genetic tests that are generated should cover all mutations known in the CFTR gene, including these novel ones. But to test for these rare mutations positive controls must be found, or generated, to experiment upon before the test is given to a patient. As an alternative to contacting researchers across the globe for positive control samples, a relatively simple alternative is to use PCR to replicate DNA with this rare mutation. This process is called Site-Directed Mutagenesis, which in principle uses imperfect stringency in primer annealing to direct a mutation into the replicated DNA. Methods: The length of the primer with the forced mutation is the foremost limitation of the replicated DNA. When the primer anneals and is replicated with the intentional mismatch, the resulting PCR product will begin with the 5 end of the primer. Therefore, the length of the primer used in the allele specific positive control test can not exceed the length of the sitedirected mutagenesis primer. However, the length of the allele-specific primer must not be too short (under ~18 base pairs) otherwise it is more probable for non-specific binding on non target DNA. To minimize the complications that come with a lengthy primer, the forced mutation can be placed as close to the 3 end of the oligo as possible in order to leave the remaining length to fit the allele specific primer. Refer to Yaku et al. (2008) for ideas and clarification. 1. Design allele specific primers. 2. To design mutagenic primers, add several nucleotides to the 3 end of your allele specific primers (the exact number should be determined by Yaku et al (2008)). 3. Predict the sequence of the PCR product and confirm that it is the one you want. 5-TAC ACG CCC AAG TAC GGT TCC ACA-3 !Primer with mutation 3-CCG TCG ATG TGC GGG TTC ATG CCA AAG TGT CTG-5 !DNA Template Replication with above primer will yield a new DNA template with the forced mutation, but the DNA segment will only be the length between the forward and reverse primers from above. Therefore the direction of the replication in the next ASPCR will have to be closely watched. 5-TAC ACG CCC AAG TAC GGT TG-3!ASPCR Primer using Yaku Method. 3-ATG TGC GGG TTC ATG CCA ACG TGT CTG-5 ! Complement to primer with forced mutation.

120

4558 Nucleic Acids Research, Vol. 19, No. 16

l. 1991 Oxford University Press

Improved site-directed mutagenesis method using PCR

Oscar P.Kuipers, Hein J.Boot and Willem M.de Vos Molecular Genetics Group of the Department of Biophysical Chemistry, Netherlands Institute for Dairy Research (NIZO), PO Box 20, 6710 BA Ede, The Netherlands
Submitted June 18, 1991
Several methods for site-directed mutagenesis using PCR have been described in the last few years. One of the most rapid, universal and economical methods was described by Landt et al. (1). This procedure requires just one mutagenic primer and two universal primers, which may contain convenient restriction sites for cloning. Essentially, it makes use of two subsequent amplification rounds, the first with the mutagenic oligonucleotide and the antiparallel universal primer and the second one using the purified first fragment as a primer, together with the second universal primer, and subsequent digestion and cloning of the fragment. A possible problem described by these authors is the untemplated addition of one nucleotide at the 3' site-specifically altered end of the first amplified fragment by Taq-polymerase, which can give rise to unwanted mutations in the second generated fragment. The authors advise to use lower concentrations of dNTPs to avoid untemplated addition of a nucleotide. A drawback of this procedure is a lower yield and no guarantee for the absence of a 3' additional residue. A second solution for the problem is to remove the additional 3' residue by the action of e.g. T4-polymerase prior to performance of the second PCR. This means that an additional enzymatic modification step has to be performed, which might not be fool-proof. As has been observed by several authors the 3' additional nucleotide appears almost invariably to be an A-residue when using Taq polymerase (2, 3). Making use of this observation we have successfully applied a modification in the method which can generally be used to exclude the described difficulties. A mutagenic oligonucleotide is used for the first PCR reaction which is designed in such a way that the first 5' nucleotide of the primer follows a T-residue in the same strand of template sequence. Thus, whether or not the amplified primer fragment from the first PCR contains an additional 3' A-residue, in both cases the amplified product will have the correct sequence, without need for further modifications. Since in almost every case it should be possible to find a T-residue at a reasonable distance from the site of mutation, this adjusted method is generally applicable. We performed several different site-directed mutagenesis experiments by this method on the nisA gene (4). The following experimental conditions were used. Approximately 10 ng of plasmid DNA harbouring the nisA gene was used as template for PCR in a total volume of 50 Id, containing 1 U of Taq-polymerase (BRL), 50 mM NaCl, 10 mM Tris-HCl pH 8.8, 2 mM MgCl2, 10 itg gelatine, 200 zM of dNTPs, 10 pmol of each primer, 2.5 of stabilizer (1% W-1, BRL) and covered with 100 ,ul of light mineral oil. PCR was performed in 30 cycles, each cycle consisting of a denaturing step at 93 C for 1 min., a primer annealing step at 54 C for 1.5 min. and an extension step at 72 C for 2.5 min. using a Biomed Thermocycler 60. The DNA-fragments were purified by
TAE-agarose gel electrophoresis and recovered using the GeneClean procedure (Bio 101, La Jolla, California). Fig. 1. shows the sequence of the nisA gene and that of one of the oligonucleotides we used for site-directed mutagenesis. In each case we obtained the designed mutated fragment without undesired substitutions as was shown by dideoxy sequencing of six independent clones from each of several different mutagenesis experiments. This shows that no other nucleotide than an Aresidue, or no nucleotide at all, had been applied to the 3' end of the amplified primer fragment although we used up to 200 AM of dNTPs in all PCR reactions. In two other mutagenesis experiments using the same PCR conditions as described above, primers were used which followed another nucleotide than a Tresidue at the 5' end (in our case a C-residue). Following subcloning of the digested fragments, six clones obtained from each mutagenesis experiment were sequenced. In ten out of twelve cases a T for C substitution was encountered on the left side of the 5' end of the first mutagenic primer, simultaneously with the desired mutation. In one case the wild-type sequence was observed, probably originating from a cloned template fragment and in one case the desired mutation and the correct sequence at the 5' end of the primer were found. Thus, when using this mutagenesis method, a well considered choice of primer sequences can considerably increase the frequency of correctly mutated sequences.

REFERENCES
1. Landt,O., Grunert,H.-P. and Hahn,U. (1990) Gene 96, 125-128. 2. Clark,J.M. (1988) Nucl. Acids Res. 16, 9677-9686. 3. Mole,S.E., Iggo,R.D. and Lane,D.P. (1989) Nucl. Acids Res. 17, 3319. 4. Buchman,G.W., Banerjee,S. and Hansen,J.N. (1988) J. Biol. Chem. 263, 16260-16266.

'TAA

AOGTTAG 3 '(PstI)

S5*ACAAGTAr2TCZCTA-TGACACCCGG2TG 3' CATTACAAGTATTTCGCTATGTACACCCGGTTGTAAAACAGGAGCTCTGATGGGTTGTAACATGAAAACAGCAA CTTGTCATTGTAGTATTCACGTAAGCAAATAACCAAATCAAAGGATAGTATTTTGTTAGTTCAGACATGGATAC

TATCCTATTTTTATAAGTTATTTAGGG 3'
3 'GGATAAAAATATTCQAAAAATCCC

5' (HindIII)

Figure 1. Sequence of nisA and primers used for PCR. Primers are shown in bold, the template T-residue 5' to the mutagenic primer (Ser5 - Ala) is indicated by an asterisk and sites of mutation are underlined. The non-coding sequence
of the nisA gene is shown in italics.

