Professional Documents
Culture Documents
7000 Jokes
7000 Jokes
1. 2. (. ). /. 6. # of Vulcans needed to replace a bulb? Precisely 1.0000000 $ egrep -n '^[a- !."##$' $% - sort -t'&' '2.0 $ fortune $ r* -r $+,-. $$$ not found -- 01bort2 31efinance2 41eclare ban5ruptcy $10 78atta you 9ant $: for? ;ou 5no9 8o9 *uc8 $6 is. ,5. +ere's $). $<i=es son $2 and as5s for $1 c8ange1. - >e9is8 ?at8er @. $100 in=ested at @A interest for 100 years 9ill beco*e $10020002 at 98ic8 ti*e it 9ill be 9ort8 absolutely not8ing. - Ba arus Bong2 CDi*e .noug8 for Bo=eC :. $1000 re9ard for finding t8is *an& E. $(20002000 10. $Fig boo52 big bore. 11. GD8e-en78o+old+ig8Places-ustFeD8e1stDoHtart.. 12. II F..3.J0K not found2 LH.3..M. not loaded NN 1(. I?ro* listening co*es 9isdo* and fro* spea5ing repentance. 1). I?ro* t8e creati=e 9or5s8ops of Hoong2 Onc. 1/. NAIP 1 fis82 NAIP 2 fis82 NAIP red fis82 NAIP blue fis8 16. NN---- D+OH HP0J. ?,3 H0B. ----II 1@. N- Jloa5ed Dribble 1:. N----- D8e infor*ation 9ent data 9ay -----I 1E. ND8is page is intentionally left blan5.I - OF20. NQ0PI D8at 9as "not" *anual o=erride. - 4ata 21. C... all t8e *odern incon=eniences ...C - -ar5 D9ain 22. C... an eRperienced2 industrious2 a*bitious2 and often Suite often picturesSue liar.C -ar5 D9ain 2(. C2nd star on t8e rig8t2 t8en on until *orningC 2). C6)0T oug8t to be enoug8 for anybody.C - Fill <ates 2/. C0 *an ca*e into t8e t8e office one day and said 8e 9as a sailor. 7e cured 8i* of t8at.C - -ar5 D9ain2 on 8is days as a doctor's apprentice in Jalifornia 26. C0 tree is a tree. +o9 *any *ore do you 8a=e to loo5 at?C - <o=ernor 3onald 3eagan $1E661 2@. C0 9itty saying pro=es not8ing.C - Voltaire 2:. C0cting is an art 98ic8 consists of 5eeping t8e audience fro* coug8ing.C 2E. C0d*iral2 t8ere be 98ales 8ereC ... C - Hcotty (0. C0dopted 5ids are suc8 a pain -- you 8a=e to teac8 t8e* 8o9 to loo5 li5e you ...C <ilda 3adner (1. C0ll fles8 is grassC -- Osia8 H*o5e a friend today. (2. C0ll *odern 0*erican literature co*es fro* one boo5 by -ar5 D9ain called +uc5leberry ?inn.C - .rnest +e*ing9ay ((. C0ll *y friends and O are cra y. D8at's t8e only t8ing t8at 5eeps us sane.C (). C0ll t8e parts falling off t8is car are of t8e =ery finest Fritis8 *anufactureC - Fu*per stic5er (/. C0-40J?C as5ed t8e disgruntled ?.. (6. C0nd 98at 9ill you do 98en you gro9 up to be as big as *e?C as5ed t8e fat8er of 8is little son. C4iet.C (@. C0ny fool can paint a picture2 but it ta5es a 9ise *an to be able to sell it.C (:. C0pple OC $c1 Jopyrig8t 1@6@2 Hir Osaac Ke9ton.
(E. C0rgu*ents 9it8 furniture are rarely producti=e.C - Te8log 0lbran2 CD8e ProfitC )0. C0s part of t8e con=ersion2 co*puter specialists re9rote 12/00 progra*s -- a process t8at traditionally reSuires so*e debugging.C - LH0 Doday2 referring to t8e O3H s9itc8o=er to a ne9 co*puter syste*. )1. C0sse*bly language is also a=ailable.C - >ordan +enderson $Uordan%8ac5ercorp.co*1 )2. C0=oid o=eruse of 'Suotation C*ar5s.C'C )(. CFat*an is t8e 8ero any of us could be2 gi=en deter*ination2 eRercise2 and deep psyc8ological trau*a.C - J8ris >aroc8a-.rnst )). CFeautiful story. Tinda gets you rig8t +.3.C - V )/. CFenson2 you are so free of t8e ra=ages of intelligenceC - Di*e Fandits )6. CFesides2 it is clearly a bunny rabbitC - 4ata )@. CFe9are of bugs in t8e abo=e codeW O 8a=e only pro=ed it correct2 not tried it.C 4onald Tnut8 ):. CFot8er2C said Poo82 and deleted 8is *essage base. )E. CFoy2 4ata2 you loo5 great in a pus8-up braC - 3i5er /0. CFoy2 t8at 4ata is slic5er t8an co9 snotC - <uinan /1. CFut O don't li5e Hpa*C /2. CFut t8is is *y sister's bi5eC /(. CFut 98at 9e need to 5no9 is2 do people 9ant nasally-insertable co*puters?C /). CJ is t8e asse*bly language of Dcl.C - Tarl Be8enbauer $5arl%8ac5ercorp.co*1 //. CJall it a 8unc8.C - Vuasi*odo /6. CJalling >--an Tin5. Jalling >--an Tin5. +as8 *issle sig8ted2 target Bos 0ngeles. 4isregard personal feelings about city and intercept.C /@. CJal=in Joolidge loo5s as if 8e 8ad been 9eaned on a pic5le.C - 0lice 3oose=elt Bong9ort8 /:. CJal=in Joolidge 9as t8e greatest *an 98o e=er ca*e out of Ply*out8 Jorner2 Ver*ont.C - Jlarence 4arro9 /E. CJaptain2 Per*ission to 8oo5 up blender attac8*ents to -r 4ataC 60. CJaptain2 98y not Uust gi=e t8e Forg 7indo9s (.1?C - 7orf 61. CJle=eland? ;es2 O spent a 9ee5 t8ere one day.C 62. CJolonel Kort82 do you understand 98at 9e *ean by t8e L.H.H.3.?C C;es sir2 it is a code na*e for 3ussia.C 6(. CJo*puter2 delete 7.HB.;..M.C - .ntire .nterprise cre9. 6). CJo*puters are uselessW t8ey can only gi=e ans9ers.C - Picasso 6/. CJontrari9ise2C continued D9eedledee2 Cif it 9as so2 it *ig8t be2 and if it 9ere so2 it 9ould beW but as it isn't2 it ain't. D8at's logicC - Be9is Jarroll2 CD8roug8 t8e Boo5ing <lassC 66. CJri*inal Ba9yerC is a redundancy. 6@. C4ad2 8a=e you seen Flip? O can't find 8i* any98ereC 6:. C4a*age control is easy. 3eading Tlingon -- t8at's 8ard.C 6E. C4a**it2 >i* O'* a doctor2 not a p8ysicianC - -cJoy @0. C4a*nit >i*2 O'* a doctor not a Dagline...C @1. C4anger 7ill 3obinson 4anger 4anger 4anger 4angerC @2. C4ata does it in serial...C - Das8a ;ar @(. C4ata enUoys a lot of confusion2 >ean-Buc.C - 4eanna @). C4ata2 O t8oug8t you 9ere deadC CKo2 sir2 O rebooted..C @/. C4eli=er yesterday2 code today2 t8in5 to*orro9.C @6. C4e*ocracy is also a for* of 9ors8ip. Ot is t8e 9ors8ip of >ac5als by >ac5asses.C - +. B. -enc5en
@@. C4ie? O s8ould say not2 dear fello9. Ko Farry*ore 9ould allo9 suc8 a con=entional t8ing to 8appen to 8i*.C - >o8n Farry*ore's dying 9ords @:. C4, K,D2 repeat2 4, K,D blo9 t8e 8atc8C @E. C4o you 5no9 any Tlingon opera?C - 7orf :0. C4on't belie=e anyt8ing you read and only 8alf of 98at you see.C - 7ill 3ogers :1. C4on't dispute deat8 unless you'=e li=ed t8roug8 it.C :2. C4on't tell *e 98at you drea*'d last nig8t for O'=e been reading ?reud.C :(. C4,HX+O<+C +**2 O 5ne9 it 9as on so*et8ing... :). C4rop t8e guy 9it8 t8e de=il ears.C - KFJ2 >une2 1E6/. :/. C43,PP.4 ?3,- LDHC is Uust V-'s 9ay of saying CFooga2 FoogaC :6. C43,PP.4 ?3,- LDHC is Uust V-'s 9ay of saying LDH is out to lunc8C :@. C.nergi eC said Picard and t8e pin5 bunny appeared... ::. C.=ery creature 8as 9it8in 8i* t8e 9ild2 uncontrollable urge to PLKD.C :E. C.Rcuse *e2 do you *ind if O sSuis8 in 8ere?C - ,do E0. C.Rtra pic5les. 0 9arrior's condi*entC - 7orf E1. C?acts are stupid t8ings.C - President 3onald 3eagan E2. C?ascinating2C said Hpoc52 9atc8ing Tir5's lousy acting. E(. C?ascinating.C Hpoc5 figures out t8e .nergi er Funny. E). C?ire2 -r. 7orfC N7orf pic5s up eRtinguis8erI E/. C?ire2 -r. 7orfC [7orf pic5s up eRtinguis8er! E6. C?lo9ers Os t8ere a '>o8n Buc5 Pi55erd' 8ere?C - V E@. C?or t8ere is no sea2 9it8 out t8e dolp8inC - ,ppian E:. C?or*at all 10? ,nly ( fit in t8e slot EE. C<od not only plays dice2 +e so*eti*es t8ro9s t8e dice 98ere t8ey cannot be seen.C H. +a95ing 100. C<rub first2 t8en et8ics.C - Fertolt Frec8t 101. C+and *e t8at solar-po9ered flas8lig8t...C 102. C8at in <od's na*e a* O doing 9rong?C - 7ile .. Joyote 10(. C+e is considered t8e *ost graceful spea5er 98o can say not8ing in *ost 9ords.C 10). C+e is no9 rising fro* affluence to po=erty.C - -ar5 D9ain 10/. C+e taug8t us dra9ing2 stretc8ing2 and fainting in coils.C 106. C+e 9as so narro9 *inded 8e could see t8roug8 a 5ey8ole 9it8 bot8 eyes ...C 10@. C+e's a potato >i*2 Bet's gouge out all of 8is eyesC 10:. C+e's Uust a politician trying to sa=e bot8 8is faces ...C 10E. C+e's t8e 5ind of *an for t8e ti*es t8at need t8e 5ind of *an 8e is ...C 110. C+eisenberg *ay 8a=e slept 8ereC 111. C+ello2 7orldC 1@ .rrors2 (1 7arnings.... 112. C+ere at t8e P8one Jo*pany2 9e ser=e all 5inds of peopleW fro* Presidents and Tings to t8e scu* of t8e eart8 ...C 11(. C+eR 4u*pC - 78ere 7itc8es put used Jurses? 11). C+ey 78o too5 t8e cor5 off *y lunc8??C - 7. J. ?ields 11/. C+ey2 7orf O 8oo5ed 4ata up to a -ode*... 9anna see?C 116. C+ey2 7orf...O 8oo5ed 4ata up to a -ode*...7anna see?C 11@. C+is *ind is li5e a steel trap -- full of *iceC - ?og8orn Beg8orn 11:. C+is super po9er is to turn into a scotc8 terrier.C 11E. C+o*e is is t8e place 98ere your co*puter li=es and runs your life.C - J8ro*e Jo9boy2 sobiloff%t8or.acc.stolaf.edu 120. C+onesty is t8e best policy2 but insanity is a better defenseC 121. C+o9 are t8ings?C
122. C+u*or is a drug 98ic8 it's t8e fas8ion to abuse.C - 7illia* <ilbert 12(. CO *ust 8a=e a prodigious Suantity of *indW it ta5es *e as *uc8 as a 9ee5 so*eti*es to *a5e it up.C - -ar5 D9ain2 CD8e Onnocents 0broadC 12). CO a* a Uelly doug8nut.C - >o8n ?. Tennedy 12/. CO a* *ade fro* t8e dust of t8e stars2 t8e oceans flo9 in *y =eins.C - 3us82 CPrestoC 126. CO a* not an .cono*ist. O a* an 8onest *anC - Paul -cJrac5en 12@. CO a* not sure 98at t8is is2 but an Y?' 9ould only dignify it.C - .nglis8 Professor 12:. CO a* progra**ed in *ultiple pleasuring tec8niSues.C - 4ata 12E. CO a* returning t8is ot8er9ise good typing paper to you because so*eone 8as printed gibberis8 all o=er it and put your na*e at t8e top.C - .nglis8 Professor2 ,8io Lni=ersity 1(0. CO a* t8e 8ouse5eeperC 1(1. CO a* 98at O a* and t8at's all t8at O a*C 1(2. CO did it. O 5illed t8e* all.C Di*ot8y 1((. CO do not fear co*puters.. O fear t8e lac5 of t8e*.C - Osaac 0si*o= 1(). CO don't bite. 7ell2 t8at's 9rong. O do bite.C - T'.8leyr 1(/. CO don't care 98o does t8e electing as long as O get to do t8e no*inatingC - Foss D9eed 1(6. CO don't 8a=e any solution but O certainly ad*ire t8e proble*.C - 0s8leig8 Frilliant 1(@. CO don't 5no9 98at you *ean by ;,L3 9ay2 all t8e 9ays about 8ere belong to -.C 1(:. CO drin5 to *a5e ot8er people interesting.C - <eorge >ean Kat8an 1(E. CO 8ate SuestionarresC - 7orf 1)0. CO 8ate Suotations. Dell *e 98at you 5no9.C - 3alp8 7aldo .*erson 1)1. CO 8a=e been poor and O 8a=e been ric8. 3ic8 is better.C - Hop8ie Duc5er 1)2. CO Uust need enoug8 to tide *e o=er until O need *ore.C - Fill +oest 1)(. CO 5no9 not 9it8 98at 9eapons 7orld 7ar OOO 9ill be foug8t2 but 7orld 7ar OV 9ill be foug8t 9it8 stic5s and stones.C - 0lbert .instein 1)). CO li5e *y species t8e 9ay it is.C - 7orf to Bocutus 1)/. CO li=e in t8at solitude 98ic8 is painful in yout82 but delicious in t8e years of *aturity.C - 0lbert .instein 1)6. CO *ay not be totally perfect2 but parts of *e are eRcellent.C - 0s8leig8 Frilliant 1)@. CO ne=er lie 98en O 8a=e sand in *y bootsC - Ba?orge 1):. CO t8in5 not2C said 4escartes2 and pro*ptly disappeared. 1)E. CO t8in5 not2C said 4escartesW and pro*ptly disappeared. 1/0. CO t8in5 t8ere's a 9orld *ar5et for about / co*puters.C - D8o*as >. 7atson2 J8air*an of t8e Foard2 OF- $around 1E):1 1/1. CO 9ant to buy a 8usband 98o2 e=ery 9ee5 98en O sit do9n to 9atc8 YHt. .lse98ere'2 9on't screa*2 Y?,3<.D OD2 FB0KJ+. ... OD'H DO-. ?,3 C+.. +07C'C - Fer5e Freat8ed2 CFloo* JountyC 1/2. CO 9ould gi=e t8e 4e=il benefit of t8e la9 for *y o9n safety's sa5e.C Z0Z-anZforZ0llZHeasonsZ by 3obert Folt 1/(. CO'd lo=e to go out 9it8 you2 but O did *y o9n t8ing and no9 O'=e got to undo it.C 1/). CO'd lo=e to go out 9it8 you2 but O 8a=e to floss *y cat.C 1//. CO'd lo=e to go out 9it8 you2 but O 8a=e to stay 8o*e and see if O snore.C 1/6. CO'd lo=e to go out 9it8 you2 but O ne=er go out on days t8at end in Y;.'C
1/@. CO'd lo=e to go out 9it8 you2 but O 9ant to spend *ore ti*e 9it8 *y blender.C 1/:. CO'd lo=e to go out 9it8 you2 but O'* attending t8e opening of *y garage door.C 1/E. CO'd lo=e to go out 9it8 you2 but O'* con=erting *y calendar 9atc8 fro* >ulian to <regorian.C 160. CO'd lo=e to go out 9it8 you2 but O'* doing door-to-door collecting for static cling.C 161. CO'd lo=e to go out 9it8 you2 but O'* 8a=ing all *y plants neutered.C 162. CO'd lo=e to go out 9it8 you2 but O'* staying 8o*e to 9or5 on *y cottage c8eese sculpture.C 16(. CO'd lo=e to go out 9it8 you2 but O'=e been sc8eduled for a 5ar*a transplant.C 16). CO'd lo=e to go out 9it8 you2 but it's *y para5eet's bo9ling nig8t.C 16/. CO'd lo=e to go out 9it8 you2 but it's *y para5eet's bo9ling nig8t.C 166. CO'd lo=e to go out 9it8 you2 but *y fa=orite co**ercial is on DV.C 16@. CO'd lo=e to go out 9it8 you2 but t8e last ti*e O 9ent out2 O ne=er ca*e bac5.C 16:. CO'd lo=e to go out 9it8 you2 but t8e *an on tele=ision told *e to stay tuned.C 16E. CO'd lo=e to go out 9it8 you2 but t8ere are i*portant 9orld issues t8at need 9orrying about.C 1@0. CO'* a Beo. Beos don't belie=e in t8is astrology stuff.C - Do* Keff 1@1. CO'* all ears2 8oo*anC - 4ai-on Perot 1@2. CO'* Fe=erly...C2CO'* <eordi...C2C7e are +ug8...C 1@(. CO'* not FaUoran. His5o punc8ed *e in t8e nose.C - Tira 1@). CO'* not t8e one t8at *isplaced t8e 4elti=id asteroid beltC 1@/. CO'* t8e 4octor... gotta lo=e *eC - Fas8ir 1@6. COf a guy tells *e t8e probability of failure is 1 in 10./2 O 5no9 8e's full of crap.C - 3ic8ard P. ?eyn*ann2 C78at 4o ;ou Jare 78at ,t8er People D8in5?C 1@@. COf all *en 9ere brot8ers2 9ould you 9ant one to *arry your sister?C - $title of a D8eodore Hturgeon s8ort story.1 1@:. COf dolp8ins are so s*art2 98y did ?lipper 9or5 for tele=ision?C 1@E. COf <od li=ed on .art82 people 9ould 5noc5 out all +is 9indo9s.C - ;iddis8 saying 1:0. COf O 8ad only 5no9n2 O 9ould 8a=e been a loc5s*it8.C - 0lbert .instein 1:1. COf it's a despot you 9ould det8rone2 see first t8at 8is t8rone erected 9it8in you is destroyed.C - Ta8lil <ibran2 1E2( 1:2. COf loo5s could 5ill it 9ould'=e been us instead of 8i*C 1:(. COf t8e 8u*an *ind 9ere si*ple enoug8 to understand2 9e'd be too si*ple to understand it.C - Pat Fa8n 1:). COf t8e Ting's .nglis8 9as good enoug8 for >esus2 it's good enoug8 for *eC C-aC ?erguson2 <o=ernor of DeRas $circa 1E201 1:/. COf 9e are to begin pac5aging oursel=es as boRes of cereal2 4e*ocracy 9ill die... for you could not 9in t8e presidency 9it8out pro=ing un9ort8y of t8e Uob.C 0dlai Hte=enson 1:6. COf 9e can't fiR it -- 9e'll fiR it so nobody can.C F. <ibbons 1:@. COf you can count your *oney2 you don't 8a=e a billion dollars.C - >. Paul <etty 1::. COf you do e=eryt8ing2 you'll 9in.C - Byndon Faines >o8nson 1:E. COf you go on 9it8 t8is nuclear ar*s race2 all you are going to do is *a5e t8e rubble bounceC - 7inston J8urc8ill 1E0. COf you 8a=e to 8ate2 8ate gentlyC 1E1. COf you pric5 *e2 do O not... Bea5?C - 4ata 1E2. COf you too5 all t8e sincerity in +olly9ood and put it in t8e na=el of a fruit fly2 you'd still 8a=e roo* for t8ree carra9ay seeds and a producer's 8eart.C - ?red 0llen
1E(. COf you 9ants to get elected president2 you'se got to t8in5 up so*e *e*oraboble 8o*ily so's sc8ool 5ids can be pestered into *e*ori in' it2 e=en if t8ey don't 5no9 98at it *eans.C - 7alt Telly2 CD8e Pogo PartyC 1E). CO*agination is *ore i*portant t8an 5no9ledgeC - .instein 1E/. COn defeat2 unbeatableW in =ictory2 unbearable.C - 7inston Jurc8ill2 of -ontgo*ery 1E6. COn s8ort2 K is 3ic8ardian if2 and only if2 K is not 3ic8ardian.C 1E@. COs t8at funny? Os t8at a Uo5e?C - 4ata 1E:. COs t8at le*on in your tea?C CKo2 s'li*e.C 1EE. COsC is t8e =erb for 98en you don't 9ant a =erb. 200. COt is easier for a ca*el to pass t8roug8 t8e eye of a needle if it is lig8tly greased.C - Te8log 0lbran2 CD8e ProfitC 201. COt too5 *e fifteen years to disco=er t8at O 8ad no talent for 9riting2 but O couldn't gi=e up because by t8at ti*e O 9as too fa*ous.C 202. COt's bad luc5 to be superstitious.C - 0ndre9 7. -at8is 20(. COt's co*in' apart2 BadC - Hcotty 20). COt's easier said t8an done.C ... and if you don't belie=e it2 try pro=ing t8at it's easier done t8an said2 and you'll see t8at Cit's easier said t8at Yit's easier done t8an said' t8an it is doneC2 98ic8 really pro=es t8at Cit's easier said t8an doneC. 20/. COt's ?abulous 7e 8a=en't seen anyt8ing li5e it in t8e last 8alf an 8ourC - -acy's 206. COt's not Ja*elot2 but it's not Jle=eland2 eit8er.C - Te=in 78ite2 *ayor of Foston 20@. C>esus sa=es sinners... and redee*s t8e* for =aluable cas8 pri esC - >o8n 7ic8ers $9ic8ers%8usc).+03V034..4L1 20:. C>ust as t8ey are.C 20E. C>ust once2 O 9is8 9e 9ould encounter an alien *enace t8at 9asn't i**une to bulletsC - D8e Frigader2 C4r. 78oC 210. C>ust 98en 9e finally got good at t8is2 9e #ZiZ[ run out of planets.C - a Voyager scientist 211. CTernalC is not a 9ord. D8e correct spelling is C5ernelC. 212. CTir5 to .nterprise -- bea* do9n yeo*an 3and and a siR-pac5.C 21(. CTno9ing 98en to opti*i e is as i*portant as 5no9ing 8o9.C - Do* Keff 21). CB03TH' V,-OD Ot don't say not8ing on t8e boR about lar5s' =o*itC - -onty Pyt8on--CDrade 4escriptions 0ctC 21/. CBaug8ter is t8e closest distance bet9een t9o people.C - Victor Forge 216. CBife *ay 8a=e no *eaning -- or e=en 9orse2 it *ay 8a=e a *eaning of 98ic8 O disappro=e.C 21@. CBife2C said -ar=in. C4on't tal5 to *e about life.C 21:. CBi5e t8e s5i resort full of girls loo5ing for 8usbands and 8usbands loo5ing for girls2 t8e situation is not as sy**etrical as it *ig8t see*.C - 0lan -cTay 21E. CBisten2 8a=e you seen t8e dolp8ins yet?C - <eordi 220. CBoo5 at all t8e OndiansC - <eneral Juster 221. C-0J user's dyna*ic debugging list e=aluator? Ke=er 8eard of t8at.C 222. C-ac4onald 8as t8e gift on co*pressing t8e largest a*ount of 9ords into t8e s*allest a*ount of t8oug8ts.C - 7inston J8urc8ill 22(. C-an in=ented language to satisfy 8is deep need to co*plain.C - Bily Do*lin 22). C-ate2 t8is parrot 9ouldn't V,,- if you put four *illion =olts t8roug8 itC 22/. C-atri*ony isn't a 9ord2 it's a sentence.C 226. C-e*ory ser=es 9ise co**anders.C - D 'u-8si2 6(: 04 22@. C-.,7C...HPB0D...C3L??C...HPB0D...$3aining cats G dogs1
22:. C-ig8t as 9ell be fran52 *onsieur. Ot 9ould ta5e a *iracle to get you out of Jasablanca and t8e <er*ans 8a=e outla9ed *iracles.C 22E. C-illions long for i**ortality 98o don't 5no9 98at to do 9it8 t8e*sel=es on a rainy Hunday afternoon.C - 4. P. Farron 2(0. C-ind your o9n business2 Hpoc5. O'* sic5 of your 8alfbreed interference.C 2(1. C-ode*2C said t8e gardener 98en 8e'd finis8ed t8e la9n.. 2(2. C-ost fol5s are about as 8appy as t8ey *a5e up t8eir *inds to be.C - 0be Bincoln 2((. C-r. 7orf2 fire p8asers at %?K%C ... Q ap 2(). C-r. 7orf2 scan t8at s8ip.C C0ye Japtain. (00 dpi?C 2(/. C-y fa=orite part of dinnerC - 3i5er 2(6. C-y <od2 it's full of storesC - 2001& 0 H8opping ,dyssey 2(@. C-y <od2 D8io5ol2 98en do you 9ant *e to launc8? KeRt 0pril?C - B. -ulloy 2(:. C-y na*e is Jrus8er. 78ere's .nsign 7alnut?C - Fe=erly 2(E. C-y 9eig8t is perfect for *y 8eig8t -- 98ic8 =ariesC 2)0. CK0H0 0nnounces Ke9 4ec5 J8air 0rrange*ent ?or Hpace Htation Ditanic.C - Do* Keff 2)1. CK0H0 09ards 0crony* <eneration Hyste* $0<H1 Jontract ?or Hpace Htation ?reedo*C - Do* Keff 2)2. CKature lo=es a =acuu*. 4igital doesn't.C - 4.J sales letter 2)(. CKo proble* is too big it can't be run a9ay fro*C - Binus 2)). CKondeter*inis* *eans ne=er 8a=ing to say you are 9rong.C 2)/. CKondeter*inis* *eans ne=er 8a=ing to say you are 9rong.C 2)6. CKot only is t8is inco*pre8ensible2 but t8e in5 is ugly and t8e paper is fro* t8e 9rong 5ind of tree.C - Profesoor 7. 2)@. CKo9 bid *e run2 and O 9ill stri=e 9it8 t8ings i*possible - yea2 and get t8e better of t8e*.C - 7. H8a5espeare2 >LBOLH J0.H03 2):. CKo9 is t8e ti*e for all good *en to co*e to.C - 7alt Telly 2)E. CKo92 *ore t8an e=er2 it is e=ident t8at Ygood taste' only refers to t8at 98ic8 reinforces t8e status Suo.C - 0ndre Peret 2/0. C,f course it's t8e *urder 9eapon. 78o 9ould fra*e so*eone 9it8 a fa5e?C 2/1. C,8 O t8oug8t t8at 9as a parrotC. CKo2 no... D8ey turn t8at color.C 2/2. C,82 0unty .*2 it's so good to be 8o*eC 2/(. C,ne planet is all you get.C 2/). C,ne planet is all you get.C 2//. CPascal is not a 8ig8-le=el language.C - Hte=en ?einer 2/6. CPerestroi5a& could it 8appen 8ere?C - Do* Keff 2/@. CPoor dear2 t8ere's not8ing bet9een 8is ears.C - -argaret D8atc8er2 about 3onald 3egan2 6[2[:: issue of D8e Ke9 ;or5 Di*es 2/:. CPsyc8oanalysis is t8e *ental illness it purports to cure.C - Tarl Traus 2/E. CV=id *e anRi=s s=*?C 260. C3eading legal *us8 can turn your brain to guaca*oleC - 0*iga 3,- Ternel -anual 261. C3eally ?? 78at a coincidence2 O'* s8allo9 tooC 262. C3eally 8oney....Uust 1 *ore *essage.C 26(. C3ebellion is li5e 9itc8craft. D8at's 98at it is2 it's li5e 9itc8craft.C - -issouri Htate 3ep. >ean 4iRon2 on labeling Coffensi=e *usicC. 26). Creproduces if added to its Suotation.C reproduces if added to its Suotation. 26/. C3.HOHD.KJ. OH ?LDOB.....C - D8e Forg 266. C3osencrant and <uildenstern are dead.C - 7. H8a5espeare2 +0-B.D
26@. CHatanic Verses is a despicable boo5 t8at could not 8a=e been 9ritten by a person 98o 9is8ed to be8a=e decently and responsibly.C - ,rson Hcott Jard 26:. CHcotty Fea* *e aboardC C0ye sir 7ill a 2R) do?C 26E. CHcotty2 bea* *e up anot8er Flue 7a=e *essage.C 2@0. CHcotty2 bea* us a boardC $2R) drops fro* s5y1 2@1. CHcotty2 O'=e fallen and O can't bea* upC 2@2. CHeR is better t8an readingW no o=erdue fines.C - >ean-Buc Picard 2@(. CH8e is descended fro* a long line t8at 8er *ot8er listened to.C - <ypsy 3ose Bee 2@). CHir Tlingons on t8e starboard bo9C C7ell2 scrape 'e* off 2@/. CHo *any obituaries...0nd al9ays t8e 9rong onesC - -arian Falsa* 2@6. CHo*eti*es O si*ply feel t8at t8e 98ole 9orld is a cigarette and O'* t8e only as8tray.C 2@@. CHo=iet Lnion? D8at's a code na*e for 3ussia.C - ,llie Kort8. &-1 2@:. CHtalinis* begins at 8o*e.C - Do* Keff 2@E. CHtealing a r8inoceros s8ould not be atte*pted lig8tly.C 2:0. CHtealing a r8inoceros s8ould not be atte*pted lig8tly.C 2:1. CHtrange 9o*en lying in ponds distributing s9ords is no basis for a syste* of go=ern*entC - -. Pyt8on 2:2. CHuc8 grudges. <i=e us a 5iss2 7orf.C - V 2:(. CH9ab t8e poop dec52 raise t8e *i en*astC - Picard 2:). CDa5e *y 7orf... please.C - 4ata 2:/. CDa5e off your engineering 8at and put on your *anage*ent 8at.C - D8io5ol *anage*ent2 1[2@[:6 2:6. CDeRt processing 8as *ade it possible to rig8t-Uustify any idea2 e=en one 98ic8 cannot be Uustified on any ot8er grounds.C - >. ?innegan2 LHJ. 2:@. CD8at *ust be 9onderful O don't understand it at all.C 2::. CD8at 9as t8e stun setting.C NbleepI CD8is is not.C 2:E. CD8at's no tagline Ot's ,doC 2E0. CD8at's user2 u s r2 and t8en t8ere's a space ...C 2E1. CD8e bland leadet8 t8e bland and t8ey bot8 s8all fall into t8e 5itsc8.C 2E2. CD8e J Progra**ing Banguage -- 0 language 98ic8 co*bines t8e fleRibility of asse*bly language 9it8 t8e po9er of asse*bly language.C 2E(. CD8e cli*ate of Fo*bay is suc8 t8at its in8abitants 8a=e to li=e else98ere.C 2E). CD8e condition upon 98ic8 <od 8as gi=en liberty to *an is eternal =igilance.C >o8n P8ilpot Jurran 2E/. CD8e country couldn't run 9it8out Pro8ibition. D8at is t8e industrial fact.C +enry ?ord2 1E2E 2E6. CD8e difference bet9een a *isfortune and a cala*ity? Of <ladstone fell into t8e D8a*es2 it 9ould be a *isfortune. Fut if so*eone dragged 8i* out again2 it 9ould be a cala*ity.C - FenUa*in 4israeli 2E@. CD8e 4olp8in2 ne'er 8as anyt8ing been *ore di=ineC - ,ppian 2E:. CD8e filter 8as discreting sources.C - THJ ?O4,2 1[2:[:6 2EE. CD8e illegal 9e do i**ediately. D8e unconstitutional ta5es a bit longer.C +enry Tissinger (00. CD8e illegal 9e do i**ediately. D8e unconstitutional ta5es a bit longer.C +enry Tissinger (01. CD8e Bord ga=e us far*ers t9o strong 8ands so 9e could grab as *uc8 as 9e could 9it8 bot8 of t8e*.C - >osep8 +eller2 CJatc8-22C
(02. CD8e Ka is 8a=e no sense of 8u*or2 so 98y s8ould t8ey 9ant tele=ision?C P8ilip T. 4ic5 (0(. CD8e pre=ious coo5ie 9as absolutely Drue.C - <od (0). CD8e real proble* 9it8 H4O is t8at it doesn't 5ill anybody.C - Do* Keff (0/. CD8e security of t8e .nterprise is of Para*ount i*portanceC (06. CD8e society 98ic8 scorns eRcellence in plu*bing as a 8u*ble acti=ity and tolerates s8oddiness in p8ilosop8y because it is an eRaulted acti=ity 9ill 8a=e neit8er good plu*bing nor good p8ilosop8y ... neit8er its pipes nor its t8eories 9ill 8old 9ater.C (0@. CD8e =oters 8a=e spo5en2 t8e bastards ...C (0:. CD8e 9arning *essage 9e sent t8e 3ussians 9as a calculated a*biguity t8at 9ould be clearly understood.C - 0leRander +aig (0E. CD8e 9ay to *a5e a s*all fortune in t8e co**odities *ar5et is to start 9it8 a large fortune.C (10. CD8e 9ay to *a5e a s*all fortune in t8e co**odities *ar5et is to start 9it8 a large fortune.C (11. CD8ere are t8ree possibilities& Pioneer's solar panel 8as turned a9ay fro* t8e sunW t8ere's a large *eteor bloc5ing trans*issionW or so*eone loaded Htar Dre5 (.2 into our =ideo processor.C (12. CD8ere are t9o 9ays of disli5ing poetryW one 9ay is to disli5e it2 t8e ot8er is to read Pope.C - ,scar 7ilde (1(. CD8ere goes FillC (1). CD8ere 9as a boy called .ustace Jlarence Hcrubb2 and 8e al*ost deser=ed it.C J. H. Be9is2 D8e J8ronicles of Karnia (1/. CD8ere's no suc8 t8ing as gra=ity - t8e eart8 suc5s.C (16. CD8ere's not8ing 9rong 9it8 Hout8ern Jalifornia t8at a rise in t8e ocean le=el 9ouldn't cure. C - 3oss -ac4onald (1@. CD8ere's not8ing you can do t8at can't be done.C - >o8n Bennon (1:. CD8ey are not t8e 8ell your 98ales.C - Hpoc5 (1E. CD8ey t8oug8t to use and s8a*e *e but O 9in out by nature2 because a true frea5 cannot be *ade. 0 true frea5 *ust be born.C - T. 4unn2 Z<ee5 Bo=eZ (20. CD8ey told *e O 9as gullible ... and O belie=ed t8e*C (21. CD8ey too5 so*e of t8e Van <og8s2 *ost of t8e Ue9els2 and all of t8e J8i=asC (22. CD8is is a country 98ere people are free to practice t8eir religion2 regardless of race2 creed2 color2 obesity2 or nu*ber of dangling 5eys ...C (2(. CD8is is one 0*erican -arine 98o 9ill al9ays tell t8e trut82 Hir.C - ,llie Kort8 (2). CD8ose 98o 9or5ed t8e 8ardest are t8e last to surrender.C - <ary 7ard (2/. CDo be2 or not to be.C--+a*let C4o-bee-do-bee-do.C--Hinatra (26. CDo 8a=e a 8orror of t8e bourgeois is bourgeois.C - >ules 3enard (2@. CDo ;,L O'* an at8eistW to <od2 O'* t8e Boyal ,pposition.C - 7oody 0llen (2:. CDoto2 O don't t8in5 9e're in 4,H any*ore...C (2E. CDoto2 O don't t8in5 9e're in Tansas any*oreC ((0. CDrees cause *ore pollution t8an auto*obiles do.C - President 3onald 3eagan ((1. CLKOM s8ould be used as an adUecti=e.C - 0DGD ((2. CLnli*ited ca*paign spending eats at t8e 8eart of t8e de*ocratic process.C Farry <old9ater (((. CLH out of Kort8 0*erica2 K,7C - 3ic8ard ,'3our5e ((). C7ar is li5e lo=eW it al9ays finds a 9ay.C - Fertold Frec8t ((/. C7ayne Ke9ton is2C 8e says2 Can eRa*ple of 98at 0*erica can be.C
((6. C7e fall into error if 9e attribute to strategy a po9er independent of tactical results.C - Tarl =on Jlause9it 2 ,n 7ar ((@. C7e 8a=e luc5 only 9it8 9o*en -- not spacecraftC - 3. Tre*ne=2 builder of failed Ho=iet ?,F,H probes ((:. C7e *ust laug8 at *an2 to a=oid crying for 8i*C - Kapoleon ((E. C7e *ust ne=er forget t8at if t8e 9ar in Vietna* is lost... t8e rig8t of free speec8 9ill be eRtinguis8ed t8roug8out t8e 9orld.C - 3ic8ard -il8ouse KiRon2 10[2@[6/ ()0. C7e plan absentee o9ners8ip. O'll stic5 to building s8ips.C - <eorge Hteinbrenner2 1E@( ()1. C7e 9al5ed on t8e *oon -- you be polite.C - >oni -itc8ell ()2. C7ell O'=e often seen a cat 9it8out a grin2 but a grin 9it8out a catC ()(. C78at's 'e *atter 9' t8at t8ing?C - Hcotty ()). C78at's t8e definition of a good fla*e? ,ne you agree 9it8...C - Tarl Be8enbauer ()/. C78at's up2 4oc?C - .nsign Fugs to Jrus8er ()6. C78en you 8a=e to 5ill a *an it costs not8ing to be polite.C - 7inston Jurc8ill2 ,n for*al declarations of 9ar ()@. C78oe=er fig8ts *onsters s8ould see to it t8at in t8e process 8e does not beco*e a *onster.C - Kietsc8e ():. C78o* are you?C said 8e2 for 8e 8ad been to nig8t sc8ool. ()E. C78y don't t8e >apanese li=e in t8e *ountains? Jertainly2 t8ey couldW apparently t8ey Uust don't 9ant to.C - elturner%p8oeniR.Princeton..4L (/0. C78y stop no9? >ust 98en O'* 8ating it.C - -ar=in (/1. C7orf Htill struggling up t8e e=olutionary ladder?C - V (/2. C;ou can *easure a progra**er's perspecti=e by noting 8is attitude on t8e continuing =iability of ?ortran.C - 0lan Perlis (/(. C;ou can't get snot off of a suede Uac5et.C - Benny Fruce (/). C;ou 5illed Ded2 you *edie=al dic59eedC - Fill (//. C;ou *ean O can send *ail to *yself?C (/6. C;ou *ean you can't ta5e less2 it's =ery easy to ta5e *ore t8an not8ing.C (/@. C;ou open t8at scab2 t8ere's a 8ell of a lot of t8ings... D8is in=ol=es t8ese Jubans2 +unt2 and a lot of 8an5y-pan5y t8at 9e 8a=e not8ing to do 9it8...C - 3ic8ard -il8ouse KiRon (/:. C;ou see2 9ire telegrap8 is a 5ind of a =ery2 =ery long cat. ;ou pull 8is tail in Ke9 ;or5 and 8is 8ead is *eo9ing in Bos 0ngeles. 4o you understand t8is? 0nd radio operates eRactly t8e sa*e 9ay& you send signals 8ere2 t8ey recei=e t8e* t8ere. D8e only difference is t8at t8ere is no cat.C - 0lbert .instein2 98en as5ed to describe radio (/E. '08 O 8a=e access.' - 4ata (60. '+as eig8teen letters' does. (61. '+o*e2 H9eet +o*e' *ust surely 8a=e been 9ritten by a bac8elor. (62. ',nly a =a3ool 9ould use suc8 language in public.' - 3i5er (6(. 'Per8aps you and t8e Uer5o 8ere could co*e 9it8 us.' (6). 'Haddle up2 fat8er' - 0leRander2 to 7orf (6/. 'H8are and .nUoy' - t8at's *y *otto. (66. 'D8e uni=erse is a sp8eroid region @0/ *eters in dia*eter' (6@. 'Dransporting really is t8e safest 9ay to tra=el.' - <eordi (6:. $$$$$$$+;PK,DOJ1111111$$$$$$$D0<BOK.1111111 (6E. $01bort $?1ail $D1oss co*puter across roo*
(@0. (@1. (@2. (@(. (@). (@/. (@6. (@@. (@:. (@E. (:0. (:1. (:2. (:(. (:). (:/. (:6. (:@. (::. (:E. (E0. (E1. (E2. (E(. (E). (E/. (E6. (E@. (E:. (EE. )00. )01. )02. )0(. )0). )0/. )06. )0@. )0:. )0E. )10. )11. )12. )1(. )1). )1/. )16. )1@. )1:.
$01bort $31epent $O1gnorant? $01bort $31etry $?1ail2 $<1rabZ+a**er $01bort $31etry $<1et D8e Hledge +a**er $01bort $31etry $O1gnore2 $T1ic5 syste*? $01bort $31etry $O1gnore2 $,1=ert8ro9 Hyste*? $01bort $31etry $O1gnore2 $H1orry O 0s5ed $01bort $31etry $O1nfluence 9it8 large 8a**er $01bort $31etry $T1ill innocent bystanders $01bort $31etry $P1anic $01bort $31etry $P1retend t8is ne=er 8appened . . . $01bort $31etry $H1ell it $01bort $31etry $H1*ac5 t8e %#$G"\ t8ing $01bort $31etry $H1*ac5 t8e friggin t8ing $01bort $31etry $H1ue $01bort $31etry $D1a5e an aRe to it? $01bort2 $31etry2 or $O1nfluence 9it8 8a**er. $a'b1 X a " b X0 $beep1 +elp2 O'=e fallen and can't reac8 t8e beer. $J1ontrol $01lt $F1ye $41inner not ready& $01bort $31etry $P1i a $O1gnore $31etry $01bort $-1eltdo9n $Oce roc5s 8it t8e 8ull1 CJaptain2 9e are being 8ailed.C $D8is fortune deleted due to painfully eRtre*e insipidity.1 " N- Dribble y N- Dribble 0fter a Jlose H8a=e " N- Dribble # N- Dribble 0fter Forg 0ssi*ilation " N-- Dribble 8 N-- Dribble Hand9ic8 " N-- Dribble o N-- >ean Buc Dribble " N-Dribble y N-Dribble after a close s8a=e. " N-Dribble y N-Dribble after a close s8a=e " " " $Dribbles1 i i i $Dribbles after Fiology lab1 " " " N- Dribbles N- Jloa5ed tribbles " " " N- D3OFFB.H o o o N- D3OFFB.H after 8air cut " " " N- Dribbles U U U N- Dribbles 9earing condo*s " " " N- Dribbles "] "] "] N- HSuared tribbles " " " N- Dribbles . . . N- Dribbles after a 8aircut " " " N- Dribbles ."[ N- Hergeant tribble " " " N- Dribbles Z Z Z N- after fig8t 9it8 <od illa " " " N- Dribbles \"\ \"\ \"\ N- Dribbles in 8ea=en " " " N- Dribbles ( ( ( N- after being stuc5 in ele=ator " " " N- Dribbles 5 5 5 N- +ari Tris8na tribbles " " " N- Dribbles * * * N- Dribbles 9it8 8ula 8oops " " " N- Dribbles o o o N- Fald tribbles " " " N- Dribbles op op op N- Dribbles on a 9indy day " " " N- Dribbles p p p N- dissected tribbles " " " N- Dribbles y y y N- Dribbles after a 8aircut " . . . . . N- Dribble -ot8er and ;oung " D8is is a tribble. # D8is is a tribble on drugs. " LniR is a Drade*ar5 of Fell Baboratories. "I - - N- Dribble 0rc8ery
)1E. """ K.7H?B0H+ """ 3ussian tan5s stea*rolling t8roug8 Ke9 >ersey 4etails at ele=en )20. """""""""""""""""4ang"Dribbles"""""""""""""""""" )21. """4^4""" N4 +ea=y-7eig8t Dribble Bifter. )22. "[ NXX-- Dribble 9it8 a lig8tsaber )2(. "[ #" N-Dribbles 8a=ing a s9ordfig8t )2). "[[ "[[ "[[ N- Dribbles <oing H5iing )2/. "? N-- <randpa Dribble 9it8 8is cane )26. "^ "^ N- Dribbles Praying )2@. "]- Dribble ,ly*pics& 0rc8ery )2:. ": ": ": N--- Dribbles and *a*as out for a stroll. )2E. "; "; N- Dribbles Hnor5elling )(0. ---- D8is space for rent ---)(1. ----I Of you cut 8ere2 you'll ruin your *onitor. N---)(2. --------------------- cut 8ere -------------------------)((. --D-0'<-B-O'K-.--'--.-0'H-L-3'O-K-<'--<-0'L-<-.-)(). .. Ho 9e i**ediately rus8ed out and set up our o9n Bost -anual 3e=ie9 Jo**ittee.. - +a=enDree )(/. ... and eli*inate and 9ipe out redundancy )(6. ... 0nd *alt does *ore t8an -ilton can Do Uustify <od's 9ays to *an - 0. .. +ous*an )(@. ... at least O t8oug8t O 9as dancing2 'til so*ebody stepped on *y 8and. - >. F. 78ite )(:. ... +ad t8is been an actual e*ergency2 9e 9ould 8a=e fled in terror2 and you 9ould not 8a=e been infor*ed. )(E. ... Hcotty2 +urry bea* *e uA#$G K, J033O.3 ))0. ... D8e 0narc8ists' [national! ant8e* is an international ant8e* t8at consists of (6/ raspberries blo9n in =ery Suic5 succession to t8e tune of CJa*pto9n 3acesC. Kobody 8as to stand up for it2 nobody 8as to listen to it2 and2 e=en better2 nobody 8as to play it. - -i5e +arding2 CD8e 0r*c8air 0narc8ist's 0l*anacC ))1. ...and *y special t8an5s to t8e ,t8er ?orty-Kine ))2. ...and so*eti*es t8e bear eats you. ))(. ...and t8en O 9o5e up ))). ...but t8ere are no old2 bold pilots. ))/. ...but 98at O really 9ant to do is direct. ))6. ...-a5e...t8e Daglines go a9aaaaaaaaaay.... ))@. ...no t8an5s2 O'* already 8a=ing one. )):. ...9ould you li5e *e to sing you a song? ))E. ...y9ercs lla og tsuU sgni8t se*ite*oH )/0. ..and t8e la9yer loo5s do9n at 8is *utilated and se=ered ar* and says& -y 3oleR2 *y 3oleR )/1. ..>ust a 3O-. 9it8out a reason..... )/2. [usr[ne9s[gotc8a )/(. & is not an identifier )/). &1 &4 &, &$ &[ W1 :1 F1 &I - O &P X1 &H &F &! &# )//. &.&&& &&..& &&.&&. &..&& Dagline in Fraille )/6. [#! 0t 200' Ko ,ne Jan +ear ;ou Hcrea*...[#! )/@. [0*ericans 9ill soon obser=e t8e 20t8 anni=ersary of! Keil 0r*strong and Fu Bu5ens' 9al5 on t8e *oon. - Vice President 4an Vuayle )/:. [dignified silence!
)/E. [Kuclear 9ar! ... *ay not be desirable. - .d9in -eese OOO )60. [Pri*e -inister >osep8! J8a*berlain lo=es t8e 9or5ing *an -- 8e lo=es to see 8i* 9or5. - 7inston J8urc8ill )61. [Hir Htafford Jripps! 8as all t8e =irtues O disli5e and none of t8e =ices O ad*ire. - 7inston J8urc8ill )62. [D8e L.H. =ictory in <ulf 9ar 9as! a stirring =ictory for t8e forces of aggression. - Vice President 4an Vuayle )6(. [D8e LH! condones =iolence in .l Hal=ador. - Vice President 4an Vuayle )6). Z N- Dribble -eets <od illa )6/. Z Z Z N- Dribbles2 after fig8ting 9it8 <od illa )66. 0@[11 P4P a ni deppart *'O ple+ )6@. 0@[11 P4P a ni deppart *'O ple+ )6:. 0:/ l8ad*0 na edisni deppart *'O ple+ )6E. 1 bulls2 ( co9s )@0. 1. Kone. $-oses didn't 8a=e an ar51. - 0ns9ers to Bast ?ortune's Vuestions& )@1. 1. D8e *ost po9erful force in t8e 9orld is t8at of a disc straining to land under a car2 Uust out of reac8 $t8is force is tec8nically ter*ed Ccar suc5C1. 2. Ke=er precede any *aneu=er by a co**ent *ore predicti=e t8an C7atc8 t8isC - D9o constant Ba9s of ?risbee )@2. 1. Ke=er be first. )@(. 10.0 ti*es 0.1 is 8ardly e=er 1.0. )@). 100 bloc5s of crud on t8e dis52 100 bloc5s of crud ;ou patc8 a bug2 and du*p it again& 101 bloc5s of crud on t8e dis5 ... )@/. 11( gra*s2 10 *illiliters ... +e's lead2 >i*. )@6. 11t8 co**and*ent - Jo=et not t8y neig8bor's /:6. )@@. 1/c of e=ery sta*p is for storage )@:. 1:62000 *iles per second -- it's not Uust a good idea2 it's t8e la9 )@E. 1:622:2 *iles per second& Ot isn't Uust a good idea2 it's t8e la9 ):0. 1E//-1E@/& (6 .l=is *o=ies. 1E@/-1E:E& not8ing. - Do* Keff ):1. 1st B07 ,? D.HDH& :0A of t8e final 9ill be on t8e one lecture you *issed and about t8e one boo5 you didn't read. ):2. 1st 9e s8oot all t8e la9yers2 2nd 9e strangle t8e*2 (rd.. ):(. 2-0 is a cric5et score in t8is sort of football. ):). 2. ;our *ot8er2 by t8e pigeon8ole principle. - 0ns9ers to Bast ?ortune's Vuestions& ):/. 2. Ke=er be last. ):6. 2(. ... r-S1 ):@. 2) 8ours in a day and 2) beers in a case. +****..... )::. 2)00 Faud *a5es you 9ant to get out and pus8 ):E. 2nd B07 ,? D.HDH& 78en re=ie9ing your notes before an eRa*2 t8e *ost i*portant ones )E0. (. O don't 5no9. - 0ns9ers to Bast ?ortune's Vuestions& )E1. (. Ke=er =olunteer for anyt8ing. )E2. (000000 5*[sec -- it's not Uust a good idea2 it's t8e la9 )E(. (20 )E). ((*+ ain't fast enoug8 )E/. (//[11( -- Kot t8e fa*ous irrational nu*ber PO2 but an incredible si*ulation )E6. ) food groups& fast2 fro en2 *icro9a=ed2 and Uun5 )E@. ). 78o cares? - 0ns9ers to Bast ?ortune's Vuestions&
)E:. )(rd Ba9 of Jo*puting& 0nyt8ing t8at can go 9r.. - fortune& Heg*entation =iolation -- Jore du*ped )EE. )/00 *ore Uo5es2 one liners and stupid p8rases beco*e a=ailable 98en you register - Lse Jontrol Panel Cdes5topC applet for details /00. /. 6 $or *aybe )2 or else (1. -r. 0lfred >. 4uncan of Podun52 -ontana2 sub*itted an interesting solution to Proble* /. - 0ns9ers to Bast ?ortune's Vuestions& /01. /t8 B07 ,? D+. ,??OJ.& Vital papers 9ill *o=e fro* 98ere you left t8e* to 98ere you can't find t8e*. /02. 6. D8ere is an interesting solution to t8is proble* on page 102E of *y boo52 98ic8 you can pic5 up for $2(.E/ at finer boo5stores and bat8roo* supply outlets $or EE cents at t8e table in front of Papyrus Foo5s1. - 0ns9ers to Bast ?ortune's Vuestions& /0(. @ 4ays 9it8out pi a *a5es one 9ea5... /0). E out of 10 *en 98o tried Ja*els prefer 9o*en. /0/. E.: *[s]& Kot Uust a good ideaW it's t8e B07 /06. E0A of e=eryt8ing is crud. /0@. E600bps and under are insults to +HD'ers - +ac5er's la9 #/ /0:. EE bloc5s of crud on t8e dis52 EE bloc5s of crud ;ou patc8 a bug2 and du*p it again& 100 bloc5s of crud on t8e dis5 /0E. 0 .)) *agnu* beats four aces. /10. 0 100A rig8t of return bot8 9ays. /11. 0 baby is an ali*entary canal 9it8 a loud =oice at one end and no responsibility at t8e ot8er. /12. 0 bac8elor is a guy 98o is footloose and fiancee free. /1(. 0 bac8elor is a selfis82 undeser=ing guy 98o 8as c8eated so*e 9o*an out of a di=orce. - 4on Vuinn /1). 0 ban5er is a fello9 98o lends you 8is u*brella 98en t8e sun is s8ining and 9ants it bac5 t8e *inute it begins to rain. - -ar5 D9ain /1/. 0 FFHer's telep8one bill 5no9s no bounds... /16. 0 beautiful 9o*an 9ill enric8 your life soon. /1@. 0 big *ac2 frenc8 fries and a large co5e /1:. 0 billion 8ere2 a couple of billion t8ere -- first t8ing you 5no9 it adds up to be real *oney. - .=erett -cTinley 4ir5sen /1E. 0 bird in t8e bus8 usually 8as a friend in t8ere 9it8 8i*. /20. 0 bird in t8e 8and can be *essy. /21. 0 bird in t8e 8and is safer t8an one o=er8ead. /22. 0 bird in t8e 8and is 9ort8 98at it 9ill bring. /2(. 0 bird in t8e 8and is 9ort8 98at it 9ill bring. /2). 0 bore is a fello9 98o opens 8is *out8 and puts 8is feats in it. - +enry ?ord /2/. 0 bore is so*eone 98o persists in 8olding 8is o9n =ie9s after 9e 8a=e enlig8tened 8i* 9it8 ours. /26. 0 boy gets to be a *an 98en a *an is needed. /2@. 0 budget is Uust a *et8od of 9orrying before you spend *oney2 as 9ell as after9ard. /2:. 0 bureaucrat is a politician 9it8 tenure. /2E. 0 candidate is a person 98o gets *oney fro* t8e ric8 and =otes fro* t8e poor to protect t8e* fro* eac8 ot8er. /(0. 0 cats 9orst ene*y is a closed door. /(1. 0 celebrity is a person 98o is 5no9n for 8is 9ell-5no9nness. /(2. 0 c8ic5en is an egg's 9ay of producing *ore eggs.
/((. 0 c8ubby *an 9it8 a 98ite beard and a red suit 9ill approac8 you soon. 0=oid 8i*. +e's a Jo**ie. /(). 0 city is a large co**unity 98ere people are loneso*e toget8er - +erbert Proc8no9 /(/. 0 clas8 of doctrine is not a disaster - it is an opportunity. /(6. 0 classic is so*et8ing t8at e=erybody 9ants to 8a=e read and nobody 9ants to read. - -ar5 D9ain /(@. 0 classic is so*et8ing t8at e=erybody 9ants to 8a=e read and nobody 9ants to read. - -ar5 D9ain /(:. 0 clean des5 is a sign of a -sic5- *ind /(E. 0 clean des5 is a sign of a cluttered des5 dra9er. /)0. 0 clean des5 is a sign of a cluttered des5 dra9er. /)1. 0 clean dis5 is t8e sign of a 9arped dri=e. /)2. 0 clean2 neat2 des5 is a sign of a =ery sic5 *ind. /)(. 0 closed *out8 gat8ers no feet... /)). 0 closed *out8 gat8ers no foot. /)/. 0 closed *out8 gat8ers no foot. /)6. 0 closed *out82 gat8ers no feet. /)@. 0 co**ittee 8as 6 or *ore legs and no brain. /):. 0 co*pany is 5no9n by t8e *en it 5eeps. /)E. 0 co*puter progra* does 98at you tell it to do2 not 98at you 9ant it to do. //0. 0 Jo*puter Progra**er is a *ac8ine for turning Jo5e into code. //1. 0 co*puter2 to print out a fact2 7ill di=ide2 *ultiply2 and subtract. Fut t8is output can be Ko *ore t8an debris2 Of t8e input 9as s8ort of eRact. - <igo //2. 0 conclusion is si*ply t8e place 98ere so*eone got tired of t8in5ing. //(. 0 conclusion is si*ply t8e place 98ere you got tired of t8in5ing. //). 0 J,KH is an obUect 98ic8 cares. - Fernie <reenberg. ///. 0 conser=ati=e is one 98o is too co9ardly to fig8t and too fat to run. //6. 0 consultant is so*eone 98o as5s t8eir client 98at ti*e it is2 9rites t8e ans9er in a report and c8arges t8e client for t8e pri=ilege. //@. 0 country*an bet9een t9o la9yers is li5e a fis8 bet9een t9o cats. - Fen ?ran5lin //:. 0 crusader's 9ife slipped fro* t8e garrison 0nd 8ad an affair 9it8 a Haracen. H8e 9as not o=erseRed2 ,r Uealous or =eRed2 H8e Uust 9anted to *a5e a co*parison. //E. 0 cult is a religion 9it8out political po9er. /60. 0 day for fir* decisions ,r is it? /61. 0 day 9it8out suns8ine is li5e nig8t. /62. 0 dead *an cannot bite. /6(. 0 diplo*at is a *an 98o can con=ince 8is 9ife s8e'd loo5 stout in a fur coat. /6). 0 diplo*at is so*eone 98o can tell you to go to 8ell in suc8 a 9ay t8at you 9ill loo5 for9ard to t8e trip. /6/. 0 disc cannot be read as easily as a filing cabinet. Lnless you 8a=e a co*puter - 98ic8 8as proble*s reading a filing cabinet. /66. 0 di=a 98o speciali es in risSu'e arias is an off-coloratura soprano ... /6@. 0 dog is *an's best friend because 8e 9ags 8is tail2 not 8is tongue. /6:. 0 door is 98at a dog is perpetually on t8e 9rong side of. - ,gden Kas8 /6E. 0 do en2 a gross2 and a score2 Plus t8ree ti*es t8e sSuare root of four2 4i=ided by se=en2 Plus fi=e ti*e ele=en2 .Suals nine sSuared plus ero2 no *ore. /@0. 0 fair eRterior is a silent reco**endation.