ADVANCED APPROACH: Introduction to The Yaku-Bonczyk Primer Design Method

Vincent Cracolici

The What? The Yaku-Bonczyk method is an advanced protocol by which primers can be designed in order to increase PCR stringency as well as decrease the chance of false positives or negatives seen in a gel. In 2008, Yaku et al presented this design method; it was then further investigated by LB 145 student Sarah Bonczyk in spring 2009. By slightly altering the classic 3 single base pair difference between wild-type and mutant primers, a research team can drastically increase primer discrimination against nonspecific binding. Similar results were shown by Wittwer et al (1993). How does it work? The standard method of primer design for a genetic mutation, like one on CFTR, typically involves two forward primers which are identical save for the base pair nearest the 3 end: one primer is complementary to wild-type DNA and the other to mutant DNA. However, the single base-pair mismatch between these two primers is often not enough to ensure that the wild-type primer will not anneal to and extend mutant DNA, and vice versa. The Yaku-Bonczyk method differs from the standard because the primers are designed to better discriminate against non-complementary DNA by always incorporating an intentional mismatch into the primer. The Yaku-Bonczyk method involves the most 3 base pair of each forward primer again being complementary to the mutant/wild-type DNA it is seeking, the second base pairs in are designed to always anneal to either type of DNA, and the third base pairs in are designed as an intentional mismatch that will never anneal to either type of DNA (see illustration). If a primer and its complementary DNA strand anneal to each other, the single mismatch three base pairs in from the 3 end is not enough to prevent extension and will result in only a small hairpin in the sequence. Additionally, if a primer and a non-target DNA strand anneal to each other, the complementary match at the second base pair from the 3 end of the primer is not strong enough to pull the two strands together and is unlikely to allow for extension. Therefore, nonspecific binding is decreased. Points to Ponder -The intentional mismatch that exists on all the primers three base pairs in from the 3 end provides an excellent opportunity to boost your primers G/C content. -Should this intentional mismatch still be included in the calculations of annealing temperatures? -Remember to consider purine/pyrimidine interactions with themselves and each other in designing the intentional mismatch.

122

The Yaku-Bonczyk Method

Primer: 5 AACGTGGTCXYZ 3
X: Should be designed to NEVER anneal to mutant OR wild-type DNA Y: Should be designed to ALWAYS anneal to mutant AND wild-type DNA Z: Should be site specific: anneal to EITHER mutant OR wild-type DNA

A primer designed with the Yaku-Bonczyk method will anneal to and extend target DNA despite the intentional mismatch. The force of the single repulsion will not hinder the primer as a whole.

A primer designed with the Yaku-Bonczyk method will not anneal to nor extend non-target DNA as a result of the two mismatches. The attraction at the second base pair in on the primer is not enough to allow for extension at the 3 end.

123

4130 Hidenobu Yaku1,2 Tetsuo Yukimasa1 Shu-ichi Nakano2 Naoki Sugimoto2,3 Hiroaki Oka1
1

Electrophoresis 2008, 29, 41304140

Research Article

Advanced Technology Research Laboratories, Matsushita Electric Industrial Co. Ltd., Kyoto, Japan 2 Frontier Institute for Biomolecular Engineering Research, Konan University, Kobe, Japan 3 Department of Chemistry, Faculty of Science and Engineering, Konan University, Kobe, Japan Received February 7, 2008 Revised May 14, 2008 Accepted May 21, 2008

Design of allele-specic primers and detection of the human ABO genotyping to avoid the pseudopositive problem
PCR experiments using DNA primers forming mismatch pairing with template lambda DNA at the 30 end were carried out in order to develop allele-specic primers capable of detecting SNP in genomes without generating pseudopositive amplication products, and thus avoiding the so-called pseudopositive problem. Detectable amounts of PCR products 0 were obtained when primers forming a single or two mismatch pairings at the 3 end were used. In particular, 30 terminal A/C or T/C (primer/template) mismatches tended to allow PCR amplication to proceed, resulting in pseudopositive results in many cases. While less PCR product was observed for primers forming three terminal mismatch pairings, target DNA sequences were efciently amplied by primers forming two mismatch pairings next 0 to the terminal G/C base pairing. These results indicate that selecting a primer having a 3 terminal nucleotide that recognizes the SNP nucleotide and the next two nucleotides that form mismatch pairings with the template sequence can be used as an allele-specic primer that eliminates the pseudopositive problem. Trials with the human ABO genes demonstrated that this primer design is also useful for detecting a single base pair difference in gene sequences with a signal-to-noise ratio of at least 45. Keywords: Allele-specic primer / Human ABO gene / Pseudopositive problem / SNP 30 terminal mismatch pairings DOI 10.1002/elps.200800097

1 Introduction
Among gene polymorphisms, SNP occur at the highest frequency. SNP are reported to occur at a frequency of about 0.1% in the human genome, and more than three million SNP have been identied [1]. Research on SNP in humans has revealed several associations of SNP types with diseases including diabetes, cancer, and myocardial infarction, and SNP in the human genome are also known to inuence aspects of the human constitution such as blood group type and the sensitivity to alcohol [27]. Several techniques for SNP genotyping have been reported. These include utilizing DNA hybridization [8], primer extension reaction using allele-specic DNA primers and DNA polymerase [912], DNA mismatch-recognizing enzymes [1315], the Invader assay [16, 17], DNA chips [18, 19], and pyrosequencing [2022]. Among these, the method using allele-specic primers has been investigated extensively for its advantages in cost, reaction time, and simplicity of handling. Allele-specic DNA primers exhibit different efciencies for primer extension reactions, depending on
Correspondence: Hidenobu Yaku, Advanced Technology Research Laboratories, Matsushita Electric Industrial Co. Ltd., 3-4 Hikaridai, Seika-cho, Soraku-gun, Kyoto, Japan E-mail: yaku.hidenobu@jp.panasonic.com Fax: 181-774-98-2585

the identities of the base pairs of the SNP in the template DNA, and the SNP genotyping can be achieved simply by detecting the amounts of PCR products or even by detecting the pyrophosphate generated during PCR [9, 10]. Proper design of primer DNA sequences is important for the efcient detection of SNP by PCR. The allele-specic primers are usually designed to complement template DNA 0 and contain a nucleotide specic to the SNP at the 3 end. The SNP-specic nucleotide forms a base pairing or mismatch pairing depending on the base pair identity of the SNP and only proper base pairing at the end of the primer/template duplex is effective in producing PCR products, while less PCR product is produced for terminal mismatch pairings due to decreased DNA polymerase binding and inefciencies in incorporating 20 -deoxyribonucleoside triphosphates [23]. Nevertheless, unexpected primer extension with mismatchforming DNA primers, the so-called pseudopositive problem, may occur when PCR is carried out under unsuitable reaction conditions with regard to the amplication cycle, reaction time, temperature, and 20 -deoxyribonucleoside triphosphates concentration, although each of these conditions may be optimized through repeated trials. The pseudopositive problem also arises due to specic DNA primer sequences. Primer extension reactions are often observed when a single
Additional corresponding author: Dr. Hiroaki Oka,