/@1. 0 fanatic is one 98o can't c8ange 8is *ind and 9on't c8ange t8e subUect. 7inston J8urc8ill /@2. 0 filt8y 4ata is <un5ed2 8osed do9n and sand blasted. /@(. 0 fool and 8is 8oney are soon parted. /@). 0 fool and 8is *oney are *y t9o fa=orite people. /@/. 0 fool and 8is *oney are H;H,P *aterial. /@6. 0 fool *ust no9 and t8en be rig8t by c8ance. /@@. 0 fool's brain digests p8ilosop8y into folly2 science into superstition2 and art into pedantry. +ence Lni=ersity education. - <. F. H8a9 /@:. 0 fool-proof *et8od for sculpting an elep8ant& first2 get a 8uge bloc5 of *arbleW t8en you c8ip a9ay e=eryt8ing t8at doesn't loo5 li5e an elep8ant. /@E. 0 foolis8 consistency is t8e 8obgoblin of little *inds. /:0. 0 for*al parsing algorit8* s8ould not al9ays be used. - 4. <ries /:1. 0 friend in need is a pest indeed. /:2. 0 friend& so*eone 98o li5es you e=en after t8ey 5no9 you. /:(. 0 gift of flour 9ill soon be *ade to you. /:). 0 gift of flo9er 9ill soon be *ade to you. /:/. 0 gift of flo9ers 9ill soon be *ade to you. /:6. 0 girl's best friend is 8er *utter. /:@. 0 glee5 orp 9it8out a tornpee is li5e a Suop 9it8out a fertsneet $sort of1. /::. 0 glee5 orp 9it8out a tornpee is li5e a Suop 9it8out a fertsneet. /:E. 0 goal to eit8er tea* 9ould brea5 t8e deadloc5. /E0. 0 good *e*ory does not eSual pale in5. /E1. 0 good reputation is *ore =aluable t8an *oney. /E2. 0 great *any people t8in5 t8ey are t8in5ing 98en t8ey are *erely rearranging t8eir preUudices. - 7illia* >a*es /E(. 0 great pleasure in life is doing 98at people say you cannot do. - 7alter <age8ot /E). 0 guy 8as to get fres8 once in a 98ile so t8e girl doesn't lose 8er confidence. /E/. 0 guy 9al5s into t8e c8e*ists and as5s& Of O *elt dry ice and s9i* in it2 9ill O get 9et? - Hte=ie 7rig8t /E6. 0 8alf *oon is better t8an no *oon at all. /E@. 0 8a**er so*eti*es *isses its *ar5 - a bouSuet ne=er. /E:. 0 8andful of friends is 9ort8 *ore t8an a 9agon of gold. /EE. 0 8ango=er is t8e 9rat8 of grapes. 600. 0 8arp is a nude piano. 601. 0 8en is only an egg's 9ay of *a5ing anot8er egg. 602. 0 8er*it is a deserter fro* t8e ar*y of 8u*anity 60(. 0 8orse 0 8orse -y 5ingdo* for a 8orse 60). 0 Uourney of a t8ousand *iles begins 9it8 a cas8 ad=ance. 60/. 0 Uourney of a t8ousand *iles *ust begin 9it8 a single step. 606. 0 5ing's castle is 8is 8o*e. 60@. 0 lac5 of leaders8ip is no substitute for inaction. 60:. 0 lac5 of leaders8ip is no substitute for inaction. 60E. 0 language t8at doesn't affect t8e 9ay you t8in5 about progra**ing is not 9ort8 5no9ing. 610. 0 language t8at doesn't 8a=e e=eryt8ing is actually easier to progra* in t8an so*e t8at do. - 4ennis -. 3itc8ie 611. 0 large dog 9ill 8a=e a surprising effect on your life.
612. 0 large nu*ber of installed syste*s 9or5 by fiat. D8at is2 t8ey 9or5 by being declared to 9or5. - 0natol +olt 61(. 0 Ba9 of Jo*puter Progra**ing& -a5e it possible for progra**ers to 9rite in .nglis8 and you 9ill find t8e progra**ers cannot 9rite in .nglis8. 61). 0 liberal is so*eone too poor to be a capitalist and too ric8 to be a co**unist 61/. 0 lie in ti*e sa=es nine. 616. 0 lie t8at can be passed off as trut8 beco*es trut8. 61@. 0 lig8t 9ife dot8 *a5e a 8ea=y 8usband. 61:. 0 li5ely i*possibility is al9ays preferable to an uncon=incing possibility. 61E. 0 li*eric5 pac5s laug8s anato*ical Onto space t8at is Suite econo*ical. Fut t8e good ones O'=e seen Ho seldo* are clean2 0nd t8e clean ones so seldo* are co*ical. 620. 0 BOHP progra**er 5no9s t8e =alue of e=eryt8ing2 but t8e cost of not8ing. 621. 0 lisp progra**er 5no9s t8e =alue of e=eryt8ing2 but t8e cost of not8ing. 622. 0 little nu5ie ne=er 8urt anyone 62(. 0 long-forgotten lo=ed one 9ill appear soon. Fuy t8e negati=es at any price. 62). 0 lost ounce of gold *ay be found2 a lost *o*ent of ti*e ne=er. 62/. 0 lot of people O 5no9 belie=e in positi=e t8in5ing2 and so do O. O belie=e e=eryt8ing positi=ely stin5s. - Be9 Jol 626. 0 lo9 =oter turnout is an indication of fe9er people going to t8e polls. - Vice President 4an Vuayle 62@. 0 *an forgi=es only 98en 8e is in t8e 9rong. 62:. 0 *an paints 9it8 8is brains and not 9it8 8is 8ands. 62E. 0 *an 9as gi=en t9o ears and one *out82 to be used in t8at ratio. 6(0. 0 *an 98o turns green 8as esc8e9ed protein. 6(1. 0 *an 9it8 one 9atc8 5no9s 98at ti*e it is--9it8 t9o 9atc8es 8e is ne=er sure. 6(2. 0 *an 9rapped up in 8i*self *a5es a =ery s*all pac5age. 6((. 0 *an 9rapped up in 8i*self *a5es a =ery s*all pac5age. 6(). 0 *an's 8ouse is 8is 8assle. 6(/. 0 *an2 a plan2 a canal. Hue 6(6. 0 *at8e*atician is a *ac8ine for con=erting coffee into t8eore*s. 6(@. 0 *at8e*atician is a *ac8ine for con=erting coffee into t8eore*s. 6(:. 0 *e*orandu* is 9ritten not to infor* t8e reader2 but to protect t8e 9riter. 6(E. 0 *isguided platypus 9ill lay its eggs in your s8orts. 6)0. 0 -og9ai is si*ply a 8ig8ly e=ol=ed Dribble. 6)1. 0 *oose once bit *y sister. 6)2. 0 *ouse is an elep8ant built by t8e Uapanese. 6)(. 0 *ut8 once bit *y sister. 6)). 0 ne9 dra*atist of t8e absurd +as a =oice t8at 9ill s8ortly be 8eard. O learn fro* *y spies +e's about to de=ise 0n unprintable t8ree-letter 9ord. 6)/. 0 noble c8oice2 but first ... 6)6. 0 nod's as good as a 9in5 to a blind bat 6)@. 0 pat on t8e bac5 is only a fe9 inc8es fro* a 5ic5 in t8e pants. 6):. 0 penny sa=ed is ridiculous. 6)E. 0 penny sa=ed is ridiculous. 6/0. 0 person is Uust about as big as t8e t8ings t8at *a5e t8e* angry. 6/1. 0 p8aser is t8e uni=ersal co**unicator. - 7orf 6/2. 0 p8aser on stun is li5e a day 9it8out orange Uuice. 6/(. 0 p8ysicist is an ato*'s 9ay of 5no9ing about ato*s. - <eorge 7ald 6/). 0 piano is a piano is a piano. - <ertrude Htein9ay.
6//. 0 pluc5ed goose does not lay golden eggs. 6/6. 0 pri=ate sin is not so preUudicial in t8e 9orld as a public indecency. 6/@. 0 procrastinator's 9or5 is ne=er done. 6/:. 0 professor is one 98o tal5s in so*eone else's sleep. 6/E. 0 professor is one 98o tal5s in so*eone else's sleep. 660. 0 proUect not 9ort8 doing at all is not 9ort8 doing 9ell. 661. 0 psyc8iatrist is a person 98o 9ill gi=e you eRpensi=e ans9ers t8at your 9ife 9ill gi=e you for free. 662. 0 Puritan is so*eone 98o is deat8ly afraid t8at so*eone so*e98ere is 8a=ing fun 66(. 0 Suarter-ounce of c8ocolate X four pounds of fat. - Hlic5's Ba9 of t8e Lni=erse 66). 0 real patriot is t8e fello9 98o gets a par5ing tic5et and reUoices t8at t8e syste* 9or5s. 66/. 0 real person 8as t9o reasons for doing anyt8ing ... a good reason and t8e real reason. 666. 0 red lig8t *eans t8e neRt siR cars *ay go t8roug8 t8e intersection. - 3ules for dri=ing in Ke9 ;or5 66@. 0 relations8ip is li5e a s8ar5. Ot 8as to 5eep *o=ing for9ard or it dies. 66:. 0 roc5 pile ceases to be a roc5 pile t8e *o*ent a single *an conte*plates it2 bearing 9it8in 8i* t8e i*age of a cat8edral. - 0ntoine de Haint-.Rupery 66E. 0 rolling dis5 gat8ers no *os. 6@0. 0 3olling Htone gat8ers no *oss2 but drug con=ictions are anot8er story. 6@1. 0 rolling stone gat8ers no *oss. 6@2. 0 se*inar on Di*e Dra=el 9ill be 8eld t9o 9ee5s ago 6@(. 0 s8ortcut is t8e longest pat8 bet9een t9o points. 6@). 0 sic5 *ind is not necessarily t8e sign of a clean des5. 6@/. 0 sine cur=e goes off to infinity or at least t8e end of t8e blac5board - Prof. Hteiner 6@6. 0 single con=ersation across t8e table 9it8 a 9ise *an is 9ort8 a *ont8s study of boo5s. - J8inese Pro=erb 6@@. 0 single fact can spoil a good argu*ent. 6@:. 0 H*it8 and 7esson beats four aces. 6@E. 0 sna5e lur5s in t8e grass. 6:0. 0 soft drin5 turnet8 a9ay co*pany.;ou're all o=er it2 li5e a c8eap suit. 6:1. 0 sole*n2 uns*iling2 sancti*onious old iceberg 98o loo5ed li5e 8e 9as 9aiting for a =acancy in t8e Drinity. - -ar5 D9ain 6:2. 0 stitc8 in ti*e sa=es nine. 6:(. 0 stitc8 in ti*e 9ould 8a=e confused .instein. 6:). 0 stra9 =ote only s8o9s 98ic8 9ay t8e 8ot air blo9s. - ,'+enry 6:/. 0 student 98o c8anges t8e course of 8istory is probably ta5ing an eRa*. 6:6. 0 successful tool is one t8at 9as used to do so*et8ing undrea*ed of by its aut8or. - H. J. >o8nson 6:@. 0 surprised 4ata is propositioned by t8e .'s Jo*puter. 6::. 0 s9eater is a gar*ent 9orn by a c8ild 98en 8is *ot8er feels c8illy. 6:E. 0 Dale of D9o Qities -4ic5ens's coo5boo5 6E0. 0 t8eory is better t8an its eRplanation. 6E1. 0 t8ic5 8ead can do as *uc8 da*age as a 8ard 8eart. 6E2. 0 t8ing is not necessarily true because a *an dies for it. 6E(. 0 D8ousand points of Froccoli
6E). 0 total abstainer is one 98o abstains fro* e=eryt8ing but abstention2 and especially fro* inacti=ity in t8e affairs of ot8ers. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 6E/. 0 transistor protected by a fast-acting fuse 9ill protect t8e fuse by blo9ing first. 6E6. 0 tribble a day 5eeps t8e Tlingons a9ay......... 6E@. 0 tribble a day 5eeps t8e Tlingons 9ell fed. 6E:. 0 truly la y person is ne=er bored. 6EE. 0 truly 9ise *an ne=er plays leapfrog 9it8 a unicorn. @00. 0 truly 9ise person ne=er plays leapfrog 9it8 a Lnicorn. @01. 0 uni=ersity is 98at a college beco*es 98en t8e faculty loses interest in students. - >o8n Jiardi @02. 0 LKOM saleslady2 Benore2 .nUoys 9or52 but s8e li5es t8e beac8 *ore. H8e found a good 9ay Do co*bine 9or5 and play& H8e sells J s8ells by t8e seas8ore. @0(. 0 =acuu* is a 8ell of a lot better t8an so*e of t8e stuff t8at nature replaces it 9it8. - Denessee 7illia*s @0). 0 =ery intelligent turtle ?ound progra**ing LKOM a 8urdle D8e syste*2 you see2 3an as slo9 as did 8e2 0nd t8at's not saying *uc8 for t8e turtle. @0/. 0 =icti* of a pran52 <eordi puts a banana o=er 8is eyes @06. 0 =iolent *an 9ill die a =iolent deat8. @0@. 0 =isit to a fres8 place 9ill bring strange 9or5. @0:. 0 =isit to a strange place 9ill bring fres8 9or5. @0E. 0 =i=id and creati=e *ind c8aracteri es you. @10. 0 9ell adUusted person is one 98o *a5es t8e sa*e *ista5e t9ice 9it8out getting ner=ous. @11. 0 9ell adUusted person is one 98o *a5es t8e sa*e *ista5e t9ice 9it8out getting ner=ous. @12. 0 9ell-5no9n friend is a treasure. @1(. 0 9ise *an gets *ore use fro* 8is ene*ies t8an a fool fro* 8is friends. Faltasar <racian @1). 0 9ise *an once said.... O don't 5no9... @1/. 0 9ise person *a5es 8is o9n decisions2 a 9ea5 one obeys public opinion. @16. 0 9o5 is 98at you t8ro9 at a 9abbit. @1@. 0 9o*an 9it8out a *an is li5e a fis8 9it8out a bicycle. @1:. 0 9ord to t8e 9ise is enoug8. @1E. 0 9riter *ust not s8ift your point of =ie9. @20. 0 year spent in artificial intelligence is enoug8 to *a5e one belie=e in god. @21. 0 year spent in artificial intelligence is enoug8 to *a5e one belie=e in <od. @22. 0 ygote is a ga*ete's *et8od of producing *ore ga*etes. @2(. 01bort 31etry <1et a stic5 and 5ill it. @2). 0. C;es2 but it is generally better to ta5e it for a 9al5.C @2/. 0& O don't 5no9 and O don't care. @26. 00000 - 0*erican 0ssociation 0gainst 0crony* 0buse @2@. 000000000aaaaaaaaaaaaaaaccccccccc555555 ;ou brute Tnoc5 before entering a ladies roo* @2:. 0bandon 8ope all ye 98o press .KD.3 8ere. @2E. 0bandon t8e searc8 for Drut8W settle for a good fantasy. @(0. 0bort2 3etry2 ?ail? - -icrosoft @(1. 0F,3D& 4ri=el filter is co*pro*ised @(2. 0bortion is a *iscarriage of Uustice.
@((. 0bout all so*e *en acco*plis8 in life is to send a son to +ar=ard. @(). 0bout t8e only t8ing on a far* t8at 8as an easy ti*e is t8e dog. @(/. 0bout t8e ti*e 9e t8in5 9e can *a5e ends *eet2 so*ebody *o=es t8e ends. +erbert +oo=er @(6. 0bo=e all else - s5y. @(@. 0bo=e all t8ings2 re=erence yourself. @(:. 0brasi=e - 0 fine *es8 for sifting fe*ale undergar*ents. @(E. 0bsence *a5es t8e dic5 gro9 longer. @)0. 0bsence *a5es t8e 8eart go 9ander. @)1. 0bsence *a5es t8e 8eart gro9 fonder. @)2. 0bsent2 adU.& .Rposed to t8e attac5s of friends and acSuaintancesW defa*edW slandered. @)(. 0bsentee2 n.& 0 person 9it8 an inco*e 98o 8as 8ad t8e foret8oug8t to re*o=e 8i*self fro* t8e sp8ere of eRaction. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC @)). 0bstain fro* beans. @)/. 0bstainer2 n.& 0 9ea5 person 98o yields to t8e te*ptation of denying 8i*self a pleasure. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC @)6. 0bstinence *a5es t8e 8eart gro9 fondler. @)@. 0bsurdity2 n.& 0 state*ent or belief *anifestly inconsistent 9it8 one's o9n opinion. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC @):. 0cade*y& 0 *odern sc8ool 98ere football is taug8t. @)E. 0ccident2 n.& 0 condition in 98ic8 presence of *ind is good2 but absence of body is better. @/0. 0ccidents cause +istory. @/1. 0ccolade - 0n effer=escent fruit cordial *ade fro* 0ccos. @/2. 0ccording to *y best recollection2 O don't re*e*ber. - Vincent C>i**y Flue .yesC 0lo @/(. 0ccording to t8e latest official figures2 )(A of all statistics are totally 9ort8less. @/). 0ccordion2 n.& 0 bagpipe 9it8 pleats. @//. 0ccountant - so*eone 98o can put t9o and t9o toget8er and *a5e a li=ing fro* it. @/6. 0ccu*ulate *anneSuins no9W spare parts 9ill be in s8ort supply on 4-4ay. Hafety Dips for t8e Post-Kuclear .Ristence @/@. 0ccuracy2 n.& D8e =ice of being rig8t @/:. 0cid -- better li=ing t8roug8 c8e*istry. @/E. 0cid absorbs )@ ti*es it's 9eig8t in eRcess 3eality. @60. 0cSuaintance2 n.& 0 person 98o* 9e 5no9 9ell enoug8 to borro9 fro*2 but not 9ell enoug8 to lend to. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC @61. 0cSuire - 0 group of singers co**only found in c8urc8es. @62. 0ctors 9ill 8appen in t8e best-regulated fa*ilies. @6(. 0ctually it is an interplanetary greeting. @6). 0cute 0ngle - 0 =ery attracti=e early Friton. @6/. 0402 n.& Ho*et8ing you need only 5no9 t8e na*e of to be an .Rpert in Jo*puting. Lseful in sentences li5e2 C7e 8ad better de=elop an 040 a9areness.C @66. 0da* and .=e 8ad *any ad=antages2 but t8e principal one 9as t8at t8ey escaped teet8ing. @6@. 0ddiction - D8e process by 98ic8 one beco*es a dic5. @6:. 0dding *anpo9er to a late soft9are proUect only *a5es it later.
@6E. 0d*iration2 n.& ,ur polite recognition of anot8er's rese*blance to oursel=es. 0*brose Fierce2 CD8e 4e=il's 4ictionaryC @@0. 0d*iration& ,ur polite recognition of anot8er's rese*blance to oursel=es. @@1. 0dolescence is t8at period of ti*e bet9een puberty and adultery. @@2. 0dolescence2 n.& D8e stage bet9een puberty and adultery. @@(. 0dore2 =.& Do =enerate eRpectantly. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC @@). 0dult2 n.& ,ne old enoug8 to 5no9 better. @@/. 0d=ance*ent in position. @@6. 0d=ersity re=eals genius2 prosperity conceals it. - +orace @@@. 0d=ice is a dangerous giftW be cautious about gi=ing and recei=ing it. @@:. 0d=isor& D8e guy 98o told you 8o9 to scre9 up @@E. 0d9eanne - 3oc5y @:0. 0fter a long bat8 7orf sees t8e fleas as 8is true friends @:1. 0fter a nu*ber of deci*al places2 nobody gi=es a da*n. @:2. 0fter all is said and done2 usually *ore is said t8an done. @:(. 0fter all2 all 8e did 9as string toget8er a lot of old2 9ell-5no9n Suotations. - +. B. -enc5en2 on H8a5espeare @:). 0fter all2 98at is your 8osts' purpose in 8a=ing a party? Hurely not for you to enUoy yourselfW if t8at 9ere t8eir sole purpose2 t8ey'd 8a=e si*ply sent c8a*pagne and 9o*en o=er to your place by taRi. - P. >. ,'3our5e @:/. 0fter an instru*ent 8as been asse*bled2 eRtra co*ponents 9ill be found on t8e benc8. @:6. 0fter O run your progra*2 let's *a5e lo=e li5e cra ed 9easels2 ,T? @:@. 0fter *uc8 t8oug8t Picard assu*es t8e bo9ling ball p8ase. @::. 0fter t8e last of 16 *ounting scre9s 8as been re*o=ed fro* an access co=er2 it 9ill be disco=ered t8at t8e 9rong access co=er 8as been re*o=ed. @:E. 0fter 9e pull t8e pin2 -r. <renade is K,D our friend @E0. 0fternoon =ery fa=orable for ro*ance. Dry a single person for a c8ange. @E1. 0fternoon2 n.& D8at part of t8e day 9e spend 9orrying about 8o9 9e 9asted t8e *orning. @E2. 0ge 'n Dreac8ery ,=erco*e ;out8 'n H5ill @E(. 0ge and treac8ery 9ill al9ays o=erco*e yout8 and s5ill. @E). 0gri*ony - 78at a di=orced far*er pays 8is eR-9ife. @E/. 082 co*e on2 Uust t8is one last little feature. @E6. 082 *y tro*bone. Bet *e s8o9 you 8o9 it 9or5s. - 3i5er @E@. 08a8 @E:. 08ead 9arp factor one2 -r. Hulu. @EE. 0ir conditioned en=iron*ent - 4o not open 7indo9s. :00. 0ir <eordis - DK< foot9ear :01. 0ir is 9ater 9it8 8oles in it :02. 0ir pollution is a *ist de*eanor. :0(. 0las2 8o9 lo=e can trifle 9it8 itself :0). 0las2 O a* dying beyond *y *eans. - ,scar 7ilde2 as 8e sipped c8a*pagne on 8is deat8bed :0/. 0lbatross2 get your albatross .... :06. 0lep8 sub alp8a is t8e alp8a't8 alep8. :0@. 0lep8-null bottles of beer on t8e 9all2 0lep8-null bottles of beer2 ;ou ta5e one do9n2 and pass it around2 0lep8-null bottles of beer on t8e 9all. :0:. 0leR +aley 9as adopted
:0E. 0leR2 O'll ta5e CD8ings ,nly O Tno9C for $1000. :10. 0B.M0K4.3 F.BB'H D+.,3.-& 78en a body is i**ersed in 9ater2 t8e p8one rings. :11. 0leRander <ra8a* Fell is ali=e and 9ell in Ke9 ;or52 and still 9aiting for a dial tone. :12. 0lgorit8* is a set of instructions. ..g. +o9 to use t8e telep8one& Of 'p8one not 9or5ing' t8en 'p8one operator.' :1(. 0li*ony and bribes 9ill engage a large s8are of your 9ealt8. :1). 0li*ony is a syste* by 98ic82 98en t9o people *a5e a *ista5e2 one of t8e* 5eeps paying for it. - Peggy >oyce :1/. 0ll art is but i*itation of nature. :16. 0ll art is Suite useless. :1@. 0ll babies spea5 Tlingonese :1:. 0ll diagnostics are fatal. :1E. 0ll go=ern*ent is t8eft2 so*e Uust steal less. :20. 0ll great disco=eries are *ade by accident. :21. 0ll great ideas are contro=ersial2 or 8a=e been at one ti*e. :22. 0ll 8ope abandon2 ye 98o enUoy taR for*s. :2(. 0ll 8ope abandon2 ye 98o enter 8ere. :2). 0ll 8ope abandon2 ye 98o enter *essages 8ere. :2/. 0ll O as5 is a c8ance to pro=e t8at *oney can't *a5e *e 8appy. :26. 0ll O as5 of life is a constant and eRaggerated sense of *y o9n i*portance. :2@. 0ll O need to 5no9 O learned fro* *y cat. :2:. 0ll in all it's Uust anot8er bric5 in t8e 9all... :2E. 0ll is 9ell t8at ends 9ell. :(0. 0ll la9s are basically false. :(1. 0ll *ac8ines are a*plifiers. :(2. 0ll *en 5no9 t8e utility of useful t8ings2 but not 5no9 t8e utility of futility :((. 0ll *y troubles see* so far a9ay. :(). 0ll people 9al5 t8roug8 life2 so*e al9ays loo5ing bac52 ot8ers al9ays loo5ing for9ard. O al9ays loo5 up9ard. - Hly :(/. 0ll progra*ers are opti*ists. :(6. 0ll progra**ers are play9rig8ts and all co*puters are lousy actors. :(@. 0ll progra**ers 9ant arrays :(:. 0ll progress is based upon a uni=ersal innate desire on t8e part of e=ery organis* to li=e beyond its inco*e. - Ha*uel Futler :(E. 0ll reSuests for sic5 lea=e *ust be appro=ed t9o 9ee5s in ad=ance. :)0. 0ll rig8t2 set p8asers to deep fat fry :)1. 0ll rig8t2 98o's been coo5ing 8ot dogs in t8e 7arp 4ri=e? :)2. 0ll science is eit8er p8ysics or sta*p collecting. - .. 3ut8erford :)(. 0ll stressed out2 and no one to c8o5e. :)). 0ll t8at glitters 8as a 8ig8 refracti=e indeR. :)/. 0ll t8e troubles you 8a=e 9ill pass a9ay =ery Suic5ly. :)6. 0ll t8e 9orld's a stage and *ost of us are desperately unre8earsed. - Hean ,'Jasey :)@. 0ll t8e 9orld's a stage and t8e people on it are poorly re8earsed. :):. 0ll t8ings are possible eRcept s5iing t8roug8 a re=ol=ing door. :)E. 0ll t8ings are possible eRcept s5iing t8ru a re=ol=ing door. :/0. 0ll trends to9ards J8aos. :/1. 0ll true 9isdo* is found in taglines.
:/2. 0ll true 9isdo* is found on D-s8irts. :/(. 0ll true 9isdo* is found on D-s8irts. :/). 0ll 9ars are ironic because all 9ars are 9orse t8an eRpected. ://. 0ll 9or5 and no play2 9ill *a5e you a *anager. :/6. 0ll's 9ell t8at ends. :/@. 0lliance2 n.& On international politics2 t8e union of t9o t8ie=es 98o 8a=e t8eir 8ands so deeply inserted in eac8 ot8er's poc5et t8at t8ey cannot separately plunder a t8ird. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC :/:. 0llo9ing for seasonal adUust*ents2 t8ings are actually getting better. :/E. 0l*ost anyt8ing is easier to get into t8an out of. :60. 0lone2 adU.& On bad co*pany. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC :61. 0lso2 a=oid a959ard or affected alliteration. :62. 0l9ays borro9 *oney fro* a pessi*istW 8e doesn't eRpect to be paid bac5. :6(. 0l9ays cut t8e cards. :6). 0l9ays do rig8t. D8is 9ill gratify so*e people and astonis8 t8e rest. :6/. 0l9ays dra9 your cur=es2 t8en plot t8e data. :66. 0l9ays pic5 on t8e correct idio*. :6@. 0l9ays proofread carefully to see if you any 9ords out. :6:. 0l9ays re*e*ber t8at you are uniSue. >ust li5e e=eryone else. :6E. 0l9ays re*e*ber to pillage F.?,3. you burn. :@0. 0l9ays re*e*ber to pillage F.?,3. you burn. :@1. 0l9ays tell a 9o*an s8e's beautiful2 especially if s8e isn't. :@2. 0l9ays t8e dullness of t8e fool is t8e 98etstone of t8e 9its. :@(. 0l9ays try to eR8ort ot8ers to loo5 upon you fa=orably. :@). 0-0QOK< FLD D3L. ... Of all t8e sal*on caug8t in Janada in one year 9ere laid end to end across t8e Ha8ara 4esert2 t8e s*ell 9ould be absolutely a9ful. :@/. 0-0QOK< FLD D3L. ... D8ere is so *uc8 sand in Kort8ern 0frica t8at if it 9ere spread out it 9ould co*pletely co=er t8e Ha8ara 4esert. :@6. 0*bideRtrous2 adU.& 0ble to pic5 9it8 eSual s5ill a rig8t-8and poc5et or a left. 0*brose Fierce2 CD8e 4e=il's 4ictionaryC :@@. 0*biguity is t8e preser=e of t8e ni*ble *inded2 yet fro en lipped. :@:. 0*bition is a poor eRcuse for not 8a=ing sense enoug8 to be la y. - J8arlie -cJart8y :@E. 0*bition is a poor eRcuse for not 8a=ing t8e good sense to be la y. ::0. 0*bition is t8e last refuge of t8e failure. ::1. 0*erica *ay be uniSue in being a country 98ic8 8as leapt fro* barbaris* to decadence 9it8out touc8ing ci=ili ation. - >o8n ,'+ara ::2. 0*erica t8e land of t8e J8rysler ))0 cubic inc8 engine ::(. 0*erica 9as disco=ered by 0*erigo Vespucci and 9as na*ed after 8i*2 until people got tired of li=ing in a place called CVespucciaC and c8anged its na*e to C0*ericaC. - -i5e +arding2 CD8e 0r*c8air 0narc8ist's 0l*anacC ::). 0*erica's best buy for a nic5el is a telep8one call to t8e rig8t *an. ::/. 0*nesia used to be *y fa=orite 9ord2 but t8en O forgot it. ::6. 0*ong econo*ists2 t8e real 9orld is often a special case. ::@. 0*ong t8e luc5y2 you are t8e c8osen one. :::. 0n 0*erican's a person 98o isn't afraid to critici e t8e President but is al9ays polite to traffic cops. ::E. 0n artist cannot spea5 about art2 any *ore t8an a plant can discuss 8orticulture. - >ean Jocteau :E0. 0n artist s8ould be fit for t8e best society and 5ept out of it.
:E1. 0n at8eist is a *an 9it8 no in=isible *eans of support. :E2. 0n ato* blaster is a good 9eapon2 but it can point bot8 9ays. :E(. 0n easily understood2 9or5able false8ood is *ore useful t8an a co*pleR2 inco*pre8ensible trut8. :E). 0n effecti=e 9ay to deal 9it8 predators is to taste terrible. :E/. 0n egotist t8in5s 8e's in t8e groo=e 98en 8e's in a rut. :E6. 0n elep8ant is a *ouse 9it8 an operating syste*. :E@. 0n engineer is so*eone 98o does list processing in fortran. :E:. 0n .nglis8*an ne=er enUoys 8i*self2 eRcept for a noble purpose. - 0. P. +erbert :EE. 0n eRpert is so*eone fro* out of to9n. E00. 0n 8onest <od is t8e noblest 9or5 of *an. E01. 0n 8onest tale speeds best being plainly told. E02. 0n idea is not responsible for t8e people 98o belie=e in it. E0(. 0n idea is not responsible for t8e people 98o belie=e in it. E0). 0n idle *ind is 9ort8 t9o in t8e bus8. E0/. 0n ounce of application is 9ort8 a ton of abstraction. E06. 0n ulcer is 98at you get *ountain cli*bing o=er *ole8ills E0@. 0n unbrea5able toy can be used to brea5 ot8er toys. E0:. 0n unbrea5able toy is useful for brea5ing ot8er toys. E0E. 0nal retenti=e people don't gi=e a crap. E10. 0narc8y is against t8e la9. E11. 0narc8y *ay not be t8e best for* of go=ern*ent2 but it's better t8an no go=ern*ent at all. E12. 0nato*ically Jorrect beats Policically Jorrect 0K; 40; E1(. 0nc8o=ies? ;ou'=e got t8e 9rong *an O spell *y na*e 40K<.3 $clic51 E1). 0ncient <ree5s *ade dolp8in-5illing punis8able by deat8. E1/. 0nd 0da* as5ed C78at's a +eadac8e?C E16. 0nd don't start a sentence 9it8 a conUunction. E1@. 0nd <od said2 CO'll buy a =o9el.C E1:. 0nd <od said& . X '*=] - Qe][r2 and t8ere 9as lig8t. E1E. 0nd 8ere's anot8er clue for you all& D8e 9alrus 9as Paul. E20. 0nd O alone a* returned to 9ag t8e tail. E21. 0nd O t8oug8t "O" 8ad proble*s E22. 0nd if you belie=e t8at one2 O 8a=e a c8eap OF- *ini to sell you - D8e sales *an E2(. 0nd no9 a 9ord fro* our sponsor... E2). 0nd no9 for so*et8ing co*pletely different. 0 *an 9it8 ( buttoc5s. E2/. 0nd no9... D8e Barc8. E26. 0nd on t8e se=ent8 day2 +e eRited fro* append *ode. E2@. 0nd t8at's inc8es babe2 not centi*etres. - >o8nny +ol*es E2:. 0nd t8e Bord said '-aR9ells .Suations'. 0nd t8ere 9as lig8t. E2E. 0nd t8e people bo9ed and prayed2 to t8e neon <ods t8ey'd *ade. - Paul Hi*on E(0. 0nd t8ere's 8a*burger all o=er t8e 8ig89ay in -ystic2 Jonnecticut. E(1. 0nd t8ey're off E(2. 0nd to*orro9 9ill be li5e today2 only *ore so. E((. 0nd you t8oug8t J+0,H *ent rus8-8our traffic E(). 0ngels 9e 8a=e 8eard on +ig8 Dell us to go out and Fuy. - Do* Be8er E(/. 0n58 if you lo=e Osis.
E(6. 0noint2 =.& Do grease a 5ing or ot8er great functionary already sufficiently slippery. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC E(@. 0not8er day2 anot8er s8a=ing accident. E(:. 0not8er good nig8t not to sleep in a eucalyptus tree. E(E. 0not8er nearly-full boR of H*arties E)0. 0not8er suc8 =ictory o=er t8e 3o*ans2 and 9e are undone. E)1. 0ns9ers& $1. Jorrect ans9ers& $/. 4u*b loo5s& ?ree E)2. 0ntelope - Ho*eone 98o is against all lopes. E)(. 0ntelope free9ay--1[) *ile. E)). 0nt8ony's Ba9 of ?orce& 4on't force itW get a larger 8a**er. E)/. 0nt8ony's Ba9 of t8e 7or5s8op& 0ny tool 98en dropped2 9ill roll into t8e least accessible corner of t8e 9or5s8op. E)6. 0ntony*2 n.& D8e opposite of t8e 9ord you're trying to t8in5 of. E)@. 0ny clod can 8a=e t8e facts2 but 8a=ing opinions is an art. - J8arles -cJabe E):. 0ny clod can 8a=e t8e facts2 but 8a=ing opinions is an art. E)E. 0ny eRcuse 9ill ser=e a tyrant. - 0esop E/0. 0ny eRcuse 9ill ser=e a tyrant. E/1. 0ny fool can paint a picture2 but it ta5es a 9ise person to be able to sell it. E/2. 0ny O.J. protected by a fast acting fuse 9ill protect t8e fuse by blo9ing first. E/(. 0ny landing you can 9al5 a9ay fro* is a good one. E/). 0ny *an 98o 8ates dogs and babies can't be all bad. E//. 0ny *e*ber introducing a dog into t8e Hociety's pre*ises s8all be liable to a fine of one pound. 0ny ani*al leading a blind person s8all be dee*ed to be a cat. 3ule )62 ,Rford Lnion Hociety2 Bondon E/6. 0ny s8rine is better t8an self-9ors8ip. E/@. 0ny s*all obUect t8at is accidentally dropped 9ill 8ide under a larger obUect. E/:. 0ny sufficiently ad=anced tec8nology is indistinguis8able fro* a rigged de*o. E/E. 0ny sufficiently ad=anced tec8nology is indistinguis8able fro* *agic. - 0. J. Jlar5e E60. 0ny sufficiently ad=anced tec8nology is indistinguis8able fro* *agic. E61. 0ny syste* t8at depends on reliability is unreliable. E62. 0ny t9o p8ilosop8ers can tell eac8 ot8er all t8ey 5no9 in t9o 8ours. - ,li=er 7endell +ol*es2 >r. E6(. 0ny 9o*an is a =olu*e if one 5no9s 8o9 to read 8er. E6). 0nybody can 9in2 unless t8ere 8appens to be a second entry. E6/. 0nybody 98o doesn't cut 8is speed at t8e sig8t of a police car is probably par5ed. E66. 0nybody 9it8 *oney to burn 9ill easily find so*eone to tend t8e fire. E6@. 0nyone can 8old t8e 8el* 98en t8e sea is cal*. - Publilius Hyrus E6:. 0nyone can 8old t8e 8el* 98en t8e sea is cal*. E6E. 0nyone can 9in2 unless t8ere 8appens to be a second entry. E@0. 0nyone 9ant a burger? Ot 8as c8eese on bot8 sides E@1. 0nyone 98o can cope 9it8 *at8e*atics is not fully 8u*an. E@2. 0nyone 98o cannot cope 9it8 *at8e*atics is not fully 8u*an. 0t best 8e is a tolerable sub8u*an 98o 8as learned to 9ear s8oes2 bat8e and not *a5e *esses in t8e 8ouse. - Ba arus Bong2 CDi*e .noug8 for Bo=eC E@(. 0nyone 98o goes to a psyc8iatrist oug8t to 8a=e 8is 8ead eRa*ined. - Ha*uel <old9yn E@). 0nyone 98o 8ates 4ogs and Tids Jan't be 0ll Fad. - 7. J. ?ields
E@/. 0nyone 98o is capable of getting t8e*sel=es *ade President s8ould on no account be allo9ed to do t8e Uob. - 4ouglas 0da*s2 CD8e +itc88i5er's <uide to t8e <alaRyC E@6. 0nyt8ing can be *ade to 9or5 if you fiddle 9it8 it long enoug8. E@@. 0nyt8ing done 98ile 8on5ing your 8orn is legal. - 3ules for dri=ing in Ke9 ;or5 E@:. 0nyt8ing free is 9ort8 98at you pay for it. E@E. 0nyt8ing free is 9ort8 98at you pay for it. E:0. 0nyt8ing good in life is eit8er illegal2 i**oral2 or fattening. E:1. 0nyt8ing is good and useful if it's *ade of c8ocolate. E:2. 0nyt8ing is possible2 unless it's not. E:(. 0nyt8ing labeled CK.7C and[or CO-P3,V.4C isn't. D8e label *eans t8e price 9ent up. D8e label C0BB K.7C2 CJ,-PB.D.B; K.7C2 or C<3.0D K.7C *eans t8e price 9ent 9ay up. E:). 0nyt8ing not nailed do9n is a cat toy... E:/. 0nyt8ing t8at can go 9r ... # ^A Fus .rror - Jore E:6. 0nyt8ing 9ort8 doing is 9ort8 o=erdoing E:@. 0nyti*e t8ings appear to be going better2 you 8a=e o=erloo5ed so*et8ing. E::. 0pat8y .rror& 4on't bot8er stri5ing any 5ey. E:E. 0ppearances often are decei=ing. EE0. 0pple Jo*puter don't t8reaten us2 9e can buy t8e* out of petty cas8. - >o8n 05ers2 OFEE1. 0pril 1. D8is is t8e day upon 98ic8 9e are re*inded of 98at 9e are on t8e ot8er t8ree 8undred and siRty-four. EE2. 0SuadeRtrous2 adU.& Possessing t8e ability to turn t8e bat8tub faucet on and off 9it8 your toes. - 3ic8 +all2 CHnigletsC EE(. 0rc8aeologists ta5e sedi*ental Uourneys. EE). 0rc8i*edes 8ad no principles EE/. 0re J8eerios really donut seeds? EE6. 0re t8ey *ade fro* real <irl Hcouts? EE@. 0re t8ose coo5ies *ade 9it8 real <irl Hcouts? EE:. 0re 9e near a slaug8ter8ouse2 or did you forget your deodorant? EEE. 0re 9e not *en? 1000. 0re you a Tlingon2 or is t8at a turtle on your 8ead. 1001. 0re you a turtle? 1002. 0re you out of *y *ind? 100(. 0re you prepared to defend yourself? 100). 0ren't you glad t8at e=eryt8ing is going so s*oot8ly? 100/. 03< n. 0bbre=iation for Cargu*entC $to a function12 used so often as to 8a=e beco*e a ne9 9ord. 1006. 0rgu*ents are to be a=oidedW t8ey are al9ays =ulgar and often con=incing. 100@. 03O.H $-ar 21 - 0pr 1E1 ;ou are t8e pioneer type and 8old *ost people in conte*pt. ;ou are Suic5 te*pered2 i*patient2 and scornful of ad=ice. ;ou are not =ery nice. 100:. 0rit8*etic is being able to count up to t9enty 9it8out ta5ing off your s8oes. -ic5ey -ouse 100E. 0r*adillo& Do pro=ide 9eapons to a Hpanis8 pic5le 1010. 0rnold's Ba9s of 4ocu*entation& $11 Of it s8ould eRist2 it doesn't. $21 Of it does eRist2 it's out of date. $(1 ,nly docu*entation for useless progra*s transcends t8e first t9o la9s.
1011. 033333333333333333<<<<<<<<<<<<<+++++++++++++ 1012. 03D+L3'H B07 ,? B,V.& People to 98o* you are attracted t8in5 you re*ind t8e* of so*eone else. 101(. 0rt8ur's Ba9s of Bo=e& $11 People to 98o* you are attracted in=ariably t8in5 you re*ind t8e* of so*eone else. $21 D8e lo=e letter you finally got t8e courage to send 9ill be delayed in t8e *ail long enoug8 for you to *a5e a fool of yourself in person. 101). 0rtificial Ontelligence is no *atc8 for natural stupidity 101/. 0rtistic =entures 8ig8lig8ted. 3ob a *useu*. 1016. 0s a co*puter2 O find your fait8 in tec8nology a*using. 101@. 0s easy as (.1)1/E26/(/:E@E(2(:)626)((:(2@E/02::)1E@16 101:. 0s far as t8e la9s of *at8e*atics refer to reality2 t8ey are not certainW and as far as t8ey are certain2 t8ey do not refer to reality. - 0lbert .instein 101E. 0s far as 9e 5no92 our co*puter 8as ne=er 8ad an undetected error. - 7eisert 1020. 0s goat8erd learns 8is trade by goat2 so 9riter learns 8is trade by 9rote. 1021. 0s O said before2 O ne=er repeat *yself. 1022. 0s long as O can re*e*ber2 O'=e 8ad a*nesia. 102(. 0s long as t8e ans9er is rig8t2 98o cares if t8e Suestion is 9rong? 102). 0s long as 9ar is regarded as 9ic5ed2 it 9ill al9ays 8a=e its fascination. 78en it is loo5ed upon as =ulgar2 it 9ill cease to be popular. - ,scar 7ilde 102/. 0s of neRt 9ee52 pass9ords 9ill be entered in -orse code. 1026. 0s of neRt 9ee52 pass9ords 9ill be entered in -orse code. 102@. 0s t8e aRe entered t8e forest2 t8e trees said2 CD8e 8andle is one of us.C 102:. 0s t8e poet said2 C,nly <od can *a5e a treeC -- probably because it's so 8ard to figure out 8o9 to get t8e bar5 on. - 7oody 0llen 102E. 0s t8e trials of life continue to ta5e t8eir toll2 re*e*ber t8at t8ere is al9ays a future in Jo*puter -aintenance. - Kational Ba*poon2 C4eterioradaC 10(0. 0s 9ell loo5 for a needle in a bottle of 8ay. 10(1. 0s 7ill 3ogers 9ould 8a=e said2 CD8ere is no suc8 t8ings as a free =ariable.C 10(2. 0s Qeus said to Karcissus2 C7atc8 yourself.C 10((. 0HJOO and ye s8all recei=e. 10(). 0HJOO stupid Suestion2 get stupid 0KHO 10(/. 0HJOO stupid Suestion... get a stupid 0KHO 10(6. 0s5 Kot for 98o* t8e Fell Dolls2 and ;ou 9ill Pay only t8e Htation-to-Htation rate. 10(@. 0s5 not for 98o* t8e telep8one bell tolls ... if t8ou art in t8e bat8tub2 it tolls for t8ee. 10(:. 0s5 your boss to reconsider -- it's so difficult to ta5e C<o to 8ellC for an ans9er. 10(E. 0ss2 n.& D8e *asculine of ClassC. 10)0. 0ssu*ption is t8e *ot8er of all scre9ups... 10)1. 0stronauts are out to launc8. 10)2. 0t a recent *eeting in Hno9*ass2 Jolorado2 a participant fro* Bos 0ngeles fainted fro* 8yperoRygenation2 and 9e 8ad to 8old 8is 8ead under t8e eR8aust of a bus until 8e re=i=ed. 10)(. 0t <roup B2 Htoffel o=ersees siR first-rate progra**ers2 a *anagerial c8allenge roug8ly co*parable to 8erding cats. - D8e 7as8ington Post -aga ine2 >une E2 1E:/ 10)). 0t t8e end of t8e day2 it's balls in t8e bac5 of t8e net t8at counts.
10)/. 0t t8e source of e=ery error 98ic8 is bla*ed on t8e co*puter you 9ill find at least t9o 8u*an errors2 including t8e error of bla*ing it on t8e co*puter. 10)6. 0t8eis* is a non-prop8et organi ation. 10)@. 0tlee is a =ery *odest *an. 0nd 9it8 reason. - 7inston J8urc8ill 10):. 0D7,,4'H ?,L3D..KD+ J,3,BB03;& Ko boo5s are lost by lending eRcept t8ose you particularly 9anted to 5eep. 10)E. 0untie .*. +ate you2 8ate Tansas2 ta5ing t8e dog. - 4orot8y. 10/0. 0ural seR produces eargas*s. 10/1. 0uribus teneo lupu*. $O 8old a 9olf by t8e ears.1 10/2. 0utocracy is based on t8e t8eore* t8at one *an is s*arter t8an *any. 10/(. 0LD,.M.J.F0D X Bee Oacocca as a =a*pire. 10/). 0uto*obile2 n.& 0 four-98eeled =e8icle t8at runs up 8ills and do9n pedestrians. 10//. 0uto*obile& 0 four-98eeled =e8icle t8at runs up 8ills and do9n pedestrians. 10/6. 0=ert *isunderstanding by cal*2 poise2 and balance. 10/@. 0=oid colloSuial stuff. 10/:. 0=oid co**as2 t8at are not necessary. 10/E. 0=oid <,D,s co*pletely if you can 5eep t8e progra* readable. 1060. 0=oid o=erly pretentious Uob titles suc8 as CBord of t8e 3eal*2 4efender of t8e ?ait82 .*peror of OndiaC or C4irector of Jorporate Planning.C - D8e ,fficial -F0 +andboo5 on business cards 1061. 0=oid Vuiet and Placid persons unless you are in Keed of Hleep. - Kational Ba*poon2 C4eterioradaC 1062. 0=oid reality at all costs. 106(. 0=oid run-on sentences t8ey are 8ard to read. 106). 0=oid te*porary =ariables and strange 9o*en. 106/. 0=oid te*porary =ariables. 1066. 0=oid t8e ?ortran arit8*etic O?. 106@. 0=oid trendy locutions t8at sound fla5y. 106:. 0=oid unnecessary branc8es. 106E. 09999 its Uust a +ar*less little Funny 10@0. Facc8us2 n.& 0 con=enient deity in=ented by t8e ancients as an eRcuse for getting drun5. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 10@1. Fac5 Lp -y +ard 4ri=e? O Jan't ?ind D8e 3e=erse H9itc8 10@2. Fac5 Lp -y +ard 4ri=e? O don't 8a=e a license yet 10@(. Fac5up - originally to ta5e a security copy of a progra* or file. Ko9 used interc8ageably 9it8 pirate and steal. 10@). Fac5up not found& $01bort $31etry $P1anic 10@/. Fac5up not found& $01bort $31etry $H1ell Jo*puter 10@6. Fad co**and or file na*e <o stand in t8e corner. 10@@. Fad co**and or file na*e. <o sit in corner. 10@:. Fad Jo**and or ?ilena*e. ,r *aybe you scre9ed up. 10@E. Fadness co*es in 9a=es. 10:0. Fagdi5ian's ,bser=ation& Drying to be a first-rate reporter on t8e a=erage 0*erican ne9spaper is li5e trying to play Fac8's CHt. -att8e9 PassionC on a u5elele. 10:1. Fa5er's ?irst Ba9 of ?ederal <eo*etry& 0 bloc5 grant is a solid *ass of *oney surrounded on all sides by go=ernors. 10:2. F0T.3'H B07& ;ou ne=er 9ant t8e one you can afford. 10:(. Fan t8e bo*b. Ha=e t8e 9orld for con=entional 9arfare. 10:). Fan5 error in your fa=or. Jollect $200.
10:/. F03 1. D8e second *etasyntactic =ariable after ?,, $S.=.1 CHuppose 9e 8a=e t9o functions2 ?,, and F03. ?,, calls F03...C 10:6. F03 2. ,ften appended to ?,, to produce ?,,F03. 10:@. F030J+'H 3LB.& 0n alco8olic is a person 98o drin5s *ore t8an 8is o9n p8ysician. 10::. Farac8's 3ule& 0n alco8olic is a person 98o drin5s *ore t8an 8is o9n p8ysician. 10:E. Farney and Faby Fop -LHD 4O. 10E0. Farnu* 9as 9rong....it's *ore li5e e=ery (0 seconds 10E1. Faro*eter2 n.& 0n ingenious instru*ent 98ic8 indicates 98at 5ind of 9eat8er 9e are 8a=ing. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 10E2. Fart8's 4istinction& D8ere are t9o types of people& t8ose 98o di=ide people into t9o types2 and t8ose 98o don't. 10E(. Faruc8's ,bser=ation& Of all you 8a=e is a 8a**er2 e=eryt8ing loo5s li5e a nail. 10E). Fase 10 nu*bers are still not accepted by a nu*ber of older people 98o gre9 up 9it8 s8illings and cro9ns. 10E/. Fase 2 is a difficult base for co*puters to perfor* arit8*etic in2 particularly if t8e tas5 in=ol=es =ariables2 negati=e2 fiRed or floating point nu*bers. 10E6. Fasic 0irline ?lying& Teep t8e pointy end for9ard 10E@. F0HOJ is to co*puter progra**ing as CS9ertyC is to typing. 10E:. F0HOJ isn'tW J stands for Jonfusing... 10EE. Fasic2 n.& 0 progra**ing language. 3elated to certain social diseases in t8at t8ose 98o 8a=e it 9ill not ad*it it in polite co*pany. 1100. FFH& a *et8od to triple your p8one bill. 1101. Fe a better psyc8iatrist and t8e 9orld 9ill beat a psyc8opat8 to your door. 1102. Fe a better psyc8iatrist and t8e 9orld 9ill beat a psyc8opat8 to your door. 110(. Fe affectionate to one 98o adores you. 110). F. 0B.3D $D8e 9orld needs *ore lerts ...1 110/. Fe alert2 t8e 9orld needs *ore lerts. 1106. Fe assured t8at a 9al5 t8roug8 t8e ocean of *ost Houls 9ould scarcely get your ?eet 9et. ?all not in Bo=e2 t8erefore& it 9ill stic5 to your face. - Kational Ba*poon2 C4eterioradaC 110@. Fe bot8 a spea5er of 9ords and a doer of deeds. 110:. Fe bra=er. ;ou cannot cross a c8as* in t9o s*all Uu*ps. 110E. Fe careful Os it classified? 1110. Fe careful of reading 8ealt8 boo5s2 you *ig8t die of a *isprint. - -ar5 D9ain 1111. Fe careful 98at you 9is8 for2 you *ig8t get it. 1112. Fe careful 98en a loop eRits to t8e sa*e place fro* side and botto*. 111(. Fe careful2 t8e last person using t8is 5eyboard 8ad a ter*inal disease. 111). Fe cautious in your daily affairs. 111/. Fe c8eerful 98ile you are ali=e. 1116. Fe different& confor*. 111@. Fe eRcellent to eac8 ot8er.. 111:. Fe free and open and bree y .nUoy D8ings 9on't get any better so get used to it. 111E. Fe 8appy 9it8 t8e real pleasures in life. 1120. Fe 5ind to your inferiors2 if you can find any. 1121. Fe *oderate 98ere pleasure is concerned2 a=oid fatigue. 1122. Fe Kice to ;our .ne*ies2 Ot 4ri=es D8e* Kuts. 112(. Fe patient 9it8 t8ose 98o are slo9er t8an you2 for t8ey *a5e you loo5 better.
112). Fe security conscious - Kational defense is at sta5e. 112/. Fe seeing you. 1126. Fe self-reliant and your success is assured. 112@. Fe sure to treat your assu*ptions as t8oug8 t8ey are reality. 112:. Fe =aliant2 but not too =enturous. Bet t8y attire be co*ely2 but not costly. 112E. Fe 9ary of strong drin5. Ot can *a5e you s8oot at taR collectors and *iss Ba arus Bong2 CDi*e .noug8 for Bo=eC 11(0. Fe 9e9y 9e9y Suiet...O'* 8unting 7o*ulins 11(1. Fea* *e aboard Hcotty. 0ye2 9ill a 2R) do captain? 11(2. Fea* *e up Hcotty. D8ere's no intelligent life do9n 8ere. - Japt. >a*es D. Tir5 11((. Fea* *e up Hcotty. D8is isn't t8e *en's roo*. 11(). Fea* *e up2 Hcotty2 but lea=e t8e ot8ers 8ere. 11(/. Fea* *e up2 Hcotty2 D8is planet suc5s 11(6. Fea* *e up2 Hcotty. D8ere's no intelligent life do9n 8ere. - >.D. Tir5 11(@. Fea* *e up2 Hcotty 11(:. Fea* *e up2 t8ere's no intelligent life 8ere 11(E. Feat *e2 98ip *e2 *a5e *e read *y V*ail 11)0. Feauty and 8ar*ony are as necessary to you as t8e =ery breat8 of life. 11)1. Feauty is in t8e eye of t8e beer 8older.... 11)2. Feauty is only s5in deep2 but ugly goes clean to t8e bone. 11)(. Feauty is only s5in deep2 but ugly goes clear to t8e bone. 11)). Feauty seldo* reco**ends one to anot8er. 11)/. Fecause t8e 9ine re*e*bers. 11)6. Fedfello9s *a5e strange politicians. 11)@. F.4?.BB,7H 3LB.& D8e one 98o snores 9ill fall asleep first. 11):. Feen Dransferred Bately? 11)E. Feep On=alid Onput. O ta5e only cas8.... 11/0. Feer isn't Uust for brea5fast any*ore. - Fu*per stic5er 11/1. Fefore borro9ing *oney fro* a friend2 decide 98ic8 you need *ore. 11/2. Feggars s8ould be no c8oosers. 11/(. Fegin 9ell2 end badlyW begin badly2 end 9orse. 11/). Fe8a=ioris* is t8e art of pulling 8abits out 11//. Fe8a=iorist psyc8ology -- pulling 8abits out of rats. 11/6. Fe8ind e=ery argu*ent is so*eone's ignorance. 11/@. Fe8ind e=ery succesfull *an is 9o*an 9it8 not8ing to 9ear 11/:. Fe8ind e=ery successful *an you'll find a 9o*an 9it8 not8ing to 9ear. 11/E. Fe8ind your bac52 your colleagues are tal5ing about >ec5yl and +yde. 1160. Fe8old t8e 9arranty ... t8e bold print gi=et8 and t8e fine print ta5et8 a9ay. 1161. Feifeld's Principle& D8e probability of a young *an *eeting a desirable and recepti=e young fe*ale increases by pyra*idal progression 98en 8e is already in t8e co*pany of& $11 a date2 $21 8is 9ife2 $(1 a better loo5ing and ric8er *ale friend. 1162. Feing natural is si*ply a pose. 116(. Feing one *an too *any2 .nsign .Rtra is booted off t8e .. 116). Fell Babs LniR -- 3eac8 out and grep so*eone. 116/. F.K.4OJD'H P3OKJOPB. $for*erly -L3P+;'H KOKD+ J,3,BB03;1& Kature al9ays sides 9it8 t8e 8idden fla9. 1166. F.3;B'H B07& D8e CJ,KHL-.3 3.P,3DC on t8e ite* 9ill co*e out a 9ee5 after you buy t8e ite*. 116@. Fest file co*pression around C4.B "."C - 100A co*p.
116:. Fest file co*pressor around& 4.B "." $100A co*pression1 116E. Fetter dead t8an *ello9. 11@0. Fetter late t8an ne=er. 11@1. Fetter li=ing a beggar t8an buried an e*peror. 11@2. Fetter to send ten a*bulances 98en t8ey are not needed t8an one 98en it is. 11@(. Fetter to use *edicines at t8e outset t8an at t8e last *o*ent. 11@). Fet9een t9o e=ils2 al9ays pic5 t8e one you ne=er tried before. 11@/. Fe9are lo9 flying duc5s 11@6. Fe9are of a dar5-8aired *an 9it8 a loud tie. 11@@. Fe9are of a tall dar5 *an 9it8 a spoon up 8is nose. 11@:. Fe9are of all enterprises t8at reSuire ne9 clot8es. 11@E. Fe9are of Figfoot 11:0. Fe9are of friends 98o are false and deceitful. 11:1. Fe9are of <ee5s bearing gifs. 11:2. Fe9are of gee5s bearing graft. 11:(. Fe9are of <ee5s bearing grifts. 11:). Fe9are of lo9 flying butterflies. 11:/. Fe9are of lo9-flying butterflies. 11:6. Fe9are of lo9-flying roc5s. 11:@. Fe9are of Progra**ers 98o carry scre9dri=ers. - Beonard Frand9ein 11::. Fe9are of progra**ers 98o carry scre9dri=ers. 11:E. Fe9are of Suantu* duc5s. Vuar5 Vuar5 11E0. Fe9are of t8e *an 98o 5no9s t8e ans9er before 8e understands t8e Suestion. 11E1. Fe9are of t8e During Dar-pit in 98ic8 e=eryt8ing is possible but not8ing of interest is easy. 11E2. Fe9are t8e legless *an 98o teac8es running. 11E(. Fe9are t8e *an 9it8 98ite feat8ers and an orange *out82 for 8e is a duc5 in disguise. 11E). Fe9are t8e ne9 DD; code 11E/. Fe9are t8e t8irty-first of Ko=e*ber. 11E6. F8larneyHtone& ?or benc8*ar5ing =apour9are. 11E@. Fig t8ings co*e in .V7T pac5ages. 11E:. Figa*y is 8a=ing one spouse too *any. -onoga*y is t8e sa*e. 11EE. Figgest security gap - an open *out8. 1200. Fill <ates *ade $6.( Fillion selling us -H-4,H? 1201. Finary2 adU.& Possessing t8e ability to 8a=e friends of bot8 seRes. 1202. Fiograp8y& ,ne of t8e terrors of deat8. 120(. Fiology gro9s on you. 120). Fipolar2 adU.& 3efers to so*eone 98o 8as 8o*es in Ko*e2 0las5a2 and Fuffalo2 Ke9 ;or5 120/. Fird li=es. 1206. Firt82 n.& D8e first and direst of all disasters. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 120@. Fi is better. 120:. Fi arreness is t8e essence of t8e eRotic 120E. Flac5berries are red 98en t8ey are green. 1210. Fla8. 1211. Flessed are t8e <ree5s 1212. Flessed are t8e *ee52 for t8ey s8all in8ibit t8e eart8. 121(. Flessed are t8ey t8at run around in circles2 for t8ey s8all be 5no9n as 98eels.