E-mail: oka.hiroaki@jp.panasonic.com

Electrophoresis 2008, 29, 41304140

Nucleic acids

4131

Table 1. Sequences of lambda DNA and the forward primers used for PCR

a) Underlined nucleotides in the forward primers are unpaired with the lambda DNA sequence.

mismatch is formed at the 30 end with the primer used [2325]. The pseudopositive problem becomes much more serious for the allele frequency analysis than when an SNP typing is aimed at distinguishing homozygotes and heterozygotes because the pseudopositive signals should be less than 1% of those obtained with matched primer in the case of the allele frequency analysis. So, several strategies have been explored to eliminate the pseudopositive problem. Kambara and coworkers [9, 10] designed allele-specic primers so that
& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

the 30 end nucleotide was specic to the SNP and the 3rd nucleotide from the 30 end was mismatched with the template DNA. Aono et al. [12] developed allele-specic primers so that the 2nd nucleotide from the 30 end was specic to the SNP and the 3rd nucleotide from the 30 end was mismatched with the template DNA. In addition, several methods using modied primer, such as locked nucleic acid primer [13], phosphorothioate-modied primer [11, 14], and dideoxynucleotideterminated primer [15] have been developed. Zhanget al. [11]
www.electrophoresis-journal.com

4132

H. Yaku et al.

Electrophoresis 2008, 29, 41304140

reported a method using an allele-specic primer in which the 30 end nucleotide was a phosphorothioate-modied nucleotide and specic to the SNP along with use of a DNA polymerase with proofreading function. Among these studies, allelespecic DNA primers forming mismatch pairings near the SNP distinction site were used in order to inhibit DNA polymerase association only when forming the mismatch pairing at the SNP site and to eliminate pseudopositive PCR products. However, the appropriate values of the number, position, and type of the mismatch nucleotide pairs have not yet been systematically examined. To investigate whether the use of allele-specic primer sequences can eliminate the pseudopositive problem, we carried out systematic PCR experiments using lambda DNA as a template and DNA primers designed to form different numbers and different types of mismatch pairings near the 30 end. DNA primers designed to form three consecutive mismatch pairings at the 30 end produced less PCR product, even after 30 amplication cycles, while DNA primers forming two mismatch pairings next to the G/C Watson-Crick base pairing produced moderate amounts of PCR product. These results demonstrate that primers for which the 30 nucleotide specic to the SNP and the other two nucleotides were mismatched with the template DNA could amplify specic alleles and would be useful for SNP genotyping. Moreover, primer design was applied to the detection of human blood types, and properly designed primers were shown to allow efcient detection of single base pair differences in the ABO gene without the pseudopositive problem.

followed by the quantication of the PCR products by Agilent 2100 Bioanalyzer (Agilent Technologies).

2.2 PCR of the human ABO blood type genes The 22nd base pair in exon 6 of the ABO gene was selected as a target for human blood genotyping. As given in Table 2, this base pair is a G/C base pair in the A and B alleles and an A/T base pair in the O allele due to deletion of the G/C base pair found in the A and B alleles [3, 4]. Accordingly, the 22nd base pair in exon 6 is the homo G/C base pair for blood type AB and the homo A/T base pair for blood type O. Two-step PCR was carried out to detect allelic difference in the 22nd base pair of exon 6 of the ABO gene. In the 1st PCR, a fragment of exon 6 in human genomic DNA was amplied by using a forward primer (50 -TAGGAAGGATGTCCTCG-30 ) complementary to base pairs 117 and a reverse primer (50 -TTCTTGATGGCAAACACAGTTAAC-30 ) (Proligo, E@sy OligosTM) complementary to base pairs 112135 of the A and B alleles or base pairs 111134 of the O allele on exon 6. The 1st PCR was carried out in 20 mL reactions using the LightCycler FastStart DNA Master SYBR Green I reaction kit with 0.5 ng/mL of genomic DNA, 1.25 mM MgCl2, and 1 mM of each of the forward and reverse primers. Following denaturation at 951C for 10 min, 50 cycles of denaturation at 951C for 10 s, annealing at 521C for 10 s, and extension at 721C for 10 s were carried out on the LightCycler. Amplication was monitored in real time by measuring the uorescent intensity of SYBR Green I, and amplications were conrmed to be completed by the 50th cycle with the amount of amplication product being almost identical for both alleles (data not shown). In order to analyze ABO genotyping with allele-specic primers, the 2nd PCR was carried out using the product of the 1st PCR as a template and the allele-specic forward primers given in Table 3 (50 -TAGGAAGGATGTCCTCGTGY3Y2G-30 ). The 30 end nucleotide of the primers is G, which is complementary to the C of the 22nd G/C base pair of exon 6 in the A
Table 2. Sequences of exon 6 of the ABO gene ABO gene Sequence (5-3)a)

2 Materials and methods

2.1 PCR using lambda DNA Sequences of lambda DNA (TAKARA BIO) that was used as a template DNA, and 41 synthetic oligoDNAs (Proligo, E@sy OligosTM) that were used as DNA forward and reverse primers are presented in Table 1. Forward primer nos. 140 are (50 -GATGAGTTCGTGTCCGTACAACX3X2X1-30 ) complementary to base pairs 71317155 of the lambda DNA sequence, forming zero, one, two, or three mismatch pairings at the 30 end depending on the identity of X1, X2, and X3. The reverse primer sequence (50 -GAATCACGGTATCCGGCTGCGCTGA-30 ) was fully matched with base pairs 74067430 of the lambda DNA (see Table 1). After initial denaturation at 951C for 10 min, the amplication was carried out for 20 or 30 cycles as follows in a LightCycler (Roche Diagnostics) thermal cycler: denaturation at 951C for 10 s, annealing at 581C for 10 s, and DNA extension at 721C for 10 s. The 20-mL PCR mixtures were prepared using the LightCycler FastStart DNA Master SYBR Green I reaction kit (Roche Diagnostics, with 1 ng/mL lambda DNA, 1.25 mM MgCl2, 1 mM forward primer, and 1 mM reverse primer. PCR products were analyzed by electrophoreses on 3% agarose gel on a Mupid (ADVANCE Co.)
& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

A allele 1 TAGGAAGGAT GTCCTCGTGG TGACCCCTTG GCTGGCTCCC and B allele 41 ATTGTCTGGG AGGGCACATT CAACATCGAC ATCCTCAACG 81 AGCAGTTCAG GCTCCAGAAC ACCACCATTG GGTTAACTGT 121 GTTTGCCATC AAGAA O allele 1 TAGGAAGGAT GTCCTCGTGG TACCCCTTGG CTGGCTCCCA 41 TTGTCTGGGA GGGCACATTC AACATCGACA TCCTCAACGA 81 GCAGTTCAGG CTCCAGAACA CCACCATTGG GTTAACTGTG 121 TTTGCCATCA AGAA a) Underlined nucleotides, the G and the A, are the 22nd nucleotide in the AB allele and the O allele, respectively.

www.electrophoresis-journal.com

Electrophoresis 2008, 29, 41304140

Nucleic acids

4133

and B alleles but is mismatched with the A/T base pair at base pair 22 of the O allele. The 2nd and 3rd nucleotides from the 30 end, Y2 and Y3, respectively, are designed to be mismatched with the 20th and 21st nucleotides of the exon 6 sequence. The reverse primer used for the 2nd PCR was 50 -TTCT TGATGGCAAACACAGTTAACC-30 . The PCR mixtures (20 mL) contained 2 mL of the 1st PCR product diluted 1000times, 1.25 mM MgCl2, 1 mM of each of the forward and reverse primers. Following DNA denaturation at 95 1C for 10 min, the 2nd PCR was carried out for 2128 cycles of denaturation at 951C for 10 s, annealing at 521C for 10 s, and extension at 721C for 10 s. Experiments using lambda DNA and exon 6 of the human ABO gene were highly reproducible, and the concentrations of the PCR product presented here are averages of three independent experiments.

3 Results and discussion

3.1 DNA primer design for PCR of lambda DNA The allele-specic primers are expected to result in successful PCR amplication only when the nucleotide specic to the SNP is present in the primer and is
Table 3. The allele-specic forward primers used for the detection of single base pair difference in the AB allele and the O allele Allele specic primer ABO261 ABO261 ABO261 ABO261 ABO261 ABO261 ABO261 ABO261 ABO261 AAG ACG AGG CAG CCG CGG TAG TCG TGG Sequence (5-3)a) TAGGAAGGATGTCCTCGTGAAG TAGGAAGGATGTCCTCGTGACG TAGGAAGGATGTCCTCGTGAGG TAGGAAGGATGTCCTCGTGCAG TAGGAAGGATGTCCTCGTGCCG TAGGAAGGATGTCCTCGTGCGG TAGGAAGGATGTCCTCGTGTAG TAGGAAGGATGTCCTCGTGTCG TAGGAAGGATGTCCTCGTGTGG

complementary to the SNP nucleotide of the analyte DNA. However, allele-specic primers with SNP-specic nucleotides at the 30 end and the other bases of the primer, which are fully complementary to the template sometimes, result in amplication, even when the SNP-specic nucleotide is not complementary to the SNP nucleotide. It has been reported that the PCR products can be suppressed by using mismatch-forming forward primers that form mismatch pairs in addition to the SNP distinction nucleotide [9, 10, 12]. To obtain information on PCR primer design, primers with different mismatches and PCR cycle numbers were tested with the lambda DNA template. As shown in Fig. 1 and Table 1, PCR experiments were primarily carried out with 13 forward primers (nos. 113, 50 -GATGAGTTCGT GTCCGTACAACX3X2X1-30 ) that were complementary to the 7131st7155th base pairs of the lambda DNA: primer no. 1 has a sequence that is fully complementary with the template DNA (50 -TGG-30 /50 -CCA-30 , where 50 -TGG-30 is X3X2X1 at the 30 end of the primer and 50 -CCA-30 is the complementary sequence of the lambda DNA), primer nos. 24 have a single mismatch at their 30 end (50 -TGX1-30 /50 CCA-30 , where X1 5 A, T, or C forming mismatch pairings of A/C, T/C, or C/C, respectively), and primer nos. 513 have mismatches on the two terminal base pairs (50 -TX2X130 /50 -CCA-30 , where X2X1 5 CA, CT, CC, AA, AT, AC, TA, TT, or TC). These primer sequences cover all possible mismatch pairings with the template DNA sequence.

3.2 PCR using mismatch-forming primers with the lambda DNA PCR products using the lambda DNA as a template were analyzed for electrophoretic mobility. Amplication products were expected to be 300 bp in accordance with the forward and the reverse primer binding sites (see Table 1). However, electrophoretic assay of amplication products produced with primer no. 1 showed a single product of about 270 bp in length, based on comparisons to marker DNA fragments (data not shown). The substitution of dUTP for dTTP in the PCR reaction kit was conrmed to

a) Underlined nucleotides are unpaired with the AB allele and the O allele.

nucleotides Forward primers 5-GATGAGTTCGTGTCCGTACAACX3X2X13 Lambda DNA

Variant

Taq polymerase

5. . .GATGAGTTCGTGTCCGTACAACTGG. . . . . 3. . .CTACTCAAGCACAGGCATGTTGACC. . . . .

7131

7155

. . . . .TCAGCGCAGCCGGATACCGTGATTC. . .3 . . . . .AGTCGCGTCGGCCTATGGCACTAAG. . .5
7406 7430

3-AGTCGCGTCGGCCTATGGCACTAAG-5 Reverse primer

Figure 1. Schematic diagram of the PCR experiments using lambda DNA and the forward primers forming zero, one, or two mismatch nucleotide pairings.

Comparison of the concentrations of the PCR products

& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

www.electrophoresis-journal.com

4134

H. Yaku et al.

Electrophoresis 2008, 29, 41304140

A
Concentration of amplification products (nM)

300 250 200 150 100 50 0 1 2 3 4 5 6 7 8 9 10 11 12 13

3 T3 5 C3 5 A3 5 G 5 A3 5 T3 5 C3 5 A3 5 T3 5 C3 5 C3 5 T3 5 A3 5 TG CC 5TG CC 5TG CC 5TG CC 5T C CC 5T C CC 5T C CC 5T A CC 5T A CC 5T A CC 5T T CC 5T T CC 5T T CC 5 A A A A A A A A A A A A A 3 3 3 3 3 3 3 3 3 3 3 3 3

Fully matched
Concentration of amplification products (nM)

Single mismatch

Two mismatches

450 400 350 300 250 200 150 100 50 0

3 T3 5 C3 5 A3 5 G 5 C3 5 T3 5 A3 5 A3 5 C3 5 T3 5 A3 5 T3 5 C3 5 TG CC 5TG CC 5TG CC 5TG CC 5T C CC 5T C CC 5T C CC 5T A CC 5T A CC 5T A CC 5T T CC 5T T CC 5T T CC 5 A A A 3A 3A 3A 3A 3 3A 3 3A 3 3A 3A 3A 3A

10

11

12

13

Fully matched

Single mismatch

Two mismatches

Figure 2. Concentrations of the target PCR products after 20 (A) or 30 (B) amplication cycles using lambda DNA and the forward primers forming zero, one, or two mismatch nucleotide pairings.