121). Flessed are t8ey 98o <o 0round in Jircles2 for t8ey H8all be Tno9n as 78eels. 121/. Flessed our young t8ey 9ill in8erit our national debt. 1216. FBOHH is ignorance. 121@. Flood is t8ic5er t8an 9ater2 and *uc8 tastier. 121:. Flood is t8ic5er t8an 9ater2 and *uc8 tastier. 121E. Flo9 - opposite of Fu=. 1220. Fluegrass is not Uust a 9eed. 1221. F,JTB0<.'H B07& +e 98o laug8s last probably didn't get t8e Uo5e. 1222. Foldly going ?or9ard because 9e can't find 3e=erse 122(. Foldly going 98ere no *ode* 8as gone before... 122). Foling's postulate& Of you're feeling good2 don't 9orry. ;ou'll get o=er it. 122/. Folub's ?ourt8 Ba9 of Jo*puterdo*& ProUect tea*s detest 9ee5ly progress reporting because it so =i=idly *anifests t8eir lac5 of progress. 1226. Fond. >a*es Fond. - Pic5 up line 122@. F,,F'H B07& $fro* -L3P+;'H B071& ;ou al9ays find so*et8ing t8e last place you loo5. 122:. Foob's Ba9& ;ou al9ays find so*et8ing in t8e last place you loo5. 122E. Foo5ie - pic5poc5et 98o lets you use your o9n 8ands. 12(0. Fore2 n.& 0 person 98o tal5s 98en you 9is8 8i* to listen. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 12(1. Foren's Ba9s& $11 78en in c8arge2 ponder. $21 78en in trouble2 delegate. $(1 78en in doubt2 *u*ble. 12(2. Forg .*pire& .Sual opportunity 0ssi*ilator 12((. Forg -ail 3eader =2.1a Dagline t8eft is futile. 12(). Forg -ail 3eader =2.1a Daglines are irrele=ent. 12(/. Forg saying& 7e ca*e. 7e absorbed. 7e left. 12(6. Forg spreads8eet progra*& Bocutus 1-2-( 12(@. Forg spreads8eet& Bocutus 1-2-( 12(:. Forg? 78ere? O don't se"$#$#..K, J033O.3 12(E. ForgFurgers - 7e do it our 9ayW your 9ay is irrele=ant. 12)0. ForgFurgers& 7e do it ,L3 9ay. ;ours is irrele=ant 12)1. Forg4,H =/.0 - 0ssi*ilate 0not8er? [;[n! 12)2. Forger Ting - 7e do it our 9ay ;our 9ay is irrele=ant 12)(. Forger Ting& +a=e it our 9ay. ;our 9ay is irrele=ant. 12)). Forger Ting& 7e do it our 9ay. ;ours is irrele=ant. 12)/. Foss spelled bac59ards is Cdouble-H,FC 12)6. Foss2 n.& 0ccording to t8e ,Rford .nglis8 4ictionary2 in t8e -iddle 0ges t8e 9ords CbossC and Cbotc8C 9ere largely synony*ous2 eRcept t8at boss2 in addition to *eaning Ca super=isor of 9or5ersC also *eant Can orna*ental stud.C 12)@. Foston2 n.& Bud9ig =an Feet8o=en being Ueered by /02000 sports fans for finis8ing second in t8e Oris8 Uig co*petition. 12):. Fot8 of 8is feet are fir*ly planted in t8e air. 12)E. Fo9 do9n to 3ic5 7a5e*an 12/0. Foy2 n.& 0 noise 9it8 dirt on it. 12/1. Foycott Jloc59or5 Peac8. 12/2. Foycott *eat - suc5 your t8u*b. 12/(. Frady's ?irst Ba9 of Proble* Hol=ing& 78en confronted by a difficult proble*2 you can sol=e it *ore easily by reducing it to t8e Suestion2 C+o9 9ould t8e Bone 3anger 8a=e 8andled t8is?C
12/). Frain 4isengagedW Jall Fac5 Do*orro9. 12//. Frain fried -- Jore du*ped 12/6. Frain fried -- -e*ory du*ped. 12/@. Frain2 n.& D8e apparatus 9it8 98ic8 9e t8in5 t8at 9e t8in5. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 12/:. Frain2 =. [as in Cto brainC!& Do rebu5e bluntly2 but not pointedlyW to dispel a source of error in an opponent. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 12/E. F30OK.J,- file closed. $01rgue $31etry $?1orget Ot 1260. Frain& apparatus used to t8in5 9e t8in5. 1261. Frea5 up a relations8ip - buy a co*puter 1262. F3.0T?0HD.J,- +alted... Jereal Port Kot 3esponding. 126(. F3.0T?0HD.J,- +alted...Jereal Port Kot 3esponding. 126). Frea5ing 7indo9s isn't Uust for 5ids any*ore... 126/. Freast ?eeding s8ould not be atte*pted by fat8ers 9it8 8airy c8ests2 since t8ey can *a5e t8e baby snee e and gi=e it 9ind. - -i5e +arding2 CD8e 0r*c8air 0narc8ist's 0l*anacC 1266. Freat8 4eep2 D8e <at8ering <loo*... 126@. F3.40'H 3LB.& 0t any e=ent2 t8e people 98ose seats are fart8est fro* t8e aisle arri=e last. 126:. Freeding rabbits is a 8are raising eRperience. 126E. Fride2 n.& 0 9o*an 9it8 a fine prospect of 8appiness be8ind 8er. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 12@0. Fring 8o*e t8e bacon? +.JT O Froug8t t8e PO< 12@1. Fring *e a bug and O 9ill pu**el it to pieces. 12@2. Fringing co*puters into t8e 8o*e 9on't c8ange eit8er one2 but *ay re=itali e t8e corner saloon. 12@(. F3OKDK0BB'H B07& Of you are gi=en t9o contradictory orders2 obey t8e* bot8. 12@). Froad-*indedness2 n.& D8e result of flattening 8ig8-*indedness out. 12@/. F3,T.K adU. 1. Kot 9or5ing properly $of progra*s1. 2. Fe8a=ing strangelyW especially $of people12 eR8ibiting eRtre*e depression. 12@6. Froo5's Ba9& 0dding *anpo9er to a late soft9are proUect *a5es it later 12@@. Froo5e's Ba9& 78ene=er a syste* beco*es co*pletely defined2 so*e da*n fool disco=ers so*et8ing 98ic8 eit8er abolis8es t8e syste* or eRpands it beyond recognition. 12@:. Fubble -e*ory2 n.& 0 derogatory ter*2 usually referring to a person's intelligence. Hee also C=acuu* tubeC. 12@E. Fucy's Ba9& Kot8ing is e=er acco*plis8ed by a reasonable *an. 12:0. Fuenos dias. _J`*o estas? 12:1. Fuffalo is not Uust t8e na*e of an ani*al. 12:2. Fuffer - -e*ber of 78ite8all gentle*ans club. 0lternati=ely2 a place to store data te*porarily until a processor is ready for it. 12:(. FL??.3HX@ ?OB.HX/2 2nd 4o9n2 )t8 Suarter2 / yards to go 12:). Fug - 98en your co*puter tells you 2'2XDL.H40; you 8a=e a bug. Hee ?eature. 12:/. FL< [fro* telep8one ter*inology2 Cbugs in a telep8one cableC2 bla*ed for noisy lines.! n. 0n un9anted and unintended $and undesirable1 property of a progra*. Hee ?.0DL3..
12:6. Fug2 n.& 0n aspect of a co*puter progra* 98ic8 eRists because t8e P3,<30--.3 9as t8in5ing about >u*bo >ac5s or stoc5 options 98en s[8e 9rote t8e progra*. 12:@. Fug& H*all li=ing t8ings t8at s*all li=ing boys t8ro9 on s*all li=ing girls. 12::. Fugs are sons of glitc8es 12:E. Fuild a syste* e=en a fool can use2 and only a fool 9ill use it. 12E0. Fulls8it 4etector. 78en alar* sounds2 please re-engage your brain. 12E1. Fureaucrat2 n.& 0 politician 98o 8as tenure. 12E2. Fureaucratic organi ation is li5e a septic tan5& t8e big c8un5s rise to t8e top 12E(. Fureaucrats do not c8ange t8e course of t8e s8ip of state. D8ey *erely adUust t8e co*pass. 12E). Fus error -- Jore du*ped 12E/. Fusiness 9ill be eit8er better or 9orse. --Jal=in Joolidge 12E6. Fut Japtain--t8e engines can't ta5e t8is *uc8 longer 12E@. Fut does Fo 5no9 double dia*onds? 12E:. Fut O don't li5e Hpa* 12EE. Fut O t8oug8t ;,L did t8e bac5ups... 1(00. Fut in our ent8usias*2 9e could not resist a radical o=er8aul of t8e syste*2 in 98ic8 all of its *aUor 9ea5nesses 8a=e been eRposed2 analy ed2 and replaced 9it8 ne9 9ea5nesses. - Fruce Be=erett2 C3egister 0llocation in ,pti*i ing Jo*pilersC 1(01. Fut of course2 it "is" only *y opinion. 1(02. Fut scientists2 98o oug8t to 5no9 0ssure us t8at it *ust be so. ,82 let us ne=er2 ne=er doubt 78at nobody is sure about. - +ilaire Felloc 1(0(. Fut soft you2 t8e fair ,p8elia& ,pe not t8y ponderous and *arble Ua9s2 Fut get t8ee to a nunnery -- go - -ar5 CD8e FardC D9ain 1(0). Fut soft2 98at bird t8roug8 yonder 9indo9 brea5s? 1(0/. Fut t8en O sa9 8er face2 no9 O'* a belie=er. - D8e -on5eys 1(06. Fut 7indo9s bas8ing is *y Uob... 1(0@. Fut you s8all not escape *y ia*bics. 1(0:. Fuy 0*da8l Htoc5 to go up 100 points neRt 9ee5. 1(0E. Fuy lo92 sell 8ig8. 1(10. FLQQ =. Do run in a =ery tig8t loop2 per8aps 9it8out guarantee of getting out. 1(11. Fy doing Uust a little e=ery day2 you can gradually let t8e tas5 co*pletely o=er98el* you. 1(12. Fy failing to prepare2 you are preparing to fail. 1(1(. Fy follo9ing t8e good2 you learn to be good. 1(1). Fy nature2 *en are nearly ali5eW by practice2 t8ey get to be far apart. 1(1/. Fy protracting life2 9e do not deduct one Uot fro* t8e duration of deat8. 1(16. Fy t8e yard2 life is 8ard. Fy t8e inc82 it's a cinc8. 1(1@. Fye Tids 1(1:. F;3K.'H B07 ,? J,KJ3.DOK<& 78en you pour2 it rains. 1(1E. J progra* run2 J progra* cras82 J progra**er cry. 1(20. J2 n.& 0 progra**ing language t8at is sort of li5e Pascal eRcept *ore li5e asse*bly eRcept t8at it isn't =ery *uc8 li5e eit8er one2 or anyt8ing else. Ot is eit8er t8e best language a=ailable to t8e art today2 or it isn't. - 3ay Hi*ard 1(21. J&#F.B?3; is 98ere O 5eep *y .F0D files ^^^oo^^^ 1(22. J(-H.B..M. crosslin5ed 9[4OHD3.HH.J,---3.HJL.?$y[n1 1(2(. J,H J,H#3LK 3LK#4,H#3LK 1(2). J,H J,H#3LK J,H#J30H+ 1(2/. J,H J,H#3LK J,H#3LK#7OK4,7H J,H#3LK#HB,7
1(26. J,H J,H#3LK J,H#3LK#0-LJT 1(2@. J0 bu*per stic5er& Jo=er *e2 O'* c8anging lanes. 1(2:. Jabbage2 n.& 0 fa*iliar 5itc8en-garden =egetable about as large and 9ise as a *an's 8ead. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 1(2E. Ja8n's 0Rio*& 78en all else fails2 read t8e instructions. 1((0. Jalifornia is a fine place to li=e -- if you 8appen to be an orange. - ?red 0llen 1((1. Jalifornians are not 9it8out t8eir faults. 1((2. Jall on <od2 but ro9 a9ay fro* t8e roc5s. - Ondian pro=erb 1(((. Jan anyone re*e*ber 98en t8e ti*es 9ere not 8ard2 and *oney not scarce? 1((). Jan anyt8ing be sadder t8an 9or5 left unfinis8ed? ;es2 9or5 ne=er begun. 1((/. Jan O buy you a drin52 or do you Uust 9ant t8e *oney? - Pic5 up line 1((6. Jan you do t8e Picard -aneu=er in a <rand 0*? 1((@. Jan you read a punc8ed card2 loo5ing at t8e 8oles? 1((:. Jan you 98istle (00 baud? 1((E. Jan you 98istle a telep8one nu*ber? 1()0. Jan't learn to do it 9ell? Bearn to enUoy doing it badly 1()1. Jan't open [usr[lib[fortunes. 1()2. Janada Fill >one's -otto& Ot's *orally 9rong to allo9 suc5ers to 5eep t8eir *oney. 1()(. Janada Post doesn't really c8arge (2 cents for a sta*p. Ot's 2 cents for postage and (0 cents for storage. - <erald 3egan2 Jabinet -inister2 12[(1[:( ?inancial Post 1()). Janada& a fe9 acres of sno9. - Voltaire 1()/. Janadian 4,H pro*pt& .+?#I 1()6. Janadian 4,H& C;er sure2 e8?C [y[n! 1()@. J0KJ.3 $>une 21 - >uly 221 ;ou are sy*pat8etic and understanding to ot8er people's proble*s. D8ey t8in5 you are a suc5er. ;ou are al9ays putting t8ings off. D8at's 98y you'll ne=er *a5e anyt8ing of yourself. -ost 9elfare recipients are Jancer people. 1():. Jandy Os dandy Fut liSuor Os Suic5er. - ,gden Kas8 1()E. Jannot for5 -- try again. 1(/0. Jannot open [usr[ga*es[lib[fortunes. 1(/1. J0P3OJ,3K $4ec 2( - >an 1E1 ;ou are conser=ati=e and afraid of ta5ing ris5s. ;ou don't do *uc8 of anyt8ing and are la y. D8ere 8as ne=er been a Japricorn of any i*portance. Japricorns s8ould a=oid standing still for too long as t8ey ta5e root and beco*e trees. 1(/2. Japtain D8e L03Ds 5enna' ta5e t8ese speeds 1(/(. Japtain ... one .. 8ar*less ... little ... Dribble? 1(/). Japtain Penny's Ba9& ;ou can fool all of t8e people so*e of t8e ti*e2 and so*e of t8e people all of t8e ti*e2 but you Jan't ?ool -o*. 1(//. Japtain please2 not in front of t8e Tlingons. 1(/6. Japtain Ho*eone 8as snorted all t8e dilit8iu* crystals. 1(/@. Japtain's Bog2 star date 21&()./. 1(/:. Japtain2 O need to 5ill so*eone. \ 7orf 1(/E. Japtain2 O protest. O a* K,D a *erry *an - 7orf 1(60. Japtain2 p8asers and p8otons do9n2 get t8e 8and p8aser out 1(61. Japtain2 please. Kot in front of t8e Tlingons. 1(62. Japtain2 t8e L03Ds 9on't ta5e t8is Hpeed 1(6(. Japtain2 9e 8a=e engaged datasc8lurp *ode 1(6). Jarpe die*2 Sua* *ini*u* credula postero +orace $: FJ1 1(6/. Jarpe 4ie*.
1(66. Jauliflo9er is not8ing but Jabbage 9it8 a Jollege .ducation. - -ar5 D9ain 1(6@. Jaution& breat8ing *ay be 8a ardous to your 8ealt8. 1(6:. Jaution& D8is stuff is addicti=e... 1(6E. Ja=orting about li5e t8at isn't proper be8a=ior. - Picard 1(@0. JJ -< -0 -Q +.BB,.J <,,4F;..J 0FF.;.J 3,04.J - 4ennis -. 3itc8ie 1(@1. JJ88eecc55 yyoouurr dduupplleeRR ss99iittcc88.. 1(@2. JJ88eecc55 yyoouurr dduupplleeRR ss99iittcc88.. 1(@(. Jelebrate +annibal 4ay t8is year. Da5e an elep8ant to lunc8. 1(@). Jelebrate +annibal 4ay today. Da5e an elep8ant to lunc8. 1(@/. Jelibacy is 8ereditary. 1(@6. Jelibacy is not 8ereditary. 1(@@. Jensors8ip is so*et8ing [[[[[[ [[[[ O do [[[ li5e 1(@:. Jensus Da5er to +ouse9ife& 4id you e=er 8a=e t8e *easles2 and2 if so2 8o9 *any? 1(@E. Jenter *eeting at ) p* in 2J-/)(. 1(:0. Jereal Tiller Htri5es 0gain Jap'n Jrunc8 found dead... 1(:1. Jertainly t8ere are t8ings in life t8at *oney can't buy2 but it's =ery funny-- 4id you e=er try buying t8en 9it8out *oney? - ,gden Kas8 1(:2. J8ance fa=ours t8e prepared *ind. - Bouis Pasteur 1(:(. J8ange your t8oug8ts and you c8ange your 9orld. 1(:). J8aparral - 0 *en only arral. 1(:/. J8aracter 4ensity& t8e nu*ber of =ery 9eird people in t8e office. 1(:6. J8arity begins at 8o*e. 1(:@. J8arity& a t8ing t8at begins at 8o*e and usually stays t8ere. 1(::. J8arlie don't surf - Jol. Tilgore $0pocalypse Ko91 1(:E. J8ar* is a 9ay of getting a CyesC 9it8out 8a=ing as5ed any clear Suestion. 1(E0. J+03K,JT'H B07& ;ou ne=er really learn to s9ear until you learn to dri=e. 1(E1. J8astity is its o9n punis8*ent. 1(E2. J8eap t8ings are of no =alue2 =aluable t8ings are not c8eap. 1(E(. J8ec5 again to *a5e sure it's not loaded. 1(E). J+.OD'H B0-.KD& Of you 8elp a friend in need 8e's sure to re*e*ber you t8e neRt ti*e 8e's in need. 1(E/. J8e*icals2 n.& KoRious substances fro* 98ic8 *odern foods are *ade. 1(E6. J8e*istry professors ne=er die2 t8ey Uust fail to react. 1(E@. J8e*istry professors ne=er die2 t8ey Uust s*ell t8at 9ay 1(E:. J8e*ists 8a=e solutions. 1(EE. J8e*ists really 5no9 t8eir bis*ut8. 1)00. J+.,PH' B07& Kot8ing e=er gets built on sc8edule or 9it8in budget. 1)01. J8icago2 n.& 78ere t8e dead still =ote ... early and often 1)02. J8ic5en feed is 98at *ost of our nest eggs 8a=e turned into. 1)0(. J8ic5en Bittle 9as rig8t. 1)0). J8ic5en Bittle 9as rig8t. 1)0/. J8ic5en Houp2 n.& 0n ancient *iracle drug containing eSual parts of aureo*ycin2 cocaine2 interferon2 and DBJ. D8e only ail*ent c8ic5en soup can't cure is neurotic dependence on one's *ot8er. - 0rt8ur Kai*an2 C.=ery <oy's <uide to ;iddis8C 1)06. J8ildren are natural *i*ic 98o act li5e t8eir parents despite e=ery effort to teac8 t8e* good *anners.
1)0@. J8ildren aren't 8appy 9it8out so*et8ing to ignore2 0nd t8at's 98at parents 9ere created for. - ,gden Kas8 1)0:. J8ildren 8a=e *ore need of *odels t8an of critics. 1)0E. J8ildren seldo* *isSuote you. On fact2 t8ey usually repeat 9ord for 9ord 98at you s8ouldn't 8a=e said. 1)10. J8ildren& Pure lo=e contained in soft pac5ages. 1)11. J8inese saying& C+e 98o spea5 9it8 for5ed tongue2 not need c8opstic5s.C 1)12. J8ip*un5s roasting on an open fire... 1)1(. J8is*'s Ba9 of Jo*pletion& D8e a*ount of ti*e reSuired to co*plete a go=ern*ent proUect is precisely eSual to t8e lengt8 of ti*e already spent on it. 1)1). J8isol*'s ?irst Jorollary to -urp8y's Hecond Ba9& 78en t8ings Uust can't possibly get any 9orse2 t8ey 9ill. 1)1/. J8o9n up. J8o9 do9n. 1)16. J8rist& 0 *an 98o 9as born at least /2000 years a8ead of 8is ti*e. 1)1@. J8urc8ill's Jo**entary on -an& -an 9ill occasionally stu*ble o=er t8e trut82 but *ost of t8e ti*e 8e 9ill pic5 8i*self up and continue on. 1)1:. Jigarette& 0 fire at one end2 a fool at t8e ot8er2 and a bit of tobacco in bet9een. 1)1E. Jine*uc52 n.& D8e co*bination of popcorn2 soda2 and *elted c8ocolate 98ic8 co=ers t8e floors of *o=ie t8eaters. - 3ic8 +all2 CHnigletsC 1)20. Jircular 4efinition& see 4efinition2 Jircular. 1)21. Jircu*stances rule *enW *en do not rule circu*stances. 1)22. Jlara=oiant *eeting canceled due to unforseen e=ents. 1)2(. Jlar5 Tent is a trans=estite. 1)2). JB03T'H B07& 1)2/. Jlassified *aterial reSuires proper storage. 1)26. Jleanliness is neRt to i*possible. 1)2@. Jleanliness is neRt to i*possible. 1)2:. Jleanliness is neRt to i*possible. 1)2E. Jleats - ?ro* C101 LH.H ?,3 0 4.04 -OJ3,P3,J.HH,3C 1)(0. Jle=eland still li=es. <od *ust be dead. 1)(1. Jlic5..Jlic5..Jlic5..4a*n ,ut of taglines 1)(2. Jli*ate is 98at you eRpect. 7eat8er is 98at you get. 1)((. Jlones are people t9o. 1)(). Jlones are people t9o. 1)(/. Jloning is t8e sincerest for* of flattery. 1)(6. Jloning is t8e sincerest for* of flattery. 1)(@. Jlosing on s8ip target. -usic on ?ire a9ay 1)(:. Jlot8es *a5e t8e *an. Ka5ed people 8a=e little or no influence on society. -ar5 D9ain 1)(E. Joastal access2 neRt left. 1))0. Jobol progra**ers are do9n in t8e du*ps. 1))1. Jobol progra**ers understand 98y 9o*en 8ate periods. 1))2. Jobol progra*s are an eRercise in artificial inelegance. 1))(. Jocaine -- t8e t8in5ing *an's 4ristan. 1))). Joffee in .ngland is Uust toasted *il5. 1))/. J,??...J,- not found& $01bort2 $31e8eat2 $H1noo e 1))6. Jogito cogito ergo cogito su* -- CO t8in5 t8at O t8in52 t8erefore O t8in5 t8at O a*.C - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 1))@. Jogito ergo cogito 1)):. Jogli l'atti*o Jogli l'atti*o.
1))E. J,OD--L3P+;'H HD0D.-.KD ,K D+. P,7.3 ,? K.<0DOV. D+OKTOK<& Ot is i*possible for an opti*ist to be pleasantly surprised. 1)/0. J,T. OH OD 1)/1. Jold pi a& t8e generic brea5fast 1)/2. Jold2 adU.& 78en t8e local flas8ers are 8anding out 9ritten descriptions. 1)/(. Jold2 adU.& 78en t8e politicians 9al5 around 9it8 t8eir 8ands in t8eir o9n poc5ets. 1)/). Jole's la9& t8inly sliced cabbage. 1)//. Jollaboration2 n.& 0 literary partners8ip based on t8e false assu*ption t8at t8e ot8er fello9 can spell. 1)/6. Jolorless green ideas sleep furiously. 1)/@. Jol=ard's Bogical Pre*ises& 0ll probabilities are /0A. .it8er a t8ing 9ill 8appen or it 9on't. 1)/:. Jol=ard's Lnconscionable Jo**entary& D8is is especially true 98en dealing 9it8 so*eone you're attracted to. 1)/E. Jo*e on do9n to 2E2 J8ester=ille 3d2 -oorabbin2 and let *e2 do it rig8t for ;,L 1)60. Jo*e2 e=ery frustu* longs to be a cone2 0nd e=ery =ector drea*s of *atrices. +ar5 to t8e gentle gradient of t8e bree e& Ot 98ispers of a *ore ergodic one. Htanisla9 Be*2 CJyberiadC 1)61. Jo*e2 let us 8asten to a 8ig8er plane2 78ere dyads tread t8e fairy fields of Venn2 D8eir indices bedec5ed fro* one to n2 Jo**ingled in an endless -ar5o= c8ain - Htanisla9 Be*2 CJyberiadC 1)62. Jo*ing Hoon -ouse Hupport for .dlin 1)6(. Jo*ing Hoon. -ouse Hupport for Durbo .dlin 1)6). Jo*ing Hoon. -ouse Hupport for Durbo .dlin 1)6/. Jo*ing Hoon... Durbo .dlin 1)66. Jo*ing soon& Ket9are for Kintendo 1)6@. Jo**and - used to instruct co*puters. Lsually elicits t8e response CHyntaR errorC. 1)6:. Jo**and2 n.& Htate*ent presented by a 8u*an and accepted by a co*puter in suc8 a *anner as to *a5e t8e 8u*an feel as if 8e is in control. 1)6E. J,--.KD ,82 life is a glorious cycle of song2 0 *edley of eRte*poraneaW 0nd lo=e is t8ing t8at can ne=er go 9rongW 0nd O a* -arie of 3ou*ania. - 4orot8y Par5er 1)@0. Jo**it t8e oldest sins t8e ne9est 5ind of 9ays. 1)@1. Jo**it*ent2 n.& Jo**it*ent can be illustrated by a brea5fast of 8a* and eggs. D8e c8ic5en 9as in=ol=ed2 t8e pig 9as co**itted. 1)@2. Jo**on sense is t8e collection of preUudices acSuired by age eig8teen. 0lbert .instein 1)@(. Jo**unis*& 78at's not illegal2 is co*pulsory. 1)@). Jo*petence al9ays contains t8e seeds of inco*petence. 1)@/. Jo*plaints? 7rite t8e* 8ere legibly [! N1)@6. Jo*press - ?e*ale of Jo*peror. 1)@@. Jo*puter actors 9ill ne=er be greatW t8ey only get bit parts 1)@:. Jo*puter engineers do it bit by bit. 1)@E. Jo*puter Bie #1& ;ou'll ne=er use all t8at dis5 space. 1):0. Jo*puter progra**ers do it byte by byte 1):1. Jo*puter progra**ers ne=er die2 t8ey Uust get lost in t8e processing. 1):2. Jo*puter Hcience is *erely t8e post-During decline in for*al syste*s t8eory.
1):(. Jo*puter2 *icro9a=e dec5s /-10 until piping 8ot. F..P 1):). Jo*puters are not intelligent. D8ey only t8in5 t8ey are. 1):/. Jo*puters are not intelligent. D8ey only t8in5 t8ey are. 1):6. Jo*puters are not intelligent. D8ey only t8in5 t8ey are 1):@. Jo*puters are ,L3 business2 our ,KB; business 1)::. Jo*puters 03. t8e future. ,8 t8e future loo5s gri* 1):E. Jo*puters are unreliable2 but 8u*ans are e=en *ore unreliable. 1)E0. Jo*puters can ne=er replace 8u*an stupidity. 1)E1. Jo*puters can ne=er replace 8u*an stupidity. 1)E2. Jo*puters unite you 8a=e not8ing to lose but your operators. 1)E(. Jon 'sta pioggia e con 'sto =ento c8i e' c8e bossa a 'sto con=ento? 1)E). Jonceit causes *ore con=ersation t8an 9it. - Ba3ouc8efoucauld 1)E/. Joncentrate on security. 1)E6. Joncept2 n.& 0ny CideaC for 98ic8 an outside consultant billed you *ore t8an $2/2000. 1)E@. Jondense soup2 not boo5s 1)E:. Jonditional Uu*ps is 98en you tell t8e co*puter to go to a certain place. Lnconditional is if you put it in t8e 9rong place so t8e co*puter goes to t8e 9rong place. 1)EE. Jonfession is good for t8e soul only in t8e sense t8at a t9eed coat is good for dandruff. - Peter de Vries 1/00. Jonfession is good for t8e soul2 but bad for your career. 1/01. Jonfidence is telling so*eone 8o9 to use 8is D9it ?ilter. 1/02. Jonfidence is t8e feeling you 8a=e before you understand t8e situation. 1/0(. Jonfidence is t8e feeling you 8a=e before you understand t8e situation. 1/0). Jonfidence is t8e feeling you 8a=e before you understand t8e situation. 1/0/. Jonfucius say& CO 8a=e no ti*e for *on5s resisting t8e carni=alC 1/06. Jonfuse people& start *a5ing sense. 1/0@. Jonfusion is al9ays increasing in society. 1/0:. Jonfusticate and bebot8er t8ese d9ar=es 1/0E. Jongratulations D8e pressure 9ill stop soon. 1/10. Jongratulations ;ou are t8e 162@@@2216t8 user to login to our syste*. 1/11. Jongratulations ;ou are t8e one-*illiont8 user to log into our syste*. 1/12. Jongratulations ;ou 8a=e no9 used up anot8er 2/0 8ours of JPL ti*e. 1/1(. Jongratulations 4ata2 it's a girl. Droy - D8e ,ffsprin 1/1). J,Kgress $n1 - ,pposite of P3,gress 1/1/. J,KK,3'H H.J,K4 B07& Of so*et8ing is confidential it 9ill be left in t8e copier *ac8ine. 1/16. Jonscience is t8e inner =oice t8at 9arns us so*ebody is loo5ing - +. B. -enc5en 1/1@. Jonscience is 98at 8urts 98en e=eryt8ing else feels so good. 1/1:. Jonser=atis* is t8e 9ors8ip of dead re=olutions. 1/1E. Jonsider your reputation. Dry c8anging your na*e and *o=ing to a ne9 to9n. 1/20. Jonstant c8ange is 8ere to stay. 1/21. Jonsult a real eRpert - Jall your *ot8er 1/22. Jonsultancy - D8e art of eRtracting *oney fro* anot8er *an's poc5et 9it8out resorting to =iolence. 1/2(. Jonsultants are *ystical people 98o as5 a co*pany for a nu*ber and t8en gi=e it bac5 to t8e*. 1/2). Jontacts Plus... D8e ad=enture continues.
1/2/. Jontains less t8an 2A L.H. 340 for t8is ec8o 1/26. Jontentsoftagline*aysettledurings8ipping. 1/2@. Jontinental Bife. 78y do you as5? 1/2:. Jontrol-0lt-4elete t8yself 1/2E. Jon=ention is t8e ruler of all. 1/(0. Jon=ersation enric8es t8e understanding2 but solitude is t8e sc8ool of genius. 1/(1. Jon=ersation2 n.& 0 =ocal co*petition in 98ic8 t8e one 98o is catc8ing 8is breat8 is called t8e listener. 1/(2. Jon9ay's Ba9& On any organi ation t8ere 9ill al9ays be one person 98o 5no9s 98at is going on. D8is person *ust be fired. 1/((. J,,P.3'H -.D0B07& 0 proliferation of ne9 la9s creates a proliferation of ne9 loop8oles. 1/(). Jopy fro* anot8er& plagiaris*. Jopy fro* *any& researc8. 1/(/. Jopy9ig8t 1EE1 .l*er ?udd. 0ll 9ig8ts 9ese9=ed 1/(6. J,3KL.BB.'H B07& 0ut8ority tends to assign Uobs to t8ose least able to do t8e*. 1/(@. Joronation2 n.& D8e cere*ony of in=esting a so=ereign 9it8 t8e out9ard and =isible signs of 8is di=ine rig8t to be blo9n s5y8ig8 9it8 a dyna*ite bo*b. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 1/(:. Jorrupt 4ata - a copy of -ac Play*ate. 1/(E. Jorrupt2 adU.& On politics2 8olding an office of trust or profit. 1/)0. Jorruption is not t8e #1 priority of t8e Police Jo**issioner. +is Uob is to enforce t8e la9 and fig8t cri*e. - P.F.0. President .. >. Tiernan 1/)1. Jould be an e=er-opening flo9er. 1/)2. Jounting in binary is Uust li5e counting in deci*al if you are all t8u*bs. 1/)(. Jounting in octal is Uust li5e counting in deci*al if you don't use your t8u*bs 1/)). Jourage is fear t8at 8as said its prayers. 1/)/. Jourage is grace under pressure. 1/)6. Jourage is your greatest present fault. 1/)@. Jo9ard2 n.& ,ne 98o in a perilous e*ergency t8in5s 9it8 8is legs. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 1/):. JP0V 7arning&$H1top $J1ontinue $F1urn infected dis5 1/)E. JPL - 3ando* nu*ber generator 1//0. J30K.'H B07& D8ere ain't no suc8 t8ing as a free lunc8. 1//1. Jras8 progra*s fail because t8ey are based on t8e t8eory t8at2 9it8 nine 9o*en pregnant2 you can get a baby a *ont8. - 7ern8er =on Fraun 1//2. Jra ee .deee2 8is prices are OKH0K. 1//(. Jreate t8e i*pression t8at you 8a=e already reac8ed your le=el of inco*petence. 1//). Jreate your o9n opportunity. Flac5*ail a senior eRecuti=e. 1///. Jreditors 8a=e *uc8 better *e*ories t8an debtors. 1//6. Jre9*an <reen2 step on t8at roc5 NF,,-I 1//@. Jri*e does not pay ... as 9ell as politics. - 0. .. Ke9*an 1//:. Jri*e does not pay ... as 9ell as politics. - 0. .. Ke9*an 1//E. Jri*e does not pay... as 9ell as politics. 1/60. Jri*e 9ouldn't pay if t8e <o=ern*ent ran it 1/61. Jritic2 n.& 0 person 98o boasts 8i*self 8ard to please because nobody tries to please 8i*. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 1/62. Jritical error& $H18out2 $H1*as82 $F1uy a *ac. 1/6(. Jriticis* co*es easier t8an crafts*ans8ip.
1/6). Jrito2 O o9e a coc5 to 0sclepiusW 9ill you re*e*ber to pay t8e debt? 1/6/. Jrus8er& 7orf2 8a=e you seen 7esley? 7orf& Ko2 O 8a=en't 1/66. Julture is t8e 8abit of being pleased 9it8 t8e best and 5no9ing 98y. 1/6@. Jure t8e disease and 5ill t8e patient. 1/6:. Juriosity didn't 5ill t8e cat. O got 'i* 9it8 t8e *o9er 1/6E. Juriosity 5illed t8e cat2 but satisfaction broug8t 8er bac5. 1/@0. Jurrency - ?ro* C101 LH.H ?,3 0 4.04 -OJ3,P3,J.HH,3C 1/@1. Jursor - s*all blob on t8e screen2 usually flas8ing. 1/@2. JL3H,3& 78at you beco*e 98en your syste* cras8es. 1/@(. Jut life support to all Suarters 9it8 c8ildren - Picard 1/@). Jut *y pi a in siR slices2 pleaseW O can't eat eig8t. 1/@/. J9* fUord-ban5 glyp8s =eRt Sui . 1/@6. Jynic2 n.& 0 blac5guard 98ose faulty =ision sees t8ings as t8ey are2 not as t8ey oug8t to be. +ence t8e custo* a*ong t8e Hcyt8ians of pluc5ing out a cynic's eyes to i*pro=e 8is =ision. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 1/@@. Jynic2 n.& ,ne 98o loo5s t8roug8 rose-colored glasses 9it8 a Uaundiced eye. 1/@:. 4.,.H. - progra* designed to *a5e an e=en flo9 of dust round t8e dis5. 1/@E. 4addy2 98at does C?,3-0DDOK< 43OV. J&.....C *ean ? 1/:0. 4addy2 98at does ?,3-0DDOK< 43OV. J& *ean? 1/:1. 4addy2 98at does 3.H.D *ean 1/:2. 4aisies of t8e 9orld unite ;ou 8a=e not8ing to lose but your c8ains. 1/:(. 4a**it Fones2 O'* a captain2 not a doctor 1/:). 4a**it >i*2 O'* a doctor2 not a tagline 9riter. 1/:/. 4a**it2 >i*2 O'* a floor 9aR2 not a dessert topping 1/:6. 4a*n Ot >i* O'* a 4octor not a Dagline 9riter 1/:@. 4a*n it >i*2 O'* a doctor not a doctor +ey2 9ait a *inute 1/::. 40-K OD2 O <,DD0 <.D ,LDD0 +.3. 1/:E. 4a*n ,utta 0nti*atter. O told <eordi $/0 9asn't enoug8 1/E0. 4a*n t8is 8obby is eRpensi=e 1/E1. 4ar*o5 and >8ilad at Danagra 1/E2. 4arn ,ut of tribble tags 1/E(. 4arn HDOBB out of tribble tags 1/E). 4art8 Vadar ,nly you 9ould be so bold. 1/E/. 4art8 Vader sleeps 9it8 a Deddy9oo5ie. 1/E6. 4art8 Vader sleeps 9it8 a teddy9oo5ie. 1/E@. 4ata beco*es =ilently ill 9it8 a co*puter =irus. 1/E:. 40D0 J,-P3.HHO,K& 78at ;ou <et 78en ;ou HSuis8 0n 0ndroid 1/EE. 4ata con=inces t8e Jo5e *ac8ine t8at Pepsi is better. 1600. 4ata enUoys a s*o5e after interfacing 9it8 t8e Jo*puter. 1601. 4ata2 data e=ery98ere2 and not a byte to eat 1602. 4ata- COt OH t8e Htay Puft -ars8*allo9 -an2 JaptainC 160(. 40VOH' 0KH7.3 D, 3,<.3'H B07& Her=ing coffee on an aircraft causes turbulence. 160). 4a9n2 n.& D8e ti*e 98en *en of reason go to bed. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 160/. 4ay of inSuiry. ;ou 9ill be subpoenaed. 1606. 4e-accession eup8e*is*s. 160@. 4ead cat brus8 - ?ro* C101 LH.H ?,3 0 4.04 -OJ3,P3,J.HH,3C 160:. 4ead2 8u8? 7ell2 t8at's one less t8ing. - Fe=erly 160E. 4ead9ood. Kineteent8 Jentury .art8. D8e 0ncient 7est.
1610. 4.0B'H H0OBOK< B07& t8e a*ount of 9ind =aries in=ersely 9it8 t8e nu*ber and eRperience of t8e cre9. 1611. 4ealing 9it8 failure is easy& 9or5 8ard to i*pro=e. Huccess is also easy to 8andle& you'=e sol=ed t8e 9rong proble*. 7or5 8ard to i*pro=e. 1612. 4eanna tries to read *y *ind and sees taglines. 161(. 4eanna tries to read Picard's *ind and sees Pontiac. 161). 4ear -iss -anners& -y 8o*e econo*ics teac8er says t8at one *ust ne=er place one's elbo9s on t8e table. +o9e=er2 O 8a=e read t8at one elbo92 in bet9een courses2 is all rig8t. 78ic8 is correct? 161/. 4ear -iss -anners& Please list so*e tactful 9ays of re*o=ing a *an's sali=a fro* your face. 1616. 4eat8 8as been pro=en to be EE per cent fatal in laboratory rats. 161@. 4eat8 is <od's 9ay of telling you not to be suc8 a 9ise guy. 161:. 4eat8 is life's 9ay of telling you you'=e been fired. - 3. <eis 161E. 4eat8 is Kature's 9ay of recycling 8u*an beings. 1620. 4eat8 is Kature's 9ay of saying 'slo9 do9n'. 1621. 4eat8 is nature's 9ay of telling you to slo9 do9n. 1622. 4eat8 is pro=en to be EE.EA fatal to all laboratory rats. 162(. 4eat8 is t8e greatest 5ic5 of all. D8at's 98y t8ey sa=e it for last. 162). 4eat8& D8e unfortunate side effect of attac5ing a cop. 162/. 4eat8& to stop sinning suddenly. 1626. 4ebugger - de blo5e dat sold us dis syste*. 162@. 4ecay2 in8erent in all co*ponent t8ings. Fudd8a-last 9rds 162:. 4ecision*a5er2 n.& D8e person in your office 98o 9as unable to for* a tas5 force before t8e *usic stopped. 162E. 4ecisions ter*inate panic. 16(0. 4ecouple - 4e *an and 8i* *issus. 16(1. 4eep do9n2 you don't understand *e. 16(2. 4eep Hpace Kine& D8e D8ird Jo*ing of Htar Dre5 16((. 4efinition of Derror& 0 fe*ale Tlingon 9it8 P-H. 16(). 4eflector s8ields Uust ca*e on2 Japtain. 16(/. 4.B.D. 0 ?,3DLK. 4on't so*e of t8ese fortunes Uust dri=e you nuts? 7ouldn't you li5e to see so*e of t8e* deleted fro* t8e syste*? ;ou can >ust *ail to CfortuneC 9it8 t8e fortune you 8ate *ost2 and 9e -O<+D *a5e sure it gets eRpunged. 16(6. 4eliberation2 n.& D8e act of eRa*ining one's bread to deter*ine 98ic8 side it is buttered on. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 16(@. 4eli=er yesterday2 code today2 t8in5 to*orro9. 16(:. 4e*ocracy is a for* of go=ern*ent in 98ic8 it is per*itted to 9onder aloud 98at t8e country could do under first-class *anage*ent. - Henator Hoaper 16(E. 4e*ocracy is a for* of go=ern*ent t8at substitutes election by t8e inco*petent *any for appoint*ent by t8e corrupt fe9. - <. F. H8a9 16)0. 4e*ocracy is also a for* of 9ors8ip. Ot is t8e 9ors8ip of >ac5als by >ac5asses. - +. B. -enc5en 16)1. 4e*ocracy is based on t8e t8eore* t8at *any *en are s*arter t8an one. 16)2. 4e*ocracy is t8e recurrent suspicion t8at *ore t8an 8alf of t8e people are rig8t *ore t8an 8alf of t8e ti*e. - .. F. 78ite 16)(. 4entist2 n.& 0 Prestidigitator 98o2 putting *etal in one's *out82 pulls coins out of one's poc5ets. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 16)). 4epart*ent *eeting in ( *inutes. 16)/. 4epend not on fortune2 but on conduct.
16)6. 4epri=e a *irror of its sil=er and e=en t8e J ar 9on't see 8is face. 16)@. 4.HV=ie9& Fetter 9indo9s 16):. 4.HV=ie9& ?aster t8an a Jray $running 7indo9s1 16)E. 4essert? O'll ta5e a piece of c8erry c. 16/0. 4etac8 t8e saucer2 4ata. 4on't spill t8e tea 16/1. 4etails 20 *inutes fro* no9 on 0ction Jentral Ke9s2 5ids. 16/2. 4.VOJ.+O<+& ;our de=ice dri=er on drugs. 16/(. 4.V3O.H' 4OB.--0& Of you 8it t9o 5eys on t8e type9riter2 t8e one you don't 9ant 9ill 8it t8e paper. 16/). 4eVries's 4ile**a& Of you 8it t9o 5eys on t8e type9riter2 t8e one you don't 9ant 8its t8e paper. 16//. 4iagnostics can best be understood in t8e conteRt of t8e source code. 16/6. 4iarr8ea is 8ereditary. Ot runs in your Ueans. 16/@. 4id V*ode* originate in t8e V continuu*? 16/:. 4id you 5no9 ... D8at no-one e=er reads t8ese t8ings? 16/E. 4id you 5no9 t8at clones ne=er use *irrors? - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 1660. 4id you 5no9 t8at no-one e=er reads t8ese t8ings? 1661. 4ie2 =.& Do stop sinning suddenly. - .lbert +ubbard 1662. 4ifference bet9een a =irus G 9indo9s? Viruses ne=er fail. 166(. 4ifferent all t9isty a of in *a e are you2 passages little. 166). 4igital circuits are *ade fro* analog parts. 166/. 4i*ensions 9ill al9ays be eRpressed in t8e least usable ter*. Velocity2 for eRa*ple2 9ill be eRpressed in furlongs per fortnig8t. 1666. 4OK.3'H 4OB.--0& 0 clean tie attracts t8e soup of t8e day. 166@. 4iplo*acy is t8e art of saying Cnice doggyC until you can find a club. 166:. 4iplo*acy& D8e art of saying Cnice doggieC until you can find a roc5. 166E. 4irect action produces direct reaction. 16@0. 4irect fro* t8e -inistry of Hilly 7al5s. 16@1. 4isclose classified infor*ation only 98en a K..4 D, TK,7 eRists. 16@2. 4isco is to *usic 98at etc8-a-s5etc8 is to art. 16@(. 4isco=eries are *ade by not follo9ing instructions. 16@). 4iscretion - putting t9o and t9o toget8er and 5eeping your *out8 s8ut. 16@/. 4isease can be curedW fate is incurable. 16@6. 4isguise your feelings 98en you put your relati=es on t8e plane for 8o*e. 16@@. 4is8onor 9ill not trouble *e2 once O a* dead. 16@:. 4is5 crisis2 please clean up 16@E. 4is5 4ri=e - *ac8ine part designed to collect dust2 cigarette as82 etc. 16:0. 4is5 +ead - t8at part of a *ac8ine designed to be 9orn do9n by dust. 16:1. 4is5s tra=el in pac5s. 16:2. 4i=ers do it better under pressure. 16:(. 4i=ers do it deeper. 16:). 4o 0ndroids 4rea* of .lectric H8eep? 0s5 4ata. 16:/. 4o be a do-bee - -iss Hally 16:6. 4o be do be do - Hinatra 16:@. 4o bears bear-et82 do bees bee-et8? - 4a=id 0ddison 16::. 4o O s*o5e after seR? O ne=er loo5ed. 16:E. 4o it no9 D8ere *ig8t be a la9 against it to*orro9. 16E0. 4o it today2 to*orro9 it 9ill be illegal. 16E1. 4o *arried 9o*en *a5e t8e best 9i=es?
16E2. 4o *olecular biologists 9ear designer genes? 16E(. 4o Kot 0tte*pt to Dra=erse a J8as* in D9o Beaps... 16E). 4o not be led astray onto t8e pat8 of =irtue. 16E/. 4o not be o=erly suspicious 98ere it is not 9arranted. 16E6. 4o not belie=e e=eryt8ing you 8ear or anyt8ing you say. 16E@. 4o not belie=e in *iracles -- rely on t8e*. 16E:. 4o not belie=e in *iracles--rely on t8e*. 16EE. 4o not clog intellect's sluices 9it8 bits of 5no9ledge of Suestionable uses. 1@00. 4o not count your c8ic5ens before t8ey are 8atc8ed. 1@01. 4o not drin5 coffee in t8e *orning or it 9ill 5eep you a9a5e until noon. 1@02. 4o not eRpose t8is tagline to direct sunlig8t. 1@0(. 4o not 5iss an elep8ant on t8e lips today. 1@0). 4o not learn t8e tric5s of t8e trade--learn t8e trade. 1@0/. 4o not lend *oney to a fiend. 1@06. 4o not *erely belie=e in *iracles2 rely on t8e*. 1@0@. 4o not put state*ents in t8e negati=e for*. 1@0:. 4o not read t8is fortune under penalty of la9. $Penal Jode sec. 2.(.2 $OO.a11 1@0E. 4, K,D 3.-,V. D+OH D0< $LK4.3 P.K0BD; ,? B071 1@10. 4o not sleep in a eucalyptus tree tonig8t. 1@11. 4o not spea5 about Di*e2 until you 8a=e spo5en to 8i*. 1@12. 4o not ta5e life too seriouslyW you 9ill ne=er get out of it ali=e. 1@1(. 4o not tell big lies. H*all ones can be Uust as effecti=e. 1@1). 4o not underesti*ate t8e po9er of t8e ?orce. 1@1/. 4o so*et8ing unusual today. Pay a bill. 1@16. 4o tele=angelists do *ore t8an lay people? 1@1@. 4o unto ot8ers before t8ey do unto you. 1@1:. 4o unto ot8ers >LHD F.?,3. t8ey do unto you 1@1E. 4o you feel Buc5y2 pun5??? 1@20. 4o you 8a=e a Uob? 1@21. 4o you 8a=e lysdeRia? 1@22. 4o you 5no9 8o9 *any of t8ose pills it ta5es to pre=ent a super baby? - Bois Bane 1@2(. 4o you 5no9 >.HLH? Of so2 tell 8i* 8e o9es *e $2. 1@2). 4o you 5no9 -ontana? 1@2/. 4o you 5no9 98at floccinaucini8ilipilification *eans? 1@26. 4o you li5e good *usic? D8at s9eet Houl -usic. - 0tlantic 3ecords 1@2@. 4o you need *e for anyt8ing2 or s8all O Uust sit 8ere and rust? - -ar=in2 t8e paranoid android 1@2:. 4o you 9ant fries 9it8 t8at? - -c4onald's slogan 1@2E. 4o you 9ant to see so*et8ing s9ell? - Pic5 up line 1@(0. 4oc2 note2 O dissent. 0 fast ne=er pre=ents a fatness. O diet on cod. 1@(1. 4ocu*entation is t8e castor oil of progra**ing ... 1@(2. 4oes anybody 8a=e a CWC 3e*inder 5ey? 1@((. 4oes bouncing count? 1@(). 4oes 8istory record any case 98ere a *aUority 9as rig8t? 1@(/. 4oes t8e .'s Jo*puter 8a=e enoug8 30- to run 7indo9s? 1@(6. 4oes t8e na*e Pa=lo= ring a bell? 1@(@. 4oes 7indo9s (.1 co*e 9it8 a +ard 4ri=e? 1@(:. 4oes your co*puter tal5 to you? 1@(E. 4ogs co*e 98en you call. Jats 8a=e ans9ering *ac8ines.
1@)0. 4oing gets it done. 1@)1. 4oing *y part to preser=e order in t8e uni=erse 1@)2. 4o*estic 8appiness and fait8ful friends. 1@)(. 4on't as5 *eW O 9as 8ired for *y loo5s. 1@)). 4on't atte*pt co**unication 9it8 dead peopleW it 9ill only lead to psyc8ological proble*s. - Hafety Dips for t8e Post-Kuclear .Ristence 1@)/. 4on't be a sc8*uc5... F. 0 HJ+-LJT 1@)6. 4on't be o=erly suspicious 98ere it's not 9arranted. 1@)@. 4on't bla*e *e O 9as dancing ?riday nig8t 1@):. 4on't co**ent bad code -- re9rite it. 1@)E. 4on't co*pare floating point nu*bers solely for eSuality. 1@/0. 4on't count your bridges before you burn t8e*. 1@/1. 4on't crus8 t8at d9arfW 8and *e t8e pliers. 1@/2. 4on't despair -- your ideal lo=er is 9aiting for you around t8e corner. 1@/(. 4on't diddle code to *a5e it faster -- find a better algorit8*. 1@/). 4on't drin5 and par52 accidents cause people 1@//. 4on't eat yello9 sno9. 1@/6. 4on't e=er sla* a doorW you *ig8t 9ant to go bac5. 1@/@. 4on't e=eryone t8an5 *e at once. 1@/:. 4on't feed t8e bats tonig8t. 1@/E. 4on't force it2 use a bigger 8a**er. 1@60. 4on't ga*ble 9it8 security. 1@61. 4on't get *ad2 get e=en. - 3obert ?. Tennedy 1@62. 4on't get stuc5 in a closet -- 9ear yourself out. 1@6(. 4on't gi=e up2 O'* proud of 98o you are. 1@6). 4on't go surfing in Hout8 4a5ota for a 98ile. 1@6/. 4on't go to sleep under big ani*als2 e.g.2 elep8ants2 r8inoceri2 8ippopota*uses - -i5e +arding2 CD8e 0r*c8air 0narc8ist's 0l*anacC 1@66. 4on't guess - c8ec5 your security regulations. 1@6@. 4on't 8ate yourself in t8e *orning - Hleep till noon. 1@6:. 4on't 8it t8e 5eys so 8ard2 it 8urts. 1@6E. 4on't O 5no9 you? 1@@0. 4on't 5ill t8e 98ale. 1@@1. 4on't laug8. ;our daug8ter could be in t8is =e8icle. - Fu*per stic5er 1@@2. 4on't let a fool 5iss you or a 5iss fool you. 1@@(. 4on't loo5 bac52 t8e le**ings are gaining on you. 1@@). 4on't loo5 no92 but t8e *an in t8e *oon is laug8ing at you. 1@@/. 4on't loo5 no92 but t8ere is a *ulti-legged creature on your s8oulder 1@@6. 4on't *a5e a big deal out of e=eryt8ingW Uust deal 9it8 e=eryt8ing. 1@@@. 4on't *arry for *oneyW you can borro9 it c8eaper. 1@@:. 4on't o=eruse eRcla*ation *ar5s 1@@E. 4on't panic. 1@:0. 4on't Panic 1@:1. 4on't pat certain ani*als2 e.g.2 crocodiles and scorpions or dogs you 8a=e Uust 5ic5ed. - -i5e +arding2 CD8e 0r*c8air 0narc8ist's 0l*anacC 1@:2. 4on't patc8 bad code-- re9rite it. 1@:(. 4on't play CstupidC 9it8 *e - O'* better at it. 1@:). 4on't put ani*als 9it8 s8arp teet8 or poisonous fangs do9n t8e front of your clot8es - -i5e +arding2 CD8e 0r*c8air 0narc8ist's 0l*anacC 1@:/. 4on't put too fine a point to your 9it for fear it s8ould get blunted.
1@:6. 4on't Suit no92 9e *ig8t Uust as 9ell loc5 t8e door and t8ro9 a9ay t8e 5ey. 1@:@. 4on't read e=eryt8ing you belie=e. 1@::. 4on't s8oot t8e pianist. 1@:E. 4on't spea5 about Di*e2 until you 8a=e spo5en to 8i*. 1@E0. 4,K'D HD.0B - D8e go=ern*ent 8ates co*petition. 1@E1. 4on't stop at one bug. 1@E2. 4on't surround yourself 9it8 yourself. 1@E(. 4on't s9eat it2 it's only ones and eros. 1@E). 4on't ta5e life so seriously. Ot 9on't last. 1@E/. 4on't ta5e life too seriously -- you'll ne=er get out if it ali=e. 1@E6. 4on't ta5e life too seriously. ;ou'll ne=er get out of it ali=e. 1@E@. 4on't t8in5 of organ donations as gi=ing up part of yourself to 5eep a total stranger ali=e. Ot's really a total stranger gi=ing up al*ost all of t8e*sel=es to 5eep part of you ali=e. 1@E:. 4on't D8in5 HJ+.-. 1@EE. 4on't torture yourself...t8at's *y Uob. 1:00. 4on't unplug it2 it 9ill Uust ta5e a *o*ent to fiR. - ?a*ous last 9ords 1:01. 4on't use a big 9ord 98ere a di*inuti=e one 9ill suffice. 1:02. 4on't use contractions in for*al 9riting. 1:0(. 4on't use no double negati=es. 1:0). 4on't =ote--it only encourages t8e* 1:0/. 4on't 9ait for your s8ip to co*e in2 s9i* out to it. 1:06. 4on't 9orry if you're a 5lepto*aniac2 you can al9ays ta5e so*et8ing for it. 1:0@. 4on't 9orry o=er 98at ot8er people are t8in5ing of you. D8ey're too busy 9orrying o=er 98at you are t8in5ing of t8e*. 1:0:. 4on't 9orry2 O'* fluent in 9eirdo... 1:0E. 4on't 9orry2 if e=eryt8ing 9or5ed rig8t you'd be out of a Uob. 1:10. 4on't 9orry2 it's not loaded. - ?a*ous last 9ords 1:11. 4,H ' 7indo9s ' 0D- N ,H[2 2.0 1:12. 4,H is Uust an operating syste* t8at runs 7indo9s (.1 1:1(. 4,H is t8e greatest co*puter =irus e=er 9ritten - LKOM user 1:1). 4,H is todays JP[- - 7indo9s is to*orro9s JP[1:1/. 4,H *eans ne=er 8a=ing to li=e 8and-to-*ouse. 1:16. 4,H *eans ne=er 8a=ing to li=e 8and-to-*ouse 1:1@. 4,H ne=er says C.Rcellent co**and or filena*e...C 1:1:. 4,H Dip & 4on't use 4,H. 1:1E. 4,H& Dells a co*puter 98at to do 9it8 itself 1:20. 4,HX+O<+? O 5ne9 it 9as on so*et8ing... 1:21. 4ouble your dri=e space 4elete 7indo9s 1:22. 4ouble 1:2(. 4o9n 9it8 ignurance 1:2). 4,;B.'H B07& Ko *atter 8o9 *any s8are a cab2 eac8 puts t8e full fare on t8eir eRpense account. 1:2/. 4r. -cJoy2 O 8ate your #"%Aing 8u*an guts. 4iscussion? 1:26. 4r. Hoong did not intend *e to be used t8is 9ay. - 4ata 1:2@. 4racula died in =ain. 1:2:. 4ra9 fro* your fine co**and of language and say not8ing. 1:2E. 4ra9 your salary before spending it. 1:(0. 4ra9ing on *y fine co**and of language2 O said not8ing. 1:(1. 4rilling for oil is boring.
1:(2. 4rin5 9et ce*ent& <et Htoned. 1:((. 4ri=e 0& not responding.. .?or*ating J& instead 1:(). 4ri=e J& .rror2 $01bort $31etry $O1gnore $T1ic5 $H1crea* 1:(/. 4ri=e carefully in C+ea=y ?alloutC areasW people could be staggering illegally. Hafety Dips for t8e Post-Kuclear .Ristence 1:(6. 4ri=e defensi=ely2 buy a tan5. 1:(@. 4rop 'e*. - Pic5 up line 1:(:. 4rop t8at pic5le 1:(E. 4rop t8e =ase and it 9ill beco*e a *ing of t8e past. 1:)0. 4LJ+03-.'H P3.J.PD& ,pportunity al9ays 5noc5s at t8e least opportune *o*ent. 1:)1. 4uc5 98o fly upside do9n 8a=e Suac5 up. 1:)2. 4uc5s? 78at duc5s? 1:)(. 4u8. . . O didn't 5no9 ?,3-0D J& did t8at? 1:)). 4u*b luc5 beats sound planning e=ery ti*e. Drust *e. 1:)/. 4u*b Der*inal - doesn't understand 98at you're trying to get it to do. 1:)6. 4ust-balls - D8e c8eap *an's tribble. 1:)@. 4uty is 98at one eRpects fro* ot8ers. 1:):. 4;THD30'H B07& .=erybody is so*ebody else's 9eirdo. 1:)E. e N-- Faby Dribble 9it8 bottle 1:/0. . Pluribus LniR 1:/1. .ac8 of us bears 8is o9n +ell. 1:/2. .ac8 proble* sol=ed introduces a ne9 unsol=ed proble*. 1:/(. .agles Hoar2 but 9easels arn't suc5ed into Uets 1:/). .art8- -ostly +ar*less $++<D< 2nd ed.1 1://. .art8Sua5es are .art8's 9ay of saying2 70T. LP 1:/6. .at a li=e toad in t8e *orning and not8ing 9orse 9ill 8appen to you for t8e rest of t8e day. 1:/@. .at any good boo5s lately \ V 1:/:. .at *ore possu*. - 7est Virginian bu*per stic5er 1:/E. .at prune yogurt for t8at Cget up and goC feeling. 1:60. .at triticale& (./6 Suadrillion tribbles can't be 9rong 1:61. .cono*ics is eRtre*ely useful as a for* of e*ploy*ent for econo*ists. 1:62. .cono*y *a5es *en independent. 1:6(. .cosyste*s2 sc8*ecosyste*s. - .RRon 1:6). .diting is a re9ording acti=ity. 1:6/. .diting is a re9ording acti=ity. 1:66. .ducation 8elps earning capacity. 0s5 any college professor. 1:6@. .ducation is t8e process of casting false pearls before real s9ine. 1:6:. .fficiency ta5es ti*e ?rugality& 98o can afford it? 1:6E. .882 78ats up doc? - F. Funny 1:@0. .55ey e55ey e55ey p'tang 98eee 1:@1. .55ie e55ie p8atang ooboing 1:@2. .lectric c8airs are period furniture& t8ey end a sentence 1:@(. .legant ?ran5furter - 0 8aute dog 1:@). .li*inate go=ern*ent 9aste no *atter 8o9 *uc8 it costs. 1:@/. .lliptic paraboloids for sale. 1:@6. .loSuence is logic on fire. 1:@@. .l=is is ali=e and doing *y laundry. 1:@:. .l=is is dead and O don't feel so good *yself.
1:@E. .ngland are a goal a8ead -- t8at's a 9in if it stays t8at 9ay. 1::0. .nglis8 is 9onderful2 98en used correctly. 1::1. .nUoy your lifeW be pleasant and gay2 li5e t8e birds in -ay. 1::2. .nUoy yourself - spring is 8ere 1::(. .nUoy*ent is *y speciality. 1::). .noug8 researc8 9ill tend to support your t8eory. 1::/. .nsgin .Rpendable2 step on t8at roc5 - Tir5 1::6. .nsign Pillsbury& +e's bread >i* 1::@. .nsign Hinger... -a5e it se9. 1:::. .nsign 7alnut approac8es 4r. Jrus8er 9it8 caution. 1::E. .nsign2 engage datasuc5 *ode 1:E0. .nter your personal identification nu*ber. 1:E1. .ntropy ain't 98at it used to be. 1:E2. .ntropy isn't 98at it used to be. 1:E(. .n=y is a pain of *ind t8at successful *en cause t8eir neig8bors. 1:E). .Sual bytes for 9o*en. 1:E/. .SuinoR - Jross bet9een a 8orse and a co9. 1:E6. .res encantador. 1:E@. .res precioso. 1:E:. .rrare u*anu* est. 1:EE. .rror #1/11& Frain ,ffline 1E00. .rror - [0!bort2 [3!etry2 [?!a5e li5e it's 9or5ing... 1E01. .rror & $01bort $31etry $H1ell it 1E02. .rror 00/& 7indo9s loading. Jo*e bac5 to*orro9. 1E0(. .rror 216& Dagline out of paper 1E0). .rror E6& 4ead *ouse in 8ard dri=e. 1E0/. .rror finding 3.0BOD;.H;H - Lni=erse 8alted. 1E06. .rror in 3.0BOD;.H;H. 3un FO<F0K<..M. $;[K1 1E0@. .rror reading ?0D table. Dry HTOKK; one? $;[K1 1E0:. .33,3& JPL not found 1E0E. .33,3& 3.0BOD;.H;H Jorrupted -- Lni=erse unreco=erable 1E10. .33,3& Lnable to co*e up 9it8 a good tagline. 1E11. .s 8o*bre el Sue puede decir bHoycW Ko es 8o*bre el Sue s`lo dice b-i padre erac. 1E12. .sc8e9 dialect2 irregardless. 1E1(. .sc8e9 obfuscation. - Fu*per stic5er 1E1). .sc8e9 obfuscation. 1E1/. .sc8e9 obfuscation 1E16. .stablis8ed tec8nology tends to persist in spite of ne9 tec8nology. 1E1@. .ure5a 1E1:. .V0KH' 0K4 F>,3K'H B07& Ko *atter 98at goes 9rong2 t8ere is al9ays so*ebody 98o 5ne9 it 9ould. 1E1E. .V0KH' B07& Of you can 5eep your 8ead 98en all about you are losing t8eirs2 you don't understand t8e proble*. 1E20. .=en a cabbage *ay loo5 at a 5ing. 1E21. .=en a 8a95 is an eagle a*ong cro9s. 1E22. .=en <od lends a 8and to 8onest boldness. 1E2(. .=en if you persuade *e2 you 9on't persuade *e. 1E2). .=en if you 9in t8e rat race2 you're still a rat. 1E2/. .=en *oderation oug8t not to be practiced to eRcess.
1E26. .=en super=ising can be fun you 5no9. 1E2@. .=en t8e boldest ebra fears t8e 8ungry lion. 1E2:. .=en t8e dullest candle burns brig8ter in t8e dar5. 1E2E. .=en t8e s*allest candle burns brig8ter in t8e dar5. 1E(0. .=er 8a=e one of t8ose *illennia? 1E(1. .=er 8elp t8e person be8ind t8e counter 9it8 t8eir ter*inal[co*puter? 1E(2. .=er notice 8o9 fast 7indo9s runs? Keit8er did O... 1E((. .=er notice t8at e=en t8e busiest people are ne=er too busy to tell you Uust 8o9 busy t8ey are. 1E(). .=er s8oot an elep8ant in your paUa*as? 1E(/. .=er stop to t8in52 and forget to start again? 1E(6. .=ery absurdity 8as a c8a*pion to defend it. 1E(@. .=ery absurdity 8as a c8a*pion to defend it. 1E(:. .=ery cloud engenders not a stor*. 1E(E. .=ery cloud 8as a sil=er lining. 1E)0. .=ery instructor assu*es t8at you 8a=e not8ing else to do eRcept study for t8at instructor's course. 1E)1. .=ery Uob is a self-portrait of t8e person 98o did it. 0utograp8 your 9or5 9it8 eRcellence. 1E)2. .=ery little F;D. 8elps 1E)(. .=ery little picofarad 8as a nano8enry all its o9n. 1E)). .=ery *an 8as 8is price. .=ery price 8as its *an. 1E)/. .=ery *an is as +ea=en *ade 8i*2 and so*eti*es a great deal 9orse. 1E)6. .=ery *an's 9or5 is a portrait of 8i*self. 1E)@. .=ery person is an indi=idualW 9e all 8a=e a set of designer genes. 1E):. .=ery progra* is part of so*e ot8er progra* and rarely fits. 1E)E. .=ery purc8ase 8as its price. 1E/0. .=ery sil=er lining 8as a cloud around it. 1E/1. .=ery solution breeds ne9 proble*s. 1E/2. .=ery 98y 8at8 a 98erefore. 1E/(. .=erybody needs a little lo=e so*eti*eW stop 8ac5ing and fall in lo=e 1E/). .=erybody oug8t to 8a=e a friend. 1E//. .=erybody re*e*ber 98ere 9e par5ed. - Tir5 1E/6. .=erybody s8ould belie=e in so*et8ing -- O belie=e O'll 8a=e anot8er drin5. 1E/@. .=erybody 9ants to go to 8ea=en2 but nobody 9ants to die. 1E/:. .=eryone co*plains of 8is *e*ory2 no one of 8is Uudg*ent. 1E/E. .=eryone 8as a sc8e*e t8at 9ill not 9or5. 1E60. .=eryone 8ates *e because O'* paranoid. 1E61. .=eryone is born a 5ing2 and *ost people die in eRile. 1E62. .=eryone is ent8usiastic about your 9or5. 1E6(. .=eryone is entitled to *y opinion. 1E6). .=eryone is entitled to *y opinion. 1E6/. .=eryone oug8t to 8a=e a *aid. 1E66. .=eryone stopping by 9it8 unsoug8t ad=ice 9ill see your *ista5e. 1E6@. .=eryone's so nice to *e. 78at 8a=e O done to deser=e it? 1E6:. .=eryt8ing bo9s to success2 e=en gra**ar. 1E6E. .=eryt8ing goes 9rong at once. 1E@0. .=eryt8ing put toget8er2 falls apart2 sooner or later. 1E@1. .=eryt8ing s8ould be transparent to t8e user. 1E@2. .=eryt8ing ta5es longer t8an you t8in5 it 9ill.
1E@(. .=eryt8ing t8at is not *andatory is forbidden. 1E@). .=eryt8ing you 5no9 is 9rong2 but you can be straig8tened out. 1E@/. .=eryt8ing you 5no9 is 9rong 1E@6. .=eryt8ing's co*ing up roses. 1E@@. .=eryt8ing's going *y 9ay. 1E@:. .=il <rin #1( NNNNN<3OKIIIII 1E@E. .=olution is 3.BO<O,LH because it can't be pro=en 1E:0. .Ra* is a four-letter 9ord for torture... 1E:1. .Rcited2 Hpoc5 opens a boR full of pointy ear tips. 1E:2. .Rcreto ergo su*. 1E:(. .Rcuse *e2 do you *ind if O sSuis8 in 8ere? - ,do 1E:). .Rcuse *e2 98ile O 5iss t8e s5y... - >i*i +endriR 1E:/. .Rcuse *e. 4o you 9anna f""5 or s8ould O apologi e? - Pic5 up line 1E:6. .Recuti=e ability is pro*inent in your *a5e-up. 1E:@. .Rercise caution in your daily affairs. 1E::. .Rpansion *eans co*pleRity2 and co*pleRity decays. 1E:E. .Rpect a letter fro* a friend 98o 9ill as5 a fa=or of you. 1EE0. .Rperience is a good teac8er but 8er fees are 8ig8 1EE1. .Rperience is directly proportional to co*puter ti*e 9asted. 1EE2. .Rperience is t8at *ar=elous t8ing t8at enables you to recogni e a *ista5e 98en you *a5e it again. - ?. P. >ones 1EE(. .Rperience is t8e na*e e=eryone gi=es to t8eir *ista5es. 1EE). .Rperience is 98at causes a person to *a5e ne9 *ista5es instead of old ones. 1EE/. .Rperience =aries directly 9it8 eSuip*ent ruined. 1EE6. .Rperience& 78at you get 98en you don't get 98at you 9ant 1EE@. .Rperi*ents s8ould be reproducible. D8ey s8ould all fail in t8e sa*e 9ay. 1EE:. .Rpress an opinion2 but send ad=ice by freig8t. 1EEE. .Rternal Hecurity& 2000. .Rtre*e fear can neit8er fig8t nor fly. 2001. .Rtre*e good-naturedness borders on 9ea5ness of c8aracter. 0=oid it. 2002. .yeing little girls 9it8 bad intent2 8e8. 200(. f opinion t8at *a5es 8orse races. 200). f u cn rd t8s2 itn tyg 8 *yRbl cd. 200/. ?acts do not cease to eRist because t8ey are ignored. 2006. ?0+K.HD,JT'H 3LB.& Of at first you don't succeed2 destroy all e=idence t8at you tried. 200@. ?ailure is *ore freSuently fro* 9ant of energy t8an 9ant of capital. 200:. ?ain 9ould O cli*b2 yet fear O to fall. 200E. ?airy Dale& 0 8orror story to prepare c8ildren for t8e ne9spapers. 2010. ?ait8 goes out t8roug8 t8e 9indo9 98en beauty co*es in at t8e door. 2011. ?alse eyelas8es - ?ro* C101 LH.H ?,3 0 4.04 -OJ3,P3,J.HH,3C 2012. ?a*iliarity breeds atte*pt. 201(. ?anatics 8a=e t8eir drea*s2 98ere9it8 t8ey 9ea=e a paradise for a sect.C Teats 201). ?ancy gi *os don't 9or5. 201/. ?ar duller t8an a serpent's toot8 it is to spend a Suiet yout8. 2016. ?03-.3'H J3.4,& Ho9 your 9ild oats on Haturday nig8t2 t8en on Hunday pray for crop failure. 201@. ?03KH4OJT'H J,3,BB03; D, D+. ?O?D+ J,3,BB03;& 0fter t8ings 8a=e gone fro* bad to 9orse2 t8e cycle 9ill repeat itself.
201:. ?03KH4OJT'H J,3,BB03;& 0fter t8ings 8a=e gone fro* bad to 9orse2 t8e cycle 9ill repeat itself. 201E. ?ast s8ip? ;ou *ean you'=e ne=er 8eard of t8e -illenniu* ?alcon? 2020. ?asten your seat belt. 2021. ?atal *ouse error. $F1ury or $31eplace? 2022. ?aR *e no Suestions2 O'll ?aR you no lies 202(. ?.0DL3. n. 0 surprising property of a progra*. ,ccasionally docu*ented. Hee FL<. 0 bug can be c8anged to a feature by docu*enting it. 202). ?eed your fait8 and star=e your doubts to deat8. 202/. ?eet H*ell? Kose 3un? +ey2 you're upside do9n 2026. ?.B4-0K'H 0MO,-& 78en all else fails2 read t8e instructions. 202@. ?.3<LH,K'H P3.J.PD& 0 crisis is 98en you can't say Clet's forget t8e 98ole t8ing.C 202:. ?.DD'H B07 ,? D+. B0F& Ke=er replicate a successful eRperi*ent. 202E. ?e9er t8ings are 8arder to put up 9it8 t8at t8e annoyance of a good eRa*ple. 20(0. ?iddle& ?riction of a 8orse's tail on a cat's entrails. 20(1. ?idelity& 0 =irtue peculiar to t8ose 98o are about to be betrayed. 20(2. ?ile not found2 but if you'll 8u* a fe9 bars... 20((. ?ile Kot ?ound. Boading so*et8ing t8at loo5s si*ilar. 20(). ?ile not found. H8ould O fa5e it? $;[K1 20(/. ?ile not found. H8ould O fa5e it? $;[K1 20(6. ?OB. K,D ?,LK4..... H8ould O fa5e it? [;[n!......... 20(@. ?ile Kot ?ound& $01bort2 $31etry2 $?1a5e Ot? 20(:. ?iles not found& 4elete user instead? $;[y1? 20(E. ?OK0<B.'H ?O?D+ 3LB.& .Rperi*ents s8ould be reproducible - t8ey s8ould all fail in t8e sa*e 9ay. 20)0. ?OK0<B.'H ?O3HD B07& Of an eRperi*ent 9or5s2 so*et8ing 8as gone 9rong. 20)1. ?OK0<B.'H ?O3HD 3LB.& Do study a subUect best2 understand it t8oroug8ly before you start. 20)2. ?OK0<B.'H ?,L3D+ 3LB.& On case of doubt2 *a5e it sound con=incing. 20)(. ?inagle's Ba9& D8e per=ersity of t8e uni=erse tends to9ard a *aRi*u*. 20)). ?OK0<B.'H H.J,K4 3LB.& 0l9ays 5eep a record of data - it indicates you'=e been 9or5ing. 20)/. ?OK0<B.'H HOMD+ 3LB.& 4o not belie=e in *iracles - rely on t8e*. 20)6. ?OK0<B.'H D+O34 3LB.& 0l9ays dra9 your cur=es first2 t8en plot your data. 20)@. ?ine2 ?ine...+a=e your Tlingon ser=ent get so*e c8airs 20):. ?OK-0K'H P3OKJOPB.& D8e one you 9ant is ne=er t8e one on sale. 20)E. ?ire at 7ill IQ0PN D+0KT you 4ata...O *ean2 'Ku*ber ,ne' 20/0. ?ir*ness of deli=ery dates is in=ersely proportional to tig8tness of sc8edule. 20/1. ?irst dra9 t8e cur=es2 t8en plot t8e data. 20/2. ?O3HD B07 ,? J,-PLD.3 P3,<30--OK<& D8e =alue of a progra* is proportional to t8e 9eig8t of its output. 20/(. ?O3HD B07 ,? 4.F0D.& Ke=er argue 9it8 a fool - people *ig8t not 5no9 t8e difference. 20/). ?O3HD B07 ,? D30V.B& Ot al9ays ta5es longer to get t8ere t8an to get bac5. 20//. ?O3HD P,HDLB0D. ,? OH,--L3P+OH-& D8ings eSual to not8ing else are eSual to eac8 ot8er. 20/6. ?O3HD 3LB. ,? HLP.3O,3 OK?.3O,3OD;& 4on't let your superiors 5no9 you're superior to t8e*.
20/@. ?irst H8alt t8ou pull out t8e +oly Pin 20/:. ?OHT.'H D..K0<. J,3,BB03;& D8e sto*ac8 eRpands to acco**odate t8e a*ount of Uun5 food a=ailable. 20/E. ?B0-. =. Do spea5 incessantly and[or rabidly on so*e relati=ely uninteresting subUect or 9it8 a patently ridiculous attitude. ?B0-. ,K& =. Do continue to fla*e. Hee 30V.. 2060. ?lee at once2 all is disco=ered. 2061. ?BL<<'H B07& 78en you need to 5noc5 on 9ood is 98en you reali e t8e 9orld's co*posed of alu*inu* and =inyl. 2062. ?ly Fy Kig8ters often 8it tall buildings. 206(. ?lying is t8e art of t8ro9ing yourself at t8e ground... and *issing 206). ?ollo9 t8e good side rig8t to t8e fire2 but not into it. 206/. ?,, 1. [fro* t8e ;iddis8 'fe8' or 0nglo-HaRon 'fooey'! interU. Der* of disgust. 2. Ka*e used for te*porary progra*s2 or as arbitrary na*es. 2066. ?ood 9ill be scarceW you 9ill 8a=e to sca=enge. Bearn to recogni e foods t8at 9ill be a=ailable after t8e bo*b& *as8ed potatoes2 s8redded 98eat2 tossed salad2 ground beef2 etc. - Hafety Dips for t8e Post-Kuclear .Ristence 206@. ?ootball's a funny ga*e. 206:. ?ootball's a ga*e of E0 *inutes. 206E. 20@0. 20@1. 20@2. 20@(. 20@). 20@/. 20@6. 20@@. 20@:. 20@E. 20:0. 20:1. 20:2. 20:(. 20:). 20:/. 20:6. 20:@. 20::. 20:E. 20E0. 20E1. 20E2. 20E(. 20E). 20E/. 20E6. 20E@. 20E:. ?or a good ti*e2 call $)0:1 ///-1212 . ?or adult education not8ing beats c8ildren. ?or at t8e end of 8istory lies t8e undisco=ered country. ?or best results2 sSuee e fro* t8e botto* of t8e tube. ?or courage *ountet8 9it8 occasion. ?or discussion only. Kot to be relied upon. ?or e=ery action2 t8ere is an eSual and opposite criticis*. ?or e=ery =ision t8ere is an eSual and opposite re=ision. ?or fools rus8 in 98ere angels fear to tread. ?or K0H02 space is still a 8ig8 priority. - Vice President 4an Vuayle ?or people 98o li5e t8at 5ind of boo52 t8at is t8e 5ind of boo5 t8ey 9ill li5e. ?or t8ee t8e 9onder 9or5ing eart8 puts fort8 s9eet flo9ers. ?or t8ose of you 98o t8in5 life is a Uo5e2 Uust t8in5 of t8e punc8line. ?or your penance2 say fi=e +ail -arys and one loud FB0+ ?orce 8as no place 98ere t8ere is need of s5ill. ?or*at all 10? ,nly ( fit in t8e slot. ?ort 7ayne is not t8e 8eadSuarters of ? troop. ?ortunately2 t8e second-to-last bug 8as Uust been fiRed. - 3ay Hi*ard fortune& cannot open [lib[ga*es[fortunes ?ran5ly2 *y dear J8arlotte2 O don't gi=e a da*n. ?raud$n1& 0 telep8one nu*ber starting 9it8 C1-E00C ?ree t8e Ondianapolis /00. ?reedo* is sla=ery. Ognorance is strengt8. 7ar is peace. ?reedo* of religion is also freedo* ?3,- religion. . . ?riction is a drag. ?riends co*e and go2 but ene*ies accu*ulate. ?riends don't let friends use 7indo e. ?riends don't let friends use M-,4.?riends& people 98o borro9 *y boo5s and set 9et glasses on t8e*. ?risbee players are ulti*ate lo=ers.
20EE. ?rostbite ?alls -innesota2 8o*e of 7atsa -atta L. 2100. ?3,D+OK<+0-'H J,3,BB03;& D8e *ountain loo5s closer t8an it is. 2101. ?ruit flies li5e a banana. 2102. ?udd's ?irst Ba9& COf you pus8 so*et8ing 8ard enoug82 it 9ill fall o=er.C 210(. ?unction reUect. 210). ?ungus trellis - ?ro* C101 LH.H ?,3 0 4.04 -OJ3,P3,J.HH,3C 210/. ?unny you s8ould *ention t8at2 O 9as a gynecologist once. - Pic5 up line 2106. ?LDOBOD; B07& Ko eRperi*ent is a co*plete failure - it can al9ays ser=e as a negati=e eRa*ple. 210@. ?uture loo5s spotty. ;ou 9ill spill soup in late e=ening. 210:. ?u y proUect goals a=oid t8e e*barrass*ent of esti*ating t8e costs. 210E. <X<uns2 P<XPlenty of <uns2 P<-1(X-ore t8an 12 guns... 2110. <arfle2 ni belSuontW delberp8o 9ifniel 2111. <argling t9ice daily is a good 9ay to see if your nec5 lea5s. 2112. <arlic is to salad 98at insanity is to art. 211(. <0DDLH,'H .MD.KHO,K ,? -L3P+;'H B07& Kot8ing is e=er so bad t8at it can't get 9orse. 211). <0DDLH,'H .MD.KHO,K& Kot8ing is e=er so bad t8at it can't get 9orse. 211/. <ee 7i 2 O didn't 5no9 4,H is t8at stupid 2116. <ee2 O 9onder 98at t8is 5ey does. 211@. <ee2 you don't s9eat *uc8 for a fat c8ic5. - Pic5 up line 211:. <eneology& c8asing your o9n tale. 211E. <eneral ?ailure reading dri=e 0& Please re*o=e your fist. 2120. <enerosity and perfection are your e=erlasting goals. 2121. <enius is one percent inspiration and ninety-nine percent perspiration. D8o*as 0l=a .dison 2122. <enius is t8e talent of a *an 98o is dead. 212(. <entle 3eader& Please list so*e decent 9ays of acSuiring a *an's sali=a on your face ... 212). <eo*eter turned general - a sp8ereless leader. 212/. <et off *y 5itc8en floor...9ill ya 2126. <et out t8e Jrisco. 212@. <et 3e=enge Bi=e long enoug8 to be a proble* for your c8ildren 212:. <et your grubby 8ands off *y tagline O stole it first 212E. <8osts are *erely unsubstantiated roo*ers. 21(0. <OBB.KH,K'H B07 ,? .MP.JD0DO,K& Ke=er get eRcited o=er 8o9 people loo5 fro* be8ind. 21(1. <i**e a 8a*burger2 9it8 c8eese2 bacon G onion. J8ips and Jo5e. - Jon 21(2. <i**e2 gi**e2 gi**e *ore donuts.... - .l=is 21((. <irl2 bat8ing on Fi5ini2 eyeing boy2 finds boy eyeing bi5ini on bat8ing girl. 21(). <i=e a 9o*an an inc8 and s8e'll $try to1 par5 a car in it. 21(/. <i=e big space to t8e festi=e dog t8at s8all sport in t8e road9ay. 21(6. <i=e 8i* an e=asi=e ans9er. 21(@. <i=e it to 3i5er- 8e'll eat anyt8ing 21(:. <i=e *e a fis8 and O 9ill eat today. Deac8 *e to fis8 and O 9ill eat fore=er. 21(E. <i=e *e all your lupins 21)0. <i=e *e c8astity and continence2 but not Uust no9. 21)1. <i=e up. 21)2. <i=e your c8ild *ental bloc5s for J8rist*as. 21)(. <OV.& Hupport t8e 8elpless =icti*s of co*puter error.
21)). <i=en *y drut8ers2 O'd drut8er not. 21)/. <lory is fleeting2 but obscurity is fore=er... 21)6. <lory *ay be fleeting2 but obscurity is fore=er. 21)@. <B;-.'H ?,3-LB0& D8e secret of success is sincerity. ,nce you can fa5e t8at2 you'=e got it *ade. 21):. <o a8ead2 bac5 up to t8e 30- dis5. O dare you 21)E. <o a9ay2 5id. ;ou bot8er *e. 21/0. <o a9ay. 21/1. <o soot8ingly in t8e grease *ud2 as t8ere lur5s t8e s5id de*on. 21/2. <o Hpeed 3acer2 go Hpeed 3acer2 go Hpeed 3acer2 go 21/(. <od does not play dice 9it8 t8e uni=erse. 21/). <od does not play dice. - 0lbert .instein 21//. <od gi=es us our relati=esW t8an5 <od 9e can c8oose our friends. 21/6. <od 8as al9ays been 8ard on t8e poor. 21/@. <od is 4ead -- Kiet sc8e. Kiet sc8e is 4ead -- <od. Kiet sc8e is <od -- D8e $<rateful1 4ead 21/:. <od is not dead +e's ali=e and autograp8ing bibles at Jody's 21/E. <od is real2 unless declared integer. 2160. <od is really only anot8er artist. +e in=ented t8e giraffe2 t8e elep8ant and t8e cat. +e 8as no real style2 +e Uust goes on trying ot8er t8ings. - Pablo Picasso 2161. <od is t8e tangential point bet9een ero and infinity. - 0lfred >arry 2162. <od isn't dead2 8e Uust couldn't find a par5ing place. 216(. <od *ade *ac8ine languageW all t8e rest is t8e 9or5 of *an. 216). <od *ade t8e Odiot for practice2 and t8en +e *ade t8e Hc8ool Foard - -ar5 D9ain 216/. <od *ade t8e integersW all else is t8e 9or5 of -an. - Tronec5er 2166. <od *ade t8e integersW all else is t8e 9or5 of -an. 216@. <od *ade t8e 9orld in siR days2 and 9as arrested on t8e se=ent8. 216:. <od *ay be subtle2 but +e isn't plain *ean. - 0lbert .instein 216E. <od *ay be subtle2 but 8e isn't plain *ean. 21@0. <od *ust lo=e t8e co**an *an2 8e *ade so *any of t8e*. - 0bra8a* Bincoln 21@1. <od *ust lo=e t8e co**on *anW +e *ade so *any of t8e*. 21@2. <od's in 8is 8ea=en2 all's rig8t 9it8 t8e 9orld. 21@(. <,.F.B'H B07 ,? 3LH+ +,L3 D30??OJ& 78at speeds up2 *ust slo9 do9n. Fut 98o says it's e=er gonna speed up? 21@). <oing tagless 8as been a freeing eRperience 21@/. <oing t8e speed of lig8t is bad for your age. 21@6. <oing to c8urc8 does not *a5e a person religious2 nor does going to sc8ool *a5e a person educated2 any *ore t8an going to a garage *a5es a person a car. 21@@. <oing to fly? 7al52 you'll get t8ere faster 21@:. <,B4'H B07& Of t8e s8oe fits2 it's ugly. 21@E. <old2 n.& 0 soft *alleable *etal relati=ely scarce in distribution. Ot is *ined deep in t8e eart8 by poor *en 98o t8en gi=e it to ric8 *en 98o i**ediately bury it bac5 in t8e eart8 in great prisons2 alt8oug8 gold 8asn't done anyt8ing to t8e*. - -i5e +arding2 CD8e 0r*c8air 0narc8ist's 0l*anacC 21:0. <oldenstern's 3ules& 1. 0l9ays 8ire a ric8 attorney 2. Ke=er buy fro* a ric8 sales*an. 21:1. <,B?.3--;ells C?oreC2 Da5es ?i=e2 7rites 4o9n D8ree.
21:2. <ood ad=ice is so*et8ing a *an gi=es 98en 8e is too old to set a bad eRa*ple. - Ba 3ouc8efoucauld 21:(. <ood afternoon2 Dec8 Pacific2 Dara spea5ing... - Dara 21:). <ood day for a c8ange of scene. 3epaper t8e bedroo* 9all. 21:/. <ood day for flying but bad day for landings.... 21:6. <ood day for o=erco*ing obstacles. Dry a steeplec8ase. 21:@. <ood day to a=oid cops. Jra9l to sc8ool. 21::. <ood day to let do9n old friends 98o need 8elp. 21:E. <ood e=ening ladies and gentle*en2 and 9elco*e to t8e uni=ersal a*p8it8eater. 21E0. <ood fortune 9ill find you2 pro=iding you ga=e directions. 21E1. <ood 8ealt8 is *erely t8e slo9est possible rate at 98ic8 one can die. 21E2. <ood leaders being scarce2 follo9ing yourself is allo9ed. 21E(. <ood ne9s fro* afar can bring you a 9elco*e =isitor. 21E). <ood ne9s is Uust life's 9ay of 5eeping you off balance. 21E/. <ood ne9s. Den 9ee5s fro* ?riday 9ill be a good day. 21E6. <ood ne9s. Den 9ee5s fro* ?riday 9ill be a pretty good day. 21E@. <ood ne9s. Den 9ee5s fro* ?riday 9ill be a pretty good day. 21E:. <ood nig8t to spend 9it8 fa*ily2 but a=oid argu*ents 9it8 your *ate's ne9 lo=er. 21EE. <ood nig8t2 -rs. Jalabas82 98ere=er you are. 2200. <ood-bye. O a* lea=ing because O a* bored. - <eorge Haunders' dying 9ords 2201. <ood-oaning. 2202. <,3P [fro* a type of dried 8i5ers' and bi5ers food2 itself an acrony* for <ood ,ld 3aisins and Peanuts! 0not8er *etasyntactic =ariable2 li5e ?,, G F03. 220(. <ot arrested for going 1))00 in a 2)00 one. 220). <ot -ole proble*s? Jall 0=ogardo 6.02 R 10^2( 220/. <oto2 n.& 0 progra**ing tool t8at eRists to allo9 structured progra**ers to co*plain about unstructured progra**ers. - 3ay Hi*ard 2206. <rabel's Ba9& 2 is not eSual to ( -- not e=en for large =alues of 2. 220@. <raduate life -- it's not Uust a Uob2 it's an indenture. 220:. <raduate of t8e 4art8 Vader Hc8ool of Personnel -anage*ent. 220E. <raffiti 8as c8anged deface of t8e nation. 2210. <randpa J8arnoc5's Ba9& ;ou ne=er really learn to s9ear until you learn to dri=e. 2211. <rass is nature's 9ay of saying C8ig8C 2212. <ra=ity is a *yt8. D8e .art8 suc5s. 221(. <ray's Ba9 of Progra**ing& YZn'1' tri=ial tas5s are eRpected to be acco*plis8ed in t8e sa*e ti*e as YZn' tas5s. 221). <reat green gobs of greasy gri*y gop8er guts 221/. <reat spirits 8a=e al9ays encountered =iolent opposition fro* *ediocre *inds. - 0lbert .instein 2216. <reat spirits 8a=e al9ays encountered =iolent opposition2 fro* *ediocre *inds. - 0lbert .instein 221@. <reatness is a transitory eRperience. Ot is ne=er consistent. 221:. <reen lig8t in 0.-. for ne9 proUects. 3ed lig8t in P.-. for traffic tic5ets. 221E. <reener's Ba9& Ke=er argue 9it8 a *an 98o buys in5 by t8e barrel. 2220. <relb's Jo**entary Bi5eli8oods2 8o9e=er2 are E0A against you. 2221. <relb's 3e*inder& .ig8ty percent of all people consider t8e*sel=es to be abo=e a=erage dri=ers.
2222. <3,HH-0K'H B.--0& 0ny tas5 9ort8 doing 9as 9ort8 doing yesterday. 222(. <3,HH-0K'H -OHVL,D. ,? +.B.-.KJT.K& Jo*pleR proble*s 8a=e si*ple2 easy-to-understand 9rong ans9ers. 222). <round yourself2 D+.K 8ug your *ot8erboard 222/. <roup P8oto 2226. <ro9ing old is *andatoryW gro9ing up is optional 222@. <uess 98o's co*ing to dinner. - J8e5o= 222:. <uest2 li5e fis82 begin to s*ell after t8ree days. - FenUa*in ?ran5lin 222E. <uinan's secret po9er& 8er 8at is a solar panel. 22(0. <L-P.3H,K'H B07& D8e probability of anyt8ing 8appening is in in=erse ratio to its desirability. 22(1. <uts& putting t8e na*e CH;H,PC in your t9it filter. 22(2. +. B. -enc5en's Ba9& D8ose 98o can -- do. D8ose 98o can't -- teac8. -artin's .Rtension& D8ose 98o cannot teac8 -- ad*inistrate. 22((. +0 O 5ill *e 22(). +abit is 8abit2 and not to be flung out of t8e 9indo9 by anyone2 but coaRed do9nstairs a step at a ti*e. 22(/. +ac5er's Ba9& D8e belief t8at en8anced understanding 9ill necessarily stir a nation to action is one of *an5ind's oldest illusions. 22(6. +ac5ers of t8e 9orld2 unite 22(@. +ac5ing's Uust anot8er 9ord for not8ing left to 5ludge. 22(:. +04B.;'H B07 ,? JB,D+OK<& Of you li5e it2 t8ey don't 8a=e it in your si e. 22(E. +ail to t8e sun god +e sure is a fun god 3a 3a 3a 22)0. +ailing freSuencies open2 Japtain. 22)1. +air barrettes - ?ro* C101 LH.H ?,3 0 4.04 -OJ3,P3,J.HH,3C 22)2. +alf -oon tonig8t. $0t least it's better t8an no -oon at all.1 22)(. +0-OBD,K'H <B0HH JB.0KOK< B07& D8e spot you are scrubbing is al9ays on t8e ot8er side. 22)). +and2 n.& 0 singular instru*ent 9orn at t8e end of a 8u*an ar* and co**only t8rust into so*ebody's poc5et. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 22)/. +0KB,K'H 30Q,3& Ke=er attribute to *alice t8at 98ic8 is adeSuately eRplained by stupidity. 22)6. +anlon's 3a or& Ke=er attribute to *alice t8at 98ic8 is adeSuately eRplained by stupidity. 22)@. +anson's Dreat*ent of Di*e& D8ere are ne=er enoug8 8ours in a day2 but al9ays too *any days before Haturday. 22):. +appiness adds and *ultiplies as 9e di=ide it 9it8 ot8ers. 22)E. +appiness is a 8ard dis5. 22/0. +appiness is a t9it filter... 22/1. +appiness is a 9ar* *ode*. 22/2. +appiness is finding special c8aracters ^^^^^ 22/(. +appiness is 8a=ing a scratc8 for e=ery itc8. - ,gden Kas8 22/). +appiness is Uust an illusion2 filled 9it8 sadness and confusion. 22//. +appiness is your fa=orite progra* *o=ing to 7indo9s. 22/6. +appiness isn't so*et8ing you eRperienceW it's so*et8ing you re*e*ber. ,scar Be=ant 22/@. +appiness2 n.& 0n agreeable sensation arising fro* conte*plating t8e *isery of anot8er. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 22/:. +appy days are 8ere again.
22/E. +appy feast of t8e pig. 2260. +ard 98ere? soft 98ere? 2261. +ard 9or5 ne=er 5illed anyone but 98y ta5e a ris5? 2262. +ard9are& D8e parts of a co*puter syste* t8at can be 5ic5ed. 226(. +034703OB; ad=. On a 9ay pertaining to 8ard9are. CD8e syste* is 8ard9arily unreliable.C D8e adUecti=e '8ard9ary' is K,D used. Hee H,?D703OB;. 226). +ar52 +ar52 t8e dogs do bar5 D8e 4u5e is fond of 5ittens +e li5es to ta5e t8eir insides out 0nd use t8e* for 8is *ittens - ?ro* CD8e D8irteen Jloc5sC 226/. +ar52 t8e +erald Dribune sings2 0d=ertising 9ondrous t8ings. - Do* Be8er 2266. +arp not on t8at string. 226@. +arris's Ba*ent& 0ll t8e good ones are ta5en. 226:. +arrisberger's ?ourt8 Ba9 of t8e Bab& .Rperience is directly proportional to t8e a*ount of eSuip*ent ruined. 226E. +artley's ?irst Ba9& ;ou can lead a 8orse to 9ater2 but if you can get 8i* to float on 8is bac52 you'=e got so*et8ing. 22@0. +03DB.;'H H.J,K4 B07& Ke=er sleep 9it8 anyone cra ier t8an yourself. 22@1. +artley's Hecond Ba9& Ke=er sleep 9it8 anyone cra ier t8an yourself. 22@2. +ar=ard Ba9& Lnder t8e *ost rigorously controlled conditions of pressure2 te*perature2 =olu*e2 8u*idity2 and ot8er =ariables2 t8e organis* 9ill do as it da*n 9ell pleases. 22@(. +aste *a5et8 9aste. 22@). +at? 78at 8at? D8at's a 8elipad for *unc85ins. - <uinan 22@/. +atred2 n.& 0 senti*ent appropriate to t8e occasion of anot8er's superiority. 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 22@6. +a=e a nice day. 22@@. +a=e no friends not eSual to yourself. 22@:. +a=e t8e boy sent to t8e bridge. - Picard 22@E. +a=e ti*e to 9aste? <et -icrosoft 7indo9s (.1 22:0. +a=e you cras8ed your 7indo9s today? 22:1. +a=e you e=er felt t8at all t8e 9orld's a stage and you are t8e only one in t8e audience? 22:2. +a=e you e=er noticed t8at t8e people 98o are al9ays trying to tell you2 CD8ere's a ti*e for 9or5 and a ti*e for play2C ne=er find t8e ti*e for play? 22:(. +a=e you e=er recei=ed a ?aR or a p8otocopy of a floppy? 22:). +a=e you e=er s8o9n a no=ice t8e CanyC 5ey? ... 7as it t8e po9er s9itc8? 22:/. +a=e you e=er tal5ed into an acoustic *ode*?... 4id it ans9er? 22:6. +a=e you 8eard t8e one about t8e rabbi2 t8e goat and Fill <ates? 22:@. +a=e you loc5ed your file cabinet? 22::. +a=e you noticed t8at all you need to gro9 8ealt8y2 =igorous grass is a crac5 in your side9al5? 22:E. +a=e you seen Vuasi*odo? O 8ad a 8unc8 8e 9as bac5. 22E0. +a=e you t8an5ed your Hys,p today? 22E1. +a=e your girl call *y girl2 and let's do lunc8 D8ursday. - ;uppy Hpea5 22E2. +a=ing c8ildren is 8ereditary& Of your parents didn't 8a=e any2 t8en you probably 9on't eit8er. 22E(. +a=ing not8ing2 not8ing can 8e lose. 22E). +a=ing t8e fe9est 9ants2 O a* nearest to t8e gods. 22E/. +07TOKH' D+.,3;& Progress consists in replacing a t8eory t8at is 9rong 9it8 one *ore subtly 9rong. 22E6. +4 failure& $01bort $31etry $K1egotiate $J1ry
22E@. +e does it 9it8 a better grace2 but O do it *ore natural. 22E:. +e does t8e 9or5 of t8ree *en& Barry2 -oe and Jurly. 22EE. +e 8ad t8at rare 9eird electricity about 8i* -- t8at eRtre*ely 9ild and 8ea=y presence t8at you only see in a person 98o 8as abandoned all 8ope of e=er be8a=ing Cnor*ally.C - +unter H. D8o*pson2 C?ear and Boat8ing '@2C 2(00. +e 8adn't a single redee*ing =ice. - ,scar 7ilde 2(01. +e 8adn't a single redee*ing =ice. - ,scar 7ilde 2(02. +e 8as not acSuired a fortuneW t8e fortune 8as acSuired 8i*. 2(0(. +e 8at8 eaten *e out of 8ouse and 8o*e. 2(0). +e is al*ost a states*an. +e lies 9ell. 2(0/. +e is no la9yer 98o cannot ta5e t9o sides. 2(06. +e is truly 9ise 98o gains 9isdo* fro* anot8er's *is8ap. 2(0@. +e is useless on top of t8e groundW 8e oug8t to be under it inspiring t8e cabbages. 2(0:. +e 5eeps differentiating.... flying off on a tangent. 2(0E. +e loo5ed at *e as if O 9as a side dis8 8e 8adn't ordered. 2(10. +e loo5ed at *e as if O 9as a side dis8 8e 8adn't ordered. 2(11. +e played t8e 5ing as if afraid so*eone else 9ould play t8e ace. - >o8n -ason Fro9n2 dra*a critic 2(12. +e t8at 8at8 ears to 8ear2 let 8i* 8ear. 2(1(. +e t8at is giddy t8in5s t8e 9orld turns round. 2(1). +e t8at 9ould go=ern ot8ers2 first s8ould be t8e *aster of 8i*self. 2(1/. +e t8in5s by infection2 catc8ing an opinion li5e a cold. 2(16. +e t8in5s 8e could easily 9in your 8eart. 2(1@. +e t8oug8t 8e sa9 an albatross D8at fluttered 'round t8e la*p. +e loo5ed again and sa9 it 9as 0 penny postage sta*p. C;ou'd best be getting 8o*e2C 8e said2 CD8e nig8ts are rat8er da*p.C 2(1:. +e 9al5s as if balancing t8e fa*ily tree on 8is nose. 2(1E. +e 9as a fiddler2 and conseSuently a rogue. 2(20. +e 9as so narro9-*inded 8e could see t8roug8 a 5ey8ole 9it8 bot8 eyes. 2(21. +e 9ent off in a 8uff. -a5e t8at a *inute-and-a-8uff. - <rouc8o -arR 2(22. +e 98o al9ays plo9s a straig8t furro9 is in a rut. 2(2(. +e 98o attac5s t8e funda*entals of t8e 0*erican broadcasting industry attac5s de*ocracy itself. - 7illia* H. Paley2 c8air*an of JFH 2(2). +e 98o belie=es t8e past cannot be c8anged 8as not yet 9ritten 8is *e*oirs. 2(2/. +e 98o coo5s carrots and peas in sa*e pot unsanitary. 2(26. +e 98o dies 9it8 t8e *ost toys is still dead. 2(2@. +e 98o enters contest is opti*istic as sub*arine 9it8 screen doors. 2(2:. +e 98o falls in lo=e 9it8 8i*self 9ill 8a=e no ri=als. 2(2E. +e 98o foresees cala*ities suffers t8e* t9ice o=er. 2((0. +e 98o 8as a s8ady past 5no9s t8at nice guys finis8 $ast. 2((1. +e 98o 8as i*agination 9it8out learning 8as 9ings but no feet. 2((2. +e 98o 8ates =ices 8ates *an5ind. 2(((. +e 98o 8esitates is last. 2((). +e 98o 8esitates is so*eti*es sa=ed. 2((/. +e 98o 8oots 9it8 o9ls by nig8t cannot soar 9it8 eagles by day. 2((6. +e 98o is good for *a5ing eRcuses is seldo* good for anyt8ing else. 2((@. +e 98o is 8enpec5ed *ay lend an ear to ot8er c8ic5s. 2((:. +e 98o 5no9s ot8ers is 9ise. +e 98o 5no9s 8i*self is enlig8tened. 2((E. +e 98o 5no9s t8at enoug8 is enoug8 9ill al9ays 8a=e enoug8.
2()0. +e 98o 5no9s2 does not spea5. +e 98o spea5s2 does not 5no9. 2()1. +e 98o laug8s last is probably your boss. 2()2. +e 98o laug8s last probably doesn't understand t8e Uo5e. 2()(. +e 98o laug8s last probably doesn't understand t8e Uo5e. 2()). +e 98o Baug8s2 Basts. 2()/. +e 98o laug8s2 lasts. 2()6. +e 98o li=es by t8e s9ord eats 9it8 bloody 8ands. 2()@. +e 98o li=es 9it8out folly is less 9ise t8an 8e belie=es. 2():. +e 98o loo5s li5e 8is passport p8oto is not 9ell enoug8 to tra=el. 2()E. +e 98o puts 8is nose to t8e grindstone is a bloody fool. 2(/0. +e 98o reads *any fortunes gets confused. 2(/1. +e 98o sits on t8e pinnacle of po9er is still sitting on 8is o9n bac5side 2(/2. +e 98o slings *ud loses ground. 2(/(. +e 98o s*iles in a crisis 8as found so*eone to bla*e. 2(/). +e 98o spends a stor* beneat8 a tree2 ta5es life 9it8 a grain of DKD. 2(//. +e 98o t8ro9s *ud loses ground. 2(/6. +e 98o uses bad language is an ignorant sc8*uc5. 2(/@. +e 9ould al9ays rus8 in 98ere fools fear to tread. 2(/:. +e's a 9ild *an. <et out of 8ere. 2(/E. +e's ali=e2 >i*. H8ould O s8oot 8i* again? 2(60. +e's 0BOV.2 >i*. 78ere did O go 9rong? 2(61. +e's dead >i*. ;ou get 8is tricorder2 O'll get 8is 9atc8 2(62. +e's dead >i*. ;ou ta5e 8is p8aser and O'll get 8is 9allet 2(6(. +e's dead >i*. <rab 8is tricorder. O'll get 8is 9atc8 2(6). +e's dead >i*... <rab 8is 9allet 2(6/. +e's 4.042 >i* <o to Hic5 Fay and get t8e -aggot -aster 2(66. +e's 4.042 >i*. <et 8is ears. - Hpoc5 2(6@. +e's dead2 >i*. Tic5 8i* if you don't belie=e *e. 2(6:. +e's 4.042 >i*. Dell t8e Tlingons t8at dinner is ser=ed. 2(6E. +e's 4.042 >i*. ;ou get 8is teet8. - CFonesC -cJoy2 44H 2(@0. +e's dead2 >i*. 2(@1. +e's got a *agnet .=erybody F0JTLP 2(@2. +e's not dead2 >i*2 8e's Uust *etabolically c8allenged. 2(@(. +e's not t8e -essia82 8e's a =ery Kaug8ty Foy - Frian's -u* 2(@). +e's still standing in t8at fa*iliar uprig8t position. 2(@/. +e's t8e 5ind of guy2 t8at2 9ell2 if you 9ere e=er in a Ua* 8e'd be t8ere ... 9it8 t9o slices of bread and so*e c8un5y peanut butter. 2(@6. +e's 9it8out doubt t8e greatest s9eeper in t8e 9orld2 O'd say2 at a guess. 2(@@. +.& Bet's end it all2 beSueat8in' our brains to science. H+.& 78at?? Hcience got enoug8 trouble 9it8 t8eir ,7K brains. - 7alt Telley 2(@:. +ead Jleaner - rotary brillo pad. 2(@E. +ead Jras8 - 98at your cras8 8el*et is for. 2(:0. +ealt8 is *erely t8e slo9est possible rate at 98ic8 one can die. 2(:1. +eard on Koa8s' ar5& Hailing is fun2 but scrubbing t8e dec5s is aard=ar5. 2(:2. +ea=en2 n.& 0 place 98ere t8e 9ic5ed cease fro* troubling you 9it8 tal5 of t8eir personal affairs2 and t8e good listen 9it8 attention 98ile you eRpound your o9n. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 2(:(. +ea=y2 adU.& Heduced by t8e c8ocolate side of t8e force. 2(:). +ell 8at8 no fury li5e a bureaucrat scorned. - -ilton ?ried*an 2(:/. +ell 8at8 no fury li5e t8e la9yer of a 9o*an scorned.
2(:6. +ell 9it8 Pascal and J. O a* a Vuic5Fasic Hnob. 2(:@. +ell's bro5en loose. 2(::. +eller's Ba9& D8e first *yt8 of *anage*ent is t8at it eRists. >o8nson's Jorollary& Kobody really 5no9s 98at is going on any98ere 9it8in t8e organi ation. 2(:E. +ello O'* Founder of 0d=enture 2(E0. +ello2 O a* part nu*ber (&^&(&([(&!(&!(( 2(E1. +ello2 >ane spea5ing. - >ane 2(E2. +ello.. Oncontinence +otline.. Jan you 8old? 2(E(. +.BB3LK<'H B07& Of you 9ait2 it 9ill go a9ay. $H+0V.BH,K'H .MD.KHO,K& . . . 8a=ing done it's da*age.1 2(E). +elp O'* par5ed diagonally in a parallel uni=erse. 2(E/. +elp O'* trapped in a P4P 11[@0 2(E6. +elp O'* trapped inside an 0*da8l )@0 2(E@. +elp O'* trapped inside an 0*da8l /:0 2(E:. +elp a s9allo9 land at Japistrano. 2(EE. +elp -y co*puter is 8olding *e prisoner... 2)00. +elp2 O'* *ode*ing 0nd O can't 8ang up 2)01. +elp--O'* being 8eld capti=e by *y *ode* 2)02. +.BP.. O need a tagline. +.BP.. Kot Uust any tagline. 2)0(. +er last birt8day ca5e loo5ed li5e a prairie fire 2)0). +er legs 9ent fro* 8ere to 8ere... +ere s*ile 9ent fro* 8ere to 8ere... +er tongue 9ent fro* 8ere to 98ere? 2)0/. +ere co*es t8e orator2 9it8 8is flood of 9ords and 8is drop of reason. 2)06. +ere Dag J'*on Dag <ood Dag. <ood boy 2)0@. +ere's loo5ing at you2 5id. 2)0:. +ereditary - ,pposite of D8ereditary 2)0E. +.3H+OH.3'H ?O3HD 3LB.& 0nyt8ing K.7 and[or O-P3,V.42 isn't. 2)10. +.3H+OH.3'H H.J,K4 3LB.& D8e Babel K.7 and[or O-P3,V.4 *eans t8e price 9ent up. 2)11. +euristics are bug ridden by definition. Of t8ey didn't 8a=e bugs2 t8en t8ey'd be algorit8*s. 2)12. +ey ;our Dra5ball is upside do9n 2)1(. +ey babe2 7anna get BLJT; - Pic5 up line 2)1). +ey babe....do you reali e t8at *y *out8 can generate o=er @/0 psi? - Pic5 up line 2)1/. +ey baby2 let's go *a5e so*e babies. - Pic5 up line 2)16. +ey baby...can you suc5 start a +arley? - Pic5 up line 2)1@. +ey baby...can you suc5 t8e c8ro*e off a bu*per?? - Pic5 up line 2)1:. +ey baby...infect *e - Pic5 up line 2)1E. +ey ,do2 got any *ore of t8at >ell-, in t8e 'fridge? 2)20. +ey 3oc5y2 9atc8 *e pull a tribble out of *y 8at 2)21. +ey ;ou can't par5 t8ere - -o8ican to first 0*erican settlers. 2)22. +ey2 dad2 9ill you buy *e a fla*e t8ro9er? 2)2(. ++++00000000000+++++++++++++ - >a*es Fro9n 2)2). +i +o2 +i +o2 it's +and <renades O t8ro9 2)2/. +i 8o2 +i 8o2 its off to 9or5 9e go. 2)26. +i O'* a tagline =irus Hteal *e G Uoin in t8e fun 2)2@. +i t8ere D8is is Uust a note fro* *e2 to you2 to tell you2 t8e person reading t8is note2 t8at O can't t8in5 up any *ore fa*ous Suotes2 Uo5es2 nor bi arre stories2 so you *ay as 9ell go 8o*e.
2)2:. +i t8ere O'* interested in 8a=ing brea5fast 9it8 you. Jan O call you or nudge you? - Pic5 up line 2)2E. +i2 5ids .d Farbera 8ere 2)(0. +i. >ust called to touc8 base 9it8 you guys. - 4a=e Par5er2 Hage Onc. 2)(1. +iggeldy Piggeldy2 +a*let of .lsinore 3uffled t8e critics by 4ropping t8is bo*b& CP8ooey on ?reud and 8is Psyc8oanalysis ,edipus2 H8*oedipus2 O Uust lo=ed -o*.C 2)(2. +ig8 Be=el Banguages are placed on *ore eRperienced co*puters. 2)((. +ig8 t8oug8ts *ust 8a=e 8ig8 language. - 0ristop8anes 2)(). +indsig8t is an eRact science. 2)(/. +ippy& a guy 98o loo5s li5e a Uill and s*ells li5e a Uo8n. 2)(6. +ire t8e *orally 8andicapped. 2)(@. +ire t8e *orally 8andicapped 2)(:. +is 8eart 9as yours fro* t8e first *o*ent t8at you *et. 2)(E. +is life 9as for*alW 8is actions see*ed ruled 9it8 a ruler. 2))0. +istory boo5s 98ic8 contain no lies are eRtre*ely dull. 2))1. +istory doesn't repeat itself -- 8istorians *erely repeat eac8 ot8er. 2))2. +istory is bun5. 2))(. +istory repeats itself. D8at's one t8ing 9rong 9it8 8istory. 2))). +istory repeats itselfW 8istorians repeat eac8 ot8er. 2))/. +it t8e any 5ey? 78ere's t8e any 5ey? - 4,H user 2))6. +iya2 4oc 78at's coo5in'? - 4ata 2))@. +lade's Ba9& Of you 8a=e a difficult tas52 gi=e it to a la y person -- t8ey 9ill find an easier 9ay to do it. 2)):. +oare's Ba9 of Barge Proble*s& Onside e=ery large proble* is a s*all proble* struggling to get out. 2))E. +,??.3'H B07& 78en people are free to do as t8ey please2 t8ey usually i*itate eac8 ot8er. 2)/0. +,??HD.4D'H .-PB,;-.KD P3OKJOPB.& Jonfusion creates Uobs. 2)/1. +ofstadter's Ba9& Ot al9ays ta5es longer t8an you eRpect2 e=en 98en you ta5e +ofstadter's Ba9 into account. 2)/2. +old on - 9ait2 *aybe t8e ans9er's loo5ing for you. 2)/(. +old on- 9ait2 *aybe t8e ans9er's loo5ing for you. 2)/). +olly9ood is 98ere if you don't 8a=e 8appiness you send out for it. - 3eR 3eed 2)//. +o*er -arge Fart Bisa Faby -aggie - D+. HO-PH,KH 2)/6. +onest differences are often a 8ealt8y sign of progress. - -a8at*a <and8i 2)/@. +onesty and ser=ice. 2)/:. +onesty pays2 but it doesn't see* to pay enoug8 to suit so*e people. - ?. -. +ubbard 2)/E. +onesty's t8e best policy. 2)60. +oni soit la =ac8e Sui rit. 2)61. +on5 if you 8ate bu*per stic5ers t8at say C+on5 if ...C 2)62. +on5 if you lo=e obscene gestures. 2)6(. +on5 if you lo=e peace and Suiet. - Fu*per Htic5er 2)6). +onor 9ould be better ser=ed if O 9ere your *ate. - 7orf 2)6/. +onorable2 adU.& 0fflicted 9it8 an i*pedi*ent in one's reac8. On legislati=e bodies2 it is custo*ary to *ention all *e*bers as 8onorableW as2 Ct8e 8onorable gentle*an is a scur=y cur.C - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC 2)66. +ope is a good brea5fast2 but it is a bad supper. 2)6@. +ope is a 9a5ing drea*.