considerably affect mobility of the amplied fragments in the polyacrylamide gel, and products amplied with the primer no. 1 corresponded to a length of about 300 bp if thymine was incorporated compared with a length of 270 bp. Only a single amplication product was observed in the experiments, which were highly reproducible. Thus, we concluded that the PCR product with a length of 270 bp based on marker DNAs was the target PCR product. The effect of PCR cycle number on SNP detection and the specicity of allele-specic primers was examined for 20 and 30 cycles. PCR with a single mismatch at the 30 end between primers (nos. 24) and templates produced moderate amounts of product about 300 bp in length after 20 (Fig. 2A) and 30 cycles (Fig. 2B). The fully complementary primer (no. 1) produced PCR products of 260 and 390 nM after the 20 and 30 cycles, respectively, suggesting that the amplication reaches a plateau by the 20th cycle. When primer nos. 2 and 3 forming a single terminal A/C or T/C mismatch pairing, respectively, were used, the amounts of the PCR product obtained after the 20th cycle (about
& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

200 nM) were more than 70% of those obtained by the fully complementary primer, and the amounts after 30 cycles with primers nos. 13 were almost identical (about 400 nM). Primer no. 4 formed a single C/C mismatch pairing at the end, which inhibited amplication after 20 cycles (less than 50 nM). These results are in agreement with those of Huang et al. [23] and Kwok et al. [24], demonstrating much lower primer extension efciency with terminal C/C mismatch compared with A/C and T/C mismatches. The thermostability of the primertemplate duplex may not affect the efciency based on a thermodynamics study by Allawi et al. [29] showing that the T/C mismatch, as well as the C/C mismatch, destabilized the DNA duplex. On the other hand, even primer no. 4 showed additional amplication after 30 cycles. The terminal C/C, A/G, and G/A mismatches impair amplication efciency compared with complementary pairing [23]. However, based on the results shown in Figs. 2A and B, cycle number is shown to strongly affect the concentration of amplication products. Consequently, only a single terminal mismatch is thought to be insufcient for eliminating the pseudopositive problem.
www.electrophoresis-journal.com

Electrophoresis 2008, 29, 41304140

Nucleic acids

4135

Concentration of amplification products (nM)

300 250 200 150 100 50 0

14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

3 3 3 3 3 3 A3 T3 A3 T3 A3 A3 T3 T3 A3 T3 T3 A3 CA 5 AC 5 AA 5 AT 5 TA 5 TT 5 GC 5 GC 5 A 5 GA 5 T 5 GT 5 CC 5 C 5 CA 5 A 5 CT 5 CTT 5 5A ACC 5 ACC 5A ACC 5A ACC 5A CC 5A ACC 5 ACC 5 ACC 5G ACC 5 ACC 5G ACC 5 ACC 5 ACC 5C ACC 5 ACC 5C ACC 5 ACC 5 ACC A 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3

Three mismatches

Concentration of amplification products(nM)

450 400 350 300 250 200 150 100 50 0

3 3 3 3 3 3 A3 T3 A3 A3 A3 T3 T3 T3 T3 A3 T3 A3 CA 5 AC C5 AAA 5 AAT 5 AT A 5 ATT 5 GC C5 GC 5 GA C5 GA 5 GT 5 GT C5 CC 5 CC 5 CA C5 CA 5 CT C5 CTT 5 5A ACC 5 AC 5 CC 5 ACC 5 ACC 5 CC 5 AC 5 CC 5 AC 5 CC 5 CC 5 AC 5 CC 5 CC 5 AC 5 CC 5 AC 5 CC 3A 3A 3 3A 3A 3 3A 3 3 3 3A 3A 3 3A 3 3 3A 3

14

15

16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

31

Three mismatches

Figure 3. Concentrations of the target PCR products after 20 (A) or 30 (B) amplication cycles using lambda DNA and the forward primers with 30 terminal A/C or T/C mismatch pairing and mismatch pairing in the adjacent two nucleotides.

5 3

AC 3 GA T GAG T TCG TG T CCGT A CA A CT C T A C T C A A G C A C A GG C A T G T T GA CC

Figure 4. Schematic diagram of the hybridization of primer no. 15 and template.

In contrast with primers producing single mismatches, less PCR product was produced after 20 cycles with the primer nos. 513, which have two terminal mismatch pairs (Fig. 2A). In particular, primers forming the mismatched pairings, C/C, A/C, or T/C, next to the C/C mismatched pairing at the end (nos. 7, 10, and 13, respectively) showed inhibited amplication, even after 30 cycles. Because primer no. 4 that formed a G/C pair next to a C/C mismatch pair at the end resulted in amplication product, the genotyping of G and C in analyte DNA can be accomplished by using these primers. On the other hand, moderate amounts of amplication product after 30 cycles (230260 nM) were obtained for reactions with primers forming A/C or T/C mismatches at the end (nos. 6, 8, 9, 11, and 12) but not for reactions with primer no. 5. Instead of the 300-bp product produced with other primers, the product produced with primer no. 5 was longer due to primer hybridization at an unexpected site.
& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

These results suggest that the amplication product of reactions with primers with two mismatches depends on the PCR cycle number, the identities of the mismatches, and that the terminal A/C and T/C mismatch pairs have less inuence on PCR efciency. Moreover, primers forming A/C or T/C terminal pairing produced similar amounts of amplication product after 30 cycles, indicating that the penultimate mismatch has much less effect on PCR efciency than the 30 end mismatch type of primers with two consecutive mismatches at the end. Consequently, primers forming one or two mismatches at the 30 end, with the exception of primers forming terminal C/C mismatch pairings, proved to be unsuitable for avoiding pseudopositive amplications.

3.3 PCR using the primers with three mismatched nucleotides at 30 end Results of the previous section suggest that terminal A/C or T/C mismatch pairing allows amplication after 30 cycles with primers forming two mismatches at the end and potentially leading to the pseudopositive problem for SNP detection. Thus, we examined PCR using the primer nos. 1431, which had 30 terminal A/C or T/C mismatch pairing
www.electrophoresis-journal.com

4136

H. Yaku et al.

Electrophoresis 2008, 29, 41304140

Sis paired with S

Type-1

Sis unpaired with S

5 3 5
XY S

5 3

XY

S XY S

3 primer 5 template 3 primer 5 template 3 primer 5 template

3 primer

XY S

Type-2

5 3

XY S

5 template 3 primer 5 template 3 primer 5 template

S XSY

3 5 3

XSY

Type-3

5 3

X Y

SXY

S S XY

SXY

Figure 5. Candidates for the allele-specic primers. S and S0 indicate SNP in the template DNA and the corresponding SNP nucleotide in the primer, respectively. X/X and Y/Y are mismatch pairings.

Concentration of amplification products (nM)

160 140 120 100 80 60 40 20 0

3 3 3 3 3 3 3 3 3 CG 5 AG 5 TG 5 CG 5 AG 5 TG 5 CG 5 AG 5 TG 5 5A ACC 5A ACC 5A ACC 5GACC 5GACC 5GACC 5C CC 5CACC 5CACC 3 3 3 3 3 3 3 3 3A

mismatches (Fig. 4) and, thus, the base pairs near the end no longer inhibited the amplication reaction.