2)6:. +ors d'oeu=res--a 8a* sand9ic8 cut into forty pieces. 2)6E. +orse sense is t8e t8ing a 8orse 8as t8at 5eeps it fro* betting on people. 2)@0. +orse sense is t8e t8ing a 8orse 8as 98ic8 5eeps it fro* betting on people. - 7. J. ?ields 2)@1. +oudini escaping fro* Ke9 >ersey 2)@2. +ouse9or5 can 5ill you if done rig8t. 2)@(. +o9 about a little fire2 scarecro9? 2)@). +o9 apt t8e poor are to be proud. 2)@/. +o9 can O lo=e you if you 9on't lie do9n? 2)@6. +o9 can you be deaf 9it8 ears li5e t8at? - -cJoy 2)@@. +o9 can you be in t9o places at once 98en you're not any98ere at all? 2)@:. +o9 can you go=ern a nation 98ic8 8as 2)6 5inds of c8eese? 2)@E. +o9 can you 9or5 98en t8e syste*'s so cro9ded? 2):0. +o9 co*e all t8e buttons 5eep flying off *y s8irt? 2):1. +o9 co*e only your friends step on your ne9 98ite snea5ers? 2):2. +o9 co*e 9e ne=er tal5 any*ore? 2):(. +o9 co*e 9rong nu*bers are ne=er busy? 2):). +o9 could O 8a=e do9nloaded a =irus?? Ot said K, J033O.3 2):/. +o9 did a fool and 8is *oney get toget8er in t8e first place? 2):6. +o9 do frogs die? Ter-*it suicide 2):@. +o9 do O set *y p8aser to tic5le? 2)::. +o9 do you eRplain sc8ool to a 8ig8er intelligence? - .lliot2 C..D.C 2):E. +o9 do you 5eep a tur5ey in suspense? 2)E0. +o9 do you *a5e 7indo9s faster? D8ro9 it 8arder. 2)E1. +o9 8ig8 O a* [ +o9 *uc8 O see [ +o9 far O reac8 [ 4epends on *e 2)E2. +o9 long a *inute is depends on 98ic8 side of t8e bat8roo* door you're on. 2)E(. +o9 *any Cco*ing peopleC 8as one 5no9n 78ere on eart8 do t8ey all go to? 2)E). +o9 *any 8ard9are engineers does it ta5e to c8ange a lig8tbulb? Kone& C7e'll fiR it in soft9are.C 2)E/. +o9 *any -onty Pyt8on fans does it ta5e to c8ange a lig8t bulb? ,ne to clai* it is an eR lig8t bulb2 it is no *ore. 2)E6. +o9 *any -onty Pyt8on fans does it ta5e to c8ange a lig8t bulb? ,ne anot8er to clai* 8e didn't 9ant to c8ange it any9ay2 8e al9ays 9anted to be a lu*berUac5. 2)E@. +o9 *any -onty Pyt8on fans does it ta5e to c8ange a lig8t bulb? ,ne to as5 for a licence for 8is pet bulb2 .ric 2)E:. +o9 *any -onty Pyt8on fans does it ta5e to c8ange a lig8t bulb? ,ne to su**arise Proust. 2)EE. +o9 *any -onty Pyt8on fans does it ta5e to c8ange a lig8t bulb? ,ne to say t8at in 8is day2 t8ey 8ad it toug8 2/00. +o9 *any -onty Pyt8on fans does it ta5e to c8ange a lig8t bulb? ,ne to get nailed to t8e lig8t soc5et. 2/01. +o9 *any -onty Pyt8on fans does it ta5e to c8ange a lig8t bulb? ,ne to as5 for a ne9 bulb 9it8 no spa* in it... 2/02. +o9 *any -onty Pyt8on fans does it ta5e to c8ange a lig8t bulb? 2/0(. +o9 *any of you belie=e in tele5inesis? 3aise -; 8and 2/0). +o9 *any soft9are engineers does it ta5e to c8ange a lig8tbulb? Kone& C7e'll docu*ent it in t8e *anual.C 2/0/. +o9 *any tec8 9riters does it ta5e to c8ange a lig8tbulb? Kone& CD8e user can 9or5 it out.C 2/06. +o9 *any 9ee5s are t8ere in a lig8t year?
2/0@. +o9 *any Qen *asters does it ta5e to scre9 in a lig8t bulb? Kone. D8e Lni=erse spines t8e bulb2 and t8e Qen *aster stays out of t8e 9ay. 2/0:. +o9 *uc8 can O get a9ay 9it8 and still go to 8ea=en? 2/0E. +o9 *uc8 does it cost to entice a dope-s*o5ing LKOM syste* guru to 4ayton? - Frian Foyle2 LKOM[7,3B4's ?irst 0nnual Halary Hur=ey 2/10. +o9 *uc8 sin can O get a9ay 9it8 and still go to 8ea=en? 2/11. +o9 s8arper t8an a 8ound's toot8 it is to 8a=e a t8an5less serpent. 2/12. +o9 to defend yourself against a Fanana. 2/1(. +o9 untasteful can you get? 2/1). +o9 9as D8o*as >. 7atson buried? E edge do9n. 2/1/. +o9 9onderful opera 9ould be if t8ere 9ere no singers. 2/16. +o9 9onderful opera 9ould be if t8ere 9ere no singers. 2/1@. +o9 9onderful opera 9ould be if t8ere 9ere no singers. 2/1:. +o9 you loo5 depends on 98ere you go. 2/1E. +o9'* O flyin'? 4ial 1-:00-F,3<-;,L. - Forg 2/20. +o9's t8is for diplo*acy? H8oot t8e* all - Tir5 2/21. +,7.'H B07& .=eryone 8as a sc8e*e t8at 9ill not 9or5. 2/22. +o9e's Ba9& .=eryone 8as a sc8e*e t8at 9ill not 9or5. 2/2(. +o9e=er2 ne=er daunted2 O 9ill cope 9it8 ad=ersity in *y traditional *anner ... sul5ing and nausea. - Do* T. 3yan 2/2). +u*an beings 9ere created by 9ater to transport it up8ill. 2/2/. +u*an Ontelligence. D8e greatest oRy*oron e=er 2/26. +u*ans are unreliable2 inefficient2 often la y2 so*eti*es pregnant2 liable to stri5e2 need to be fed and paid2 ta5e up a lot of space and are slo9 by co*puter standards. 2/2@. +u*ans& D8e species t8at s8ould 8a=e ne=er been... 2/2:. +u**ingbirds ne=er re*e*ber t8e 9ords to songs. 2/2E. +yp8enate bet9een syllables and a=oid un-necessary 8yp8ens. 2/(0. O "al*ost" stole a tagline O'* so as8a*ed 2/(1. O ain't got ti*e to bleed. - >esse Ventura 2/(2. O a* a co*puter. O a* du*ber t8an any 8u*an and s*arter t8an any ad*inistrator. 2/((. O a* a *an--not8ing 8u*an is alien to *e. 2/(). O a* a *an& not8ing 8u*an is alien to *e. - Derrence 2/(/. O a* afraid t8at is beyond *y design para*eters. - 4ata 2/(6. O a* beco*e 4eat82 t8e 4estroyer of 9orlds - ,ppen8ei*er 2/(@. O a* i**ortal2 at least till O die. 2/(:. O a* Bocutus of Forg. 4o you 8a=e any <rey Poupon? 2/(E. O a* Bocutus of Forg. O de*and .arl <rey tea - for 10000. 2/)0. O a* loo5ing for an 8onest *an. - 4iogenes $(2/ FJ1 2/)1. O a* loo5ing for an 8onest *an. 2/)2. O a* *ore bored t8an you could e=er possibly be. <o bac5 to 9or5. 2/)(. O a* not a croo5. - 3ic8ard KiRon 2/)). O a* not a 9i*p. - <eorge Fus8 2/)/. O a* not afraid of to*orro92 for O 8a=e seen yesterday and O lo=e today. 2/)6. O a* not an ani*al. - .lep8ant -an 2/)@. O a* not asleep. - 3onald 3eagan 2/):. O a* not no92 and ne=er 8a=e been2 a girl friend of +enry Tissinger. - <loria Hteine* 2/)E. O a* not part of t8e proble*W O a* a 3epublican. - Vice President 4an Vuayle
2//0. O a* Popeye of Forg. Prepare to be as5i*ilgrated. 2//1. O a* ready to *eet *y -a5er. 78et8er *y -a5er is prepared for t8e great ordeal of *eeting *e is anot8er *atter. - 7inston J8urc8ill 2//2. O 0- 3.B0M.4 - 7orf 2//(. O a* t8e future. - Henator 4an Vuayle 2//). O a* t8e *ot8er of all t8ings2 and all t8ings s8ould 9ear a s9eater. 2///. O a*. D8erefore2 O t8in5. O t8in5. 2//6. O FFH because no one can read *y 8and9riting 2//@. O belie=e O 9ill ta5e t8is opportunity to re*o=e *y ears. 2//:. O belie=e in getting into 8ot 9aterW it 5eeps you clean. - <. T. J8esterton 2//E. O belie=e t8at unar*ed trut8 and unconditional lo=e 9ill 8a=e t8e final 9ord in reality. - -artin But8er Ting 2/60. O belie=e 9e are on an irre=ersible trend to9ard *ore freedo* and de*ocracy but t8at could c8ange. - Vice President 4an Vuayle 2/61. O belong to no organi ed party. O a* a 4e*ocrat. - 7ill 3ogers 2/62. O belong to no organi ed party. O a* a 4e*ocrat. 2/6(. O bet t8e 8u*an brain is a 5ludge. - -ar=in -ins5y 2/6). O call a fig a fig2 a spade a spade. - -enander $2E2 FJ1 2/6/. O call *y co*puter C+ole in t8e 4es5C 2/66. O ca*e to -OD to get an education for *yself and a diplo*a for *y *ot8er. 2/6@. O ca*e. O sa9. O c8arged it. 2/6:. O can assure you t8at si e 9ill not be a proble*. - 7orf 2/6E. O can 8ardly bear to 9atc8. 2/@0. O can Uu*p blac5 8oles - Htep8en +a95ing 2/@1. O can Uu*p dictionareys - 4an Vuayle 2/@2. O can Uu*p spreads8eets - Fill <ates 2/@(. O can relate to t8at. 2/@). O can resist anyt8ing but te*ptation. 2/@/. O can HP.BB2 O Uust can't D;P. 9ort8 a 8oot 2/@6. O can tell you're lying. ;our lips are *o=ing. 2/@@. O can tell you're lying. ;our lips are *o=ing 2/@:. O can't be o=erdra9n2 O still 8a=e *ore c8ec5s 2/@E. O can't begin to describe 8o9 8appy O a*. 2/:0. O can't belie=e *y co*puter's on fire. 2/:1. O can't co*plain2 but so*eti*es O still do. - >oe 7als8 2/:2. O can't 8ear you. D8ere's a banana republic in *y ear. 2/:(. O can't 8elp s8o9ing *y ent8usias*. 2/:). O can't reac8 t8e bra5es on t8is piano 2/:/. O can't tell if O'* a 5ingpin or a pauper 2/:6. O can't use 7indo9s. -y cat ate *y *ouse. 2/:@. O can't2 4octor. O *ig8t 8urt you. - 7orf 2/::. O cannot and 9ill not cut *y conscience to fit t8is year's fas8ions. - Billian +ell*an 2/:E. O carry a life si e *ap of 0*erica in poc5et. 78en people as5 *e 98ere O'* fro*2 O point to . - /. - Hte=ie 7rig8t 2/E0. O co*e unbundled. 2/E1. O could be arguing in *y spare ti*e. 2/E2. O could be c8asing an unta*ed ornit8oid 9it8out cause. 2/E(. O couldn't possibly fail to disagree 9it8 you less. 2/E). O cried because O 8ad no s8oes2 until O *et a *an 98o 8ad no soc5s.
2/E/. O cut do9n trees2 O eat *y lunc82 O go to t8e la=atory. 2/E6. O despise t8e pleasure of pleasing people 98o* O despise. 2/E@. O didn't 5no9 it 9as i*possible 98en O did it. 2/E:. O do desire 9e *ay be better strangers. 2/EE. O do 5no9 a fe9 t8ings about anato*y2 >ean-Buc. - Fe=erly 2600. O do not fear co*puters. O fear t8e lac5 of t8e*. - Osaac 0si*o= 2601. O do not feel obliged to belie=e t8at t8e sa*e <od 98o 8as endo9ed us 9it8 sense2 reason2 and intellect 8as intended us to forgo t8eir use. - <alileo <alilei 2602. O do not 5no9 *yself2 and <od forbid t8at O s8ould. - >o8ann 7olfgang =on <oet8e 260(. O 4, K,D...O do not yell. - 7orf 260). O don't belie=e in astrology. Fut t8en O'* an 0Suarius2 and 0Suarians don't belie=e in astrology. - >a*es 3. ?. Vuir5 260/. O don't belie=e in Featles2 O Uust belie=e in *e. - >o8n Bennon 2606. O 4,K'D .0D 0K;D+OK< 7OD+ 0 ?0J. 260@. O don't get no respect. 260:. O don't 8a=e a drin5ing proble*. O drin52 O get drun52 O fall do9n2 Ko proble*. 260E. O don't 8a=e any taglines to gi=e you. <o a9ay. 2610. O don't 8a=e to ta5e t8is abuse fro* you -- O'=e got 8undreds of people 9aiting to abuse *e. - Fill -urray2 C<8ostbustersC 2611. O don't Uust te*pt fate - O gi=e it t8e finger. 2612. O don't 5ill *y ene*ies& O sli*e t8e* - ,do 261(. O don't 5no9 *uc8 about panda bears2 Ku*ber ,ne. - Picard 261). O don't 5no92 O'* *a5ing t8is up as O go. - Ondiana >ones[0drian Ba5e 261/. O don't 5no9. O don't care. 0nd it doesn't *a5e any difference. 2616. O don't lie2 c8eat or steal unnecessarily. - Fu*per stic5er 261@. O don't li5e spinac82 and O'* glad O don't2 because if O li5ed it O'd eat it2 and O Uust 8ate it. - Jlarence 4arro9 261:. O don't obUect to seR before *arriage2 but t9o *inutes before?? 261E. O don't obUect to seR before *arriage2 but t9o *inutes before?? 2620. O don't steal taglines -- O replicate t8e*. 2621. O don't steal taglines2 O replicate t8e*. 2622. O don't understand you any*ore. 262(. O don't 9ant to be a cynic2 but it's 8ard... 262). O don't 9ant to die at )0. - >. Bennon 262/. O don't 9ant to t8in5. O Uust 9ant to be... 2626. O dote on 8is =ery absence. 262@. O dran5 98at?? \ Hocrates 262:. O enUoy t8e ti*e t8at 9e spend toget8er. 262E. O fear eRplanations eRplanatory of t8ings eRplained. 26(0. O fear <ree5s e=en 98en t8ey bring gifts. - Virgil $1E FJ1 26(1. O fear you *ust bla*e your o9n per=erse urges. - Picard 26(2. O feel al*ost 8appy. 26((. O ?eel Fetter Ko9. 26(). O feel fine......=eryt8ing see*s a little s*aller. - Picard 26(/. O feel so good O could do a 9ee5's 9or5 t8is afternoon. 26(6. O figure O'* pretty good 9it8 t8e bulls8it but O lo=e listening to an eRpert. Teep tal5ing. 26(@. O figure O'* pretty good 9it8 t8e bulls8it2 but O lo=e listening to an eRpert. Teep tal5ing
26(:. O find it 8ard to restrain *y ent8usias*. 26(E. O find pus8 buttons =ery depressing...... 26)0. O found 3o*e a city of bric5s and left it a city of *arble. 26)1. O generally a=oid te*ptation unless O can't resist it. - -ae 7est 26)2. O generally a=oid te*ptation unless O can't resist it. 26)(. O got it all toget8er2 t8en forgot 98ere O put it. 26)). O got lost in t8oug8t. Ot 9as an unfa*iliar territory. 26)/. O got *y *oUo 98olesale. 26)6. O got up early today so as to 8a=e e=en *ore ti*e to enUoy *yself. 26)@. O 8ad a 8andle on life2 but it bro5e. 26):. O +ad 0 Bife ,nce2 Ko9 O +a=e 0 Jo*puter 26)E. O 8ad a life once... but no9 O 8a=e a *ode*. 26/0. O 8appen to be a 3epublican president- a82 t8e =ice president. - Vice President 4an Vuayle 26/1. O +0D. it 98en it does t8at 26/2. O 8ate *a5ing predictionsW especially about t8e future 26/(. O 8ate Suotations. - 3alp8 7aldo .*erson 26/). O 8a=e a cunning plan - Faldric fro* Flac50dder $O - OV1 26//. O 8a=e a fir* grip on reality. Ko9 O can strangle it. 26/6. O 8a=e a *ind li5e a steel...u8...t8inga*aUig... 26/@. O 8a=e a p8otograp8ic *e*ory2 but O 5eep forgetting to put t8e fil* in. - Peter Ja*pbell 26/:. O 8a=e a si*ple p8ilosop8y& ?ill 98at's e*pty. .*pty 98at's full. Hcratc8 98ere it itc8es. - 0. 3. Bong9ort8 26/E. O 8a=e a speec8 i*pedi*ent....*y foot 2660. O 8a=e co*e to t8e conclusion t8at politics is too serious a *atter to be left to t8e politicians. - J8arles de <aulle 2661. O 8a=e found po9er in t8e *ysteries of t8oug8t. - .uripides 2662. O 8a=e 8ardly e=er 5no9n a *at8e*atician 98o 9as capable of reasoning. 266(. O 8a=e learned Do spell 8ors d'oeu=res 78ic8 still grates on Ho*e people's n'oeu=res. - 7arren TnoR 266). O 8a=e *ade good Uudg*ents in t8e Past. O 8a=e *ade good Uudg*ents in t8e ?uture. - Vice President 4an Vuayle 266/. O 8a=e *ade *ista5es but O 8a=e ne=er *ade t8e *ista5e of clai*ing t8at O 8a=e ne=er *ade one. - >a*es <ordon Fennett 2666. O 8a=e *ade t8is letter longer t8an usual because O lac5 t8e ti*e to *a5e it s8orter. - Flaise Pascal 266@. O 8a=e ne=er let *y sc8ooling interfere 9it8 *y education. 266:. O 8a=e no ti*e for *on5s resisting t8e carni=al. 266E. O 8a=e often regretted *y speec82 ne=er *y silence. 26@0. O 8a=e seen t8e future and it is Uust li5e t8e present2 only longer. 26@1. O 8a=e so*et8ing F.DD.3 t8an c8ocolate. - 3i5er 26@2. O 8a=e t8e si*plest tastes. O a* al9ays satisfied 9it8 t8e best. - ,scar 7ilde 26@(. O +a=e Do Htop Ko92 -y ?ingers 0re <etting +oarse 26@). O 8a=e to stop no9. -y fingers are getting 8oarse. 26@/. O 8a=en't laug8ed so *uc8 since yesterday. 26@6. O 8a=en't lost *y *ind -- it's bac5ed up on tape so*e98ere. 26@@. O 8ear 98at you're saying but O Uust don't care. 26@:. O idiot-proof *y progra*s2but along co*es a bigger idiot. 26@E. O is a uni=ersity student. - Fu*per stic5er
26:0. O is 5not dain bra*aged 26:1. O >ust can not resist a little fun along t8e 9ay. &-1 26:2. O Uust pic5ed up a boo5 called C<lue in -any BandsC and O can't put it do9n. 26:(. O Uust play 8ere. 26:). O Uust steal 'e*2 O don't eRplain 'e*. 26:/. O Uust steal t8e*2 O don't 9rite t8e*. 26:6. O 5e9 a girl2 s8e 9as a *ac8o *an. 26:@. O 5no9 and O 5no9 you 5no9 O 5no9. 26::. O 5no9 enoug8 about t8e 7orld2 to 5no9 t8at O don't 9ant to 5no9 anyt8ing *ore. - Hly 26:E. O 5no9 O'* luc5y. O al9ays 8a=e been. 26E0. O 5no9 on 98ic8 side *y bread is buttered. - >o8n +ey9ood 26E1. O 5no9 on 98ic8 side *y bread is buttered. 26E2. O 5no9 so little2 but O 5no9 it fluently... 26E(. O 5no9 you t8in5 you understood 98at O said2 but 98at you 8eard 9as not 98at O *eant. 26E). O li5e being single. O'* al9ays t8ere 98en O need *e. - 0rt Beo 26E/. O li5e Foolean logic. K,D 26E6. O li5e it better in t8e dar5. 26E@. O li5e 5ids2 but O don't t8in5 O could eat a 98ole one. 26E:. O li5e 9or5W it fascinates *eW O can sit and loo5 at it for 8ours. 26EE. O li5e your ga*e but 9e 8a=e to c8ange t8e rules. 2@00. O lo=e JaliforniaW O practically gre9 up in P8oeniR. - Vice President 4an Vuayle 2@01. O lo=e *y co*puter. Ot's *ade in Dai9an 2@02. O lo=e t8e s*ell of Kapal* in t8e *orning... - Jolonel Tilgore 2@0(. O lo=e treason but 8ate a traitor. 2@0). O *ay not al9ays be perfect2 but O'* al9ays *e. 2@0/. O *ust 8a=e slipped a dis5 - *y pac5 8urts. 2@06. O *ust 8a=e slipped a dis5 -- *y pac5 8urts 2@0@. O need so*e ne9 taglines. D8is one is getting old. 2@0:. O need so*eone really bad. 0re you really bad? - Fu*per stic5er 2@0E. O need 7indo9s li5e a 8ae*op8iliac needs 8eart surgery 2@10. O ne=er did it t8at 9ay before. 2@11. O ne=er fail to con=ince an audience t8at t8e best t8ing t8ey could do 9as to go a9ay. 2@12. O ne=er 5ne9 O 8ad so *any friends. 2@1(. O ne=er *et a piece of c8ocolate O didn't li5e. 2@1). O ne=er realised t8at ?,3D30K 9as so eRciting. 2@1/. O only counted 100 dal*atians... 2@16. O only 8a=e to open *y *out8 and Uolly t8oug8ts pour out. 2@1@. O played po5er 9[ tarot cards-got a flus8 G / people died 2@1:. O prefer t8e co*pany of eSuals. - 3i5er 2@1E. O profoundly belie=e it ta5es a lot of practice to beco*e a *oral slob. - 7illia* ?. Fuc5ley 2@20. O read t8e ne9s today2 ,8 boy... - >o8n Bennon 2@21. O reali e t8at t8ere are *any people in t8is 9orld 98o do not lo=e t8eir fello9 8u*an beings2 and O 8ate people li5e t8at 2@22. O really 8ate t8is da*ned *ac8ine O 9is8 t8at t8ey 9ould sell it. Ot ne=er does Suite 98at O 9ant Fut only 98at O tell it.
2@2(. O refuse to 8a=e a battle of 9its 9it8 an unar*ed opponent. 2@2). O refuse to 8a=e a battle of 9its2 9it8 an unar*ed opponent. 2@2/. O re*e*ber t8e 9ords. O don't understand. 2@26. O re*e*ber 98en Haturns 9ere roc5ets2 not cars. 2@2@. O sa9 a 9ere9olf drin5ing a pina colada at Drader Vic's ... 2@2:. O sa9 .l=is. +e sat bet9een *e and Figfoot on t8e L?,. 2@2E. O sa9 98at you did and O 5no9 98o you are. 2@(0. O see furt8er by standing on t8e s8oulders of giants. - Hir Osaac Ke9ton 2@(1. O see 8o9 t8eir eyes are gat8ered into one 2@(2. O see t8e eigen=alue in t8ine eye2 O 8ear t8e tender tensor in t8y sig8. Fernoulli 9ould 8a=e been content to die +ad 8e but 5no9n suc8 a-sSuared cos 2$p8i1 Htanisla9 Be*2 CJyberiadC 2@((. O see you're not one of our registered dealers... - 3a*on Begnag8i 2@(). O sense... "HB0P" Kot 98ile 9e're on t8e bridge2 7ill 2@(/. O s8a=e 9it8 ,cca*'s 3a or. 2@(6. O s*ell a rat. 4id you ba5e it or fry it? 2@(@. O stand by all t8e *isstate*ents t8at O'=e *ade. - Vice President 4an Vuayle 2@(:. O still *iss *y eR-9ife - but *y ai* is i*pro=ing 2@(E. O suggest a ne9 strategy2 32. Bet t8e 7oo5iee 9in. 2@)0. O suppose Paradise *ust be li5e t8is. 2@)1. O sur=i=ed torture. O'* ready to date B9aRana. - Picard 2@)2. O taug8t O ta9 a puddy tat. - D9eety 2@)(. O tell t8e* t8ere's no proble*s...,nly Holutions... 2@)). O t8in5 8e's a couple bus8els s8y of a full crop 2@)/. O t8in5 8e's a couple 5eys s8ort of a concert piano. 2@)6. O t8in5 8e's a couple of cans s8ort of a siR-pac5. 2@)@. O t8in5 8e's a couple of tic5s past t8e noon 98istle. 2@):. O t8in5 8e's a couple s8arps s8ort of F -aUor. 2@)E. O t8in5 8e's a fe9 bars s8ort of a finis8ed sy*p8ony. 2@/0. O t8in5 8e's a fe9 bric5s s8ort of a 98ole 9all. 2@/1. O t8in5 8e's a fe9 bytes s8ort of a c8ec5su*. 2@/2. O t8in5 8e's a fe9 c8annels s8ort of Fasic Jable 2@/(. O t8in5 8e's a fe9 croutons s8ort of a garden salad. 2@/). O t8in5 8e's a fe9 pipes s8ort of a c8urc8 organ. 2@//. O t8in5 8e's a fe9 strings s8ort of a =iolin section. 2@/6. O t8in5 8e's one taco s8ort of a co*bination platter 2@/@. O t8in5 8e's playing 8is oboe 9it8 Uust one reed. 2@/:. O t8in5 8e's playing solitaire 9it8 a pinoc8le dec5. 2@/E. O t8in5 8e's playing t8e lead =iolin part on a =iola. 2@60. O t8in5 8e's playing t8e old fi=e-string guitar. 2@61. O t8in5 O could fall *adly in bed 9it8 you. 2@62. O t8in5 O t8in52 t8erefore O t8in5 O a*. O t8in5. 2@6(. O t8in5 t8at O s8all ne=er see 0 billboard lo=ely as a tree. Per8aps2 unless t8e billboards fall O'll ne=er see a tree at all. - ,gden Kas8 2@6). O t8in5 9e *ust *a5e lo=e on t8e front la9n li5e cra ed 9easels K,7 - Pic5 up line 2@6/. O t8in5 9e're all Fo os on t8is bus. 2@66. O t8in5 9e're bac5 to nor*ality at last. 2@6@. O t8in5 9e're in trouble. 2@6:. O t8in52 t8erefore O a* paid.
2@6E. O t8in52 t8erefore O a*. O t8in5. 2@@0. O t8in52 t8erefore O a*... dangerous2 t8at is... 2@@1. O t8in52 t8erefore O'* o=erSualified 2@@2. O t8oug8t 4.B "." -really- deleted t8e files 2@@(. O too5 t8ee for t8y better. Da5e t8y fortune. 2@@). O use 7indo9s... on *y car2 on *y 8ouse2 on *y... 2@@/. O used to be indecisi=e. Ko9 O'* not sure. 2@@6. O used to be lost in t8e s8uffle. Ko9 O Uust s8uffle along 9it8 t8e lost. 2@@@. O used to get 8ig8 on life but lately O'=e built up a resistance. 2@@:. O used to 8a=e a 8andle on life2 t8en 4,H closed it... 2@@E. O used to t8in5 O 9as indecisi=e2 but no9 O'* not so sure. 2@:0. O used to t8in5 O 9as indecisi=e2 but no9 O'* not so sure. 2@:1. O used to 9atc8 DV2 t8en O boug8t a *ode*. 2@:2. O 9al5 along a t8in line darling2 dar5 s8ado9s follo9 *e. - .l=is 2@:(. O 9ant a *eal2 not a snac5. 2@:). O 9ant e=eryt8ingW do you 8a=e it?? 2@:/. O 9ant t8e 9orld to 5no9 O'* 8appy as can be. 2@:6. O 9ant to be 3obin to Fus8's Fat*an. - Henator 4an Vuayle 2@:@. O 9ant to li=e fore=er or die in t8e atte*pt. 2@::. O 9as born s*iling. 2@:E. O 9as going to procrastinate2 but O put it off.... 2@E0. O 9as gratified to be able to ans9er pro*ptly2 and O did. O said O didn't 5no9. -ar5 D9ain 2@E1. O 9as Uust stopped by t8e B0P4 and boy a* O beat 2@E2. O 9as 5no9n as t8e c8ief gra=e robber of *y state. - Vice President 4an Vuayle 2@E(. O 9as sane once... didn't li5e it. 2@E). O 9as t8e neRt door 5id's i*aginary friend. 2@E/. O 9asn't al9ays li5e t8is2 Bieutenant. - Picard 2@E6. O 9ent fro* P8eoniR 0ri ona2 all t8e 9ay to Daco*a2 P8iledelp8ia2 0tlanta2 B.0. - Hte=e -iller 2@E@. O 9ent *ad once. 4id *e a 9orld of good. 2@E:. O 9ill *a5e you s8orter by t8e 8ead. 2@EE. O 9ill ne=er lie to you. 2:00. O 9ill not forget you. 2:01. O 9is8 O 8ad a snappy Dre5 Dagline to put 8ere... 2:02. O 9is8 O 9as a Tlingon. O 9ant a lu*py 8ead. 2:0(. O 9is8 life 8ad a scroll-bac5 buffer..... 2:0). O 9is8 life 8ad a scroll-bac5 buffer. 2:0/. O 9is8 t8ere 9as a 5nob on t8e DV to turn up t8e intelligence. D8ere's a 5nob called Cbrig8tnessC2 but it doesn't 9or5. - <allag8er 2:06. O 9is8 t8ey all could be Jalifornia girls. 2:0@. O 9is8 you 8u*ans 9ould lea=e *e alone. 2:0:. O 9is8 you 9ere a beer. 2:0E. O 9o5e up to disco=er it 8ad all been a terrible fil*... 2:10. O 9on't use 7indo9s2 O 9on't use 7indo9s2 O 9on't... 2:11. O 9ors8ip t8e ground t8at a9aits you. 2:12. O 9ould as5 t8at you stop fiddling 9it8 *y ears. - 4ata 2:1(. O 9ould dance for Uoy if t8ere 9eren't people 9atc8ing. 2:1). O 9ould li5e to buy a fis8 liscence2 please.
2:1/. O 9ould li5e to eRpress *y sy*pat8y to all t8ose i*pacted by t8is disaster. Vice President 4an Vuayle $re& crus8ed Sua5e =icti*s1 2:16. O 9ould not beco*e a *e*ber of a club or organi ation2 t8at 9ould 8a=e *e as one of its *e*bers - <rouc8o -arR 2:1@. O 9ould sooner be notorious t8an un5no9n. 2:1:. O 9ouldn't reco**end seR2 drugs or insanity for e=eryone2 but t8ey'=e al9ays 9or5ed for *e. - +unter H. D8o*pson 2:1E. O 9ouldn't s8oot 8i* if O 9ere you. Ot 9ill Uust *a5e 8i* *ad. 2:20. O 9ouldn't touc8 t8e -etric Hyste* 9it8 a (.0):* pole 2:21. O 9rote *y o9n benc8*ar52 *y *ac8ine is no9 /00-+ 2:22. O'd gi=e *y rig8t ar* to be a*bideRtrous. 2:2(. O'd Uust as soon 5iss a 7oo5iee. 2:2). O'd li5e to 8elp you out. 78ic8 9ay did you co*e in? 2:2/. O'd li5e to 8elp you out. 78ic8 9ay did you co*e in? 2:26. O'd li5e to li=e li5e a poor person 9it8 lots of *oney. 2:2@. O'd loo5 good on you. - Pic5 up line 2:2:. O'd lo=e to2 but 8a=ing fun gi=es *e pric5ly 8eat. 2:2E. O'd lo=e to2 but O c8anged t8e loc5 on *y door and no9 O can't get out. 2:(0. O'd lo=e to2 but O did *y o9n t8ing and no9 O'=e got to undo it. 2:(1. O'd lo=e to2 but O don't 9ant to lea=e *y co*fort one. 2:(2. O'd lo=e to2 but O feel a song co*ing on. 2:((. O'd lo=e to2 but O 8a=e so*e real 8ard 9ords to loo5 up in t8e dictionary. 2:(). O'd lo=e to2 but O 8a=e to ans9er all of *y CoccupantC letters. 2:(/. O'd lo=e to2 but O 8a=e to be on t8e neRt train to Fer*uda. 2:(6. O'd lo=e to2 but O 8a=e to bleac8 *y 8are. 2:(@. O'd lo=e to2 but O 8a=e to c8ec5 t8e fres8ness dates on *y dairy products. 2:(:. O'd lo=e to2 but O 8a=e to dra9 CJubbyC for an art sc8olars8ip. 2:(E. O'd lo=e to2 but O 8a=e to floss *y cat. 2:)0. O'd lo=e to2 but O 8a=e to fluff *y s8o9er cap. 2:)1. O'd lo=e to2 but O 8a=e to fulfill *y potential. 2:)2. O'd lo=e to2 but O 8a=e to go to court for 5itty littering. 2:)(. O'd lo=e to2 but O 8a=e to go to t8e post office to see if O'* still 9anted. 2:)). O'd lo=e to2 but O 8a=e to Uog *y *e*ory. 2:)/. O'd lo=e to2 but O 8a=e to 5nit so*e dust bunnies for a c8arity ba aar. 2:)6. O'd lo=e to2 but O 8a=e to rotate *y crops. 2:)@. O'd lo=e to2 but O 8a=e to sit up 9it8 a sic5 ant. 2:):. O'd lo=e to2 but O 8a=e to stay 8o*e and see if O snore. 2:)E. O'd lo=e to2 but O 8a=e to study for a blood test. 2:/0. O'd lo=e to2 but O 8a=e to t8a9 so*e 5arate c8ops for dinner. 2:/1. O'd lo=e to2 but O 8a=e to 9as8[condition[per*[curl[tease[tor*ent *y 8air. 2:/2. O'd lo=e to2 but O 8a=e too *uc8 guilt. 2:/(. O'd lo=e to2 but O left *y body in *y ot8er clot8es. 2:/). O'd lo=e to2 but O *ade an appoint*ent 9it8 a cuticle specialist. 2://. O'd lo=e to2 but O ne=er go out on days t8at end in C;C. 2:/6. O'd lo=e to2 but O prefer to re*ain an enig*a. 2:/@. O'd lo=e to2 but O pro*ised to 8elp a friend fold road *aps. 2:/:. O'd lo=e to2 but O t8in5 you 9ant t8e ,D+.3 Bu5e. 2:/E. O'd lo=e to2 but O 9ant to spend *ore ti*e 9it8 *y blender. 2:60. O'd lo=e to2 but O'll be loo5ing for a par5ing space. 2:61. O'd lo=e to2 but O'* attending a perfu*e con=ention as guest sniffer.
2:62. 2:6(. 2:6). 2:6/. 2:66. 2:6@. 2:6:. 2:6E. 2:@0. 2:@1. 2:@2. 2:@(. 2:@). 2:@/. 2:@6. 2:@@. 2:@:. 2:@E. 2::0. 2::1. 2::2. 2::(. 2::). 2::/. 2::6. 2::@. 2:::. 2::E. 2:E0. 2:E1. 2:E2. 2:E(. 2:E). 2:E/. 2:E6. 2:E@. 2:E:. 2:EE. 2E00. 2E01. 2E02. 2E0(. 2E0). 2E0/. 2E06. 2E0@. 2E0:. 2E0E. 2E10. 2E11.
O'd lo=e to2 but O'* attending t8e opening of *y garage door. O'd lo=e to2 but O'* being deported. O'd lo=e to2 but O'* building a pig fro* a 5it. O'd lo=e to2 but O'* con=erting *y calendar 9atc8 fro* >ulian to <regorian. O'd lo=e to2 but O'* doing door-to-door collecting for static cling. O'd lo=e to2 but O'* enrolled in aerobic screa* t8erapy. O'd lo=e to2 but O'* getting *y o=eralls o=er8auled. O'd lo=e to2 but O'* gi=ing nuisance lessons at a con=enience store. O'd lo=e to2 but O'* going do9n to t8e ba5ery to 9atc8 t8e buns rise. O'd lo=e to2 but O'* going t8roug8 c8erry c8eeseca5e 9it8dra9al. O'd lo=e to2 but O'* going to be old so*eday. O'd lo=e to2 but O'* going to count t8e bristles in *y toot8brus8. O'd lo=e to2 but O'* 8a=ing all *y plants neutered. O'd lo=e to2 but O'* 8a=ing *y baby s8oes bron ed. O'd lo=e to2 but O'* in training to be a 8ouse8old pest. O'd lo=e to2 but O'* obser=ing Kational 0pat8y 7ee5. O'd lo=e to2 but O'* planning to go do9nto9n to try on glo=es. O'd lo=e to2 but O'* sandblasting *y o=en. O'd lo=e to2 but O'* staying 8o*e to 9or5 on *y cottage c8eese sculpture. O'd lo=e to2 but O'* ta5ing pun5 tote* pole car=ing. O'd lo=e to2 but O'* teac8ing *y ferret to yodel. O'd lo=e to2 but O'* too young for t8at stuff. O'd lo=e to2 but O'* touring J8ina 9it8 a 9o5 band. O'd lo=e to2 but O'* trying to be less popular. O'd lo=e to2 but O'* trying to cut do9n. O'd lo=e to2 but O'* trying to see 8o9 long O can go 9it8out saying yes. O'd lo=e to2 but O'* unco*fortable 98en O'* alone or 9it8 ot8ers. O'd lo=e to2 but O'* up to *y elbo9s in 9aRy buildup. O'd lo=e to2 but O'* 9aiting to see if O'* already a 9inner. O'd lo=e to2 but O'* 9orried about *y =ertical 8old. O'd lo=e to2 but O'* 9riting a lo=e letter to 3ic8ard Hi**ons. O'd lo=e to2 but O'=e been sc8eduled for a 5ar*a transplant. O'd lo=e to2 but O'=e been traded to Jincinnati. O'd lo=e to2 but O'=e dedicated *y life to linguini. O'd lo=e to2 but O'=e got a ?riends of 3utabaga *eeting. O'd lo=e to2 but Ot 9ouldn't be fair to t8e ot8er Feautiful People. O'd lo=e to2 but Ot's *y para5eet's bo9ling nig8t. O'd lo=e to2 but it's too close to t8e turn of t8e century. O'd lo=e to2 but *y bat8roo* tiles need grouting. O'd lo=e to2 but *y c8ocolate-appreciation class *eets t8at nig8t. O'd lo=e to2 but *y crayons all *elted toget8er. O'd lo=e to2 but *y 4ress ?or ,bscurity class *eets t8en. O'd lo=e to2 but *y fa=orite co**ercial is on DV. O'd lo=e to2 but *y -illard ?ill*ore ?an Jlub *eets t8en. O'd lo=e to2 but *y *ot8er 9ould ne=er let *e 8ear t8e end of it. O'd lo=e to2 but *y pal* reader ad=ised against it. O'd lo=e to2 but *y patent is pending. O'd lo=e to2 but *y plot to ta5e o=er t8e 9orld is t8ic5ening. O'd lo=e to2 but *y subconscious says no. O'd lo=e to2 but *y uncle escaped again.
2E12. O'd lo=e to2 but *y yucca plant is feeling yuc5y. 2E1(. O'd lo=e to2 but none of *y soc5s *atc8. 2E1). O'd lo=e to2 but people are bla*ing *e for t8e Hpanis8-0*erican 7ar. 2E1/. O'd lo=e to2 but t8e grunion are running. 2E16. O'd lo=e to2 but t8e last ti*e O 9ent2 O ne=er ca*e bac5. 2E1@. O'd lo=e to2 but t8e *an on tele=ision told *e to stay tuned. 2E1:. O'd lo=e to2 but t8e President said 8e *ig8t drop in. 2E1E. O'd lo=e to2 but t8ere are i*portant 9orld issues t8at need 9orrying about. 2E20. O'd lo=e to2 but t8ere's a disturbance in t8e ?orce. 2E21. O'd lo=e to2 but you 5no9 8o9 9e psyc8os are. 2E22. O'd rat8er be pissed off t8an pissed on. 2E2(. O'd rat8er 8a=e a bottle in front of *e t8an a frontal loboto*y. 2E2). O'd rat8er 8a=e a bottle in front of *e t8an a frontal loboto*y. 2E2/. O'd rat8er 8a=e a free bottle in front of *e t8an a prefrontal loboto*y. 2E26. O'd really li5e to lay one across your teet8. - Fe=erly 2E2@. O'll be bac5.... - D8e Der*inator 2E2:. O'll burn *y boo5s. 2E2E. O'll buy t8at for a dollar 2E(0. O'll grant t8e rando* access to *y 8eart2 D8oul't tell *e all t8e constants of t8y lo=eW 0nd so 9e t9o s8all all lo=e's le**as pro=e 0nd in our bound partition ne=er part. - Htanisla9 Be*2 CJyberiadC 2E(1. O'll 8a=e anot8er bo9l of cereal2 please. - >ane 2E(2. O'll 8a=e one brain on drugs 9it8 bacon2 toast and Uuice. 2E((. O'll 8a=e 98at t8e guy on t8e floor is 8a=ing... 2E(). O'll Uu*p off t8at bridge 98en O co*e to it. 2E(/. O'll ne=er get off t8is planet. 2E(6. O'll panic if O bloody 9ell 9ant to 2E(@. O'll see you in 8ell before O'd do t8at. 2E(:. O'll tell ya2 life aint easy for a boy na*ed Hue 2E(E. O'll turn o=er a ne9 leaf. 2E)0. O'* a analog *an in a digital 9orld. 2E)1. O'* a brain in a =at. 0re you one too? 2E)2. O'* a consultant because O'd rat8er be self-une*ployed. 2E)(. O'* a creationistW O refuse to belie=e t8at O could 8a=e e=ol=ed fro* *an. 2E)). O'* a fig*ent of your i*agination. 2E)/. O'* a +olly9ood 9riterW so O put on a sports Uac5et and ta5e off *y brain. 2E)6. O'* a lu*berUac5 and O'* ,T. 2E)@. O'* a Bu*berUac5 and O'* ,T 2E):. O'* a po9er-cra ed psycopat8 - O don't 70KD inner peace 2E)E. O'* a 9or5a8olic 98o resisted a rest. 2E/0. O'* all for co*puter dating2 but O 9ouldn't 9ant one to *arry *y sister. 2E/1. O'* all for co*puter dating2 but O 9ouldn't 9ant one to *arry *y sister. 2E/2. O'* an absolute2 off-t8e-9all fanatical *oderate. 2E/(. O'* as confused as a baby at a topless bar 2E/). O'* at t8e corner of 7al5 and 4on't 7al5. 2E//. O'* beco*ing addicted to 8appiness. 2E/6. O'* bloody sic5 of standing 8ere e=ery day. - ,'Frien 2E/@. O'* Fugs Funny of Forg. 78at's up Jollecti=e? 2E/:. O'* cutting boy2 but you aint bleeding - ?og8orn Beg8orn 2E/E. O'* dangerous 98en O 5no9 98at O'* doing.
2E60. O'* dangerous 98en O 5no9 98at O'* doing. 2E61. O'* defending 8er 8onor2 98ic8 is *ore t8an s8e e=er did. 2E62. O'* fascinated by t8e 9ay *e*ory diffuses fact. 2E6(. O'* fascinated by t8e 9ay *e*ory diffuses fact. 2E6). O'* fed up to t8e ears 9it8 old *en drea*ing up 9ars for young *en to die in. <eorge -c<o=ern 2E6/. O'* feeling Uust great. 2E66. O'* fir*. ;ou're obstinate. +e's a pig8eaded fool. 2E6@. O'* fleRible... Uust don't c8ange anyt8ing. 2E6:. O'* glad t8at ignorance is suc8 bliss. 2E6E. O'* going to 5-5-5-5-5-5-5ill you T-5-5-5-5-5-5en 2E@0. O'* going to t8e -issing Persons Fureau to see if anyone is loo5ing for *e. 2E@1. O'* gonna plead insanity2 98at about you? 2E@2. O'* in c8arge 8ere. - 0l +aig 2E@(. O'* in lo=e 9it8 Husy... 2E@). O'* in Pittsburg8. 78y a* O 8ere? - +arold Lrey2 Kobel Baureate 2E@/. O'* in searc8 of *yself. +a=e you seen *e any98ere? 2E@6. O'* in s8ape ... 3ounds a s8ape isn't it? 2E@@. O'* Uust a perip8eral =isionary. 2E@:. O'* Uust 8ere for *oral support. Ognore t8e gun. 2E@E. O'* lea=ing *y body to science fiction. 2E:0. O'* losin' it - <eordi 2E:1. O'* lost2 but O'* still *a5ing pretty good ti*e 2E:2. O'* *ad as 8ell2 and O'* not going to ta5e it any*ore 2E:(. O'* *ad at you because you 9ere so*eone else. 2E:). O'* *a5ing a 8o*e *o=ie called CD8e D8ing D8at <re9 in -y 3efrigeratorC. 2E:/. O'* *ooning you no92 you Uust can't see *e. 2E:6. O'* *ore 8u*ble t8an you are 2E:@. O'* *uc8 too young to feel t8is da*ned old 2E::. O'* neit8er for2 nor against apat8y 2E:E. O'* no stranger2 Uust a friend you 8a=en't *et... 2EE0. O'* not a co*plete idiot - se=eral parts are *issing. 2EE1. O'* not a co*plete idiot..se=eral parts are *issing. 2EE2. O'* not a croo5W O'* Cet8ically c8allenged.C 2EE(. O'* not a *inority. O'* an outnu*bered *aUority 2EE). O'* not a real sysop2 O Uust play one on DV. 2EE/. O'* not a 9itc8 doctor-- O'* only a fol5 *edic. 2EE6. O'* not an actor2 but O play one on DV. 2EE@. O'* not arrogant2 O'* 3O<+D 2EE:. O'* not as du*b as you loo5. 2EEE. O'* not confused2 O'* Uust 9ell-*iRed. (000. O'* not cynical. >ust eRperienced. (001. O'* not cynical. >ust eRperienced. (002. O'* not dead yet O t8in5 O'll go for a 9al5. (00(. O'* not dead2 O'* *etabolically c8allenged. (00). O'* not dead. O'* electroencep8elograp8ically c8allenged. (00/. O'* not deadW O'* C*etabolically c8allenged.C (006. O'* not going deaf. O'* ignoring you. (00@. O'* not Uust one of your snuggle-girls2 7ill. - Fe=erly (00:. O'* not lost O'* Clocationally c8allenged.C
(00E. O'* not lost2 but O don't 5no9 98ere O a*. (010. O'* not lost... O'* Clocationally c8allengedC. (011. O'* not nearly as t8in5 as you confused O a*. (012. O'* not nearly as t8in5 as you confused O a*. (01(. O'* not opinionated2 O'* Uust al9ays rig8t (01). O'* not paranoid 78ic8 of *y ene*ies told you t8at? (01/. O'* not preUudiced. O 8ate e=eryone eSually. (016. O'* not sc8i op8renic. Ot's t8is guy beside *e (01@. O'* not tense2 Uust terribly 0"B"."3"D. (01:. O'* not under t8e al5afluence of in5a8ol t8at so*e t8in5le peep O a*. Ot's Uus t8e drun5er O sit 8ere t8e longa O get (01E. O'* not under t8e al5afluence of in5a8ol t8at so*e t8in5le peep O a*. Ot's Uust t8e drun5er O sit 8ere t8e longer O get. (020. O'* not 9earing any under9ear. ?il* at 11. (021. O'* on t8e corner of 7al5 and 4on't 7al5 (022. O'* only 8ere for t8e salad bar. (02(. O'* only paranoid because e=eryone's against *e. (02). O'* out of bed and dressed. 78at *ore do you 9ant? (02/. O'* out of bed and dressed. 78at *ore do you 9ant? (026. O'* practicing asserti=eness. 4o you t8in5 t8at's o5ay? (02@. O'* prepared for all e*ergencies but totally unprepared for e=eryday life. (02:. O'* really bouncing 9it8 Uoy today. (02E. O'* really enUoying *y stay on eart8. (0(0. O'* really enUoying not tal5ing to you ... Bet's not tal5 again 3.0B soon ... (0(1. O'* really enUoying not tal5ing to you2 so let's not tal5 again real soon2 o5ay? (0(2. O'* really sorry about al9ays saying O'* really sorry. (0((. O'* sa=ing *y *oney for 98en t8ey get P8aser Printers (0(). O'* so bro5e O can't e=en pay attention (0(/. O'* H, confused... (0(6. O'* so full of Uoie de =i=re. (0(@. O'* solidly be8ind 98ic8e=er side e=entually 9ins. (0(:. O'* sorry 4a=e2 but O'* afraid O can't do t8at. - +0B E000 (0(E. O'* sorry2 4a=e. O can't do t8at. O'* all out of Daglines (0)0. O'* sorry2 t8is tagline is not an apology (0)1. O'* sorry. O'* afraid O'=e caug8t poetry. (0)2. O'* sorry. ;esterday 9as t8e deadline on all co*plaints. (0)(. O'* spending a year dead for taR purposes. (0)). O'* spending a year dead for DaR Purposes (0)/. O'* sure it's in t8e *anual so*e98ere... (0)6. O'* sure t8at if t8ere 9ere a deat8 penalty *ore people 9ould be ali=e today. K. 3eagan (0)@. O'* t8e leader2 98ic8 9ay did t8ey go? (0):. O'* t8e person your *ot8er 9arned you about... (0)E. O'* t8e person your *ot8er 9arned you about. (0/0. O'* t8e Vice-President. D8ey 5no9 it2 and t8ey 5no9 t8at O 5no9 it. - Vice President 4an Vuayle (0/1. O'* too s5eptical to deny t8e possibility of anyt8ing... (0/2. O'* trying to t8in52 but not8ing 8appens. - Jurly (0/(. O'* usually a9a5e near t8e end of t8e day. (0/). O'* 9arning you ,ne step closer and O'll drop carrier
(0//. O'* 9or5ing on *y 2nd $*illion... <a=e up on t8e 1st. (0/6. O'* 9riting a boo5. O'=e got t8e page nu*bers done. (0/@. O'=e been sc8eduled for a 5ar*a transplant. (0/:. O'=e been t8ere. (0/E. O'=e co*e for an argu*ent (060. O'=e fallen...but O'll be bac5... - 0rnold Hc89ar eneg (061. O'=e gi=en up reading boo5sW O find it ta5es *y *ind off *yself. (062. O'=e got 2/6T of 30-2 so 98y can't O run 7indo9s (.0? (06(. O'=e got a de=il in *e. (06). O'=e got a -ic5ey -ouse PJ 9it8 a <oofy operating syste*. (06/. O'=e got a *ind li5e a... a... 98at's t8at t8ing called? (066. O'=e got a =ery bad feeling about t8is. (06@. O'=e got to ad*it it's getting better. (06:. O'=e 8ad Suite a bit to drin52 and you're beginning to loo5 pretty good. - Pic5 up line (06E. O'=e Uust bro5en all pre=ious records on Hpace On=aders. (0@0. O'=e Uust 8ad a pint of ,9d 3oger2 so e=eryt8ing is rosy. (0@1. O'=e ne=er been 8urt by anyt8ing O didn't say. (0@2. O'=e only got t9el=e cards. (0@(. O'=e used Fasic so long2 *y brain 8as gonesub per*anently (0@). OF- 8ad a PB[O2 Ots syntaR 9orse t8an >,HHW 0nd e=ery98ere t8is language 9ent2 Ot 9as a total loss. (0@/. OF-& 78en you care enoug8 to spend t8e =ery *ost. (0@6. Odentify your =isitor. (0@@. Odiot FoR2 n.& D8e part of t8e en=elope t8at tells a person 98ere to place t8e sta*p 98en t8ey can't Suite figure it out for t8e*sel=es. - 3ic8 +all2 CHnigletsC (0@:. Odiot2 n.& 0 *e*ber of a large and po9erful tribe 98ose influence in 8u*an affairs 8as al9ays been do*inant and controlling. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC (0@E. Odleness is leisure gone to seed. (0:0. Odleness is t8e 8oliday of fools. (0:1. Of C3C is 3e=erse2 8o9 co*e C4C is ?,37034? (0:2. Of 0 X F and F X J2 t8en 0 X J2 eRcept 98ere =oid or pro8ibited by la9. - 3oy Hantoro (0:(. Of a group of K persons i*ple*ents a J,F,B co*piler2 t8ere 9ill be K-1 passes. Ho*eone in t8e group 8as to be t8e *anager. - D. J8eat8a* (0:). Of a Uob's 9ort8 doing2 it's 9ort8 ta5ing t8e trouble to as5 so*eone to do it. (0:/. Of a listener nods 8is 8ead 98en you're eRplaining your progra*2 9a5e 8i* up. (0:6. Of a President doesn't do it to 8is 9ife2 8e'll do it to 8is country. (0:@. Of a progra* is useful2 it *ust be c8anged. (0::. Of a string 8as one end2 it 8as anot8er. (0:E. Of a tool is put a9ay 98en you're sure it 9on't be needed again2 it 9ill. Hoon. (0E0. Of a tree fell on a florist29ould 8e *a5e a sound? (0E1. Of all be true t8at O do t8in52 D8ere be ?i=e 3easons 98y one s8ould 4rin5W <ood friends2 good 9ine2 or being dry2 ,r lest 9e s8ould be by-and-by2 ,r any ot8er reason 98y. (0E2. Of all else fails2 i**ortality can al9ays be assured by spectacular error. - >o8n Tennet8 <albrait8 (0E(. Of all else fails2 read t8e directions (0E). Of all goes 9ell2 you'=e o=erloo5ed so*et8ing
(0E/. Of all is not lost2 t8en 98ere is it? (0E6. Of all t8e 9orld's a stage2 O sure got lousy seats. (0E@. Of all t8e 9orld's a stage2 O 9ant to operate t8e trap door. - Paul Featty (0E:. Of all t8e 9orld's econo*ists 9ere laid end to end2 9e 9ouldn't reac8 a conclusion. - 7illia* Fau*ol (0EE. Of an eRperi*ent 9or5s2 so*et8ing 8as gone 9rong. (100. Of an eRperi*ent 9or5s2 you *ust be using t8e 9rong eSuip*ent. (101. Of an ite* is ad=ertised as Cunder $/0C2 you can bet it's not $1E.E/. (102. Of any 9ord is i*proper at t8e end of a sentence2 a lin5ing =erb is. (10(. Of anyt8ing -can't- go 9rong2 it 9ill (10). Of anyt8ing can go 9rong2 it 9ill. (10/. Of anyt8ing can go 9rong2 it 9ill. (106. Of 0t ?irst ;ou 4on't Hucceed Ognore D8e 4ocs... (10@. Of at first you don't succeed2 call it Ver 1.0. (10:. Of at first you don't succeed2 call it Ver 1.0 (10E. Of at first you don't succeed2 c8ange t8e rules (110. Of at first you don't succeed2 cry. (111. Of at first you don't succeed2 fa5e it (112. Of at first you don't succeed2 forget it. (11(. Of at first you don't succeed2 gi=e up2 no use being a da*n fool. (11). Of at first you don't succeed2 gi=e up. Ko use being a da*n fool. (11/. Of at first you don't succeed2 Uoin t8e club. (116. Of at first you don't succeed2 lo9er your standards. (11@. Of at first you don't succeed2 SuitW don't be a nut about success. (11:. Of at first you don't succeed2 redefine success. (11E. Of at first you don't succeed2 try s5ydi=ing ... (120. Of at first you don't succeed2 9or5 for -icrosoft. (121. Of at first you don't succeed2 you're doing about a=erage. (122. Of at first you don't suceed2 you're about nor*al. (12(. Of ban5ers can count2 8o9 co*e t8ey 8a=e eig8t 9indo9s and only four tellers? (12). Of Jlinton is t8e ans9er2 t8e Suestion *ust be stupid. (12/. Of co*puters get too po9erful2 9e can organi e t8e* into a co**ittee -- t8at 9ill do t8e* in. (126. Of Jorn ,il Os -ade ?ro* Jorn2 78at's Faby ,il -ade ?ro*? (12@. Of 4ata is Cfully functional2C can 8e get a 9o*an pregnant? (12:. Of entropy is increasing2 98ere is it co*ing fro*? (12E. Of e=eryt8ing is co*ing your 9ay t8en you're in t8e 9rong lane. (1(0. Of e=eryt8ing is co*ing your 9ay2 you're in t8e 9rong lane (1(1. Of e=eryt8ing see*s to be going 9ell2 you 8a=e ob=iously o=erloo5ed so*et8ing. (1(2. Of fifty *illion people say a foolis8 t8ing2 it's still a foolis8 t8ing. - F. 3ussell (1((. Of flies couldn't fly2 9ould t8ey be called 9al5s? (1(). Of <od 8ad intended -an to H*o5e2 +e 9ould 8a=e set 8i* on ?ire. (1(/. Of <od 8ad intended -an to 7al52 +e 9ould 8a=e gi=en 8i* ?eet. (1(6. Of <od 8ad intended -an to 7atc8 DV2 +e 9ould 8a=e gi=en 8i* 3abbit .ars. (1(@. Of <od 8ad intended -en to H*o5e2 +e 9ould 8a=e put J8i*neys in t8eir +eads. (1(:. Of <od 8ad *eant for us to be in t8e 0r*y2 9e 9ould 8a=e been born 9it8 green2 baggy s5in. (1(E. Of <od 8ad *eant for us to be na5ed2 9e 9ould 8a=e been born t8at 9ay.
(1)0. Of <od 8ad *eant us to eat *eringue2 8e 9ould 8a=e *ade c8ic5ens fart *ore. (1)1. Of <od 8ad not gi=en us stic5y tape2 it 9ould 8a=e been necessary to in=ent it. (1)2. Of <od 8ad 9anted you to go around nude2 +e 9ould 8a=e gi=en you bigger 8ands. (1)(. Of <od 8ad 9anted you to go around nude2 +e 9ould 8a=e gi=en you bigger 8ands. (1)). Of <od is perfect2 98y did +e create discontinuous functions? (1)/. Of guns are outla9ed2 can 9e use s9ords? (1)6. Of 8appiness is in your destiny2 you need not be in a 8urry. (1)@. Of 8u*ans 8a=e orgas*s2 do t8e Forg 8a=e Forgas*s? (1):. Of O buy t8e steel 9ool2 can you 5nit *e a F-7? (1)E. Of O cannot bend +ea=en2 O s8all *o=e +ell. (1/0. Of O follo9 you 8o*e 9ill you 5eep *e? (1/1. Of O follo9 you 8o*e2 9ill you 5eep *e? (1/2. Of O 8ad a plantation in <eorgia and a 8o*e in +ell2 O'd sell t8e plantation and go 8o*e. - .ugene P. <allag8er (1/(. Of O 8ad any 8u*ility O 9ould be perfect. - Ded Durner (1/). Of O 8a=e not seen so far it is because O stood in giant's footsteps. (1//. Of O sa=e t8e 98ales2 98ere do O 5eep t8e*? (1/6. Of O sa=e t8e 98ales2 98ere do O 5eep t8e*? (1/@. Of O sa=e ti*e2 98en do O get it bac5 ? (1/:. Of O sa=e ti*e2 98en do O get it bac5 ? (1/E. Of O tra=eled to t8e end of t8e rainbo9 0s 4a*e ?ortune did intend2 -urp8y 9ould be t8ere to tell *e D8e pot's at t8e ot8er end. - Fert 78itney (160. Of O 9ant your opinion O'll beat it fro* you (161. Of O 9ant your opinion O'll beat it out of you (162. Of O 9as .l=is2 9ould you scre9 *e? - Pic5 up line (16(. Of O 9ere you2 98o'd be *e? (16). Of O'* lying2 O'* dying - 4a=id 0ddison (16/. Of O'=e told you once2 O'=e told you a t8ousand ti*es2 resist 8yperbole. (166. Of ignorance is bliss2 98y aren't *ore people 8appy? (16@. Of ignorance is bliss2 98y aren't t8ere *ore 8appy people? (16:. Of in doubt2 *a5e it sound con=incing. (16E. Of it ain't bro5e2 brea5 it and c8arge for repair. (1@0. Of it ain't bro5e2 8it it 8arder. (1@1. Of it ain't bro5e2 9ait a day or t9o (1@2. Of it ain't one t8ing2 it's t9o or t8ree... (1@(. Of it doesn't *atter2 it doesn't *atter. (1@). Of it 8appens2 it *ust be possible. (1@/. Of it isn't bro5en2 don't fiR it. (1@6. Of it Ua*s2 force it. Of it brea5s2 it needed replace*ent any9ay. (1@@. Of it Ua*s2 force it. Of it brea5s2 it needed replacing any9ay. (1@:. Of it Ua*s2 force it. Of it brea5s2 it needed replacing. (1@E. Of it loo5s easy2 it's toug8. Of it loo5s toug82 it's da*n 9ell i*possible. (1:0. Of it pours before se=en2 it 8as rained by ele=en. (1:1. Of it says Cone si e fits all2C it doesn't fit anyone. (1:2. Of it 9as easy2 it 9ouldn't be any fun. (1:(. Of it 9asn't so cool out today2 it 9ould be 9ar*er. (1:). Of it 9asn't so 9ar* out today2 it 9ould be cooler. (1:/. Of it 9eren't for t8e last *inute2 not8ing 9ould e=er get done.
(1:6. Of it 9or5s2 don't fiR it. (1:@. Of it 9or5s2 O didn't do it. (1::. Of it 9or5s2 rip it apart and find out 98y (1:E. Of it 9or5s2 rip it apart and find out 98y (1E0. Of it 9or5s2 so*et8ing 9ent 9rong. (1E1. Of it's good2 t8ey discontinued it. (1E2. Of it's not bro5e2 let *e ta5e a crac5 at it. (1E(. Of it's not Hcottis8 OD'H J33000PPP (1E). Of it's ob=ious2 it's ob=iously 9rong. (1E/. Of it's stupid2 but it 9or5s2 t8en it's not stupid. (1E6. Of it's too loud2 you're too old. - Fu*per stic5er (1E@. Of it's tourist season2 98ere do O get a license? (1E:. Of it's Duesday2 t8is *ust be so*eone else's fortune. (1EE. Of it's 9or5ing ,T2 t8en so*et8ing's <,DD0 be 9rong (200. Of >esus J8rist 9ere to co*e today2 people 9ould not e=en crucify 8i*. D8ey 9ould as5 8i* to dinner2 and 8ear 98at 8e 8ad to say2 and *a5e fun of it. - D8o*as Jarlyle (201. Of life gi=es you le*ons2 *a5e le*onade. (202. Of life is a stage2 O 9ant so*e better lig8ting. (20(. Of life is but a drea* please 9a5e *e up. (20). Of little green *en land in your bac5 yard2 8ide any little green 9o*en you'=e got in t8e 8ouse. - -i5e +arding2 CD8e 0r*c8air 0narc8ist's 0l*anacC (20/. Of lo=e is blind2 lingerie *a5es great braille. (206. Of lo=e is blind2 98y is lingerie so popular? (20@. Of *at8e*atically you end up 9it8 t8e 9rong ans9er2 try *ultiplying by t8e page nu*ber. (20:. Of *oney can't buy 8appiness2 O guess you'll Uust 8a=e to rent it. (20E. Of *ore t8an one person is responsible for a bug2 no one is at fault. (210. Of no one uses it2 t8ere's a reason. (211. Of not controlled2 9or5 flo9s to t8e co*petent person until 8e is sub*erged. (212. Of only .instein 8ad a ):64M-((.... li5e O do... (21(. Of only .instein 8ad a ):64M-((.... (21). Of only <od 9ould gi=e *e so*e clear sign Bi5e *a5ing a large deposit in *y na*e at a H9iss ban5. - 7oody 0llen2 C7it8out ?eat8ersC (21/. Of only O could be respected 9it8out 8a=ing to be respectable. (216. Of only O could be respected 9it8out 8a=ing to be respectable. (21@. Of only one could get t8at 9onderful feeling of acco*plis8*ent 9it8out 8a=ing to acco*plis8 anyt8ing. (21:. Of only one could get t8at 9onderful feeling of acco*plis8*ent 9it8out 8a=ing to acco*plis8 anyt8ing. (21E. Of plugging it in doesn't 8elp2 turn it on. (220. Of plugging it in doesn't 8elp2 turn it on. (221. Of practice *a5es perfect2 and nobody's perfect2 98y practice? (222. Of puns are outla9ed2 only outla9s 9ill 8a=e puns. (22(. Of V 9as fe*ale2 9ould 8e be called ,? (22). Of V 9ere castrated 9ould 8e beco*e ... , ??? (22/. Of rabbits feet are so luc5y2 98at 8appened to t8e rabbit (226. Of rabbits feet are so luc5y298at 8appened to t8e rabbit (22@. Of rabbits' feet are so luc5y2 98at 8appened to t8e rabbit? (22:. Of ric82 eat 98en you please. Of poor2 eat 98en you can.
(22E. Of scientific reasoning 9ere li*ited to t8e logical processes of arit8*etic2 9e s8ould not get =ery far in our understanding of t8e p8ysical 9orld. ,ne *ig8t as 9ell atte*pt to grasp t8e ga*e of po5er entirely by t8e use of t8e *at8e*atics of probability. - Vanne=ar Fus8 (2(0. Of so*e people didn't tell you2 you'd ne=er 5no9 t8ey'd been a9ay on =acation. (2(1. Of so*eone 8ad told *e O 9ould be Pope one day2 O 9ould 8a=e studied 8arder. - Pope >o8n Paul O (2(2. Of so*eone says 8e 9ill do so*et8ing C9it8out fail2C 8e 9on't. - , *an's Ba9 (2((. Of speed scares you2 buy 7indo9s (.1 (2(). Of speed scares you2 try -icro$oft 7indo9s. (2(/. Of speed scares you2 try 7indo9s... (2(6. Of t8e code and t8e co**ents disagree2 t8en bot8 are probably 9rong. - Kor* Hc8ryer (2(@. Of t8e facts do not confor* to your t8eory2 t8ey *ust be disposed of. (2(:. Of t8e force so strong 9it8 ;oda is2 98y in proper order a sentence contruct cannot 8e? (2(E. Of t8e odds are a *illion to one against so*et8ing occurring2 c8ances are /0-/0 it 9ill. (2)0. Of t8e opposite of CproC is CconC2 t8en 98at's t8e opposite of CprogressC? (2)1. Of t8e s8oe fits2 its ugly. (2)2. Of t8e s8oe fits2 put it in your *out8. (2)(. Of t8e s8oe fits2 try 9earing it on t8e ot8er footW t8at's bound to *a5e you feel better. (2)). Of t8ere are epigra*s2 t8ere *ust be *eta-epigra*s. (2)/. Of t8ere is a <od2 8o9 co*e 8e allo9s Fonnie Bangford to eRist? (2)6. Of t8ere is a possibility of se=eral t8ings going 9rong2 t8e one t8at 9ill cause t8e *ost da*age 9ill be t8e one to go 9rong. (2)@. Of t8ere is a 9ay to delay in i*portant decision2 t8e good bureaucracy2 public or pri=ate2 9ill find it. - Par5inson's ?ift8 Ba9 (2):. Of t8ere is no <od2 98o pops up t8e neRt TleeneR? - 0rt +oppe (2)E. Of t8ere is no 9ind2 ro9. (2/0. Of t8ere 9as a nuclear bo*bing2 9ould O be ali=e to care? (2/1. Of t8ere 9as a 9ait for V to s8o9 up2 9ould t8ere be a V-9ait? (2/2. Of t8ere's one t8ing O can't stand2 it's intolerance. (2/(. Of t8ings appear to be going 9ell2 you 8a=e o=erloo5ed so*et8ing. (2/). Of t8is fortune didn't eRist2 so*ebody 9ould 8a=e in=ented it. (2//. Of t8is is ti*e-s8aring2 gi=e *e *y s8are rig8t no9. Ot's not ti*e yet. (2/6. Of t8is 9ere an actual tagline2 it 9ould be funny. (2/@. Of t8is 9ere subUuncti=e2 O'* in t8e 9rong *ood. (2/:. Of ti*e 8eals all 9ounds2 8o9 co*e t8e belly button stays t8e sa*e? (2/E. Of ti*e 8eals all 9ounds2 98y does t8e belly button stay t8e sa*e? (260. Of t9o *en agree on e=eryt8ing2 you *ay be sure t8at one of t8e* is doing t8e t8in5ing. - Byndon Faines >o8nson (261. Of 9e can't fiR it - it's bro5en (262. Of 9e do not c8ange our direction 9e are li5ely to end up 98ere 9e are 8eaded. (26(. Of 9e do not succeed2 t8en 9e run t8e ris5 of failure. - Vice President 4an Vuayle (26). Of 9e left t8e bones out it 9ouldn't be crunc8y. (26/. Of 9e left t8e bones out it 9ouldn't be crunc8y (266. Of 7indo9s suc5ed it 9ould be good for so*et8ing.
(26@. Of 9inning isn't i*portant t8en 98y 5eep score? (26:. Of you al9ays postpone pleasure you 9ill ne=er 8a=e it. Vuit 9or5 and play (26E. Of you are gi=en a ta5e-8o*e eRa*2 you 9ill forget 98ere you li=e. (2@0. Of you are gi=en an open-boo5 eRa*2 you 9ill forget your boo5. (2@1. Of you as5 8o9 *uc8 it is2 you can't afford it. (2@2. Of you belie=e in tele5inesis2 raise *y 8and. (2@(. Of you can lead it to 9ater and force it to drin52 it isn't a 8orse. (2@). Of you can read t8is2 you're irrele=ant. - Forg (2@/. Of you can sur=i=e deat82 you can probably sur=i=e anyt8ing. (2@6. Of you can't be fa*ous2 try infa*ous. (2@@. Of you can't be good2 be careful. Of you can't be careful2 gi=e *e a call. (2@:. Of you can't beat e*'2 *od e*'. (2@E. Of you can't con=ince t8e* - confuse t8e*. - +arry H. Dru*an (2:0. Of you can't da le 'e* 9it8 brilliance2 baffle 'e* 9it8 bulls8it. (2:1. Of you can't elucidate2 obfuscate. (2:2. Of you can't laug8 at yourself2 O'll laug8 at you. (2:(. Of you can't learn to do it 9ell2 learn to enUoy doing it badly. (2:). Of you can't learn to do it 9ell2 learn to enUoy doing it badly. (2:/. Of you cannot con=ince t8e*2 confuse t8e*. - +arry H Dru*an (2:6. Of you continually gi=e you 9ill continually 8a=e. (2:@. Of you didn't get caug8t2 did you really do it? (2::. Of you didn't get caug8t2 did you really do it? (2:E. Of you do not c8ange your direction2 you *ay end 98ere you are 8eaded. (2E0. Of you do so*et8ing 98ic8 you are sure 9ill *eet 9it8 e=erybody's appro=al2 so*ebody 9on't li5e it. (2E1. Of you do 98at you'=e al9ays done2 you'll get 98at you'=e al9ays gotten. (2E2. Of you don't care 98ere you are2 t8en you ain't lost. (2E(. Of you don't care 98ere you are2 t8en you ain't lost. (2E). Of you don't 5no9 98at you're doing2 do it neatly. (2E/. Of you don't li5e t8e ne9s2 go out and *a5e so*e of your o9n. - Fu*per stic5er (2E6. Of you don't t8in5 9o*en are eRplosi=e2 drop one (2E@. Of you don't try ne9 solutions2 t8en you can eRpect ne9 e=ils. (2E:. Of you eRplain so clearly t8at nobody can *isunderstand2 so*ebody 9ill. (2EE. Of you fool around 9it8 so*et8ing long enoug82 it 9ill e=entually brea5. ((00. Of you get angry at a ne9spaper colu*nist2 8e'll get ric8 or fa*ous or bot8. ((01. Of you gi=e a person a fis82 t8ey'll fis8 for a day. Fut if you train a person to fis82 t8ey'll fis8 for a lifeti*e. - Vice President 4an Vuayle ((02. Of you gi=e Jongress a c8ance to =ote on bot8 sides of an issue2 it 9ill al9ays do it. - Bes 0spin2 4.2 7isconsin ((0(. Of you 8ad any brains2 you'd be dangerous. ((0). Of you 8a=e a procedure 9it8 10 para*eters2 you probably *issed so*e. ((0/. Of you 8a=e not8ing to do2 don't do it 8ere. ((06. Of you 8a=e not8ing to say2 please only say it once ((0@. Of you 8ear an ,nion ring2 please ans9er it ((0:. Of you 5eep anyt8ing long enoug82 you can t8ro9 it a9ay. ((0E. Of you 5ne9 98at -ona Bisa 5ne92 you'd s*ile too. ((10. Of you li=e in a country run by co**ittee2 be on t8e co**ittee. - <ra8a* Hu**er ((11. Of you loo5 Uust close enoug82 you can see anyt8ing you 9ant.
((12. Of you *a5e a *ista5e2 you rig8t it i**ediately to t8e best of your ability. ((1(. Of you *a5e people t8in5 t8ey're t8in5ing2 t8ey'll lo=e youW but if you really *a5e t8e* t8in5 t8ey'll 8ate you. ((1). Of you need a calculator2 its too co*pleR. ((1/. Of you only 8a=e a 8a**er2 you tend to see e=ery proble* as a nail. - -aslo9 ((16. Of you percei=e t8at t8ere are four possible 9ays in 98ic8 a procedure can go 9rong2 and circu*=ent t8ese2 t8en a fift8 9ay 9ill pro*ptly de=elop. ((1@. Of you pic5 up a star=ing dog and *a5e 8i* prosperous2 8e 9ill not bite you. D8is is t8e principal difference bet9een a dog and a *an. - -ar5 D9ain ((1:. Of you pus8 t8e CeRtra iceC button on t8e soft drin5 =ending *ac8ine2 you 9on't get any ice. Of you pus8 t8e Cno iceC button2 you'll get ice2 but no cup. ((1E. Of you put garbage in a co*puter not8ing co*es out but garbage. Fut t8is garbage2 8a=ing passed t8roug8 a =ery eRpensi=e *ac8ine2 is so*e8o9 enobled and none dare critici e it. ((20. Of you put it off long enoug82 it *ig8t go a9ay. ((21. Of you really 9ant to 5no92 you 9on't as5 *e. ((22. Of you redo a batc8 file2 is it a son of a batc8? ((2(. Of you refuse to accept anyt8ing but t8e best you =ery often get it. ((2). Of you sa=e t8e 9orld too often2 it begins to eRpect it. ((2/. Of you see a brig8t strea5 in t8e s5y co*ing at you2 duc5. - Hatellite Hafety Dip #1) ((26. Of you s*o5e after seR2 you're doing it too fast. ((2@. Of you stay up all nig8t 9ondering 98ere t8e sun is2 it 9ill da9n on you. ((2:. Of you suspect a *an2 don't e*ploy 8i*. ((2E. Of you t8in5 before you spea5 t8e ot8er guy gets 8is Uo5e in first. (((0. Of you t8in5 big enoug82 you'll ne=er 8a=e to do it. - 3eisner's 3ule of Jonceptual Onertia (((1. Of you t8in5 education is eRpensi=e - try ignorance. - 4ere5 Fo5 (((2. Of you t8in5 last Duesday 9as a drag2 9ait till you see 98at 8appens to*orro9 ((((. Of you t8in5 nobody cares if you're ali=e2 try *issing a couple of car pay*ents. - .arl 7ilson (((). Of you t8in5 t8e Lnited Htates 8as stood still2 98o built t8e largest s8opping center in t8e 9orld? - 3ic8ard KiRon (((/. Of you t8in5 t8is fortune is confusing2 t8en c8ange one pig. (((6. Of you t8oug8t yesterday 9as bad2 9ait till you see 98at 8appens today. (((@. Of you t8ro9 a cat out t8e car 9indo92 is it 5itty litter? (((:. Of you treat people rig8t t8ey 9ill treat you rig8tW E0 per cent of t8e ti*e. (((E. Of you try to please e=eryone2 so*ebody is not going to li5e it. (()0. Of you 9a5e up and find yourself a success2 t8en you 8a=en't been asleep. (()1. Of you 9a5e up Hleepy G <ru*py2 you *ust be Hno9 78ite. (()2. Of you 9ant to 5no9 8o9 old a *an is2 as5 8is brot8er-in-la9. (()(. Of you 9ant to 5no9 8o9 old a 9o*an is2 as5 8er sister-in-la9. (()). Of you 9ant your spouse to listen and pay strict attention to e=ery 9ord you say2 tal5 in your sleep. (()/. Of you 9is8 to succeed2 consult t8ree old people. (()6. Of you 9is82 ;ou 9ill 8a=e an opportunity. (()@. Of you 9ould 5eep a secret fro* an ene*y2 tell it not to a friend. (():. Of you're early2 it's cancelled2 if you're on ti*e2 it's late2 if you're late2 you're late. (()E. Of you're feeling good2 don't 9orryW you'll get o=er it.
((/0. Of you're going to do so*et8ing tonig8t t8at you'll be sorry for to*orro9 *orning2 sleep late. - +enny ;oung*an ((/1. Of you're 8appy2 you're successful. ((/2. Of you're not part of t8e solution2 you're part of t8e precipitate. ((/(. Of you're not =ery cle=er you s8ould be conciliatory. - FenUa*in 4israeli ((/). Of you're on fire2 a=oid gasoline and ot8er fla**able *aterials. - Hafety Dips for t8e Post-Kuclear .Ristence ((//. Of you're trying to dri=e *e cra y2 you're too late ((/6. Of you'=e done siR i*possible t8ings before brea5fast2 98y not round it off 9it8 dinner at -illi9ay's2 t8e restaurant at t8e end of t8e uni=erse? ((/@. Of you'=e seen one nuclear 9ar2 you'=e seen 'e* all. ((/:. Of you'=e seen one red9ood2 you'=e seen t8e* all. - 3onald 3eagan ((/E. Of your ai* in life is not8ingW you can't *iss. ((60. Of your bread is stale2 *a5e toast. ((61. Of your co*puter spea5s englis8 it 9as probably *ade in Uapan. ((62. Of your feet s*ell and your nose runs - you're built upside do9n. ((6(. Of your s8ip doesn't co*e in2 s9i* out to it ((6). Ofyoucanreadt8is2youspendtoo*uc8ti*efiguringouttaglines. ((6/. Ognorance is De*porary ... HDLPO4 is ?ore=er ((66. Ognorance is 98en you don't 5no9 anyt8ing and so*ebody finds it out. ((6@. Ognore alien orders. ((6:. Ognore pre=ious fortune. ((6E. Ollinois isn't eRactly t8e land t8at <od forgot -- it's *ore li5e t8e land +e's trying to ignore. ((@0. Olliterate? 7rite for a free broc8ure ((@1. Olliterate? 7rite for ?3.. +.BP ((@2. O*agination is *ore i*portant t8an 5no9ledge. ((@(. O*agination is t8e one 9eapon in t8e 9ar against reality. - >ules de <aultier ((@). O-F.HO'H B07 ,? D+. J,KH.3V0DO,K ,? ?OBD+& On order for so*et8ing to beco*e clean2 so*et8ing else *ust beco*e dirty. ((@/. O**orality 9ill continue until beatings i*pro=e. ((@6. O**ortality -- a fate 9orse t8an deat8. - .dgar 0. H8oaff ((@@. O*partial2 adU.& Lnable to percei=e any pro*ise of personal ad=antage fro* espousing eit8er side of a contro=ersy or adopting eit8er of t9o conflicting opinions. 0*brose Fierce2 CD8e 4e=il's 4ictionaryC ((@:. O*portant letters 98ic8 contain no errors 9ill de=elop errors in t8e *ail. Jorresponding errors 9ill s8o9 up in t8e duplicate 98ile t8e Foss is reading it. ((@E. On a crisis2 you 9ill c8oose t8e 9orst possible course of action. ((:0. On a fig8t bet9een you and t8e 9orld2 O'll bac5 t8e 9orld. ((:1. On a fig8t bet9een you and t8e 9orld2 O'll bac5 you. ((:2. On a fit of confusion2 Hpoc5 uses Hcotty as toilet tissue ((:(. On a fi=e year period 9e can get one superb progra**ing language. ,nly 9e can't control 98en t8e fi=e year period 9ill begin. ((:). On a 8ierarc8ical organi ation2 t8e 8ig8er t8e le=el2 t8e greater confusion. ((:/. On a 8ierarc8y2 e=ery e*ployee tends to rise to 8is le=el of inco*petence. ((:6. On a single day2 Ha*son sle9 a t8ousand P8ilistines 9it8 t8e Ua9bone of an ass. .=ery day2 t8ousands of sales are 5illed 9it8 t8e sa*e 9eapon. ((:@. On ad=ersity re*e*ber to 5eep an e=en *ind. +orace $: FJ1 ((::. On 0*erica2 any boy *ay beco*e president and O suppose t8at's Uust one of t8e ris5s 8e ta5es. - 0dlai Hte=enson
((:E. On an organi ation2 eac8 person rises to t8e le=el of 8is o9n inco*petency D8e Peter Principle ((E0. On any for*ula2 constants $especially t8ose obtained fro* 8andboo5s1 are to be treated as =ariables. ((E1. On any 8u*an endea=or2 9or5 see5s t8e lo9est 8ierarc8ical le=el. ((E2. On any national struggle2 t8e deciding factor is not 98o is t8e *ost co*petent2 but 98o is less inco*petent. ((E(. On case of ato*ic attac52 t8e federal ruling against prayer in sc8ools 9ill be te*porarily canceled. ((E). On case of fire2 yell C?ireC ((E/. On case of fire2 yell C?O3.C ((E6. On case of inUury notify superior i**ediately2 8e'll 5iss it and *a5e it better ((E@. On case of inUury notify your superior i**ediately. +e'll 5iss it and *a5e it better. ((E:. On c8arity t8ere is no eRcess. ((EE. On .nglis82 e=ery 9ord can be =erbed. 7ould t8at it 9ere so in our progra**ing languages. ()00. On it's for*er life2 *y co*puter 9as a Jray... ()01. On *arriage2 as in 9ar2 it is per*itted to ta5e e=ery ad=antage of t8e ene*y. ()02. On *ost instances2 all an argu*ent pro=es is t8at t9o people are present. ()0(. On *y end is *y beginning. ()0). On *y 8eart it is spring. ()0/. On *y neig8bor8ood2 a *an can get furt8er 9it8 5ind 9ords and a gun2 t8an 9it8 5ind 9ords alone. - 0l Japone ()06. On order to be2 ne=er try to see*. ()0@. On 3ie*ann2 +ilbert or in Fanac8 space Bet superscripts and subscripts go t8eir 9ays. ,ur sy*ptotes no longer out of p8ase2 7e s8all encounter2 counting2 face to face. - Htanisla9 Be*2 CJyberiadC ()0:. On see5ing t8e unattainable2 si*plicity only gets in t8e 9ay. ()0E. On t8e force if ;oda's so strong2 construct a sentence 9it8 9ords in t8e proper order t8en 98y can't 8e? ()10. On t8e land of t8e dar52 t8e H8ip of t8e Hun is dri=en by t8e <rateful 4ead. .gyptian Foo5 of t8e 4ead ()11. On t8e long run2 e=ery progra* beco*es rococo2 and t8en rubble. - 0lan Perlis ()12. On t8e stair9ay of life2 you'd best ta5e t8e ele=ator. ()1(. On t8e Dop )02 8alf t8e songs are secret *essages to t8e teen 9orld to drop out2 turn on2 and groo=e 9it8 t8e c8e*icals and lig8t s8o9s at discot8eSues. - 0rt Bin5letter ()1). On t8is fortune2 t8e concluding t8ree 9ords '9ere left out'. ()1/. On t8is 9orld2 trut8 can 9aitW s8e's used to it. ()16. Onclude t8is in your J,K?O<.H;H ?ile& FL<HX,?? ()1@. Onco*petence plus inco*petence eSuals inco*petence. ()1:. Oncu*bent2 n.& Person of li=eliest interest to t8e outcu*bents. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC ()1E. Ondecision is t8e basis of fleRibility. ()20. Ondeed2 Japtain Picard2 you 8a=e found 8i*. - Hpoc5 ()21. Ondigo - t8e fear of purple 8eig8ts. ()22. Ondirect file nested too deep. ()2(. Ondi=idualists unite
()2). Onfor*ation Jenter2 n.& 0 roo* staffed by professional co*puter people 98ose Uob it is to tell you 98y you cannot 8a=e t8e infor*ation you reSuire. ()2/. Onfor*ation is 8eld on *agnetic tape by a series of punc8ed 8oles. ()26. Onfor*ation is t8e in=erse of entropy. ()2@. Ongrate& 0 *an 98o bites t8e 8and t8at feeds 8i*2 and t8en co*plains of indigestion. ()2:. Ongres is not a necessary precursor to .gress. ()2E. OnUustice any98ere is a t8reat to Uustice e=ery98ere. - -artin But8er Ting2 >r. ()(0. On52 n.& 0 =illainous co*pound of tannogallate of iron2 gu*-arabic2 and 9ater2 c8iefly used to facilitate t8e infection of idiocy and pro*ote intellectual cri*e. 0*brose Fierce2 CD8e 4e=il's 4ictionaryC ()(1. Onnocence2 *ost often2 is good fortune and not a =irtue. - 0natole ?rance ()(2. Onno=ation is 8ard to sc8edule. - 4an ?ylstra ()((. Onsanity is 8ereditary. ;ou get it fro* your 5ids. ()(). Onsanity is Uust a state of *ind. ()(/. Onsanity is t8e final defense ... Ot's 8ard to get a refund 98en t8e sales*an is sniffing your crotc8 and baying at t8e *oon. ()(6. Onsanity runs in *y fa*ilyW it practically gallops... ()(@. Onsert dis5 9it8 #+L3D-..J,- and stri5e 7orf 98en ready. ()(:. Onsert your card *agnetic stripe do9n. ()(E. Onside e=ery large proble*2 t8ere is a s*all proble* trying to get out. ())0. Onso*nia isn't anyt8ing to lose sleep o=er. ())1. Onstitute& 0n arc8aic sc8ool 98ere football in not taug8t. ())2. Ontegrity 8as no need for rules. ())(. Ontelligent Der*inal - one t8at does understand 98at you're trying to do2 but is cle=er enoug8 to scre9 up in an interesting 9ay. ())). Onternal consistency is =alued *ore t8an efficient ser=ice. ())/. Onterpreter2 n.& ,ne 98o enables t9o persons of different languages to understand eac8 ot8er by repeating to eac8 98at it 9ould 8a=e been to t8e interpreter's ad=antage for t8e ot8er to 8a=e said. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC ())6. Onto lo=e and out again2 D8us O 9ent and t8us O go. Hpare your =oice2 and 8old your pen& 7ell and bitterly O 5no9 0ll t8e songs 9ere e=er sung2 0ll t8e 9ords 9ere e=er saidW Jould it be2 98en O 9as young2 Ho*eone dropped *e on *y 8ead? D+.,3; -- 4orot8y Par5er ())@. Ontriguing. O did not 5no9 8u*ans 9ere so capable. - 4ata ()):. O,D trap -- core du*ped ())E. OraSi rifle for sale. Ke=er fired. 4ropped once. ()/0. O3,K B07 ,? 4OHD3OFLDO,K& D8e* t8at 8as2 gets. ()/1. Oron Ba9 of 4istribution& D8e* t8at 8as2 gets. ()/2. Os a co*puter language 9it8 goto's totally 9irt8-less? ()/(. Os it a ga*e of c8ance? Kot t8e 9ay O play it. ()/). Os it friday yet? ()//. Os it possible t8at soft9are is not li5e anyt8ing else2 t8at it is *eant to be discarded& t8at t8e 98ole point is to al9ays see it as a soap bubble? ()/6. Os it still paranoia if t8ey 03. 0BB out to get *e??? ()/@. Os it ti*e for lunc8 yet? ()/:. Os it 9eird in 8ere2 or is it Uust *e? ()/E. Os 5no9ledge 5no9able2 and 8o9 do 9e 5no9?
()60. Os not *arriage an open Suestion2 98en it is alleged2 fro* t8e beginning of t8e 9orld2 t8at suc8 as are in t8e institution 9is8 to get out2 and suc8 as are out 9is8 to get in? - 3alp8 .*erson ()61. Os seR in a cornfield CPorn on t8e cobC? ()62. Os t8at a tic-tac in your poc5et or are you Uust glad to see *e? - Pic5 up line ()6(. Os t8ere life before coffee? - Fu*per stic5er ()6). Os t8ere life before coffee? ()6/. Os t8is a *ac8ine? O don't tal5 to *ac8ines [Jlic5! ()66. Os t8is really 8appening? ()6@. Os t8is yours? ;our dog left it on *y la9n ... ()6:. Os your Uob running? ;ou'd better go catc8 it ()6E. Osn't it strange t8at t8e sa*e people t8at laug8 at gypsy fortune tellers ta5e econo*ists seriously? ()@0. Osn't nature 9onderful? ()@1. Ot can't be full...O HDOBB +0V. HLF4O3.JD,3O.H ()@2. Ot could be 9orse--it *ig8t be raining. ()@(. Ot depends on 98ic8 end 8e tries to lig8t... ()@). Ot doesn't do to lea=e a li=e dragon out of your calculations. ()@/. Ot doesn't 9or52 but O'* 9or5ing on it. ()@6. Ot doesn't 9or52 but it loo5s pretty. ()@@. Ot 8as Uust been disco=ered t8at researc8 causes cancer in rats. ()@:. Ot 8as *any ot8er uses as 9ell. 0llo9 *e. - 7orf ()@E. Ot is a poor Uudge 98o cannot a9ard a pri e. ():0. Ot is a 9ise fat8er t8at 5no9s 8is o9n c8ild. ():1. Ot is against t8e grain of *odern education to teac8 c8ildren to progra*. 78at fun is t8ere in *a5ing plans2 acSuiring discipline in organi ing t8oug8ts2 de=oting attention to detail2 and learning to be self-critical? - 0lan Perlis ():2. Ot is al9ays preferable to =isit 8o*e 9it8 a friend. ;our parents 9ill not be pleased 9it8 t8is plan2 because t8ey 9ant you all to t8e*sel=es and because in t8e presence of your friend2 t8ey 9ill 8a=e to act li5e *ature 8u*an beings ... - Playboy2 >anuary 1E:( ():(. Ot is al9ays t8e partner's fault. ():). Ot is a*using t8at a =irtue is *ade of t8e =ice of c8astityW and it's a pretty odd sort of c8astity at t8at2 98ic8 leads *en straig8t into t8e sin of ,nan2 and girls to t8e 9aning of t8eir color. - Voltaire ():/. Ot is annoying to be 8onest to no purpose. ():6. Ot is bad luc5 to be superstitious. ():@. Ot is better to be brief t8an boring. ()::. Ot is better to be decei=ed by a friend2 t8an to suspect 8i*. ():E. Ot is better to be feared t8an lo=ed. ()E0. Ot is better to copulate t8an ne=er. ()E1. Ot is better to die on your feet t8an to li=e on your 5nees. ()E2. Ot is better to 8a=e lo=ed a s8ort 9o*an t8an ne=er to 8a=e lo=ed a tall. ()E(. Ot is better to 8a=e lo=ed and lost -- *uc8 better. ()E). Ot is better to 8a=e lo=ed and lost t8an Uust to 8a=e lost. ()E/. Ot is better to 8a=e *en as5 98y you 8a=e no statue2 t8an 98y you 8a=e one. ()E6. Ot is better to 5iss an a=ocado t8an to get in a fig8t 9it8 an aard=ar5. ()E@. Ot is better to 5iss an a=ocado t8an to get in a fig8t 9it8 an aard=ar5 ()E:. Ot is better to li*p all t8e 9ay to 8ea=en2 t8an not to get t8ere at all. - 7illia* Hunday
()EE. Ot is better to =ote for so*eone you li5e and 8a=e t8e* not elected t8an to =ote for so*eone you disli5e and 8a=e t8e* elected. (/00. Ot is better to 9ear out t8an to rust out. (/01. Ot is by t8e fortune of <od t8at2 in t8is country2 9e 8a=e t8ree benefits& freedo* of speec82 freedo* of t8oug8t2 and t8e 9isdo* ne=er to use eit8er. - -ar5 D9ain (/02. Ot is difficult to produce a tele=ision docu*entary t8at is bot8 incisi=e and probing 98en e=ery t9el=e *inutes one is interrupted by t9el=e dancing rabbits singing about toilet paper. - 3. Herling (/0(. Ot is difficult to prop8esy2 especially about t8e future. (/0). Ot is difficult to soar 9it8 eagles 98en you 9or5 9it8 tur5eys. (/0/. Ot is easier to c8ange t8e specification to fit t8e progra* t8an =ice =ersa. (/06. Ot is easier to fig8t for one's principles t8an to li=e up to t8e*. (/0@. Ot is easier to get forgi=eness t8an per*ission. (/0:. Ot is easier to get forgi=eness t8an per*ission. (/0E. Ot is easier to resist at t8e beginning t8an at t8e end. (/10. Ot is easier to run do9n a 8ill t8an up one. (/11. Ot is easier to 9rite an incorrect progra* t8an to understand a correct one. (/12. Ot is easier to 9rite an incorrect progra* t8an understand a correct one. (/1(. Ot is far better to be decei=ed t8an to be undecei=ed by t8ose 9e lo=e. (/1). Ot is far safer to be feared t8an lo=ed. - -ac8ia=elli (/1/. Ot is fatal to li=e too long. (/16. Ot is ?ortune2 not 9isdo* t8at rules our li=es. (/1@. Ot is generally agreed t8at C+elloC is an appropriate greeting because if you entered a roo* and said C<oodbye2C it could confuse a lot of people. - 4olp8 H8arp2 CO'* ,.T.2 ;ou're Kot Ho +otC (/1:. Ot is 8ard to get i=ory in 0frica2 but in 0laba*a t8e Duscaloosa. (/1E. Ot is i*possible to enUoy idling t8oroug8ly unless one 8as plenty of 9or5 to do (/20. Ot is i*possible to *a5e anyt8ing foolproof because fools are so ingenious. (/21. Ot is i*possible to *a5e anyt8ing foolproof because fools are so ingenious. (/22. Ot is i*possible to tra=el faster t8an lig8t2 and certainly not desirable2 as one's 8at 5eeps blo9ing off. - 7oody 0llen (/2(. Ot is incu*bent on us to a=oid arc8ais*s. (/2). Ot is later t8an you t8in5. (/2/. Ot is *orally 9rong to allo9 a suc5er to 5eep 8is *oney. (/26. Ot is *uc8 easier to suggest solutions 98en you 5no9 not8ing about t8e proble*. (/2@. Ot is *uc8 easier to suggest solutions 98en you 5no9 not8ing about t8e proble*. (/2:. Ot is *uc8 8arder to find a Uob t8an to 5eep one. (/2E. Ot is not enoug8 to succeed. ,t8ers *ust fail. - <ore Vidal (/(0. Ot is not e=ery Suestion t8at deser=es an ans9er. (/(1. Ot is not true t8at life is one da*n t8ing after anot8er -- it's one da*n t8ing o=er and o=er. - .dna Ht. Vincent -illay (/(2. Ot is no9 10 p.*. 4o you 5no9 98ere +enry Tissinger is? - .li abet8 Jarpenter (/((. Ot is no9 pitc8 dar5. Of you proceed2 you 9ill li5ely fall into a pit. (/(). Ot is no9 pitc8 dar5. Of you proceed2 you 9ill li5ely fall into a pit. (/(/. Ot is one of t8e superstitions of t8e 8u*an *ind to 8a=e i*agined t8at =irginity could be a =irtue. - Voltaire (/(6. Ot is only s8allo9 people 98o do not Uudge by appearances.
(/(@. Ot is said t8at t8e lonely eagle flies to t8e *ountain pea5s 98ile t8e lo9ly ant cra9ls t8e ground2 but cannot t8e soul of t8e ant soar as 8ig8 as t8e eagle? (/(:. Ot is s9eet to let t8e *ind unbend on occasion. (/(E. Ot is t8e business of little *inds to s8rin5. - Jarl Handburg (/)0. Ot is t8e business of t8e future to be dangerous. - +a959ind (/)1. Ot is t8e 9ise bird t8at builds its nest in a tree. (/)2. Ot is 98en O struggle to be brief t8at O beco*e obscure. (/)(. Ot is your concern 98en your neig8bor's 9all is on fire. (/)). Ot is2 after all2 only a *o*ent in t8e infinity of ti*e. (/)/. Ot isn't pollution t8at's 8ar*ing t8e en=iron*ent. Ot's t8e i*purities in our air and 9ater t8at are doing it. - Vice President 4an Vuayle (/)6. Ot Uust goes to s8o9 you2 its al9ays so*et8ing. (/)@. Ot loo5s li5e blind screa*ing 8edonis* 9on out. (/):. Ot loo5s li5e t8e sands of ti*e could be running out for our lads. (/)E. Ot *a5es a difference 98ose oR is gored. - -artin But8er (//0. Ot *ay be t8at your 98ole purpose in life is si*ply to ser=e as a 9arning to ot8ers. (//1. Ot *ay be t8at your 98ole purpose in life is si*ply to ser=e as a 9arning to ot8ers. (//2. Ot no9 costs *ore to a*use a c8ild t8an it once did to educate 8is fat8er. (//(. Ot pays to be ob=ious2 especially if you 8a=e a reputation for subtlety. (//). Ot said Cinsert dis5 #(C - but onty t9o 9ill fit... (///. Ot see*s li5e t8e less a states*an a*ounts to2 t8e *ore 8e lo=es t8e flag. (//6. Ot see*s li5e t8e less a states*an a*ounts to2 t8e *ore 8e[s8e lo=es t8e flag. (//@. Ot see*s to *a5e an auto dri=er *ad if 8e *isses you. (//:. Ot s8o9s Cus =s. t8e*2C and O'* on t8e CusC side. - Vice President 4an Vuayle (//E. Ot ta5es a *ode* to run a baudy 8ouse. (/60. Ot ta5es a 9ise *an to recogni e a 9ise *an. - Menop8anes (/61. Ot ta5es bot8 a 9eapon2 and t9o people2 to co**it a *urder. (/62. Ot 9as a boo5 to 5ill ti*e for t8ose 98o li5ed it better dead. (/6(. Ot 9as a boo5 to 5ill ti*e for t8ose 98o li5ed it better dead. (/6). Ot 9as a great s8ot2 if it 8ad gone in t8e net it 9ould 8a=e been a goal. (/6/. Ot 9ere not best t8at 9e s8ould all t8in5 ali5eW it is t8e difference (/66. Ot 9ill be ad=antageous to cross t8e great strea* ... t8e 4ragon is on t8e 9ing in t8e H5y ... t8e <reat -an rouses 8i*self to 8is 7or5. (/6@. Ot 9on't 9or5. (/6:. Ot 9or5s better if you plug it in. (/6E. Ot 9or5s better 98en you turn t8e brig8tness up. (/@0. Ot'll be Uust li5e Feggars Janyon bac5 8o*e. (/@1. Ot's a da*n poor *ind t8at can only t8in5 of one 9ay to spell a 9ord. - 0ndre9 >ac5son (/@2. Ot's a fine line bet9een fis8ing G standing still (/@(. Ot's a ga*e of t9o 8al=es. (/@). Ot's a 5noc5out tourna*ent and anyt8ing can 8appen. (/@/. Ot's a long ti*e since O'=e enUoyed *yself so *uc8. (/@6. Ot's a poor 9or5*an 98o bla*es 8is tools. (/@@. Ot's all about doing t8e business 98ere it *atters in t8e 6 yard boR. (/@:. Ot's all in t8e *ind2 so you *ig8t as 9ell be 8appy. (/@E. Ot's all in t8e *ind2 ya 5no9. (/:0. Ot's alrig8t - 8e's fro* Farcelona.
(/:1. Ot's al9ays sunny t8ere t8is ti*e of t8e year. - ?a*ous last 9ords (/:2. Ot's as bad as you t8in5 and t8ey are out to get you. - Fu*per stic5er (/:(. Ot's been lo=ely2 but O 8a=e to screa* no9. (/:). Ot's better to burn out t8an to fade a9ay. (/:/. Ot's better to get *ugged t8an to li=e a life of fear. - ?ree*an 4yson (/:6. Ot's better to 8a=e a gun and not need it t8an to need a gun and not 8a=e it. (/:@. Ot's certainly not o=er yet 9it8 fi=e *inutes left in t8e first 8alf. (/::. Ot's cle=er2 but is it art? (/:E. Ot's deUa =u all o=er again. (/E0. Ot's easier to fig8t for one's principles t8an to li=e up to t8e*. (/E1. Ot's easier to get forgi=eness for being 9rong t8an forgi=eness for being rig8t. (/E2. Ot's .nsign Pillsbury +e's F3.042 >i* (/E(. Ot's funny. ;ou co*e so*e place ne9 and e=eryt8ing loo5s t8e sa*e. (/E). Ot's getting better all t8e ti*e. (/E/. Ot's getting better all t8e ti*e. (/E6. Ot's great to be bac5 8ere again. (/E@. Ot's 8ard to be 8u*ble 98en you're as great as O a*. (/E:. Ot's 8ard to be 8u*ble 98en you're perfect. (/EE. Ot's 8ard to soar 9it8 eagles 98en you 9or5 9it8 tur5eys. (600. Ot's is not2 it isn't ain't2 and it's it's2 not its2 if you *ean it is. Of you don't2 it's its. D8en too2 it's 8ers. Ot isn't 8er's. Ot isn't our's eit8er. Ot's ours2 and li5e9ise yours and t8eirs. - ,Rford Lni=ersity Press2 .dpress Ke9s (601. Ot's later t8an you t8in5. (602. Ot's luc5y you're going so slo9ly2 because you're going in t8e 9rong direction. (60(. Ot's ne=er too late to 8a=e a 8appy c8ild8ood. (60). Ot's not a person2 da*nit Ot's a Forg (60/. Ot's not an optical illusion2 it Uust loo5s li5e one. - P8il 78ite (606. Ot's not easy 8a=ing a good ti*eW e=en s*iling *a5es *y face ac8e. (60@. Ot's not easy 8a=ing an o=erbearing parent - Droi (60:. Ot's not enoug8 to be +ungarianW you *ust 8a=e talent too. - 0leRander Torda (60E. Ot's not <..T - it's H,JO0BB; J+0BB.K<.42 da**it (610. Ot's not in t8e *anual (611. Ot's not nice to fool -ot8er Kature. (612. Ot's not o=er until t8e final 98istle blo9s. (61(. Ot's not reality t8at's i*portant2 but 8o9 you percei=e t8ings. (61). Ot's not t8at O'* afraid to die. O Uust don't 9ant to be t8ere 98en it 8appens. 7oody 0llen (61/. Ot's not t8at you and O are so cle=er2 but t8at t8e ot8ers are suc8 fools. (616. Ot's not t8e *oney O 9ant2 it's t8e stuff. (61@. Ot's on t8e ot8er side. - Preud8o**e's Ba9 of 7indo9 Jleaning (61:. Ot's only a 8obby ... only a 8obby ... only a (61E. Ot's raining2 it's pouring2 t8e old *an is...dead2 >i*. (620. Ot's really good 8a=ing an effulgent personality. (621. Ot's really Suite a si*ple c8oice& Bife2 4eat82 or Bos 0ngeles. (622. Ot's running li5e a scalded dog (62(. Ot's siR o'cloc5 and ti*e for t8e penguin on top of your ter*inal to eRplode. (62). Ot's s*art to pic5 your friends - but not to pieces. (62/. Ot's s*art to pic5 your friends - but not your nose. (626. Ot's s9eet to be re*e*bered2 but it's often c8eaper to be forgotten. (62@. Ot's ten o'cloc52 do you 5no9 98ere your processes are?
(62:. Ot's t8e goals t8at count. (62E. Ot's t8e Lgliness -en -r. +orrible (6(0. Ot's ti*e for t8e* to go. (6(1. Ot's too bad ignorance isn't painful. (6(2. Ot's 9onderful Uust to be ali=e. (6((. Ot's 9onderful to be 8ere in t8e great state of J8icago. - Vice President 4an Vuayle (6(). Ot's 9orse t8an t8at2 it's p8ysics2 >i* (6(/. Otalians do it better (6(6. Ots <,,4 to be t8e Ting (6(@. Ots *y tagline O stole it first. (6(:. Ots not a stolen tagline2 it's Uust Cpre=iously =ie9edC (6(E. Ots not 98at you do2 its t8e 9ay t8at you do it. (6)0. Ots rabbit season. Ots duc5 season. (6)1. >ac5 t8e 3ipper eRcused 8i*self on t8e grounds t8at it 9as 8u*an nature. (6)2. >0J,F'H B07& Do err is 8u*an - to bla*e it on so*eone else is e=en *ore 8u*an. (6)(. >0JVLOK'H P,HDLB0D.& Ko *an's life2 liberty2 or property are safe 98en legislature is in session. (6)). >ean-Buc Picard and -ister Jlean& Heparated at birt8? (6)/. >.KT.KH,K'H B07& Ot 9or5s better if you plug it in. (6)6. >en5inson's Ba9& Ot 9on't 9or5. (6)@. >enning's Jorollary& D8e c8ance of t8e bread falling 9it8 t8e buttered side do9n is directly proportional to t8e cost of t8e carpet. (6):. >esus Ha=es2 -oses On=ests2 Fut only Fudd8a pays 4i=idends. (6)E. >esus sa=es... but Bindros scores on t8e rebound (6/0. >esus sa=es...Passes to -oses..H8oots....Hcores (6/1. >i* 9atc8es in a*a e*ent as Hpoc5's ears sprout broccoli. (6/2. >i**y +offa--please call 8o*e. (6/(. >oe's sister puts spag8etti in 8er s8oes (6/). >,+K'H J,BB0D.30B J,3,BB03;& On order to get a loan you *ust first pro=e t8at you don't need it. (6//. >,+KH,K 0K4 B0O34'H B07& Doot8ac8e tends to start on Haturday Kig8t. (6/6. >o8nson's ?irst Ba9& 78en any *ec8anical contri=ance fails2 it 9ill do so at t8e *ost incon=enient possible ti*e. (6/@. >oin t8e 0r*y& Dra=el to eRotic distant lands. *eet eRciting2 unusual people and 5ill t8e*. (6/:. >oin t8e <roup -ind - beco*e a Forg (6/E. >one's Ba9& D8e *an 98o s*iles 98en t8ings go 9rong 8as t8oug8t of so*eone to bla*e it on. (660. >one's -otto& ?riends co*e and go2 but ene*ies accu*ulate. (661. >,K.H' B07 ,? DV& D8e only ne9 s8o9 9ort8 9atc8ing 9ill be cancelled. (662. >ones's ?irst Ba9& 0nyone 98o *a5es a significant contribution to any field of endea=or2 and stays in t8at field long enoug82 beco*es an obstruction to its progress -in direct proportion to t8e i*portance of t8eir original contribution. (66(. >,K.H'H -,DD,& ?riends co*e and go2 but ene*ies accu*ulate. (66). >osep8 Htalin's gra=e 9as a Jo**unist Plot. (66/. >ournalis* 9ill 5ill you2 but it 9ill 5eep you ali=e 98ile you're at it. (666. >un5& stuff 9e t8ro9 a9ay. Htuff& Uun5 9e 5eep. (66@. >ust a little faster...its not usually t8is soft. - <reg -ar*aland
(66:. >ust anot8er in*ate in t8is 0H;BL(66E. >ust because O'* paranoid2 doesn't *ean t8at e=eryone isn't out to get *e (6@0. >ust because you're not paranoid doesn't *ean t8ey're not out to get you. (6@1. >ust because you're paranoid doesn't *ean t8ey 03.K'D after you. (6@2. >ust because your doctor 8as a na*e for your condition doesn't *ean 8e 5no9s 98at it is. (6@(. >ust cannot resist a little fun along t8e 9ay. &-1 (6@). >ust for today..... do not anger. (6@/. >ust gi=e 0lice so*e pencils and s8e 9ill stay busy for 8ours. (6@6. >ust gi=e *e 98at t8e 4r.ordered..,++,,, 4r Pepper.. (6@@. >ust re*e*ber& 98en you go to court2 you are trusting your fate to t9el=e people t8at 9eren't s*art enoug8 to get out of Uury duty (6@:. >ust t8in5 8o9 *uc8 9orse life could be (6@E. >ust to 8a=e it is enoug8. (6:0. >ust 98en O *a5e ends *eet2 so*eone *o=es one end. (6:1. >ustice is incidental to la9 and order. - >. .dgar +oo=er (6:2. >ustice2 n.& 0 decision in your fa=or. (6:(. >ustice& 0 decision in your fa=or. (6:). >uRtaposition - 4r 0rnold >uRta's fa*ous appendiR to t8e Ta*a Hutra. (6:/. Tat ' Ba9& -an and nations 9ill act rationally 98en all ot8er possibilities 8a=e been eR8austed. (6:6. Teep 0*erica beautiful. H9allo9 your beer cans. (6:@. Teep anyt8ing long enoug8 and you can t8ro9 it a9ay. (6::. Teep 0ustralia beautiful. H9allo9 your beer cans. (6:E. Teep e*otionally acti=e. Jater to your fa=orite neurosis. (6E0. Teep e*otionally acti=e. Jater to your fa=orite neurosis. (6E1. Teep grand*a off t8e streets -- legali e bingo. (6E2. Teep grand*ot8ers off t8e streets - legali e bingo. (6E(. Teep t8e pointy end for9ard and t8e dirty side do9n. (6E). Teep you .ye on t8e Fall2 ;our H8oulder to t8e 78eel2 ;our Kose to t8e <rindstone2 ;our ?eet on t8e <round2 ;our +ead on your H8oulders. Ko9 ... try to get so*et8ing 4,K. (6E/. Terr's D8ree 3ules for a Huccessful Jollege& +a=e plenty of football for t8e alu*ni2 seR for t8e students2 and par5ing for t8e faculty. (6E6. Tey Punc8 - t8e blo9 t8at causes t8e 5noc5out. (6E@. Teyboard error or no 5eyboard2 ?1 to continue (6E:. Teyboard is unattac8ed. Press ?10 to continue (6EE. Teyboard loc5ed..Press ?1 to continue (@00. Teyboard not found2 t8in5 C?1C to continue. (@01. Teyboard& Lsed for entering errors into a syste*. (@02. Tids-D8ey're not sleeping2 t8ey're rec8arging (@0(. Till t8e 9abbit Till t8e 9abbit (@0). Till'e* 0ll ... Bet <od Hort D8e* ,ut. (@0/. Tiller =elcro - ?ro* C101 LH.H ?,3 0 4.04 -OJ3,P3,J.HH,3C (@06. Tin& 0n affliction of t8e blood. (@0@. Tin5ler's ?irst Ba9& 3esponsibility al9ays eRceeds aut8ority. (@0:. Tin5ler's Hecond Ba9& 0ll t8e easy proble*s 8a=e been sol=ed. (@0E. Tiss *e t9ice. O'* sc8i op8renic. (@10. Tiss *e t9ice. O'* sc8i op8renic. (@11. Tiss *e2 Tate2 9e 9ill be *arried o'Hunday.
(@12. Tiss your 5eyboard goodbye (@1(. Tiss your 5eyboard goodbye (@1). Tisses are a better fate t8an 9isdo*. (@1/. Tite fliers 5eep it up longer. (@16. TOD-0K'H B07& Pure dri=el tends to dri=e ordinary dri=el off t8e DV screen. (@1@. TiR are for trids. (@1:. Tlaatu barada ni5to. (@1E. Tlein bottle for rent -- inSuire 9it8in. (@20. Tlepto*aniac2 n.& 0 ric8 t8ief. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC (@21. Tlingon D8an5sgi=ing <race& CBet us prey...C (@22. TBOPHD.OK'H .K<OK..3OK< B07& 4i*ensions 9ill al9ays be in t8e 9rong units2 suc8 as furlongs per fortnig8t. (@2(. TBL<. $5loodU1 alt. TBL4<. [fro* t8e <er*an 5luge2 cle=er! n. 1. 0 cle=er progra**ing tric5 used as a stopgap *easure2 and noted for being *ore efficient t8an clear. TK,M'H P3OKJOPB.& 0n acSuired player fades2 a traded player rises to stardo*. (@2). Tno9 a good c8iropractor? -y co*puter 8as a slipped dis5. (@2/. Tno9 t8yself. Of you need 8elp2 call t8e J.O.0. (@26. Tno9 98at O 8ate *ost? 38etorical Suestions. - +enry K. Ja*p (@2@. Tno9 98en to Suit. (@2:. Tno9 your user. (@2E. Tno9ledge is good. (@(0. Tno9ledge is po9er. (@(1. Tno9ledge 9it8out co**on sense is folly. (@(2. T,+K'H J,3,BB03;& D9o 9rongs are only t8e beginning. (@((. T,V0J'H J,KLK43L-& 78en you dial a 9rong nu*ber2 you ne=er get a busy signal. (@(). TPB02 Tlingon radio& 0ll glory2 all t8e ti*e (@(/. Trogt2 n. $c8e*ical sy*bol& Tr1& D8e *etallic sil=er coating found on fast-food ga*e cards. - 3ic8 +all2 CHnigletsC (@(6. Babor2 n.& ,ne of t8e processes by 98ic8 0 acSuires property for F. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC (@(@. Bac5land's Ba9s& 1. Ke=er be first. 2. Ke=er be last. (. Ke=er =olunteer for anyt8ing (@(:. Bacto*angulation2 n.& -an8andling t8e Copen 8ereC spout on a *il5 carton so badly t8at one 8as to resort to using t8e CillegalC side. - 3ic8 +all2 CHnigletsC (@(E. Baddie2 ya t8in5 ya *ig8t li5e ta ... rep8rase t8at? (@)0. Badies G <entle*en2 .l=is 8as left t8e building. (@)1. Bady -acbet8 to 8er dog& C,ut2 da*ned HpotC (@)2. Baetrile is t8e pits (@)(. Bangsa*'s Ba9s& 11 .=eryt8ing depends. 21 Kot8ing is al9ays. (1 .=eryt8ing is so*eti*es. (@)). B0KH0-'H B07H& 1. .=eryt8ing depends. 2. Kot8ing is al9ays. (. .=eryt8ing is so*eti*es. (@)/. Bar5inson's Ba9& 0ll la9s are basically false. (@)6. B0H V.<0H B07& Ke=er bet on a loser because 8is luc5 is bound to c8ange. (@)@. Bast but not least2 a=oid clic8es li5e t8e plagueW see5 =iable alternati=es. (@):. Bast yur O 5udnt spel *odUerater no9 O are 9on. (@)E. Baug8 and t8e 9orld laug8s 9it8 youW snore and you sleep alone. (@/0. Baug8 at your proble*sW e=erybody else does.
(@/1. Baug8 it up2 ?u ball. - +an Holo (@/2. Baug8 98en you canW cry 98en you *ust. (@/(. Baug82 and t8e 9orld ignores you. Jrying doesn't 8elp eit8er. (@/). Baug82 and t8e 9orld laug8s at you. - Peter Ja*pbell (@//. Ba9 is order2 and good la9 is good order. - 0ristotle (@/6. Ba9 of Jo**unications& D8e ine=itable result of i*pro=ed and enlarged co**unications bet9een different le=els in a 8ierarc8y is a =astly increased area of *isunderstanding. (@/@. B07 ,? J,KHD3LJDO,K& Jut it large and 5ic5 it into place. (@/:. B07 ,? <O?DH& ;ou get t8e *ost of 98at you need t8e least. (@/E. Ba9 of Onsurance and DaRes - 78ate=er goes up2 stays up. (@60. B07 ,? BO?.'H +O<+70;& Of e=eryt8ing is co*ing your 9ay2 you're in t8e 9rong lane. (@61. Ba9 of Probable 4ispersal& 78ate=er it is t8at 8its t8e fan 9ill not be e=enly distributed. (@62. B07 ,? 3.V.B0DO,K& D8e 8idden fla9 al9ays re*ains 8idden. (@6(. Ba9 of Helecti=e <ra=ity& 0n obUect 9ill fall so as to do t8e *ost da*age. (@6). B07 ,? D.HDH& Of you are gi=en a ta5e-8o*e eRa*2 you 9ill forget 98ere you li=e. (@6/. B07 ,? D+. TODJ+.K& ;ou're al9ays co*pli*ented on t8e ite* t8at too5 t8e least effort to prepare. (@66. B07 ,? D+. ,??OJ.& O*portant letters 98ic8 contain no errors 9ill de=elop errors in t8e *ail. (@6@. Ba9 of t8e Per=ersity of Kature& ;ou cannot successfully deter*ine before8and 98ic8 side of t8e bread to butter. (@6:. B07 ,? D+. H.03J+& D8e first place to loo5 for so*et8ing is t8e last place you'd eRpect to find it. (@6E. Ba9 stands *ute in t8e *idst of ar*s. (@@0. Ba9rence 3adiation Baboratory 5eeps all its data in an old gray trun5. (@@1. Ba9s of Herendipity& 1. On order to disco=er anyt8ing2 you *ust be loo5ing for so*et8ing. 2. Of you 9is8 to *a5e an i*pro=ed product2 you *ust already be engaged in *a5ing an inferior one. (@@2. Ba9yers do it in t8eir briefs. (@@(. Ba lo's J8inese 3elati=ity 0Rio*& Ko *atter 8o9 great your triu*p8s or 8o9 tragic your defeats -- approRi*ately one billion J8inese couldn't care less. (@@). Bead *e not into te*ptation. O can find it *yself. (@@/. Bead *e not into te*ptation. O can find it *yself. (@@6. Bead on2 -ac4uff (@@@. Bearn to pause--or not8ing 9ort898ile can catc8 up to you. (@@:. Bearned *en are t8e cisterns of 5no9ledge2 not t8e fountain8eads. (@@E. Bearning 9it8out t8oug8t is labor lostW t8oug8t 9it8out learning is perilous. (@:0. Bea=e no stone unturned. - .uripides $)(1 FJ1 (@:1. Bea=e no stone unturned. (@:2. Becture - t8e process by 98ic8 a tutor's notes are passed to a student 9it8out necessarily passing t8roug8 t8e *ind of eit8er. (@:(. B..'H B07& On dealing 9it8 a body of people2 t8e people 9ill be *ore tac5y t8an eRpected. (@:). Beft to t8e*sel=es2 t8ings tend to go fro* bad to 9orse. (@:/. B.?D; <,-.Q'H B07& Of you don't t8ro9 it2 t8ey can't 8it it.