3.4 Design of DNA primers with two mismatch pairs adjacent to the terminal base pair Three types of DNA primer designs for forming three mismatches at the end were considered for the SNP detection (Fig. 5): Type 1, the 30 end nucleotide is specic to the SNP and the next two nucleotides are mismatched pairings; Type 2, the 2nd nucleotide from the 30 end is specic to the SNP and the adjacent nucleotides on either side are mismatch pairings; Type 3, the 3rd nucleotide from the 30 end is specic to the SNP and the other nucleotides form mismatch pairings. Clarication of the amount of the PCR product produced when S0 is paired with S and the reduced amount of product when S0 is unpaired with S for the SNP detections (Fig. 5) is required. In fact, Kambara and coworkers [9, 10] have already reported reduced efciency of primer extension for primer DNA corresponding to type 2 design even when S0 is paired with S. Additionally, although type 3 primers form two mismatches, the S0 pairing with S was found to produce amplication product depending on the mismatch and PCR cycles, as shown in Figs. 2 and 3. Therefore, we further investigated DNA primers of type 1 design. To examine type 1 primers, PCR experiments using the primer nos. 3240 (Table 1) were tested. Primer nos. 3240 were designed to form two mismatched base pairs adjacent to the terminal G/C pair when associating with the lambda DNA template (50 -X3X2G-30 /50 -CCA-30 , where X3X2 5 AC, AA, AT, GC, GA, GT, CC, CA, or CT). The terminal G/C pair was supposed to distinguish the SNP nucleotide based of the type 1 primer design. As a result, substantial amounts of the product (150320 nM) were obtained by all primer nos. 3240 after 30 cycles (Fig. 6) and six of the primers provided PCR product of more than 50 nM, even after 20 cycles (data not shown). The results indicate that the type 1 primers are promising as allele-specic primers without the pseudopositive problem. Importantly, less target PCR
www.electrophoresis-journal.com

32

33

34

35

36

37

38

39

40

Concentration of amplification products (nM)

350 300 250 200 150 100 50 0

32 33 34 35 36 37 38 39 40

3 3 3 3 3 3 3 3 3 CG 5 AG 5 TG 5 CG 5 AG 5 TG 5 CG 5 AG 5 TG 5 5A ACC 5A ACC 5A ACC 5GACC 5GACC 5GACC 5C CC 5CACC 5CACC 3 3 3 3 3 3 3 3 3A

Figure 6. Concentrations of the target PCR products after 20 (A) or 30 (B) amplication cycles using lambda DNA and forward primers designed to have 30 terminal G/C base pairing and two mismatched base pairings adjacent to the G/C pair.

with the template along with mismatches at the adjacent two positions (50 -X3X2X1-30 /50 -CCA-30 , where X1 5 A or T, and X3X2 5 AC, AA, AT, GC, GA, GT, CC, CA, or CT). The amount of amplication product expected by using these primers, with the exception of primer no. 15, was small after 20 cycles (Fig. 3A) and even by the 30 cycles (Fig. 3B). These observations suggest that primers forming three mismatch pairings at the 30 end result in less amplication product, regardless of mismatch type and number of PCR cycles. Primer no. 15 unexpectedly resulted in PCR product after the 30 cycles due to hybridization at the target binding site by forming a bulge structure that avoided the three terminal
& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Electrophoresis 2008, 29, 41304140

Nucleic acids

4137

Isolated genomic DNA from AB or O type blood

Exon 6 of ABO gene

1st PCR

5 3

5-TTCTTGATGGCAAACACAGTTAAC-3 3 5

5-TAGGAAGGATGTCCTCG-3

2nd PCR

5 3

5-TTCTTGATGGCAAACACAGTTAAC-3 3 5

5-TAGGAAGGATGTCCTCGTGY3Y2G-3

Y2 and Y 3 are mismatched with the template DNA sequence [Y 3,Y 2]=[AA],[CA],[TA],[AC],[CC],[TC],[AG],[CG] or [TG] ABO261AAG, CAG, TAG, ACG, CCG, TCG, AGG, CGG or TGG
Figure 7. Schematic diagram for the detection of single base pair difference in exon 6 of the ABO gene using allele-specic primers.

Electrophoresis

1 2 3 M + AB O M + AB O M + AB O

6 4 5 M + AB O M + AB O M + AB O

7 8 9 M + AB O M + AB O M + AB O

Figure 8. Detection of the single base pair difference in exon 6 of the AB and O alleles by different primers (1:ABO261-AAG, 2: ABO261ACG, 3: ABO261-AGG, 4: ABO261-CAG, 5: ABO261-CCG, 6: ABO261-CGG, 7: ABO261-TAG, 8: ABO261-TCG, and 9: ABO261-TGG.). The arrows indicate target PCR products (135 and 134 bp for the AB and O alleles, respectively). Plus indicates the positive control lane, where the AB allele was used as a template and the fully matched primers were used. Minus indicates the negative control lane, where no primers were added to the AB allele. M indicates the 20-bp DNA ladder.

product was observed for DNA primers with three consecutive mismatches, even after the 30 amplication cycles (Fig. 3B), suggesting that the type 1 primers can prevent the pseudopositive problem independent of the number of PCR cycles. These reaction conditions allow SNP genotyping with DNA template of an unknown concentration. Comparison of amplication data for the primers with two mismatches (Fig. 2) and three mismatches (Fig. 3) also give insights into the type 3 primer design in that the 3rd nucleotide from the 30 end is specic to the SNP. Primers
& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

with two mismatches, including the terminal T/C or A/C pairing produced PCR products by 30 amplication cycles, while less product was formed by the primers with three mismatches. However, the signal-to-noise ratios were smaller than for the type 1 primers and all primers forming two mismatches produced less target PCR product (o50 nM) after 20 amplication cycles, indicating that SNP genotyping of the type 3 primer depends on the number of amplication cycles. Therefore, the DNA primer design based on the type 1 detection is more promising than that of type 3.
www.electrophoresis-journal.com

4138
90 80 70 60 50 40 30 20 10 0 Concentration of amplification products (nM)

H. Yaku et al.

Electrophoresis 2008, 29, 41304140

AB

AB

AB

ABO261-ACG

ABO261-TCG

ABO261-CCG

Figure 9. Concentrations of the prospective PCR products using the AB and O alleles as template, and ABO261-ACG, ABO261TCG, and ABO261-CCG as an allele-specic primer.