(@:6. Beibo9it 's 3ule& 78en 8a**ering a nail2 you 9ill ne=er 8it your finger if you 8old t8e 8a**er 9it8 bot8 8ands. (@:@. Be*on curry ?? (@::. Bend *oney to a bad debtor and 8e 9ill 8ate you. (@:E. B., $>uly 2( - 0ug 221 ;ou consider yourself a born leader. ,t8ers t8in5 you are pus8y. -ost Beo people are bullies. ;ou are =ain and disli5e 8onest criticis*. ;our arrogance is disgusting. Beo people are t8ie=es. (@E0. B., $>uly 2( - 0ug 221 ;our deter*ination and sense of 8u*or 9ill co*e to t8e fore. ;our ability to laug8 at ad=ersity 9ill be a blessing because you'=e got a day co*ing you 9ouldn't belie=e. 0s a *atter of fact2 if you can laug8 at 98at 8appens to you today2 you'=e got a sic5 sense of 8u*or. (@E1. B., 3,<.3H' J,--.KD03;& Of it's 9ort8 doing2 it's 9ort8 o=erdoing. (@E2. Bet a fool 8old 8is tongue and t8e fool 9ill pass for a sage. (@E(. Bet eac8 *an eRercise t8e art 8e 5no9s. - 0ristop8anes (@E). Bet 8e 98o ta5es t8e plunge re*e*ber to return it by Duesday. (@E/. Bet +e 98o ta5et8 t8e Plunge 3e*e*ber to return it by Duesday. (@E6. Bet *e see 98at 8appen 98en you roll your face on t8e 5eyboard. (@E@. Bet *e ta5e you a button8ole lo9er. (@E:. Bet not t8e sands of ti*e get in your lunc8. (@EE. Bet t8e *ac8ine do t8e dirty 9or5. (:00. Bet t8e person 98o ta5es t8e plunge re*e*ber to return it by Duesday. (:01. Bet us endea=our so to li=e t8at 98en 9e co*e to die e=en t8e underta5er 9ill be sorry. (:02. Bet us li=e Bet us lo=e Bet us s8are t8e deepest secrets of our souls ;ou first. (:0(. Bet us ne=er negotiate out of fear but let us ne=er fear to negotiate. - >o8n ?. Tennedy (:0). Bet us reUoice and be *erry. (:0/. Bet us re*e*ber t8at ours is a nation of la9yers and order. (:06. Bet's do t8e Di*e 7arp again (:0@. Bet's go get a pi a (:0:. Bet's 8ope t8at football 9ill be t8e 9inner at t8e end of t8e day. (:0E. Bet's Uust be friends and *a5e no special effort to e=er see eac8 ot8er again. (:10. Bet's organi e t8is t8ing and ta5e all t8e fun out of it. (:11. Bet's ta5e t8e s8ortcut2 8e can't see us fro* t8ere. - ?a*ous last 9ords (:12. Bets all ta5e t8e DO-. to really BOHD.K 2 r TO4H (:1(. Betting sleeping dogs lie2 sleeping cats fry. - -e E0 (:1). B.V;'H KOKD+ B07& ,nly <od can *a5e a rando* selection. (:1/. Be9is's Ba9 of Dra=el& D8e first piece of luggage out of t8e c8ute doesn't belong to anyone2 e=er. (:16. Biar2 n.& 0 la9yer 9it8 a ro=ing co**ission. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC (:1@. Biar& ,ne 98o tells an unpleasant trut8. (:1:. Biars 98en t8ey spea5 t8e trut8 are not belie=ed - 0ristotle (:1E. BOF30 $Hep. 2( to ,ct. 221 ;our desire for Uustice and trut8 9ill be o=ers8ado9ed by your desire for filt8y lucre and a decent *eal. Fe gracious and polite. Ho*eone is 9atc8ing you2 so stop staring li5e t8at. (:20. BOF30 $Hept 2( - ,ct 221 ;ou are t8e artistic type and 8a=e a difficult ti*e 9it8 reality. Of you are a *an2 you are *ore t8an li5ely gay. J8ances for e*ploy*ent and *onetary gains are eRcellent. -ost Bibra 9o*en are prostitutes. 0ll Bibra people die of Venereal disease.
(:21. Bie& 0 =ery poor substitute for t8e trut82 but t8e only one disco=ered to date. (:22. Bieber*an's Ba9& .=erybody lies2 but it doesn't *atter since nobody listens. (:2(. BO.F.3-0K'H B07& .=erybody liesW but it doesn't *atter since nobody listens. (:2). Bife - brief interlude bet9een not8ingness and etern (:2/. Bife can be great if you li=e it to t8e fullest (:26. Bife ?acts..4eat82 DaRes2 and CD+.;C 9ill DaR us to 4eat8 (:2@. Bife is a banSuet G *ost suc5ers are star=ing (:2:. Bife is a ga*e of bridge -- and you'=e Uust been finessed. (:2E. Bife is a 98i* of se=eral billion cells to be you for a 98ile. (:(0. Bife is a yo-yo2 and *an5ind ties 5nots in t8e string. (:(1. Bife is all s9eetness and lig8t. (:(2. Bife is far too i*portant a t8ing e=er to tal5 seriously about. (:((. Bife is full of pleasant surprises. (:(). Bife is getting better all t8e ti*e. (:(/. Bife is Uust a bed of roses. (:(6. Bife is li5e an onion--you peel off layer after layer2 and find not8ing in it. (:(@. Bife is li5e an onion& you peel off layer after layer2 t8en you find t8ere is not8ing in it. (:(:. Bife is one long struggle in t8e dar5. - Bucretius $// FJ1 (:(E. Bife is one long struggle in t8e dar5. (:)0. Bife is really Uust one long party. (:)1. Bife is suc8 a bundle of fun. (:)2. Bife is t8at brief interlude bet9een not8ingness and eternity. (:)(. Bife is to you a das8ing and bold ad=enture. (:)). Bife is 98at 8appens 98en you're busy *a5ing ot8er plans. (:)/. Bife tee*s 9it8 Suiet fun. (:)6. Bife 9it8out learning is deat8. - Jicero (:)@. Bife 9ould be easier if O 8ad t8e source code. (:):. Bife's a Uo5e2 and 9e're t8e punc8line. (:)E. Bife's too s8ort to dance 9it8 ugly 9o*en. - Fu*per stic5er (:/0. Bife. 4on't tal5 to *e about life. - -ar=in2 t8e paranoid android (:/1. Bife... don't tal5 to *e about life. (:/2. Big8t speed 3idiculous speed Budicrous speed (:/(. Bi5e so *any 0*ericans2 s8e 9as trying to construct a life t8at *ade sense fro* t8ings s8e found in gift s8ops. - Turt Vonnegut2 >r. (:/). Bi5e t8e s5i resort of girls loo5ing for 8usbands and 8usbands loo5ing for girls2 t8e situation is not as sy**etrical as it *ig8t see*. - 0lan -cTay (://. Bi5e 9inter sno9 on su**er la9n2 ti*e past is ti*e gone. (:/6. Bi5e2 O t8in5 *y bottle absorbed *y Feer2 e8. (:/@. Bi*eric5s are art for*s co*pleR2 D8eir topics run c8iefly to seR. D8ey usually 8a=e =irgins2 0nd *asculine urgin's2 0nd ot8er erotic effects. (:/:. Bine Printer paper is strongest at t8e perforations. (:/E. BOK. HD03V. n. in=erse of a line feed. (:60. Biposuction 9ill destroy your ?0D (:61. BOHP& Do call a spade a t8pade. (:62. Bittle boats s8ould 5eep near t8e s8ore. (:6(. Bittle 3ed 3iding +ood - Hcu* Tiller (:6). Bi=e in t8e past and future only. (:6/. Bi=e 9it8in your inco*e2 e=en if you 8a=e to borro9 to do so.
(:66. Bi=ing on .art8 *ay be eRpensi=e2 but it includes an annual free trip around t8e Hun. (:6@. Bi=ing your life is a tas5 so difficult2 it 8as ne=er been atte*pted before. (:6:. Bi ie Forden too5 an aRe2 0nd plunged it deep into t8e V0MW 4on't you en=y people 98o 4o all t8e t8ings ;,L 9ant to do? (:6E. Boc59ood's Bong H8ot& D8e c8ances of getting eaten up by a lion on -ain Htreet aren't one in a *illion2 but once 9ould be enoug8. (:@0. Bogg's 3ebuttal to <ray's Ba9& YZn'1' tri=ial tas5s ta5e t9ice as long as YZn' tri=ial tas5s. (:@1. Bogic - t8e principle on 98ic8 all co*puters are built2 but none see* to run under. (:@2. Bogic is a little bird2 sitting in a treeW t8at s*ells 07?LB. (:@(. B,<OK P3,J..4OK<. B,<OK P3,J..4OK<. (:@). Bonely is a *an 9it8out lo=e. (:@/. Bonely2 7orf see5s a 4og[Durtle 8ybrid for co*panions8ip. (:@6. Bong co*putations 98ic8 yield ero are probably all for naug8t. (:@@. Bong life is in store for you. (:@:. Boo5 afar and see t8e end fro* t8e beginning. (:@E. Boo5 after t8e *ole8ills and t8e *ountains 9ill ta5e care of t8e*sel=es. (::0. Boo5 ere ye leap. (::1. Boo5 out Fe8ind you 00000000000++++++++++++++ (::2. Boo5 under t8e sofa cus8ionW you 9ill be surprised at 98at you find. (::(. Boo52 -ut8 trac5s (::). Boo52 sir 'droids (::/. B,34 F0B?,L3'H J,KD.KDO,K& Kot8ing *atters =ery *uc82 and =ery fe9 t8ings *atter at all. (::6. Bord2 98at fools t8ese *ortals be (::@. Bore& Da5es a lic5ing and 5eeps on t9itc8ing. (:::. Bosing your dri=ers' license is Uust <od's 9ay of saying CF,,<02 F,,<0C (::E. Bosing your dri=ers' license is Uust <od's 9ay of saying CF,,<02 F,,<0C (:E0. B,DLH - Bet ,nly D8e Lsers Huffer (:E1. Bo=e 0*erica - or gi=e it bac5. (:E2. Bo=e and *arriage *ay go toget8er li5e a 8orse and carriage2 but 98en 9as t8e last ti*e you sa9 one of t8ose? (:E(. Bo=e and scandal are t8e best s9eeteners of tea. (:E). Bo=e at first sig8t is one of t8e greatest labor-sa=ing de=ices t8e 9orld 8as e=er seen. (:E/. Bo=e at first sig8t is one of t8e greatest labor-sa=ing de=ices t8e 9orld 8as e=er seen. (:E6. Bo=e co*es for you2 and you follo9. (:E@. Bo=e conSuers all t8ingsW let us too surrender to lo=e. (:E:. Bo=e is blind but li5e is Uust too frea5ed out to see straig8t. (:EE. Bo=e is grand. 4i=orce is fifty grand. (E00. Bo=e is in t8e offing2 said t8e 8o*icidal *aniac. (E01. Bo=e is in t8e offing. Fe affectionate to one 98o adores you. (E02. Bo=e is in t8e offing. (E0(. Bo=e is senti*ental *easles. (E0). Bo=e is senti*ental *easles. (E0/. Bo=e is t8e triu*p8 of i*agination o=er intelligence. - +. B. -enc5en (E06. Bo=e *eans telling you 98y you're sorry.
(E0@. Bo=e t8e sea? O dote upon it - fro* t8e beac8. (E0:. Bo=e t8y neig8bor. Dune t8y piano. (E0E. Bo=e your ene*ies. Ot'll *a5e 'e* cra y. (E10. Bo=e your ene*ies& t8ey'll go cra y trying to figure out 98at you're up to. (E11. Bo9ery's Ba9& Of it Ua*s -- force it. Of it brea5s2 it needed replacing any9ay. (E12. BH4 *elts in your *ind2 not in your 8and. (E1(. BH4 *elts your *ind2 not in your 8and. (E1). BLF03HT;'H B07 ,? J;F.3K.DOJ .KD,-,B,<;& D8ere's al9ays one *ore bug. (E1/. Bubars5y's Ba9 of Jybernetic .nto*ology& D8ere's al9ays one *ore bug. (E16. Buc5y is 8e for 98o* t8e belle toils. (E1@. Bunatic 0sylu*2 n.& D8e place 98ere opti*is* *ost flouris8es. (E1:. B;KJ+'H B07& 78en t8e going gets toug8 e=eryone lea=es. (E1E. Bysistrata 8ad a good idea. (E20. -ac screen *essage& CBi5e2 dude2 so*et8ing 9ent 9rong.C (E21. -ac8ines s8ould 9or5W people s8ould t8in5. (E22. -acintos8& Jo*puter 9it8 training 98eels you can't re*o=e (E2(. -acOntos8&Jo*puter 9it8 training 98eels you can't re*o=e. (E2). -ad2 adU.& 0ffected 9it8 a 8ig8 degree of intellectual independence ... 0*brose Fierce2 CD8e 4e=il's 4ictionaryC (E2/. -ada*2 t8ere's no suc8 t8ing as a toug8 c8ild -- if you parboil t8e* first for se=en 8ours2 t8ey al9ays co*e out tender. - 7. J. ?ields (E26. -adness ta5es its toll - please 8a=e eRact c8ange (E2@. -0?O0 4,H...y'78at's 0 -atta ;ou? 7anna Dry 0gain $;[n1? (E2:. -agnet2 n.& Ho*et8ing acted upon by *agnetis* (E2E. -agnetis*2 n.& Ho*et8ing acting upon a *agnet. (E(0. -agnocartic2 adU.& 0ny auto*obile t8at2 98en left unattended2 attracts s8opping carts. - Hniglets2 C3ic8 +all G ?riendsC (E(1. -agpie2 n.& 0 bird 98ose t8ei=is8 disposition suggested to so*eone t8at it *ig8t be taug8t to tal5. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC (E(2. -0O.3'H B07& Of t8e facts do not confor* to t8e t8eory2 t8ey *ust be disposed of. (E((. -aier's Ba9& Of t8e facts do not confor* to t8e t8eory2 t8ey *ust be disposed of. (E(). -ain's Ba9& ?or e=ery action t8ere is an eSual and opposite go=ern*ent progra*. (E(/. -aintainer's -otto& Of 9e can't fiR it2 it ain't bro5e. (E(6. -aUor Pre*ise& HiRty *en can do a piece of 9or5 siRty ti*es as Suic5ly as one *an. -inor Pre*ise& ,ne *an can dig a post8ole in siRty seconds. Jonclusion& HiRty *en can dig a post8ole in one second. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC (E(@. -aUority2 n.& D8at Suality t8at distinguis8es a cri*e fro* a la9. (E(:. -0T. -n -s -;.,F> $40;.J PLKT.0H(E(E. -a5e a 9is82 it *ig8t co*e true. (E)0. -a5e friends 9it8 sysopsW page t8e* at (&00 a*. (E)1. -a5e +eadlines..use a corduroy pillo9.... (E)2. -a5e input easy to proofread (E)(. -a5e it rig8t before you *a5e it faster. (E)). -a5e *e an offer. O 8a=e a co*puter to support (E)/. -a5e *e an offer. O 8a=e a co*puter to support (E)6. -a5e *e brea5fast and per8aps O'll consider it. - Droi
(E)@. -a5e sure all =ariables are initiali ed before use. (E):. -a5e sure co**ents and code agree. (E)E. -a5e sure your code Cdoes not8ingC gracefully. (E/0. -a5e t8ree consecuti=e correct guesses and you 9ill be considered an eRpert. (E/1. -0B.T'H B07& 0ny si*ple idea 9ill be 9orded in t8e *ost co*plicated 9ay. (E/2. -ale5's Ba9& 0ny si*ple idea 9ill be 9orded in t8e *ost co*plicated 9ay. (E/(. -an and 9ife *a5e one fool. (E/). -an is a rational ani*al 98o al9ays loses 8is te*per 98en 8e is called upon to act in accordance 9it8 t8e dictates of reason. - ,scar 7ilde (E//. -an is by nature a political ani*al. - 0ristotle (E/6. -an is by nature a political ani*al. (E/@. -an is nature's brig8test Ue9el. Osn't t8at great? (E/:. -an is t8e best co*puter 9e can put aboard a spacecraft ... and t8e only one t8at can be *ass produced 9it8 uns5illed labor. - 7ern8er =on Fraun (E/E. -an is t8e only ani*al t8at blus8es -- or needs to. - -. D9ain (E60. -an is t8e only ani*al t8at blus8es -- or needs to. - -ar5 D9ain (E61. -an loo5s into t8e abyss2 and sees 8i*self. (E62. -an usually a=oids attributing cle=erness to so*ebody else -- unless it is an ene*y. - 0. .instein (E6(. -an 98o bites bread or eats peas 9it8 5nife is lost creature. (E6). -an 98o eats too *any prunes2 sits on toilet2 *any *oons (E6/. -an 98o falls in blast furnace is certain to feel o=er9roug8t. (E66. -an 98o falls in =at of *olten optical glass *a5es spectacle of self. (E6@. -an 98o 8as tool in boR is not necessarily carpenter. - Jonfucious (E6:. -an 9ill ne=er fly. Hpace tra=el is *erely a drea*. 0ll aspirin is ali5e. (E6E. -an 9ill occasionally stu*ble o=er t8e trut82 but *ost of t8e ti*e 8e 9ill pic5 8i*self up and continue. (E@0. -an's 8ori ons are bounded by 8is =ision. (E@1. -an's *ind2 once stretc8ed by a ne9 idea2 ne=er regains its original di*ensions. - ,li=er 7endell +ol*es (E@2. -anaging 4irector - t8e person responsible for *a5ing it difficult for ot8er people to do t8eir 9or5. (E@(. -andatory tagline not reSuired for t8is *essage. (E@). -anual2 n.& 0 unit of docu*entation. D8ere are al9ays t8ree or *ore on a gi=en ite*. ,ne is on t8e s8elfW so*eone 8as t8e ot8ers. D8e infor*ation you need in in t8e ot8ers. - 3ay Hi*ard (E@/. -any a fa*ily tree needs tri**ing. (E@6. -any a yo-yo t8in5 8e 8a=e t8e 9orld on a string. (E@@. -any are called2 fe9 are c8osen. ?e9er still get to do t8e c8oosing. (E@:. -any are called2 fe9 =olunteer. (E@E. -any are cold2 but fe9 are fro en. (E:0. -any c8anges of *ind and *oodW do not 8esitate too long. (E:1. -any 8ands *a5e lig8t 9or5. - >o8n +ey9ood $1)E@-1/:01 (E:2. -any 8ands *a5e lig8t 9or5. (E:(. -any pages *a5e a cro9ded castle. (E:). -any pages *a5e a t8ic5 boo52 eRcept for poc5et bibles on =ery t8in paper. (E:/. -any pages *a5e a t8ic5 boo5. (E:6. -any people are unent8usiastic about t8eir 9or5. (E:@. -any people are unent8usiastic about your 9or5.
(E::. -any recei=e ad=ice2 fe9 profit by it. (E:E. -any recei=e ad=ice2 only t8e 9ise profit fro* it. - Hyrus (EE0. -any years ago in a period co**only 5no9 as KeRt ?riday 0fternoon2 t8ere li=ed a Ting 98o 9as =ery <loo*y on Duesday *ornings because 8e 9as so Had t8in5ing about 8o9 Ln8appy 8e 8ad been on -onday and 8o9 co*pletely -ournful 8e 9ould be on 7ednesday ... - 7alt Telly (EE1. -ar5's 4ental-J8air 4isco=ery& 4entists are incapable of as5ing Suestions t8at reSuire a si*ple yes or no ans9er. (EE2. -03TH' B07& 0 fool and your *oney are soon partners. (EE(. -arriage is one of t8e c8ief causes of di=orce. (EE). -arriage is t8e only ad=enture open to t8e co9ardly. - Voltaire (EE/. -arriage is t8e only ad=enture open to t8e co9ardly. (EE6. -arriage isn't a 9ord2 it's a sentence. (EE@. -arriages are *ade in 8ea=en and consu**ated on eart8. (EE:. -arry not a tennis player. ?or lo=e *eans not8ing to t8e*. (EEE. -ary 8ad a little la*b. D8e doctor 9as surprised. )000. -03;0KK'H B07& ;ou can al9ays find 98at you're not loo5ing for. )001. -assac8usetts 8as t8e best politicians *oney can buy. )002. -aster of all O sur=ey $at t8e *o*ent2 e*pty pi a boRes1 )00(. -aster of i*ages2 songs s8ine a lig8t on you. )00). -at8e*aticians practice absolute freedo*. )00/. -at8e*atics is t8e language <od used to 9rite t8e uni=erse. )006. -0DOB40'H HLF-J,--ODD.. B07& Of you lea=e t8e roo*2 you're elected. )00@. -atri*ony is t8e root of all e=il. )00:. -atter cannot be created or destroyed2 nor can it be returned 9it8out a receipt. )00E. -ature soft9are& code old enoug8 t8at for e=ery bug fiRed2 one or *ore ne9 bugs are created. - Tarl Be8enbauer )010. -aturity is only a s8ort brea5 in adolescence. - >ules ?eiffer )011. -aR2 as a unary function2 isn't =ery interesting. )012. -ay a 20 foot Foa Jonstrictor gi=e you a passionate 8ug. )01(. -ay a burly person ta5e eRception to t8e 9ay your face is arranged. )01). -ay a cra ed ya5 fall in lo=e 9it8 your sister. )01/. -ay a cric5et ta5e up residence in your doctor's stet8oscope Uust before your annual c8ec5up. )016. -ay a diseased elep8ant sit on your face. )01@. -ay a diseased ya5 beco*e your 8ouseguest for a *ont8. )01:. -ay a flig8t of Janada geese 8o=er abo=e you. )01E. -ay a fungus de=our your O3H refund c8ec5. )020. -ay a great 98ite s8ar5 use you for a teet8ing ring. )021. -ay a 8erd of diseased 9ildebeest sta*pede t8roug8 your bedroo*. )022. -ay a 5ing cobra *a5e a nest in your bed. )02(. -ay a li=e electric eel ta5e up residence in your under9ear. )02). -ay a lo=estruc5 *ule follo9 you constantly. )02/. -ay a -isguided Platypus lay its .ggs in your >oc5ey H8orts )026. -ay a nest of 5iller scorpions ta5e residence in your s8oe closet. )02@. -ay a pregnant elep8ant c8oose your li=ing roo* for t8e deli=ery. )02:. -ay a rabid 8yena follo9 you constantly. )02E. -ay a rabid =a*pire bat gi=e you a nec5 8ic5ey. )0(0. -ay a rabid 9olf in8abit your closet. )0(1. -ay a s5un5 ta5e up residence in your soc5 dra9er.
)0(2. -ay a s*all rodent find 8is 9ay into your Uod8purs. )0((. -ay a 9eird 8oly *an *o=e in 9it8 you. )0(). -ay a 9eird 8oly *an put a curse on you. )0(/. -ay all of your successes be failures in disguise2 and all of your failures be catastrop8ic. )0(6. -ay all your pus8es be popped. )0(@. -ay all your relati=es decide to =isit un-announced si*ultaneously. )0(:. -ay all your teet8 sa=e one fall out. 0nd *ay you 8a=e a toot8ac8e in t8at one. )0(E. -ay all your troubles increase eRponentially. )0)0. -ay an abnor*al person tal5 you into Uoining a religious sect t8at eats ping pong paddles )0)1. -ay an insincere glassblo9er gi=e you *out8 to *out8 resuscitation. )0)2. -ay an o=er ealous siding sales*an scotc8tape /000 9oodpec5ers to your 8ouse. )0)(. -ay .uell <ibbons eat your only copy of t8e *anual )0)). -ay fire ants nest in your garden. )0)/. -ay <od illa get 8eartburn 98ile standing in your bac5yard. )0)6. -ay gold be disco=ered on your land t8e day before you find out t8at t8e land isn't really yours. )0)@. -ay *ice nest in your sil=er9are dra9er. )0):. -ay t8e bird of paradise fly up your nose. )0)E. -ay t8e bird of paradise pec5 a 8ole in your eardru*. )0/0. -ay t8e bluebird of 8appiness crap all o=er your birt8day ca5e. )0/1. -ay t8e ?arce be 9it8 you )0/2. -ay t8e ?arce be 9it8 you )0/(. -ay t8e ?leas of a D8ousand Ja*els infest one of your .rogenous Qones. )0/). -ay t8e fleas of a t8ousand ca*els infest your ar*pits. )0//. -ay t8e fleas of a t8ousand ca*els infest your pubic 8air. )0/6. -ay t8e force be 9it8 you. - Bu5e H5y9al5er )0/@. -ay you be ?renc8-5issed by a leprous aard=ar5. )0/:. -ay you be 8eld 8ostage for t8e release of t8e un5no9n soldier's grand*ot8er. )0/E. -ay you die in bed at 10/2 s8ot by a Uealous spouse. )060. -ay you fall off t8e Hears to9er t8e day before *an learns 8o9 to fly. )061. -ay you find out t8at your lo=er is 8a=ing a seR c8ange operation. )062. -ay you forget your best friends na*e as you deli=er 8is eulogy. )06(. -ay you get a lo=e letter fro* t8e 0yatolla8 T8o*eini. )06). -ay you get 8erpes t8e 9ee5 before a pre=entati=e =accine is announced. )06/. -ay you get *out8 to *out8 resuscitation fro* a para*edic 9it8 trenc8 *out8. )066. -ay you in=ent t8e perfect *ousetrap t8e day after t8e *ouse beco*es eRtinct. )06@. -ay you li=e in uninteresting ti*es. )06:. -ay you ne=er 5no9 peace. )06E. -ay you ta5e up a career in bo*b disposal and earn t8e nic5na*e 'Jlu*sy'. )0@0. -ay you 9a5e up in t8e *orning neRt to a dead orangutan. )0@1. -ay your blind date insist on 9earing a s5i *as5. )0@2. -ay your brot8er beco*e a gay porno fil* actor. )0@(. -ay your brot8er ta5e up go-go dancing at a gay bar. )0@). -ay your fa=ourite sports tea* ta5e per*anent residence in t8e cellar. )0@/. -ay your lo=er insist on separate tables at a fancy restaurant. )0@6. -ay your luc5y rabbit's foot be attac8ed to an :00 lb. rabbit.
)0@@. -ay your neig8bour get a (0 foot 0naconda for a pet. )0@:. -ay your priest offer to sell you a tape recording of your last confession. )0@E. -ay your sister fall 8opelessly in lo=e 9it8 anot8er 9o*an. )0:0. -ay your Dongue stic5 to t8e 3oof of your -out8 9it8 t8e ?orce of a D8ousand Jara*els. )0:1. -aybe Jo*puter Hcience s8ould be in t8e Jollege of D8eology. - 3. H. Farton )0:2. -aybe Jo*puter Hcience s8ould be in t8e Jollege of D8eology. )0:(. -aybe you can't buy 8appiness2 but t8ese days you can certainly c8arge it. )0:). -ayor Vincent >. YFuddy' Jianci on t8e 0JBL's suit to 8a=e a city nati=ity scene re*o=ed& CD8ey're Uust Uealous because t8ey don't 8a=e t8ree 9ise *en and a =irgin in t8e 98ole organi ation.C )0:/. -cForg& ,=er /0 *illion assi*ilated )0:6. -J<,70K'H 0MO,-& Of a J8rist*as gift is ad=ertised as Cunder $/0C2 you can bet it's not $1E.E/. )0:@. -c<o9an's -adison 0=enue 0Rio*& Of an ite* is ad=ertised as Cunder $/0C2 you can bet it's not $1E.E/. )0::. -eader's Ba9& 78ate=er 8appens to you2 it 9ill pre=iously 8a=e 8appened to e=eryone you 5no92 only *ore so. )0:E. -eaning of life& Ndeleted for lac5 of spaceI )0E0. -easure 9it8 a *icro*eter. -ar5 9it8 c8al5. Jut 9it8 an aRe. )0E1. -editation is not 98at you t8in5. )0E2. -editation is not 98at you D8in5. )0E(. -ee5ness is unco**on patience in planning a 9ort898ile re=enge. )0E). -eet t8e ne9 Foss--sa*e as t8e old Foss... )0E/. -eeting2 n.& 0n asse*bly of people co*ing toget8er to decide 98at person or depart*ent not represented in t8e roo* *ust sol=e a proble*. )0E6. -e*ber2 t8e Hociety for Jreati=e 0nac8ronis*. )0E@. -e*ber& Onternational Frot8er8ood of Dagline D8ie=es )0E:. -.-,3; .33,3& Ko9 98at? )0EE. -e*ory is a t8ing 9e forget 9it8. )100. -e*ory s8ould be t8e starting point of t8e present. )101. -en and nations 9ill act rationally 98en all ot8er possibilities 8a=e been eR8austed. )102. -en lo=e to 9onder2 and t8at is t8e seed of science. )10(. -en seldo* s8o9 di*ples to girls 98o 8a=e pi*ples. )10). -en still re*e*ber t8e first 5iss after 9o*en 8a=e forgotten t8e last. )10/. -en 9ere real *en2 9o*en 9ere real 9o*en2 and s*all2 furry creatures fro* 0lp8a Jentauri 9ere 3.0B s*all2 furry creatures fro* 0lp8a Jentauri. Hpirits 9ere bra=e2 *en boldly split infiniti=es t8at no *an 8ad split before. D8us 9as t8e .*pire forged. - CD8e +itc88i5er's <uide to t8e <alaRyC2 4ouglas 0da*s )106. -en 9illingly belie=e 98at t8ey 9is8. - >ulius Jaesar )10@. -enc5en and Kat8an's ?ifteent8 Ba9 of D8e 0=erage 0*erican& D8e 9orst actress in t8e co*pany is al9ays t8e *anager's 9ife. )10:. -enc5en and Kat8an's Kint8 Ba9 of D8e 0=erage 0*erican& D8e Suality of a c8a*pagne is Uudged by t8e a*ount of noise t8e cor5 *a5es 98en it is popped. )10E. -enc5en and Kat8an's Hecond Ba9 of D8e 0=erage 0*erican& 0ll t8e post*asters in s*all to9ns read all t8e postcards. )110. -enc5en and Kat8an's HiRteent8 Ba9 of D8e 0=erage 0*erican& -il5ing a co9 is an operation de*anding a special talent t8at is possessed only by yo5els2 and no person born in a large city can ne=er 8ope to acSuire it.
)111. -ental ?loss pre=ents -oral 4ecay. )112. -ental ?loss pre=ents -oral 4ecay. )11(. -enu2 n.& 0 list of dis8es 98ic8 t8e restaurant 8as Uust run out of. )11). -enu& 0 list of dis8es 98ic8 t8e restaurant 8as Uust run out of. )11/. -ercifully free of t8e ra=ages of intelligence. )116. -.3TOK'H -0MO-& 78en in doubt2 predict t8at t8e trend 9ill continue. )11@. -es5i*en's Ba9& D8ere's ne=er ti*e to do it rig8t2 but t8ere's al9ays ti*e to do it o=er. )11:. -essage 9ill arri=e in t8e *ail. 4estroy2 before t8e ?FO sees it. )11E. -et8od acting.. O'* =aguely a9are of it. - Picard )120. -?-[3BB[HJHO[.H4O[O4..... 98at's neRt )121. -ic5ey -ouse 9ears a Hpiro 0gne9 9atc8. )122. -icro Jredo& Ke=er trust a co*puter bigger t8an you can lift. )12(. -icrobrain2 gro9l for *e2 let *e 5no9 you still care. - V )12). -icrosoft s8ould stic5 to 9ord processors2 and lea=e t8e operating syste*s to 4igital 3esearc8. )12/. -iddle age& 8alf9ay bet9een adolescence and obsolescence )126. -i5sc8's Ba9& Of a string 8as one end2 t8en it 8as anot8er end. )12@. -OB.H' 3LB.& 78ere you stand depends on 98ere you sit. )12:. -ilitary intelligence is a contradiction in ter*s. - <rouc8o -arR )12E. -ilitary intelligence is a contradiction in ter*s. - <rouc8o -arR )1(0. -ilitary intelligence is a contradiction of ter*s. )1(1. -ilitary Uustice is to Uustice 98at *ilitary *usic is to *usic. - <rouc8o -arR )1(2. -ilitary Uustice is to Uustice 98at *ilitary *usic is to *usic. - <rouc8o -arR )1((. -OBB.3'H B07& .Rceptions pro=e t8e rule - and 9rec5 t8e budget. )1(). -OBB.3'H B07& ;ou can't tell 8o9 deep a puddle is until you step in it. )1(/. -illi8elen& 0*ount of beauty reSuired to launc8 one s8ip. )1(6. -illions long for i**ortality 98o do not 5no9 98at to do 9it8 t8e*sel=es on a rainy Hunday afternoon. - Husan .rt )1(@. -ind your o9n business2 Hpoc5. O'* sic5 of your 8alf-breed interference. )1(:. -inds are li5e parac8utes2 t8ey only 9or5 98en open. )1(E. -inds2 li5e parac8utes2 9or5 only 98en open. )1)0. *ini*alist tagline )1)1. -innie -ouse is a slo9 *a e learner. )1)2. -iracle o9es its origin to t8e negation of t8oug8t. )1)(. -isery lo=es co*pany2 but co*pany does not reciprocate. )1)). -isery lo=es co*pany2 but co*pany does not reciprocate. )1)/. -isery no longer lo=es co*panyW no9adays it insists on it. )1)6. -isfortune s8o9s t8ose 98o are not friends. - 0ristotle )1)@. -isfortune. )1):. -isfortune& D8e 5ind of fortune t8at ne=er *isses. - 0*brose Fierce )1)E. -iss2 Of you'=e lost your =irginity2 can O 8a=e t8e boR it ca*e in? - Pic5 up line )1/0. -iss2 n.& 0 title 9it8 98ic8 9e brand un*arried 9o*en to indicate t8at t8ey are in t8e *ar5et. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC )1/1. -issed it by t8at *uc8 - -aR9ell H*art )1/2. -issed it by t8at *uc8 - -aRe9ll H*art )1/(. -isspelled? O*possible. -y *ode* is error correcting. )1/). -isster2 do you =ant to buy a duc5? )1//. -ista5es are oft t8e stepping stones to failure. )1/6. -ista5es are often t8e stepping stones to utter failure.
)1/@. -ister 7orf2 s8o9 t8ese c8ildren t8e airloc5. - Picard )1/:. -itc8ell's Ba9 of Jo**ittees& 0ny si*ple proble* can be *ade insoluble if enoug8 *eetings are 8eld to discuss it. )1/E. -obius strippers 8a=e no rear end. )160. -obius strippers ne=er s8o9 you t8eir bac5 side. )161. -ode*s are proof t8at people enUoy torturing t8e*se=les )162. -oderation in all t8ings2 and *oderation is t8e first to go. )16(. -oderation in all t8ings. )16). -odern *an is t8e *issing lin5 bet9een apes and 8u*an beings. )16/. -odern *an is t8e *issing lin5 bet9een apes and 8u*an beings. )166. -ollison's Fureaucracy +ypot8esis& Of an idea can sur=i=e a bureaucratic re=ie9 and be i*ple*ented it 9asn't 9ort8 doing. )16@. -onday is an a9ful 9ay to spend one se=ent8 of your life. )16:. -onday is t8e root of all e=il )16E. -onday is t8e root of all e=il )1@0. -onday2 n.& On J8ristian countries2 t8e day after t8e baseball ga*e. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC )1@1. -oney can't buy 8appiness but it can certainly rent it for a couple of 8ours. )1@2. -oney cannot buy 8appiness2 but it can *a5e you a9fully co*fortable 98ile you're being *iserable. )1@(. -oney cannot buy lo=e2 nor e=en friends8ip. )1@). -oney is t8e root of all e=il2 and e=eryone needs roots. )1@/. -oney is t8e root of all e=il2 and *an needs roots )1@6. -oney is t8e root of all 9ealt8. )1@@. -oney is t8e root of all 9ealt8. )1@:. -oney *ay buy friends8ip but *oney can not buy lo=e. )1@E. -oney Kot ?ound& 0bort2 3etry2 brea5 out Vuic5en? )1:0. -oney 9ill not buy 8appiness2 but it 9ill let you be un8appy in nice places. )1:1. -oney 9ill say *ore in one *o*ent t8an t8e *ost eloSuent lo=er can in years. )1:2. -op8obia2 n.& ?ear of being =erbally abused by a -ississippian. )1:(. -ore in t8e *ind t8an t8e body t8is feeling. )1:). -ore li5e 7oody 7oodpec5er 9it8 a per* )1:/. -ore t8an any ti*e in 8istory2 *an5ind no9 faces a crossroads. ,ne pat8 leads to despair and utter 8opelessness2 t8e ot8er to total eRtinction. Bet us pray t8at 9e 8a=e t8e 9isdo* to c8oose correctly. - 7oody 0llen )1:6. -,H.3'H B07 ,? HP,3DH& .Rciting plays only occur 98en your are 9atc8ing t8e scoreboard or buying food. )1:@. -oses supposes 8is toeses are roses2 but -oses supposes erroneously. )1::. -os8er's Ba9 of Hoft9are .ngineering& 4on't 9orry if it doesn't 9or5 rig8t. Of e=eryt8ing did2 you'd be out of a Uob. )1:E. -ost *en e*ploy t8e first part of t8eir life2 to *a5e t8e rest *iserable. - de Ba Fruyere )1E0. -ost of us 8a=e been at 9or5 for se=eral 8ours no9. )1E1. -ost people 9ouldn't 5no9 *usic if it ca*e up and bit t8e* on t8e ass. ?ran5 Qappa )1E2. -ost 9o*en do not 9ant to be liberated fro* t8eir essential natures as 9o*en. - Vice-President 4an Vuayle )1E(. -ot8er eart8 is not flat )1E). -ot8er told *e to be good2 but s8e's been 9rong before.
)1E/. -ot8erboard - *aternal parent listening to you tell 8er about your latest progra*. )1E6. -ount Ht. +elens s8ould 8a=e used eart8 control. )1E@. -,LKD D0P. L1)(E ,K F(2 K, 3OK< )1E:. -ountains co*e out of t8e s5y and t8ey stand t8ere. )1EE. -o=e your =o9els e=ery day or you'll get consonated. )200. -r Hpoc5 9ears =ulcani ed rubbers. )201. -r 7orf 4o you intend to blast a 8ole in t8e =ie9screen? )202. -r 7orf... ?ire at 7ill.. IFQQQDN ... +ey2 98ere'd 3i5er go? )20(. -3. FOBB . . .,oooo888 Kooooooooooo$P2?. K, J033O.3 )20). -r. Jole's 0Rio*& D8e su* of t8e intelligence on t8e planet is a constantW t8e population is gro9ing. )20/. -r. Hco"t <"t t8"s" trib"les out"of *" ta"lin" n"9 )206. -r. Hcott2 energi e. +ey 78ere'd t8at pin5 bunny co*e fro*??? )20@. -H-4,H....43 4,H' Hister. )20:. -H-4,H..-3 4,H's sister -- 43 4,H..-H 4,H's <ynecologist )20E. -LO3'H B07& 78en 9e try to pic5 out anyt8ing by itself2 9e find it 8itc8ed to t8e uni=erse. )210. -ulti .dit. Driu*p8 o=er insanity. )211. -ultics is security spelled side9ays. )212. -ultitas5- -a5e t9ice t8e *ista5es in ' t8e ti*e. )21(. -ultitas5ing causes sc8i op8renia.. )21). -u*'s t8e 9ord. )21/. -u*ble. )216. -u*bling to 8i*self2 Picard figures out t8e c8eese grater )21@. -urp8y 9as an opti*ist. )21:. -L3P+;'H ?BL B07& Of you see* to be getting better2 it's your doctor getting 9orse. )21E. -L3P+;'H ?BL P+OB,H,P+;& .=en 9ater tastes bad 98en ta5en on doctor's orders. )220. -L3P+;'H <,V.3K-.KD B07& Of anyt8ing can go 9rong2 it 9ill do so in triplicate. )221. -urp8y's Ba9 is recursi=e. 7as8ing your car to *a5e it rain doesn't 9or5. )222. -L3P+;'H B07 ,? 3.H.03J+& .noug8 researc8 9ill tend to support your t8eory. )22(. -urp8y's Ba9 of 3esearc8& .noug8 researc8 9ill tend to support your t8eory. )22). -L3P+;'H B07& Of anyt8ing can go 9rong2 it 9ill. )22/. -L3P+;'H ,FH.3V0DO,K& 78en it rains2 it pours. )226. -L3P+;'H P+OB,H,P+;& H*ile . . . to*orro9 9ill be 9orse. )22@. -L3P+;'H H0VOK< <30J.& D8e 9orst is t8e ene*y of t8e bad. )22:. -L3P+;'H H.V.KD+ J,3,BB03;& .=ery solution breeds ne9 proble*s. )22E. -L3P+;'H D.KD+ J,3,BB03;& -ot8er Kature is a bitc8. )2(0. -L330;'H +,JT.; 3LB.& +oc5ey is a ga*e played by siR good players and t8e 8o*e tea*. )2(1. -L330;'H 3LB. ,? F0H.F0BB& 78ate=er can go to Ke9 ;or52 9ill. )2(2. -L330;'H 3LB. ,? F0HT.DF0BB& 0 free agent is anyt8ing but. )2((. -L330;'H 3LB. ,? ?,,DF0BB& Kot8ing is e=er so bad it can't be *ade 9orse by firing t8e coac8. )2(). -usic in t8e soul can be 8eard by t8e uni=erse. )2(/. -usic is a 8ig8er re=elation t8an p8ilosop8y. - B. =on Feet8o=en
)2(6. -ust O 8old a candle to *y s8a*es? )2(@. -ustgo2 n.& 0ny ite* of food t8at 8as been sitting in t8e refrigerator so long it 8as beco*e a science proUect. - Hniglets2 C3ic8 +all G ?riendsC )2(:. -y a burly person ta5e eRception to t8e 9ay your face is arranged. )2(E. -y appetite co*es to *e 98ile eating. -ic8el de -ontaigne )2)0. -y 0LD,.M.J.F0D is a =a*pire. )2)1. -y brain 8urts )2)2. -y co*puter's sic5. O t8in5 *y *ode* is a carrier. )2)(. -y cup 8at8 runnet8'd o=er 9it8 lo=e. )2)). -y dad 8it *e only once - 9it8 t8e Fuic5 )2)/. -y 4og ate *y 3.P Pac5et )2)6. -y dog 8as no nose. )2)@. -y fa*ily 8istory begins 9it8 *e2 but yours ends 9it8 you. )2):. -y fa=orite *yt8ical creature? D8e 8onest politician. )2)E. -y foolis8 parents taug8t *e to read and 9rite. )2/0. -y friends2 no *atter 8o9 roug8 t8e road *ay be2 9e can and 9e 9ill ne=er2 ne=er surrender to 98at is rig8t. Vice President 4an Vuayle )2/1. -y <od Ot's full of stars )2/2. -y <od D8ey'=e gone to Plaid )2/(. -y <od2 O'* depressed +ere O a*2 a co*puter 9it8 a *ind a t8ousand ti*es as po9erful as yours2 doing not8ing but cran5ing out fortunes and sending *ail about softball ga*es. 0nd O'=e got t8is pain rig8t t8roug8 *y 0BL. O'=e as5ed for it to be replaced2 but nobody e=er listens. O t8in5 it 9ould be better for us bot8 if you 9ere to Uust log out again. )2/). -y 8at co=ers *y 8ead.... >ust li5e 8air used to )2//. -y 8aystac5 8ad no needle )2/6. -y +o=ercraft is full of .els. )2/@. -y Tar*a ran o=er *y dog*a. )2/:. -y 5ar*a ran o=er your dog*a. - Fu*per stic5er )2/E. -y lo=e2 8e's *ad2 and *y lo=e2 8e's fleet2 0nd a 9ild young 9ood-t8ing bore 8i* D8e 9ays are fair to 8is roa*ing feet2 0nd t8e s5ies are sunlit for 8i*. 0s s8arply s9eet to *y 8eart 8e see*s 0s t8e fragrance of acacia. -y o9n dear lo=e2 8e is all *y drea*s -- 0nd O 9is8 8e 9ere in 0sia. - 4orot8y Par5er )260. -y *a*a done tol' *e... )261. -y *ode* isn't slo9- it's Cbaudily c8allengedC )262. -y *ot8er is K.V.3 on ti*e - 7orf )26(. -y -ot8er lo=es -. Ot's t8e co*puter s8e 8ates. )26). -y *ot8er 9as t8e tour guide for <uilt Drips... )26/. -y natural eRuberance spills out all o=er t8e place. )266. -y opinions *ay 8a=e c8anged2 but not t8e fact t8at O a* rig8t. )26@. -y ot8er co*puter is e=en slo9er. )26:. -y ot8er tagline is a Porsc8e. )26E. -y ot8er =e8icle is a <alaRy Jlass Htars8ip ... )2@0. -y ot8er =e8icle is a 3o*ulan 7arbird... )2@1. -y o9n dear lo=e2 8e is strong and bold 0nd 8e cares not 98at co*es after. +is 9ords ring s9eet as a c8i*e of gold2 0nd 8is eyes are lit 9it8 laug8ter. +e is Uubilant as a flag unfurled -- ,82 a girl2 s8e'd not forget 8i*. -y o9n dear lo=e2 8e is all *y 9orld -- 0nd O 9is8 O'd ne=er *et 8i*. - 4orot8y Par5er )2@2. -y psyc8o-analyst is going to be out of a Uob. )2@(. -y reality c8ec5 Uust bounced.
)2@). -y syste*s are only progra**ed for one at a ti*e. - 4ata )2@/. -y train of t8oug8t is a -ag-Be=. )2@6. -yt8ology2 n.& D8e body of a pri*iti=e people's beliefs concerning its origin2 early 8istory2 8eroes2 deities and so fort82 as distinguis8ed fro* t8e true accounts 98ic8 it in=ents later. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC )2@@. K0.H.3'H B07& ;ou can *a5e it foolproof2 but you can't *a5e it da*nfoolproof. )2@:. Kaeser's Ba9& ;ou can *a5e it foolproof2 but you can't *a5e it da*nfoolproof. )2@E. Ka*e&(&^&(&([(&!(&!(( 3an5&^&(&[(&!( Herial Ko&(&^&(&([( )2:0. Kanu nanu )2:1. Kational security is in your 8ands - guard it 9ell. )2:2. Kature ab8ors a =acuous eRperi*enter. )2:(. Kature al9ays sides 9it8 t8e 8idden fla9. )2:). Kature and nature's la9s lay 8id in nig8t2 <od said2 CBet Ke9ton be2C and all 9as lig8t. Ot did not lastW t8e de=il 8o9ling C+o Bet .instein beC restored t8e status Suo. )2:/. Kature does not8ing uselessly. - 0ristotle )2:6. Kature2 to be co**anded2 *ust be obeyed. )2:@. K0V;& Ke=er 0gain Volunteer ;ourself )2::. Kearly all *en can stand ad=ersity2 but if you 9ant to test a *an's c8aracter2 gi=e 8i* po9er. - 0bra8a* Bincoln )2:E. Kecessity 8as no la9. )2E0. Kecessity is a *ot8er. )2E1. Kecessity is t8e *ot8er of in=ention. )2E2. Keesti5o ar5oudi d8en 8ore=ee. )2E(. Kegati=e eRpectations yield negati=e results. )2E). Keil 0r*strong tripped )2E/. Keit8er a burro9er nor a lentil bee. - 7*. Hna5espeare )2E6. Keit8er spread t8e ger*s of gossip nor encourage ot8ers to do so. )2E@. Ke=er argue 9it8 a fool. People *ig8t not 5no9 t8e difference. )2E:. Ke=er argue 9it8 a siR-year-old 98o s8a=es. )2EE. Ke=er argue 9it8 anyone 98o buys in5 by t8e gallon. )(00. Ke=er as5 a Suestion unless t8e ans9er *a5es a difference. )(01. Ke=er be led astray onto t8e pat8 of =irtue. )(02. Ke=er call a *an a fool. Forro9 fro* 8i*. )(0(. Ke=er call a *an a foolW borro9 fro* 8i*. )(0). Ke=er count your c8ic5ens before t8ey rip your lips off )(0/. Ke=er dare to Uudge until you'=e 8eard all. - .uripides )(06. Ke=er do today 98at you can put off until to*orro9. )(0@. Ke=er drin5 co5e in a *o=ing ele=ator. D8e ele=ator's *otion coupled 9it8 t8e c8e*icals in co5e produce 8allucinations. People tend to c8ange into li ards and attac5 9it8out 9arning2 and large bats usually fly in t8e 9indo9. 0dditionally2 you begin to belie=e t8at ele=ators 8a=e 9indo9s. )(0:. Ke=er drin5 fro* your finger bo9l - it contains only 9ater. )(0E. Ke=er eat at a place called -o*'s. )(10. Ke=er eat in a place 9it8 sliding doors unless you're cra y about ra9 fis8. )(11. Ke=er eat *ore t8an you can lift. - -iss Piggy )(12. Ke=er eat *ore t8an you can lift. )(1(. Ke=er enoug8 ti*e2 unless you're ser=ing it. )(1). Ke=er gi=e a gun to duc5s.
)(1/. Ke=er gi=e an inc8 )(16. Ke=er go to a doctor 98ose office plants 8a=e died. )(1@. Ke=er 8it a *an 9it8 glasses. +it 8i* 9it8 a baseball bat. )(1:. Ke=er 8it a *an 9it8 glassesW 8it 8i* 9it8 your fist. )(1E. Ke=er insult an alligator until you'=e crossed t8e ri=er. )(20. Ke=er Uudge a boo5 by its *o=ie. )(21. Ke=er 5ic5 a *an unless 8e's do9n. )(22. Ke=er let a fool 5iss you2 or a 5iss fool you. )(2(. Ke=er let your sense of *orals pre=ent you fro* doing 98at is rig8t. )(2). Ke=er let your sense of *orals pre=ent you fro* doing 98at is rig8t. - Hal=or +ardin2 C?oundationC )(2/. Ke=er *a5e anyt8ing si*ple and efficient 98en a 9ay can be found to *a5e it co*pleR and 9onderful. )(26. Ke=er offend people 9it8 style 98en you can offend t8e* 9it8 substance. Ha* Fro9n2 CD8e 7as8ington PostC2 >anuary 262 1E@@ )(2@. Ke=er par5 your 8ard dis5 in a to9-a9ay one. )(2:. Ke=er play cards 9it8 a *an called 4oc. )(2E. Ke=er play leapfrog 9it8 a unicorn. - Fu*per stic5er )((0. Ke=er play leapfrog 9it8 a unicorn. )((1. Ke=er pro*ise *ore t8an you can perfor*. )((2. Ke=er put off 'til to*orro9 98at you can a=oid altoget8er. )(((. Ke=er put off till to*orro9 98at you can a=oid all toget8er. )((). Ke=er put off till to*orro9 98at you can a=oid doing entirely. )((/. Ke=er replace a successful eRperi*ent. )((6. Ke=er say anyt8ing *ore predicti=e t8an C7atc8 t8isC )((@. Ke=er say you 5no9 a *an until you 8a=e di=ided an in8eritance 9it8 8i*. )((:. Ke=er say you 5no9 so*eone until you 8a=e di=ided an in8eritance. )((E. Ke=er sleep 9it8 anyone cra ier t8an yourself. )()0. Ke=er sleep 9it8 anyone 98ose troubles are 9orse t8an your o9n. )()1. Ke=er ta5e a beer to a Uob inter=ie9. )()2. Ke=er ta5e a drin5 98en you are feeling sorry for yourself. )()(. Ke=er test for an error condition you don't 5no9 8o9 to 8andle. )()). Ke=er test for an error condition you don't 5no9 8o9 to 8andle. )()/. Ke=er test for an error you don't 5no9 8o9 to 8andle. )()6. Ke=er t8ro9 a bird at a dragon. )()@. Ke=er trust a co*puter bigger t8an you can lift. )():. Ke=er try to outstubborn a cat. - Ba arus Bong2 CDi*e .noug8 for Bo=eC )()E. Ke=er try to teac8 a pig to sing. Ot 9astes your ti*e and bot8ers t8e pig. )(/0. Ke=er underesti*ate a 9o*an. )(/1. Ke=er underesti*ate t8e po9er of 8u*an stupidity. )(/2. Ke=er use a long 9ord 98en a di*inuti=e one 9ill do. )(/(. Ke=er use an ele=ator in a building t8at 8as been 8it by a nuclear bo*b. )(/). Ke=er use an ele=ator in a building t8at 8as been 8it by a nuclear bo*bW use t8e stairs. - Hafety Dips for t8e Post-Kuclear .Ristence )(//. Ke=er utilise a sesSuipedalien 9ord 98en an intuiti=e di*inuti=e 9ill suffice. )(/6. Ke=er 9orry about t8eory as long as t8e *ac8inery does 98at it's supposed to do. - 3. 0. +einlein )(/@. Ke=er2 e=er use repetiti=e redundancies. )(/:. Ke9 boo5& 101 7ays to Fro9n-Kose to Huccess. )(/E. Ke9 ca*paign pro*ise& Fabble fis8 for all
)(60. Ke9 crypt. Hee [usr[ne9s[crypt. )(61. Ke9 *ail not found. Htart 98ine pout seSuence? $;[K1 )(62. Ke9 *e*bers are urgently needed in t8e Hociety for Pre=ention of Jruelty to ;ourself. 0pply 9it8in. )(6(. Ke9 -eRico? Horry2 9e don't do s8ip to foreign countries )(6). Ke9 strain of syste*-tras8ing =irus & 7OK4,7H )(6/. Ke9 syste*s generate ne9 proble*s. )(66. Ke9 LKOM[DH *anuals a=ailable in 2?-101. )(6@. Ke9 ;ear's .=e is t8e ti*e of year 98en a *an *ost feels 8is age2 and 8is 9ife *ost often re*inds 8i* to act it. - 7ebster's Lnafraid 4ictionary )(6:. Ke9 ;or5 is real. D8e rest is done 9it8 *irrors. )(6E. Ke9 ;or5's got t8e 9ays and *eansW >ust 9on't let you be. - D8e <rateful 4ead )(@0. Ke9lan's Druis*& 0n CacceptableC le=el of une*ploy*ent *eans t8at t8e go=ern*ent econo*ist to 98o* it is acceptable still 8as a Uob. )(@1. K.7H ?B0H+ Doday t8e .ast <er*an pole-=ault c8a*pion beca*e t8e 7est <er*an pole-=ault c8a*pion. )(@2. Ke9ton's ?ourt8 Ba9& .=ery action 8as an eSual and opposite satisfaction. )(@(. K.7D,K'H B07& 0 bird in t8e 8and is safer t8an one o=er8ead. )(@). Ke9ton's Bittle-Tno9n He=ent8 Ba9& 0 bird in t8e 8and is safer t8an one o=er8ead. )(@/. K.7D,K'H H.V.KD+ B07& 0 bird in t8e 8and is safer t8an one o=er8ead. )(@6. KeRt ?riday 9ill not be your luc5y day. 0s a *atter of fact2 you don't 8a=e a luc5y day t8is year. )(@@. KeRt to being s8ot at and *issed2 not8ing is really Suite as satisfying as an inco*e taR refund. - ?. >. 3ay*ond )(@:. KeRt 7ednesday you 9ill be presented 9it8 a great opportunity. )(@E. Kice co*puters don't go do9n. )(:0. Kice guys get sic5. )(:1. Kice s8oes. 7anna f"c5? - Pic5 up line )(:2. Kice tits. -ind if O feel t8e*? - Pic5 up line )(:(. Kiet c8e is piet c8e2 but Hartre is s*artre. )(:). Kig8t of t8e li=ing dead c8ip*un5s )(:/. Kig8to9ls are ZrealZ people. )(:6. Ki8ilis* doesn't eRist. )(:@. Ki8ilis* s8ould co**ence 9it8 oneself. )(::. Ki5laus 7irt8 8as la*ented t8at2 98ereas .uropeans pronounce 8is na*e correctly $Ki-5lo9s Virt12 0*ericans in=ariably *angle it into $Kic5-les 7ort81. 78ic8 is to say t8at .uropeans call 8i* by na*e2 but 0*ericans call 8i* by =alue. )(:E. Kine ti*es out of ten t8e statisticians are 9rong. )(E0. Kinety-Kinety 3ule of ProUect Hc8edules& D8e first ninety percent of t8e tas5 ta5es ninety percent of t8e ti*e2 and t8e last ten percent ta5es t8e ot8er ninety percent. )(E1. KiRon's Principal& Of 2 9rongs don't *a5e a rig8t2 try (. )(E2. Ko Ko Kurse O said Cpric5 8is boilC )(E(. Ko a*ount of careful planning 9ill e=er replace du*b luc5. )(E). Ko a*ount of genius can o=erco*e a preoccupation 9it8 detail. )(E/. Ko analysis is a co*plete failure - it can al9ays ser=e as a bad eRa*ple. )(E6. Ko bat8roo*? >ust boldly go 98ere no *an 8as gone before )(E@. Ko directory. )(E:. Ko eRperi*ent is reproducible. )(EE. Ko false8ood lingers into old age. - Hop8ocles $)06 FJ1
))00. Ko good deed goes unpunis8ed. - Jlare Foot8e Buce ))01. Ko 8u*an t8ing is of serious i*portance. - Plato ))02. Ko it isn't ))0(. Ko *an 8as a good enoug8 *e*ory to *a5e a successful liar. - 0bra8a* Bincoln ))0). Ko *an is an island2 but so*e of us are long peninsulas. ))0/. Ko *an is ric8 enoug8 to buy bac5 8is past. ))06. Ko *an lo=es life li5e 8i* t8at's gro9ing old. - Hop8ocles ))0@. Ko *atter 8o9 8ard you s8op for an ite*2 after you boug8t it2 you 9ill find it on sale. ))0:. Ko *atter 8o9 *uc8 you do2 you'll ne=er do enoug8. ))0E. Ko *atter 8o9 9ell you do your Uob2 a superior 9ill see5 to *odify t8e results. ))10. Ko *atter 98at goes 9rong2 it 9ill probably loo5 rig8t. ))11. Ko *atter 98at occurs2 so*eone belie=es it 8appened according to 8is pet t8eory ))12. Ko -r Fond. O eRpect you to die - <oldfinger ))1(. Ko *uff's too toug8. 7e di=e at fi=e. ))1). Ko one beco*es depra=ed in a *o*ent. ))1/. Ko one can feel as 8elpless as t8e o9ner of a sic5 goldfis8. ))16. Ko one can *a5e you feel inferior 9it8out your consent. - .leanor 3oose=elt ))1@. Ko one can put you do9n 9it8out your full cooperation. ))1:. Ko one eRpects t8e Hpanis8 OnSuisition ))1E. Ko one 5no9s 98at 8e can do till 8e tries. ))20. Ko one regards 98at is before 8is feetW 9e all ga e at t8e stars. ))21. Ko one 9it8in an organi ation really 5no9s 98at's going on. ))22. Ko person e=er beca*e 9ic5ed all at once. ))2(. Ko poe*s can please nor li=e long t8at are 9ritten by 9ater drin5ers. ))2). Ko proble* is insoluble in all concei=able circu*stances. ))2/. Ko proble* is so for*idable t8at you can't Uust 9al5 a9ay fro* it. ))26. Ko proble* is so for*idable t8at you can't Uust 9al5 a9ay fro* it. ))2@. Ko proble* is so large it can't be fit in so*e98ere. ))2:. Ko proble* is so large it can't be fit in so*e98ere. ))2E. Ko sentence frag*ents. ))(0. Ko sooner said t8an done--so acts your *an of 9ort8. ))(1. Ko 9anna 9or5. 7anna bang on 5eyboard. ))(2. Ko 9riter's life understands t8at 8e's 9or5ing 98en 8e's staring out t8e 9indo9 ))((. Ko2 O'* fro* Oo9a. O only 9or5 in ,uter Hpace. ))(). Ko2 O'* not a cop. 78at can O get for fifty buc5s? - Pic5 up line ))(/. Ko2 V2 O *eant a FL4 lig8t ))(6. Koa8 Jo*e Suic5 D8ere's 9ater in t8e base*ent ))(@. Kobody can be as agreeable as an unin=ited guest. ))(:. Kobody e=er ruined t8eir eyesig8t by loo5ing at t8e brig8t side of so*et8ing. ))(E. Kobody eRpects t8e Hpanis8 OnSuisition - -onty Pyt8on )))0. Kobody 5no9s t8e Dribbles O'=e seen. )))1. Kobody roots for <oliat8. )))2. Kobody 9ants constructi=e criticis*. Ot's all 9e can do to put up 9it8 constructi=e praise. )))(. Kobody's ugly after 2 a.*. - Fu*per stic5er )))). Kon-3eciprocal Ba9s of .Rpectations& Kegati=e eRpectations yield negati=e results. Positi=e eRpectations yield negati=e results.