3.5 Detection of single base pair difference in the ABO gene using allele-specic primers Detection of the blood typing is important for paternity testing, blood infusion, and criminal investigations, and PCR technology enables detection of blood types using DNA samples that may have been poorly preserved. Table 2 indicates the sequences of the region of exon 6 in the human ABO gene containing the nucleotides targeted for genotyping. The 22nd base pair is G/C, both in the A and B alleles, while the 22nd base pair is A/T in the O allele due to deletion of the 22nd G/C base pair found in the A and B alleles. In order to examine genotyping with PCR, identication of the 22nd base pair in the ABO genes was carried out using DNA primers (50 -TAGGAAGGATG TCCTCGTGY3Y2G-30 , as given in Table 3, which were designed based on the type 1 primer design), forming a G/C base pair with the A and B alleles but mismatch pairing with the terminal base of the O allele. The outline of SNP detection for the human ABO genes is indicated in Fig. 7. Briey, two-step PCR was used with the 30 end nucleotide of the forward primers for the 2nd PCR being located opposite to the SNP nucleotide and with the adjacent two nucleotides being mismatched with exon 6 sequence (Table 3), resulting in pairings of 50 -Y3Y2G-30 /50 CAC-30 for the AB alleles and 50 -Y3Y2G-30 /50 -TAC-30 for the O allele. The primers have G at the 30 end, which is complementary to the 22nd C of exon 6 in the AB alleles but not to the 22nd T in the O allele, and the 2nd (Y2) and the 3rd (Y3) nucleotides from the 30 end of the primers are mismatched with the 21st A and 20th C, respectively. Therefore, the PCR products were expected to be less with the O allele, but signicant for the AB allele. Gel electrophoresis demonstrated that the amplication products for the AB and O alleles from the 2nd PCR (Fig. 8) were as expected, with only the AB allele DNA being amplied efciently by the primers of ABO261-ACG, AGG, CCG, TCG, and TGG, and the amplications by ABO261ACG, TCG, and CCG forming the C/A pairing at the 2nd position from the end were more signicant than the other
& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

forward primers (80 nM for ABO261-ACG, 73 nM for ABO261-TCG, and 51 nM for ABO261-CCG, respectively, all of which contain C next to the SNP distinction nucleotide, G, and in which the last three letters are abbreviated as the primer name representing the three nucleotides at the 30 end of the primer. For example, the primer ABO261-ACG has the 30 terminal sequence 50 -ACG-30 ). In contrast, the amplication products with O allele DNA using these primers were undetectable by the Agilent 2100 Bioanalyzer, which has a detection sensitivity of about 1.1 nM (Fig. 9). Consequently, ABO261-ACG, ABO261-TCG, and ABO261CCG successfully detected blood type with signal-to-noise ratios of 70.8, 64.6, and 45.1, respectively. Moreover, ABO261-AAG, CAG, CGG, and TAG also provided less target amplication product for O allele DNA. These results are in agreement with those for lambda DNA showing that primers forming three consecutive terminal mismatch pairings prevent amplication. However, when ABO261AAG, CAG, CGG, and TAG were used, little product was produced for the AB allele. Importantly, while these four primers formed A/A or A/G mismatch at the 2nd position from the end (50 -AAG-30 /50 -CAC-30 , 50 -CAG-30 /50 -CAC-30 , 50 -CGG-30 /50 -CAC-30 , and 50 -TAG-30 /50 -CAC-30 , where underlining indicates the mismatch nucleotides), the primers of ABO261-ACG, TCG, and CCG, which amplied the AB allele, formed A/C mismatch at the same position (50 -ACG-30 /50 -CAC-30 , 50 -TCG-30 /50 -CAC-30 , and 50 -CCG30 /50 -CAC-30 , where underlining indicates the mismatch nucleotides). A/C mismatch is also formed by the purine and pyrimidine nucleotides, and the purinepyrimidine pairing may adopt geometry analogous Watson-Crick base pairing [3033]. It is known that A/C mismatch pairing is stabilized by the formation of two interstrand hydrogen bonds by protonation of the adenine base. In light of this structural aspect, it is likely that A/C mismatch pairing in a DNA duplex results in less distortion of conformation, presumably leading to less inhibition of the amplication reaction. Allowance of the A/C mismatch in DNA polymerase reactions was also suggested for the terminal A/C pairing with lambda DNA. On the other hand, the A/A and G/A mismatches, which are composed of two purine nucleotides, are supposed to distort the DNA double helix structure due to their size [3338], and the distortion would exclude DNA polymerase association. If the model showing that the geometry at the 2nd position from the 30 end inuences the PCR amplication efciency is reasonable, the nucleotides specic to SNP are also expected to be successful in distinguishing SNP, even when the 2nd nucleotide of the primer and the corresponding nucleotide of the template DNA are A and C, respectively. Furthermore, because G/T mismatch is also formed by the purine and pyrimidine nucleotides and can adopt a geometry analogous Watson-Crick base pairing like A/C mismatch pair, SNP genotyping may be achieved when the G/T or T/G mismatch is formed instead of A/C mismatch at the position. Primer ABO261-CCG with a C/C mismatch at the 3rd nucleotide position from the end resulted in less
www.electrophoresis-journal.com

Electrophoresis 2008, 29, 41304140

Nucleic acids

4139

amplication of the AB allele than did ABO261-ACG or ABO261-TCG primers in which the A/C or T/C mismatch pairing, respectively, was formed at the same position (80 nM for ABO261-ACG, 73 nM for ABO261-TCG, and 51 nM for ABO261-CCG, respectively). The 3rd nucleotide, as well as the 2nd nucleotide from the end may have an effect on PCR efciency. The results indicate that the type 1 primers can detect single base pair differences among the ABO gene alleles. Although the ability depends on mismatch pairings, especially at the 2nd position from the 30 end, our results indicate the inuences of mismatch pairings and these positions are useful in designing type 1 primers. Polymerase is also important for the PCR with allelespecic DNA primers. The allele-specic type 1 primer that hybridizes with the template DNA forms mismatched pairs at the 30 end, and the mismatched pairs may prevent DNA polymerase binding with the primertemplate DNA complex. Taq polymerase that has no 30 -50 exonuclease activity was used for these experiments. However, when using polymerase that has the 30 -50 exonuclease activity also meant that the pseudopositive problem may occur because such a polymerase may degrade the mismatched nucleotides. The use of the DNA polymerase without the 30 -50 exonuclease activity is an important consideration for SNP detection.

4 Concluding remarks
To investigate the allele-specic primer DNA sequences that can eliminate the pseudopositive problem, PCR experiments were carried out systematically using lambda DNA as a template and the DNA primers with different numbers of and different types of mismatch pairings near the 30 end. The present ndings showed that primers forming a single mismatch pairing at the 30 end of these primers gave the amplication products (primer nos. 24 in Fig. 2), indicating that only a single terminal mismatch is insufcient for inhibiting the amplication, as has also been reported previously [2325]. On the other hand, amounts of the PCR product obtained for DNA primers forming two consecutive mismatch pairings at the end strongly depended on the mismatch type and number of amplication cycles (primer nos. 513 in Fig. 2). In particular, the primers forming a mismatched pairing next to the A/C or T/C pair at the end provided moderate amounts of the amplication product after 30 amplication cycles, indicating the importance of control of the PCR cycle number for the regulation in the amount of product. In contrast with the two-mismatch primers forming the A/C or T/C mismatch pairing at the end, less PCR product was observed for the primers forming two consecutive C/C mismatch pairings at the end, even after the 30 cycles. Because the primer forming the G/C pairing next to the C/C mismatch pairing at the end gave amplication product, the genotyping of G and C in analyte DNA can be realized by using these primers.
& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

As for other SNP genotypings, such as those forming A/C and T/C mismatch pairings, two consecutive mismatches at the end seem inefcient to discriminate the sequences. However, primers forming three consecutive mismatches at the end show less target PCR product regardless of the mismatch type, even after the 30 amplication cycles (Fig. 3). When the 30 end nucleotide of the type 1 primer was mismatched with the template DNA, three consecutive mismatches at the 30 end were formed, while moderate amounts of PCR product were observed for the formation of the terminal G/C pairing (Fig. 6). Thus, the type 1 primer is promising for PCR cycle-independent SNP detection within at the most 30 amplication cycles, while the detection possibly fails after larger amplication cycles because pseudopositive signals from the primers with three consecutive mismatches become large and non-negligible. Examinations of human ABO genes also demonstrated that type 1 primer design was useful for detecting single base pair difference in the gene sequences with high signal-tonoise ratios. In this paper, systematic PCR experiments were carried out to investigate allele-specic primers without the pseudopositive problem. Although direct sequence analyses such as Sanger method [39], pyrosequencing method [2022], and single-base extension method [40] can also be useful for the SNP detection, the method using PCR with allele-specic primers have great advantages in time, cost, and a handling with ease even though the design of allele-specic primers for every new SNP analysis is needed. Examinations of human ABO genes gave us important information to design allelespecic primers. The results showed that the primers forming the A/C mismatch pairing next to the G/C pairing at the 30 end supported greater PCR amplication than did the A/A or the G/A mismatch pair, which indicates the importance of the geometry of the mismatch pair at the 2nd position from the 30 end. When the DNA sequence design of templates and primers are optimized, type 1 primer design may also be suitable for identifying genes other than the human ABO gene. Consequently, type 1 primers can be used to detect SNP with less occurrence of the pseudopositive problem. The authors declare no conict of interest.

5 References
[1] Wang, D. G., Fan, J. B., Siao, C. J., Berno, A et al., Science 1998, 280, 10771082. [2] Bos, J. L., Cancer Res. 1989, 49, 46824689. [3] Yamamoto, F., Hakomori, S., J. Biol. Chem. 1990, 265, 1925719262. [4] Yamamoto, F., Clausen, H., White, T., Marken, J., Hakomori, S., Nature 1990, 345, 229233. [5] Goedde, H. W., Agarwal, D. P., Fritze, G., Meier-Tackmann, D. et al., Hum. Genet. 1992, 88, 344346. [6] Ghosh, S., Watanabe, R. M., Hauser, E. R., Valle, T. et al., Proc. Natl. Acad. Sci. USA 1999, 96, 21982203.

www.electrophoresis-journal.com

4140

H. Yaku et al.

Electrophoresis 2008, 29, 41304140

[7] Ozaki, K., Sato, H., Iida, A., Mizuno, H. et al., Nat. Genet. 2006, 38, 921925. [8] Howell, W. M., Jobs, M., Gyllensten, U., Brookes, A. J., Nat. Biotechnol. 1999, 17, 8788. [9] Zhou, G. H., Kamahori, M., Okano, K., Chuan, G. et al., Nucleic Acids Res. 2001, 29, e93. [10] Zhou, G. H., Shirakura, H., Kamahori, M., Okano, K. et al., Hum. Mutat. 2004, 24, 155163. [11] Zhang, J., Li, K., Pardinas, J. R., Liao, D. F. et al., Mol. Biotechnol. 2004, 27, 7580. [12] Aono, T., Takarada, Y., Segawa, M., Yoshiga, S., Patent 2000, JP-101544370; PCT/WO/JP/00/08657. [13] Zhang, Y., Kaur, M., Price, B. D., Tetradis, S., Makrigiorgos, G. M., Hum. Mutat. 2002, 20, 139147. [14] Stanislawska-Sachadyn, A, Sachadyn, P., Acta Biochim. Pol. 2005, 52, 575583. [15] Drabovich, A. P., Krylov, S. N., Anal. Chem. 2006, 78, 20352038. [16] Lyamichev, V., Mast, A. L., Hall, J. G., Prudent, J. R. et al., Nat. Biotechnol. 1999, 17, 292296. [17] Hall, J. G., Eis, P. S., Law, S. M., Reynaldo, L. P. et al., Proc. Natl. Acad. Sci. USA 2000, 97, 82728277. [18] Schmalzing, D., Belenky, A., Novotny, M. A., Koutny, L. et al., Nucleic Acids Res. 2000, 28, e43. [19] Fan, J. B., Chen, X., Halushka, M. K., Berno, A. et al., Genome Res. 2000, 10, 853860. [20] Nyren, P., Karamohamed, S., Ronaghi, M., Anal. Biochem. 1997, 244, 367373. [21] Ronaghi, M., Uhlen, M., Nyren, P., Science 1998, 281, 363365. [22] Ahmadian, A., Gharizadeh, B., Gustafsson, A. C., Sterky, F. et al., Anal. Biochem. 2000, 280, 103110. [23] Huang, M. M., Arnheim, N., Goodman, M. F., Nucleic Acids Res. 1992, 20, 45674573.

[24] Kwok, S., Kellogg, D. E., McKinney, N., Spasic, D. et al., Nucleic Acids Res. 1990, 18, 9991005. [25] Rickert, A. M., Borodina, T. A., Kuhn, E. J., Lehrach, H., Sperling, S., Anal. Biochem. 2004, 330, 288297. [26] Latorra, D., Campbell, K., Wolter, A., Hurley, J. M., Hum. Mutat. 2003, 22, 7985. [27] Hu, Y. J., Li, Z. F., Diamond, A. M., Anal. Biochem. 2007, 369, 5459. [28] Liu, Q., Sommer, S. S., BioTechniques 2000, 29, 10721083. [29] Allawi, H. T., SantaLucia Jr. J., Nucleic Acids Res. 1998, 26, 26942701. [30] Boulard, Y., Cognet, J. A. H., Gabarro-Arpa, J., Bret, M. L. et al., Nucleic Acids Res. 1992, 20, 19331941. [31] Allawi, H. T., SantaLucia Jr. J., Biochemistry 1997, 36, 1058110594. [32] Allawi, H. T., SantaLucia Jr. J., Biochemistry 1998, 37, 94359444. [33] Nakano, S., Sugimoto, N., Recent Res. Dev. Nucleosides Nucleotides 2003, 1, 5980. [34] Maskos, K., Gunn, B. M ., LeBlanc, D. A ., Morden, K. M., Biochemistry 1993, 32, 35833595. [35] SantaLucia Jr. J., Turner, D. H., Biochemistry 1993, 32, 1261212623. [36] Allawi, H. T., SantaLucia Jr. J., Biochemistry 1997, 37, 21702179. [37] Wu, M., SantaLucia Jr. J., Turner, D. H., Biochemistry 1997, 36, 44494460. [38] Varani, G., McClain, W. H., EMBO Rep. 2000, 1, 1823. [39] Sanger, F., Nicklen, S., Coulson, A. R., Proc. Natl. Acad. Sci. USA 1977, 74, 54635467. [40] Chen, J., Iannone, M. A., Li, M. S., Taylor, J. D. et al., Genome Res. 2000, 10, 549557.

& 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

www.electrophoresis-journal.com