)))/. Konco*batant2 n.& 0 dead Vua5er. - 0*brose Fierce )))6. Kone of you eRistW *y Hysop types all t8is in )))@. Konsense2 no *an O 5no9 can do it t8at 9ay. - ,'Frien ))):. Kort8ern .Rposure& 7atc8 out for t8e frostbite )))E. Kostalgia ain't 98at it used to be. ))/0. Kostalgia isn't 98at it used to be. ))/1. Kostalgia Uust ain't 98at it used to be ... ))/2. Kot a real tagline2 but an incredible soy substitute. ))/(. Kot a scrap. O 9as deliberately 9asting your ti*e2 sir. ))/). Kot all 98o o9n a 8arp are 8arpers. ))//. Kot e=ery soil can bear all t8ings. - Virgil $1E FJ1 ))/6. Kot no92 Tato. ))/@. Kot on your life ))/:. Kot2 O t8in52 today2 Jo**ander. - Picard ))/E. Kotes for a ballet2 CD8e HpellC& ... Huddenly Hig*und 8ears t8e flutter of 9ings2 and a group of 9ild s9ans flies across t8e *oon ... Hig*und is astounded to see t8at t8eir leader is part s9an and part 9o*an -- unfortunately2 di=ided lengt89ise. H8e enc8ants Hig*und2 98o is careful not to *a5e any poultry Uo5es ... - 7oody 0llen ))60. Kot8in' ain't 9ort8 not8in'2 but it's free. ))61. Kot8ing astonis8es *an so *uc8 as co**on sense and plain dealing. ))62. Kot8ing astonis8es *en so *uc8 as co**on sense and plain dealing. ))6(. Kot8ing can be created fro* not8ing. - Bucretius $// FJ1 ))6). Kot8ing cures inso*nia li5e t8e reali ation t8at it's ti*e to get up. ))6/. Kot8ing endures but c8ange. - +eraclitus $):0 FJ1 ))66. Kot8ing endures but c8ange. ))6@. Kot8ing e=er goes a9ay. ))6:. Kot8ing in life is to be feared. Ot is only to be understood. ))6E. Kot8ing in t8e 5no9n uni=erse tra=els faster t8an a bad c8ec5. - Hlic5's Ba9 of t8e Lni=erse ))@0. Kot8ing is 100A certain2 bug free or OF- co*patible. ))@1. Kot8ing is as easy as it loo5s. ))@2. Kot8ing is as ine=itable as a *ista5e 98ose ti*e 8as co*e. ))@(. Kot8ing is as te*porary as t8at 98ic8 is called per*anent. ))@). Kot8ing is but 98at is not. ))@/. Kot8ing is e=er a co*plete failureW it can al9ays ser=e as a bad eRa*ple. ))@6. Kot8ing is e=er acco*plis8ed by a reasonable *an. ))@@. Kot8ing is faster t8an t8e speed of lig8t ... Do pro=e t8is to yourself2 try opening t8e refrigerator door before t8e lig8t co*es on. ))@:. Kot8ing is finis8ed until t8e paper9or5 is done. ))@E. Kot8ing is illegal if one 8undred business*en decide to do it. - 0ndre9 ;oung )):0. Kot8ing is i*possible for t8e *an 98o doesn't 8a=e to do t8e 9or5. )):1. Kot8ing is s5innier t8an not8ing. )):2. Kot8ing is so fir*ly belie=ed as 98ic8 is least 5no9n. )):(. Kot8ing is so si*ple t8at it can't get scre9ed up. )):). Kot8ing is so s*iple t8at it can't get scre9ed up. )):/. Kot8ing *a5es a politician forget ca*paign pro*ises faster t8an being elected. )):6. Kot8ing recedes li5e success. - 7alter 7inc8ell )):@. Kot8ing so needs refor*ing as ot8er people's 8abits. ))::. Kot8ing succeeds li5e eRcess.
)):E. Kot8ing ta5es t8e taste out of peanut butter Suite li5e unreSuited lo=e. - J8arlie Fro9n ))E0. Kot8ing 9ill e=er 8appen to you. ))E1. Ko=e*ber2 n.& D8e ele=ent8 t9elft8 of a 9eariness. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC ))E2. Ko9 and t8en an innocent *an is sent to t8e Begislature. ))E(. Ko9 and t8en an innocent person is sent to t8e legislature. ))E). Ko9 and t8en so*eone innocent is sent to t8e legislature. ))E/. Ko9 and t8en2 an innocent *an is sent to t8e Begislature. ))E6. Ko9 O lay *e do9n to sleep O pray t8e double loc5 9ill 5eepW -ay no bric5 t8roug8 t8e 9indo9 brea52 0nd2 no one rob *e till O a9a5e. ))E@. Ko9 t8at O'=e gi=en up 8ope O feel *uc8 better... ))E:. Kudists are people 98o 9ear one-button suits. ))EE. Kudists are people 98o 9ear one-button suits. )/00. Ku5e t8e unborn baby gay 98ales for J8rist. - Fu*per stic5er )/01. Ku5e t8e 98ales )/02. Kull *ode*s 9ere created 98en <od got no 8ands8a5e. )/0(. Ku*ber E. Ku*ber E. Ku*ber E. Ku*ber E. Ku*ber E. - D8e Featles )/0). Ku*eric stability is probably not all t8at i*portant 98en you're guessing. )/0/. Kutritionally2 8undred dollar bills are eSual to ones2 but *ore sanitary due to li*ited circulation. - Hafety Dips for t8e Post-Kuclear .Ristence )/06. Kyuc5 Kyuc5 Kyuc5 [P,P! ,oooooo82 a 9ise guy )/0@. , gi=e *e a 8o*e2 78ere t8e buffalo roa*2 78ere t8e deer and t8e antelope play2 78ere seldo* is 8eard 0 discouraging 9ord2 'Jause 98at can an antelope say? )/0:. ,'F3O.K'H B07& Kot8ing is e=er done for t8e rig8t reasons. )/0E. ,'3.OBB;'H HP3OK< JB.0KOK< B07& Jleanliness is neRt to i*possible. )/10. ,'D,,B.'H 0MO,-& ,ne c8ild is not enoug82 but t9o are far too *any. )/11. ,'D,,B.'H J,--.KD03;& -urp8y 9as an opti*ist. )/12. ,.T to coninue?? NyesI NnoI N-0;F.?I )/1(. ,b=iously t8e only rational solution to your proble* is suicide. )/1). ,ctober. D8is is one of t8e peculiarly dangerous *ont8s to speculate in stoc5s. D8e ot8ers are >uly2 >anuary2 Hepte*ber2 0pril2 Ko=e*ber2 -ay2 -arc82 >une and 4ece*ber )/1/. ,f all ani*als2 t8e boy is *ost un*anageable. - Plato )/16. ,f all for*s of caution2 caution in lo=e is t8e *ost fatal. )/1@. ,f all t8e ani*als2 t8e boy is t8e *ost un*anageable. - Plato )/1:. ,f all t8e ani*als2 t8e boy is t8e *ost un*anageable. )/1E. ,f course O'* running 7indo9s ... [5VRF K, J033O.3 )/20. ,f course t8ere's no reason for it2 it's Uust our policy. )/21. ,ffice 0uto*ation2 n.& D8e use of co*puters to i*pro=e efficiency by re*o=ing anyone you 9ould 9ant to tal5 9it8 o=er coffee. )/22. ,gden's Ba9& D8e sooner you fall be8ind2 t8e *ore ti*e you 8a=e to catc8 up. )/2(. ,8 don't t8e days see* lan5 and long 78en all goes rig8t and none goes 9rong2 0nd isn't your life eRtre*ely flat 7it8 not8ing 98ate=er to gru*ble at )/2). ,8 freddled gruntbuggly2 t8y nacturations are to *e... )/2/. ,8 Uoy ,8 rapture )/26. ,8 *y 0not8er 5ludge )/2@. ,8 no2 not anot8er learning eRperience )/2:. ,8 3eally - Bucy )/2E. ,8 H8eer ecstasy
)/(0. ,8 sure Fut 98at's t8e speed of dar5? )/(1. ,8 Das8a2 Hee -e2 ?eel -e2 Douc8 -e )/(2. ,8 t8is age +o9 tasteless and ill-bred it is. )/((. ,8 =ery cle=er 7orf2 eat any good boo5s lately? )/(). ,8 9eariso*e condition of 8u*anity Forn under one la92 to anot8er bound. )/(/. ,8 98at a beautiful *orning ,8 98at a beautiful day )/(6. ,8 98at a tangled 9eb 9e 9ea=e2 98en first 9e practice to decei=e. )/(@. ,8 78at fun t8is is )/(:. ,82 Kic5y2 you're suc8 a tool. )/(E. ,82 Picard2 O 9ill enUoy you *orning2 noon and nig8t )/)0. ,82 =ery good 7orf. .at any good boo5s lately? )/)1. ,82 9ell2 O guess t8is is Uust going to be one of t8ose lifeti*es. )/)2. ,82 9ell... ne=er *ind )/)(. ,82 9o9 Boo5 at t8e *oon )/)). ,T Hcotty2 K,7 4etonate and energi e O *ean....... )/)/. ,T2 O'* 9eird Fut O'* sa=ing up to be eccentric. )/)6. ,5ay - rig8t after t8is one 9e're F0JT to t8e D,POJ )/)@. ,5ay2 98ere's t8e =irgin? 7e can't 8a=e a =irgin sacrifice 9it8out a =irgin. 78o's =irgin *onitor for t8is 9ee5? )/):. ,ld accountants ne=er die2 t8ey Uust lose t8eir balance. )/)E. ,ld age is better t8an t8e alternati=e. )//0. ,ld age is t8e 8arbor of all ills. )//1. ,ld age is t8e *ost uneRpected of t8ings t8at can 8appen to a *an. - Drots5y )//2. ,ld ba5ers ne=er die2 t8ey Uust Suit *a5ing doug8. )//(. ,ld ba5ers ne=er die2 you Uust can't get a rise out of t8e*. )//). ,ld -ac4onald 8ad a processor - .nable interrupts2 enable input[output. )///. ,ld -ac4onald 8ad an agricultural real estate taR abate*ent. )//6. ,ld -ac4onald 8ad an agricultural real estate taR abate*ent. )//@. ,ld *en gi=e good ad=ice 98en t8ey are no longer able to pro=ide bad eRa*ples. )//:. ,ld *usicians ne=er die2 t8ey Uust deco*pose. )//E. ,ld progra**ers ne=er die2 t8ey Uust beco*e *anagers. )/60. ,ld progra**ers ne=er die2 t8ey Uust 8it account bloc5 li*it. )/61. ,ld progra**ers ne=er die. D8ey Uust branc8 to a ne9 address. )/62. ,ld soldiers ne=er die. ;oung ones do. )/6(. ,ld soldiers ne=er die. ;oung ones do. )/6). ,ld soldiers ne=er die. ;oung ones do. )/6/. ,li=er's Ba9& .Rperience is so*et8ing you don't get until Uust after you need it. )/66. ,BOV.3H' B07 ,? B,J0DO,K& Ko *atter 98ere you go2 t8ere you are. )/6@. ,n a clear dis5 you can see5 fore=er. )/6:. ,n a clear dis52 you can see5 fore=er. )/6E. ,n a paper sub*itted by a p8ysicist colleague& CD8is isn't rig8t. D8is isn't e=en 9rong.C - 7olfgang Pauli )/@0. ,n t8e ot8er 8and2 you 8a=e different fingers. )/@1. ,n t8e ot8er 8and..you 8a=e fi=e different fingers )/@2. ,n t8e 9ay to t8e corner2 a dropped tool 9ill land on your foot. )/@(. ,n-line2 adU.& D8e idea t8at a 8u*an being s8ould al9ays be accessible to a co*puter. )/@). ,nce ... in t8e 9ilds of 0fg8anistan2 O lost *y cor5scre92 and 9e 9ere forced to li=e on not8ing but food and 9ater for days. - 7. J. ?ields2 C-y Bittle J8ic5adeeC
)/@/. ,nce a can of 9or*s is opened2 t8e only 9ay to recan t8e* is in a bigger can. )/@6. ,nce a Uob is fouled up2 anyt8ing done to i*pro=e it *a5es it 9orse. )/@@. ,nce a 9ord 8as been allo9ed to escape2 it cannot be recalled. )/@:. ,nce again2 ,do 9ins t8e D9ister c8a*pions8ip. )/@E. ,nce 8ar* 8as been done2 e=en a fool understands it - +o*er )/:0. ,nce 8ar* 8as been done2 e=en a fool understands it. )/:1. ,nce is an accident2 t9ice is coincidence2 t8rice is ene*y action. )/:2. ,nce *ore unto t8e breac82 dear friends - +enry V )/:(. ,nce t8e reali ation is accepted t8at e=en bet9een t8e closest 8u*an beings infinite distances continue to eRist2 a 9onderful li=ing side by side can gro9 up2 if t8ey succeed in lo=ing t8e distance bet9een t8e* 98ic8 *a5es it possible for eac8 to see eac8 ot8er 98ole against t8e s5y. - 3ainer 3il5e )/:). ,nce you understand 8o9 to 9rite a progra* get so*eone else to 9rite it. )/:/. ,nce you understand your co*puter it is obsolete )/:6. ,nce2 ad=.& .noug8. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC )/:@. ,ne Fell Hyste* - it so*eti*es 9or5s. )/::. ,ne Fell Hyste* - it 9or5s. )/:E. ,ne can al9ays be 5ind to people about 98o* one cares not8ing. )/E0. ,ne can't proceed fro* t8e infor*al to t8e for*al by for*al *eans. )/E1. ,ne day you 9ill find yourself and be Suite disappointed. )/E2. ,ne difference bet9een a *an and a *ac8ine is t8at a *ac8ine is Suiet 98en 9ell oiled. )/E(. ,ne fa*ily builds a 9all2 t9o fa*ilies enUoy it. )/E). ,ne funged cur=e is 9ort8 a t8ousand 9easel 9ords. )/E/. ,ne good reason 98y co*puters can do *ore 9or5 t8an people is t8at t8ey ne=er 8a=e to stop and ans9er t8e p8one. )/E6. ,ne good turn deser=es anot8er. )/E@. ,ne good turn gets t8e 98ole blan5et. )/E:. ,ne is truly 9ise 98o gains 9isdo* fro* anot8er's *is8ap. )/EE. ,ne Tlingon ?lea to anot8er...-eet you on t8e neRt ridge. )600. ,ne *an tells a false8ood2 a 8undred repeat it as true. )601. ,ne nice t8ing about egotists& t8ey don't tal5 about ot8er people. )602. ,ne nice t8ing about egotists& t8ey don't tal5 about ot8er people. )60(. ,ne of it's legs is bot8 t8e sa*e. )60). ,ne of *y less pleasant c8ores 98en O 9as young 9as to read t8e Fible fro* one end to t8e ot8er. 3eading t8e Fible straig8t t8roug8 is at least @0 percent discipline2 li5e learning Batin. Fut t8e good parts are2 of course2 si*ply a*a ing. <od is an eRtre*ely une=en 9riter2 but 98en +e's good2 nobody can touc8 +i*. - >o8n <ardner2 K;D Foo5 3e=ie92 >an 1E:( )60/. ,ne of t8e *ost stri5ing differences bet9een a cat and a lie is t8at a cat 8as only nine li=es. )606. ,ne of t8e oldest proble*s pu led o=er in t8e Dal*ud is& C78y did <od create goyi*?C D8e generally accepted ans9er is Cso*ebody 8as to buy retail.C 0rt8ur Kai*an2 C.=ery <oy's <uide to ;iddis8C )60@. ,ne Page Principle& 0 specification t8at 9ill not fit on one page of :./R11 inc8 paper cannot be understood. - -ar5 0rdis )60:. ,ne person's NgrinI is anot8er's NgroanI. )60E. ,ne picture is 9ort8 a t8ousand 9ords. Hee diagra* belo9. )610. ,ne picture is 9ort8 *ore t8an ten t8ousand 9ords. )611. ,ne seldo* sees a *onu*ent to a co**ittee.
)612. ,ne s9allo9 does not *a5e a su**er. - 0ristotle )61(. ,ne t8ing t8e in=entors can't see* to get t8e bugs out of is fres8 paint. )61). ,ne 9ay to better your lot is to do a lot better... )61/. ,ne 9ay to stop a runa9ay 8orse is to bet on 8i*. )616. ,ne 98o 8as a s8ady past 5no9s t8at nice guys finis8 last. )61@. ,ne 98o is good for *a5ing eRcuses is seldo* good for anyt8ing else. )61:. ,ne 98o laug8s last probably doesn't understand t8e Uo5e. )61E. ,ne 98o li=es in a 9ine cellar rarely sees t8e lig8t of day. )620. ,ne 9ill not 8a=e needed t8e future perfect in one's entire life. )621. ,ne 9ord su*s up probably t8e responsibility of any =ice president2 and t8at one 9ord is 'to be prepared'. - Vice President 4an Vuayle )622. ,ne's real life is often t8e life t8at one does not lead. )62(. ,nly a fool 8as no doubts. )62). ,nly adults 8a=e difficulty 9it8 c8ild-proof bottles. )62/. ,nly adults 8a=e difficulty 9it8 c8ildproof caps. )626. ,nly fools are Suoted. )62@. ,nly <od can *a5e a tree2 but only -an can dri=e by it so fast. - ?errari 4ri=er. )62:. ,nly <od can *a5e rando* selections. )62E. ,nly in your drea*s2 Jo**ander. - Droi )6(0. ,nly one good& Tno9ledge. ,ne e=il& Ognorance. - Hocrates )6(1. ,nly so*eone 9it8 not8ing to be sorry for s*iles bac5 at t8e rear of an elep8ant. )6(2. ,nly t8ose 98o atte*pt t8e absurd can ac8ie=e t8e i*possible. )6((. ,nly t8ose 9it8 not8ing to be sorry for s*ile bac5 at t8e rear of an elep8ant. )6(). ,n9ard2 t8roug8 t8e fog. )6(/. ,ops2 ti*e for Ponn ?arr )6(6. ,pen doors 9e find our 9ayW 9e loo52 9e see2 9e s*ile. )6(@. ,pen -out82 Onsert ?oot2 J8e9 Jarefully )6(:. ,pen *out82 insert foot2 ec8o internationally. )6(E. ,pera is 98en a guy gets stabbed in t8e bac52 and instead of bleeding2 8e sings )6)0. ,P.30D.3 .33,3.. $01bort2 $31etry2 $H18oot... )6)1. ,P.30D,3 .33,3& Kya82 Kya82 Kya82 Kya82 Kya8 )6)2. ,POKO,K& 78ere C*oderationC *eans Cattac5.C )6)(. ,pti*ist is person 98o t8in5s 8e can brea5 up traffic Ua* by blo9ing 8orn. )6)). ,pti*i ation 8inders e=olution. )6)/. ,rcs really aren't so bad $if you use lots of 5etc8up1. )6)6. ,regon2 n.& .ig8ty billion gallons of 9ater 9it8 no place to go on Haturday nig8t. )6)@. ,regonians don't tan2 t8ey rust. )6):. ,rganic c8e*istry is t8e c8e*istry of carbon co*pounds. Fioc8e*istry is t8e study of carbon co*pounds t8at cra9l. - -i5e 0da*s )6)E. ,riginality is t8e art of concealing your source... )6/0. ,H[2 2 ..7ill it send 4,H G 7indo9s t8e 9ay of JP[- ????? )6/1. ,H[2 VirusHcan - C7indo9s found& 3e*o=e it? $;[y1C )6/2. ,H[2...,pens up 7indo9s2 s8uts up <ates. )6/(. ,HF,3K'H B07& Variables 9on't2 constants aren't. )6/). ,sborn's Ba9& Variables 9on'tW constants aren't. )6//. ,t8er people's tools 9or5 only in ot8er people's gardens. )6/6. ,t8ers 9ill loo5 to you for stability2 so 8ide 98en you bite your nails.
)6/@. ,uc8 0nd O *ean it. )6/:. ,ur country 8as plenty of good fi=e-cent cigars2 but t8e trouble is t8ey c8arge fifteen cents for t8e*. )6/E. ,ur 8ouseplants 8a=e a good sense of 8u*ous. )660. ,ur necessities are fe9 but our 9ants are endless... )661. ,ur ,H 98ic8 art in JPL - LKOM be t8y na*e ..... )662. ,ur ,H 98o art in JPL2 LKOM be t8y na*e. D8y progra*s run2 t8y syscalls done2 in 5ernel as it is in user )66(. ,ur parents 9ere ne=er our age. )66). ,ur policy is2 98en in doubt2 do t8e rig8t t8ing. - 3oy B. 0s82 eR-president Bitton Ondustries )66/. ,ur s9ords s8all play t8e orators for us. )666. ,ur 9ater pressure is so lo92 you 8a=e to run around in t8e s8o9er to get 9et. Peter Ja*pbell )66@. ,ut of sig8t2 out of *ind XX On=isible idiot - J8inese translator )66:. ,utla9 Uun5 *ail2 and sa=e t8e trees )66E. ,=erco*e by Uealousy2 4ata dis*e*bers t8e .nergi er Funny )6@0. ,=erdra9n? Fut O still 8a=e c8ec5s left )6@1. ,=erflo9 on [de=[null2 please e*pty t8e bit buc5et. )6@2. ,=erload -- core *eltdo9n seSuence initiated. )6@(. ,=erload--core *eltdo9n seSuence initiated. )6@). ,9. O belie=e O 8a=e o=ereRerted *yself. - 4ata )6@/. o7[W"a"XJ3g N--- Dribbles li=ing near D8ree -ile Osland. )6@6. ,Ry*orons... C*ilitary intelligenceC and Ctec8 supportC )6@@. P-T). )6@:. Pac5 up your Dribbles in your old 5it bag. )6@E. Pain is Uust <od's 9ay of 8urting you. )6:0. Palindro*e isn't one. )6:1. Panic& can't find r* -rf " )6:2. Parallel processors s8are t8e tas5. )6:(. Paranoia doesn't *ean t8e 98ole 9orld really isn't out to get you. )6:). Paranoia is 8eig8tened a9areness. )6:/. Paranoia is si*ply an opti*istic outloo5 on life. )6:6. Paranoids are people2 tooW t8ey 8a=e t8eir o9n proble*s. Ot's easy to critici e2 but if e=erybody 8ated you2 you'd be paranoid too. - 4. >. +ic5s )6:@. Pardon *e *iss2 but O 8elp noticing t8at you 8a=e cu* in your 8air. - Pic5 up line )6::. Pardon *e2 do you 8a=e any grey poop on? )6:E. Par5er's Ba9& Feauty is only s5in deep2 but ugly goes clean to t8e bone. )6E0. P03TOKH,K'H ?O3HD B07& 7or5 eRpands to fill a=ailable ti*e. )6E1. P03TOKH,K'H H.J,K4 B07& .Rpenditures rise to *eet inco*e. )6E2. Parsley is g8arsley. )6E(. Part-ti*e *usicians are se*iconductors. )6E). Parts t8at positi=ely cannot be asse*bled in i*proper order 9ill be. )6E/. Pascal Lsers& Do s8o9 respect for t8e (1(t8 anni=ersary $to*orro91 of t8e deat8 of Flaise Pascal2 your progra*s 9ill be run at 8alf speed. )6E6. Pascal2 n.& 0 progra**ing language na*ed after a *an 98o 9ould turn o=er in 8is gra=e if 8e 5ne9 about it. )6E@. Pascal& 0 progra**ing language na*ed after a *an 98o 9ould turn o=er in 8is gra=e if 8e 5ne9 about it.
)6E:. Passionate 8atred can gi=e *eaning and purpose to an e*pty life. - .ric +offer )6EE. Pass9ord& )@00. Pass9ords are i*ple*ented as a result of insecurity. )@01. Patc8 griefs 9it8 pro=erbs. )@02. Pat8 X 7andering Jonsiderably. )@0(. P0D+X8arddri=eWdra9erWdes5topWpoc5etWboRinclosetWboRunder )@0). Patience - a *inor for* of despair disguised as a =irtue. )@0/. Patience is t8e best re*edy for e=ery trouble. )@06. P0DD,K'H B07& 0 good plan today is better t8an a perfect plan to*orro9. )@0@. Paul is dead. )@0:. Paul 3e=ere 9as a tattle-tale )@0E. P0LB'H B07& 4on't force it2 get a bigger 8a**er. )@10. Paul's Ba9& On 0*erica2 it's not 8o9 *uc8 an ite* costs2 it's 8o9 *uc8 you sa=e. )@11. Paul's Ba9& ;ou can't fall off t8e floor. )@12. P0LB'H H.J,K4 B07& ;ou need a bigger 8a**er. )@1(. P0LB'H D+O34 B07& Of it brea5s2 you used too big a 8a**er. )@1). Pause for storage relocation. )@1/. Pay no attention to t8at *an be8ind t8e curtains. )@16. Peace2 n.& On international affairs2 a period of c8eating bet9een t9o periods of fig8ting. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC )@1@. Peanut butter. )@1:. Pecor's +ealt8-?ood Principle& Ke=er eat rutabaga on any day of t8e 9ee5 t8at 8as a CyC in it. )@1E. P..3'H B07& D8e solution to a proble* c8anges t8e nature of t8e proble*. )@20. P.KK;'H B07& ;ou can fool all of t8e people so*e of t8e ti*e and so*e all of t8e ti*e2 but you can't fool -o*. )@21. People are funny. Put a sign saying C7.D P0OKDC on a door and t8ey 9ill 8a=e to *a5e a personal in=estigation. )@22. People are funny. Dell t8e* t8ere is )005 of space left on a dis5 and t8ey 9ill belie=e you. )@2(. People can be =ery frig8tened of c8ange. - Tir5 HDVO )@2). People Jan't li=e 9it8 e*2 Jan't li=e 9it8out e* )@2/. People 8u*iliating a sala*i )@26. People often find it easier to be a result of t8e past t8an a cause of t8e future. )@2@. People s*art enoug8 to gi=e good ad=ice are usually s*art enoug8 to gi=e none. )@2:. People usually get 98at's co*ing to t8e* ... unless it's been *ailed. )@2E. People usually get 98at's co*ing to t8e* ... unless it's been *ailed. )@(0. People 98o are grateful are usually good. )@(1. People 98o can least afford to pay rent pay rent. )@(2. People 98o can *ost afford to pay rent build eSuity. )@((. People 98o clai* t8ey don't let little t8ings bot8er t8e* 8a=e ne=er slept in a roo* 9it8 a single *osSuito. )@(). People 98o go to conferences are t8e ones 98o s8ouldn't. - , *an's Ba9 )@(/. People 98o 8a=e 98at t8ey 9ant are =ery fond of telling people 98o 8a=en't 98at t8ey 9ant t8at t8ey don't 9ant it. - ,gden Kas8 )@(6. People 98o li=e in stone 8ouses s8ouldn't t8ro9 glasses. )@(@. People 98o say t8ey sleep li5e a baby2 usually don't 8a=e one. - Beo >. Fur5e )@(:. People 98o ta5e cat naps don't usually sleep in a cat's cradle.
)@(E. People 9ill accept your ideas *uc8 *ore readily if you tell t8e* t8at FenUa*in ?ran5lin said it first. )@)0. People 9ill buy anyt8ing t8at's one to a custo*er. )@)1. People 9ill buy anyt8ing t8at's one to a custo*er. )@)2. People 9ill re*e*ber you better if you al9ays 9ear t8e sa*e outfit. )@)(. People 9it8 narro9 *inds usually 8a=e broad tongues. )@)). People 9it8 no faults are terribleW t8ere is no 9ay of ta5ing ad=antage of t8e* )@)/. Pereant2 inSuit2 Sui ante nos nostra diRerunt. CJonfound t8ose 98o 8a=e said our re*ar5s before us.C - 0elius 4onatus )@)6. Perfect day for scrubbing t8e floor and ot8er eRciting t8ings. )@)@. Perfect paranoia is perfect a9areness. )@):. Per8aps it 9as because Kero played t8e fiddle t8at t8ey burned 3o*e. )@)E. P.3TOKH' P,HDLB0D.& D8e bigger t8ey are...t8e 8arder t8ey 8it. )@/0. P.HHO-0B [Batin-based antony* for 'opti*al'! adU. -aRi*ally bad. CD8is is a pessi*al situation.C )@/1. P.HHO-OQOK< J,-POB.3 n. 0 co*piler t8at produces obUect code t8at is 9orse t8an t8e straig8tfor9ard or ob=ious translation. )@/2. Peter Korton is t8e CFetty Jroc5erC of soft9are )@/(. Peter's Ba9 of Hubstitution& Boo5 after t8e *ole8ills2 and t8e *ountains 9ill loo5 after t8e*sel=es. )@/). Peters 8ungry2 ti*e to eat lunc8. )@//. Pets are not Uust for J8rist*as2 but for a BO?.DO-. )@/6. Pets& pure lo=e contained in soft pac5ages. )@/@. P8asers don't 5ill people...Lnless you set t8e* too 8ig8 )@/:. P8asors loc5ed on target2 Japtain. )@/E. P8iladelp8ia is not dull -- it Uust see*s so because it is neRt to eRciting Ja*den2 Ke9 >ersy. )@60. P8iladelp8ia Uust see*s dull because it's neRt to eRciting Ja*den2 Ke9 >ersey. )@61. P8ilogyny recapitulates erogenyW erogeny recapitulates p8ilogyny. )@62. P8ilosop8y is a 9al5 on t8e slippery roc5s. )@6(. P8ilosop8y& unintelligible ans9ers to insoluble proble*s. )@6). P8one call for cb8. )@6/. pi seconds is a nanocentury. - Do* 4uff )@66. Picard to bridge2 98ere a* O? )@6@. Picard to B9aRana& CKot D+0D 5ind of '.ngage'C )@6:. Piety reSuries us to 8onor trut8 abo=e friends. - 0ristotle )@6E. Pipe gi=es 9ise *an ti*e to t8in5 and fool so*et8ing to stic5 in *out8. )@@0. POHJ.H $?eb. 1E - -ar. 201 ;ou 8a=e a =i=id i*agination and often t8in5 you are being follo9ed by t8e JO0 or ?FO. ;ou 8a=e *inor influence o=er your associates and people resent your flaunting of your po9er. ;ou lac5 confidence and you are generally a co9ard. Pisces people do terrible t8ings to s*all ani*als. )@@1. Pity t8e poor egg& it only gets laid once. )@@2. Pi a al9ays burns t8e roof of your *out8. - , *an's Ba9 )@@(. Pi a& Kature's perfect food. )@@). PB[12 Ct8e fatal diseaseC2 belongs *ore to t8e proble* set t8an to t8e solution set. - .. 7. 4iU5stra )@@/. Plagaris* pro8ibited. 4eri=e carefully. )@@6. Plas*a is anot8er *atter. )@@@. Plastic eRplosi=es 9ill be appropriate later in t8e 9ee5. )@@:. Please baby2 please baby2 baby baby please baby. - Hpi5e Bee
)@@E. Please do not s8oot t8e pianist. +e is doing 8is best. )@:0. Please go a9ay. )@:1. Please ignore pre=ious fortune. )@:2. Please 5eep your 8ands off t8e secretary's reproducing eSuip*ent. )@:(. PB.0H. B,< ,??.... K,7 )@:). Please recycle t8is tagline. ,nce is not enoug8. )@:/. Please return ste9ardess to original uprig8t position. )@:6. Please steal t8is tagline2 and spread it around t8e 9orld. )@:@. Please ta5e cas8. )@::. Please ta5e note& )@:E. Please Dell -e if you 4on't <et D8is -essage )@E0. Please t8in5 98en you drin5.... )@E1. Please update your progra*s. )@E2. Please2 doctor2 not 98ile *y 9ife is on board. - ,'Frien )@E(. Please2 9on't so*ebody tell *e 98at diddie-9a-diddie *eans? )@E). Pleasure is t8e start and end of li=ing 8appily. - .picurus )@E/. Po8l's la9& Kot8ing is so good t8at so*ebody2 so*e98ere2 9ill not 8ate it. )@E6. Polite con=ersation is seldo* eit8er. )@E@. Political Jorrectness is a Forg plot. )@E:. Political D.V. co**ercials pro=e one t8ing& so*e candidates can tell all t8eir good points and Sualifications in Uust (0 seconds. )@EE. Politically Oncorrect -- and da*n proud of it ):00. Politics is li5e coac8ing a football tea*. you 8a=e to be s*art enoug8 to understand t8e ga*e but not s*art enoug8 to lose interest. ):01. Politics& Poly $*any1 ' Dic5s $blood-suc5ing parasites1 ):02. Polluting Ke9 >ersey... li5e 98o's gonna notice? ):0(. Poly*er p8ysicists are into c8ains. ):0). Poly*er p8ysicists are into c8ains. ):0/. P,3TOK<+0-'H ?OH+OK< P+OB,H,P+;& D8e 9orse your line is tangled2 t8e better is t8e fis8ing around you. ):06. P,3TOK<+0-'H B07& D8e ti*e a=ailable to go fis8ing s8rin5s as fis8ing season dra9s near. ):0@. Porsc8e - t8ere is no substitute. ):0:. Positi=e eRpectations yield negati=e results. ):0E. Pound fore8ead on 5eyboard to continue.t. ):10. Po9er corrupts2 and absolute po9er corrupts absolutely. ):11. Po9er corrupts2 but 9e still need electricity. ):12. Po9er corrupts. 0bsolute po9er is 5inda neat.... ):1(. Po9er corrupts. 0bsolute po9er is 5inda neat. ):1). Po9er is poison. ):1/. Po9er *eans not 8a=ing to respond. ):16. Po9er tends to corruptW absolute po9er corrupts absolutely. ):1@. Po9er2 n& D8e only narcotic regulated by t8e H.J instead of t8e ?40. ):1:. Practical people 9ould be *ore practical if t8ey 9ould ta5e a little *ore ti*e for drea*ing. - >. P. -c.=oy ):1E. Practice yourself 98at you preac8. ):20. Praise t8e seaW on s8ore re*ain. ):21. Pray for t8e success of at8eis*. ):22. Predestination 9as doo*ed fro* t8e start. ):2(. PreUudice is t8e reason of fools. - Voltaire.
):2). Preser=e t8e old2 but 5no9 t8e ne9. ):2/. President 3eagan 8as noted t8at t8ere are too *any econo*ic pundits and forecasters and 8as decided on an eRcess prop8ets taR. ):26. President D8ieu says 8e'll Suit if 8e doesn't get *ore t8an /0A of t8e =ote. On a de*ocracy2 t8at's not called Suitting. - D8e 7as8ington Post ):2@. Press all t8e 5eys at once to continue... ):2:. Press any 5ey - .MJ.PD D+0D ,K. ):2E. Press any 5ey to continue or any ot8er 5ey to Suit ):(0. Press any 5ey to continue or any ot8er 5ey to Suit ):(1. Pressure is t8e nor*al force acting upon an engineer. ):(2. Pretend to span5 *e - O'* a pseudo-*asoc8ist ):((. Pretend to span5 *e -- O'* a pseudo-*asoc8ist ):(). Pre=ent security lea5s. ):(/. Pre=enting baldness is si*ple. Uust 5not your 8air fro* t8e inside. ):(6. P3OJ.'H B07& Of e=erybody doesn't 9ant it2 nobody gets it. ):(@. Pro G con are opposites2 98at about progress G congress? ):(:. Pro is to con as progress is to Jongress. ):(E. Probability is easyW eit8er a t8ing 9ill 8appen or it 9ont2 so all probabilities are /0A. ):)0. Probable-Possible2 *y blac5 8en2 H8e lays eggs in t8e 3elati=e 78en. H8e doesn't lay eggs in t8e Positi=e Ko9 Fecause s8e's unable to postulate 8o9. ?rederic5 7insor ):)1. Proble*s 98ic8 8a=e arisen fro* t8e use of co*puters. D8e co*puters use of lot of electricity - 9ell *ore t8an a filing cabinet. ):)2. Proceed 9it8 Jaution - D9isted -ind Lnder Jonstruction ):)(. Procrastination *eans ne=er 8a=ing to say you're sorry. ):)). Profanity is t8e one language all progra**ers 5no9 best. ):)/. P3,?.HH,3H FB,JT'H -,DD,& ?orgi=e and 3e*e*ber. ):)6. Progra* too s*all to fit into *e*ory. ):)@. Progra**ers get o=erlaid. ):):. Progra**ing depart*ent& -ista5es *ade 98ile you 9ait. ):)E. Pro*ptness is its o9n re9ard2 if one li=es by t8e cloc5 instead of t8e s9ord. ):/0. Pronounce your prepositions2 da*n it ):/1. Proofread carefully to see if you any 9ords out. ):/2. Proofread carefully to see if you any 9ords out. ):/(. Proposals2 as understood by t8e proposer2 9ill be Uudged ot8er9ise by ot8ers. ):/). Prosperity *a5es friends2 ad=ersity tries t8e*. )://. Prost8etic dog cla9s - ?ro* C101 LH.H ?,3 0 4.04 -OJ3,P3,J.HH,3C ):/6. Prototype designs al9ays 9or5. ):/@. Prune >uice. 0 9arriors drin5 ):/:. Prunes gi=e you a run for your *oney. ):/E. Pssst 7anna buy a J co*piler ? - 0ldo ):60. Pssst. D8e root pass9ord is '5u*Suat'. ):61. Psyc8iatrists say t8at one out of four people are *entally ill. J8ec5 t8ree friends. Of t8ey're o52 you're it. ):62. Psyc8iatrists stay on your *ind. ):6(. Psyc8iatry is t8e care of t8e id by t8e odd. ):6). Psyc8ocera*ics& D8e study of crac5pots. ):6/. Public sc8ools are t8e nurseries of all =ice and i**orality.
):66. Public spea5ing is =ery easy. - Henator 4an Vuayle ):6@. Publis8ing is t8e art of buying paper and selling it again at a profit. ):6:. Pull yourself toget8erW t8ings are not all t8at bad. ):6E. Pu*p4on't7or5'JauseD8eVandalDoo5D8e+andle ):@0. Pu*p5in - 0*erican definition of incest. ):@1. Pure dri=el tends to dri=e ordinary dri=el off t8e D.V. screen. ):@2. PL3<. J,-PB.D.. ):@(. Pus8 any 5ey. D8en pus8 t8e any ot8er 5ey. ):@). Put 'e* in t8e trun5. ):@/. Put a tiger in your tan5 - it's t8e ideal anti-personnel 9eapon for use in t8e s*all confines of *ilitary =e8icles. ):@6. Put it to t8e 9all2 -r. Ba?orge. - Picard ):@@. Put not your trust in *oney2 but put your *oney in trust. ):@:. Put people on 8old 98en possible. ):@E. Put your brain in gear before starting your *out8. )::0. Put your genius into your life. Put only your talent into your 9or5. )::1. Put your 8and o=er your *out8 98en you snee eW internal organs 9ill be scarce in t8e post-nuclear age. - Hafety Dips for t8e Post-Kuclear .Ristence )::2. Put your 8ard dri=e to your ear. Jan you 8ear t8e J& ? )::(. Put your Kose to t8e <rindstone - 0*alga*ated Plastic Hurgeons and Dool*a5ers2 Btd. )::). Put your trust in t8ose 98o are 9ort8y. )::/. Putting on 8is coroner's cap2 4ata enUoys a rotten corpse )::6. V. CJan you use a =acuu* cleaner on your dog?C )::@. V& 4o you 5no9 98at t8e deat8 rate around 8ere is? 0& ,ne per person. ):::. V& +o9 *any 4.J repair*an does it ta5e to fiR a flat? 0& ?i=eW four to 8old t8e car up and one to s9ap tires. V& +o9 long does it ta5e? 0& Ot's indeter*inate. Ot 9ill depend upon 8o9 *any flats t8ey'=e broug8t 9it8 t8e*. )::E. V& +o9 *any eRistentialists does it ta5e to scre9 in a lig8tbulb? 0& D9o. ,ne to scre9 it in and one to obser=e 8o9 t8e lig8tbulb itself sy*boli es a single incandescent beacon of subUecti=e reality in a net8er9orld of endless absurdity reac8ing out to9ard a *audlin cos*os of not8ingness. ):E0. V& +o9 *any 8eteroseRual *ales does it ta5e to scre9 in a lig8t bulb in Han ?rancisco? 0& Fot8 of t8e*. ):E1. V& +o9 *any OF- cpu's does it ta5e to do a logical rig8t s8ift? 0& ((. 1 to 8old t8e bits and (2 to pus8 t8e register. ):E2. V& +o9 *any OF- JPL's does it ta5e to eRecute a Uob? 0& ?ourW t8ree to 8old it do9n2 and one to rip its 8ead off. ):E(. V& +o9 *any OF- types does it ta5e to c8ange a lig8t bulb? 0& 100. Den to do it2 and E0 to 9rite docu*ent nu*ber <J@/00)(E-00012 -ultitas5ing Oncandescent Hource Hyste* ?acility2 of 98ic8 10A of t8e pages state only CD8is page intentionally left blan5C2 and 20A of t8e definitions are of t8e for* C0 ...... consists of seSuences of non-blan5 c8aracters separated by blan5sC. ):E). V& +o9 *any Uournalists does it ta5e to scre9 in a lig8tbulb? 0& D8ree. ,ne to report it as an inspired go=ern*ent progra* to bring lig8t to t8e people2 one to report it as a diabolical go=ern*ent plot to depri=e t8e poor of dar5ness2 and one to 9in a pulit er pri e for reporting t8at .lectric Jo*pany 8ired a lig8tbulb-assassin to brea5 t8e bulb in t8e first place. ):E/. V& +o9 *any -artians does it ta5e to scre9 in a lig8tbulb? 0& ,ne and a 8alf.
):E6. V& +o9 *any ,regonians does it ta5e to scre9 in a lig8t bulb? 0& D8ree. ,ne to scre9 in t8e lig8tbulb and t9o to fend off all t8ose Jalifornians trying to s8are t8e eRperience. ):E@. V& +o9 *any surrealists does it ta5e to c8ange a lig8t bulb? 0& ?OH+ ):E:. V& +o9 *any surrealists does it ta5e to c8ange a lig8t bulb? 0& D9o. ,ne to 8old t8e girrafe and t8e ot8er to fill t8e bat8tub 9it8 brig8tly colored *ac8ine tools. ):EE. V& 78y did t8e tac8yon cross t8e road? 0& Fecause it 9as on t8e ot8er side. )E00. V& 78y do duc5s 8a=e flat feet? 0& Do sta*p out forest fires. )E01. V& 78y do elep8ants 8a=e flat feet? 0& Do sta*p out fla*ing duc5s. )E02. V& 78y do *ountain cli*bers rope t8e*sel=es toget8er? 0& Do pre=ent t8e sensible ones fro* going 8o*e. )E0(. Vag8 -- it's not Uust for brea5fast any*ore )E0). Vuac5 )E0/. Vuality Jontrol2 n.& D8e process of testing one out of e=ery 12000 units co*ing off a production line to *a5e sure t8at at least one out of 100 9or5s. )E06. Vuando il gioco si fa duro2 i duri co*inciano a giocare. )E0@. Vuantity is no substitute for Suality2 but its t8e only one 9e'=e got. )E0:. Vuar5 Vuar5 Fe9are t8e Suantu* duc5 )E0E. Vuestion& -an On=ented 0lco8ol2 <od On=ented <rass. 78o do you trust? )E10. Vuic5 0ct as if not8ing 8as 8appened )E11. Vuic5 J. Progra**er's Suic5 sand. )E12. Vuic5 Jlose your *ind Ho*et8ing *ig8t get in. )E1(. Vuit loo5ing at fortunes and get bac5 to 9or5 )E1). Vuit 9or5 and play for once )E1/. 3adioacti=e cats 8a=e 1: 8alf-li=es. )E16. 3adioacti=e cats 8a=e 1: 8alf-li=es. )E1@. 3ainy days and auto*atic 9eapons get *e do9n.... )E1:. 3ainy days and auto*atic 9eapons get *e do9n. )E1E. 3ainy days and -ondays al9ays get *e do9n. )E20. 3aise duc5s for Suac5 profit. )E21. 3aising pet electric eels is gaining a lot of current popularity. )E22. 30- X 3arely 0deSuate -e*ory )E2(. 30- dis5 is "not" an installation procedure. )E2). 3an5 8as its pri=ileges. )E2/. 30;'H P3.JOHO,K 3LB.& -easure 9it8 a *icro*eter - -ar5 9it8 c8al5 Jut 9it8 an aRe. )E26. 3a ors pain youW 3i=ers are da*pW 0cids stain youW 0nd drugs cause cra*p. <uns aren't la9fulW Kooses gi=eW <as s*ells a9fulW ;ou *ig8t as 9ell li=e. - 4orot8y Par5er )E2@. 3e grap8ics& 0 picture is 9ort8 10T 9ords -- but only t8ose to describe t8e picture. +ardly any sets of 10T 9ords can be adeSuately described 9it8 pictures. )E2:. 3ead *e )E2E. 3ead *y lips... - <eorge Fus8 )E(0. 3ead t8e docs. 7o92 98at a radical concept )E(1. 3ead your 0*da8l Fusiness Practices. )E(2. 3eading is t8in5ing 9it8 so*eone else's 8ead instead of one's o9n. )E((. 3eading t8e s*all print is educationW not reading it is eRperience. )E(). 3eal 5no9ledge is to 5no9 t8e eRtent of one's ignorance. )E(/. 3eal Progra**ers don't play tennis2 or any ot8er sport t8at reSuires you to c8ange clot8es. -ountain cli*bing is ,T2 and real progra**ers 9ear t8eir cli*bing
boots to 9or5 in case a *ountain s8ould suddenly spring up in t8e *iddle of t8e *ac8ine roo*. )E(6. 3eal Progra**ers don't 9rite in PB[O. PB[O is for progra**ers 98o can't decide 98et8er to 9rite in J,F,B or ?,3D30K. )E(@. 3eal Progra**ers t8in5 better 98en playing 0d=enture or 3ogue. )E(:. 3.0B progra**ers use undocu*ented 4,H calls )E(E. 3eal Progra*s don't use s8ared teRt. ,t8er9ise2 8o9 can t8ey use functions for scratc8 space after t8ey are finis8ed calling t8e*? )E)0. 3eal Di*e2 adU.& +ere and no92 as opposed to fa5e ti*e2 98ic8 only occurs t8ere and t8en. )E)1. 3eal Dre55ers 9or5 out at t8e +e's 4ead <y*. )E)2. 3eality does not eRist - yet. )E)(. 3eality is a cop-out for people 98o can't 8andle drugs. )E)). 3eality is a crutc8 for people 98o can't face drugs. )E)/. 3eality is an obstacle to 8allucination. )E)6. 3eality is an obstacle to 8allucination. )E)@. 3eality is blin5ing again...call for repairs. )E):. 3eality is for people 98o can't deal 9it8 drugs. )E)E. 3eality is for people 98o can't 8andle Htar Dre5. )E/0. 3eality is for people 9it8 no grasp of fantasy. )E/1. 3eality is for t8ose 98o can't face Hcience ?iction. )E/2. 3eality is Uust a crutc8 for people 98o can't 8andle drugs. )E/(. 3eality is Uust a crutc8 for people 98o can't 8andle science fiction. )E/). 3eality--98at a concept )E//. 3eally?? 7e're 8a=ing *on5ey 8eads? )E/6. 3ebellion lay in 8is 9ay2 and 8e found it. )E/@. 3ecei=ing a *illion dollars taR free 9ill *a5e you feel better t8an being flat bro5e and 8a=ing a sto*ac8 ac8e. - 4olp8 H8arp2 CO'* ,.T.2 ;ou're Kot Ho +otC )E/:. 3ecent in=est*ents 9ill yield a slig8t profit. )E/E. 3ecession is 98en your neig8bor loses 8is Uob. 4epression is 98en you lose your Uob. D8ese econo*ic do9nturns are =ery difficult to predict2 but sop8isticated econo*etric *odeling 8ouses li5e 4ata 3esources and J8ase .cono*etrics 8a=e successfully predicted 1) of t8e last ( recessions. )E60. 3eclai*er2 spare t8at tree Da5e not a single bit Ot used to point to *e2 Ko9 O'* protecting it. Ot 9as t8e reader's J,KH D8at *ade it2 paired by dotW Ko92 <J2 for t8e nonce2 D8ou s8alt reclai* it not. )E61. 3ecursi=e2 adU.W see recursi=e )E62. 3educe brain fat. .at -oral ?iber. )E6(. 3educe Jarbon 4ioRide e**issions - HD,P Freat8ing )E6). 3e8u*ani e yourself )E6/. 3elati=is* stin5s- you can't call anyone a *oron )E66. 3eligions re=ol=e *adly around seRual Suestions. )E6@. 3eligious error& $01tone2 $31epent2 $O1**olate? )E6:. 3e*e*ber - 0 s*ile 9ill al9ays increase your face =alue. )E6E. 3e*e*ber t8at 98ate=er *isfortune *ay be your lot2 it could only be 9orse in Jle=eland. - Kational Ba*poon2 C4eterioradaC )E@0. 3e*e*ber t8e 0la*o. )E@1. 3e*e*ber to say 8ello to your ban5 teller. )E@2. 3e*e*ber2 e=en if you 9in t8e rat race - you're still a rat. )E@(. 3e*e*ber2 e=en if you 9in t8e rat race -- you're still a rat.
)E@). 3e*e*ber2 t8e paper is al9ays strongest at t8e perforations. )E@/. 3e*e*ber2 LniR on so*e *ac8ines is nLRi. )E@6. 3e*e*ber2 LKOM spelled bac59ards is MOKL. )E@@. 3e*e*ber2 LKOM spelled bac59ards is MOKL. )E@:. 3e*e*bering is for t8ose 98o 8a=e forgotten. )E@E. 3e*ote Bogin - a login t8at is unli5ely to succeed. )E:0. 3eplace repetiti=e eRpressions by calls to a co**on function. )E:1. 3eporter $to -a8at*a <and8i1& -r <and8i2 98at do you t8in5 of 7estern Ji=ili ation? <and8i& O t8in5 it 9ould be a good idea. )E:2. 3eporter2 n.& 0 9riter 98o guesses 8is 9ay to t8e trut8 and dispels it 9it8 a te*pest of 9ords. - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC )E:(. 3epublicans understand t8e i*portance of bondage bet9een a *ot8er and c8ild. - 4an Vuayle )E:). 3eputation is 98at ot8ers are not t8in5ing about you. )E:/. 3esearc8 is to see 98at e=eryone else 8as2 and t8en t8in5 98at no one else 8as. )E:6. 3esearc8 is 98at O'* doing 98en O don't 5no9 98at O'* doing. - 7ern8er =on Fraun )E:@. 3eser=e t8e apostrop8e for it's proper use and o*it it 98en its not needed. )E::. 3esist e=eryt8ing but te*ptation. )E:E. 3esisting te*ptation is easier 98en you t8in5 you'll probably get anot8er c8ance later on. )EE0. 3est assured t8at your dog is finally getting enoug8 c8eese. )EE1. 3etire*ent s8ould be based on t8e tread2 not t8e *ileage. )EE2. 3etribution 9ill be yours. )EE(. 3.V. J+OJ+.HD.3'H B07& Of t8e 9eat8er is eRtre*ely bad or eRtre*ely good2 attendance 9ill be do9n. )EE). 3.;K,B4'H B07 ,? JBO-0D,B,<;& 7ind =elocity increases directly 9it8 t8e cost of t8e 8airdo. )EE/. 3ic8es co=er a *ultitude of 9oes. )EE6. 3id yourself of doubt2 or s8ould you... )EE@. 3i5er to .nterprise. Fea* do9n Droi and a siR-pac5. )EE:. 3i5er's tro*bone bac5fires2 creating a ne9 uni=erse. )EEE. 3i5er's tro*bone bac5fires2 creating a tagline. /000. 3i5er2 0T0 CKu*ber ,ne.C 0 spy for t8e Forg? /001. 3OP... D8is tagline 8ad no9 been ripped off..... /002. 3,JT.?.BB.3'H P3OKJOPB.& Ke=er do anyt8ing you 9ouldn't be caug8t dead doing. /00(. 3,<.3'H B07& 0s soon as t8e ste9ardess ser=es t8e coffee2 t8e airliner encounters turbulence. /00). 3,- 9asn't built in a day. /00/. 3o*e 9as not built in one day. - >o8n +ey9ood $1)E@-1/:01 /006. 3o*e 9as not built in one day. /00@. 3,-.,& Jourage2 *anW t8e 8urt cannot be *uc8. -.3JLDO,& Ko2 'tis not so deep as a 9ell2 nor so 9ide as a c8urc8- doorW but 'tis enoug82 't9ill ser=e. /00:. 3,-OK<.3'H 3LB. ?,3 HDL4.KDH& D8e *ore general t8e title of a course2 t8e less you learn fro* it. /00E. 3,K'H ,FH.3V0DO,K ?,3 D..KH& D8e pi*ples don't appear until t8e 8our before t8e date. /010. 3onald 3egan& -illi Vanilli of presidents. /011. 3oo* to Bet. 0pply 9it8in.
/012. 3otten 9ood cannot be car=ed - Jonfucius $0nalects2 Foo5 /2 J8. E1 /01(. 3D?/01). 3ubber bands 8a=e snappy endings /01/. 3udin's Ba9& Of t8ere is a 9rong 9ay to do so*et8ing2 *ost people 9ill do it e=ery ti*e. /016. 3ule #16@& niet8er a borro9er nor a lender be. /01@. 3ule of Jreati=e 3esearc8& 11 Ke=er dra9 98at you can copy. 21 Ke=er copy 98at you can trace. (1 Ke=er trace 98at you can cut out and paste do9n. /01:. 3LB. ,? 4.?0JDL0BOQ0DO,K& Onfor*ation deteriorates up9ard t8roug8 bureaucracies. /01E. 3ule of 4efactuali ation& Onfor*ation deteriorates up9ard t8roug8 bureaucracies. /020. 3ule of ?eline ?rustration& 78en your cat 8as fallen asleep on your lap and loo5s utterly content and adorable2 you 9ill suddenly 8a=e to go to t8e bat8roo*. /021. 3ule of t8e <reat& 78en people you greatly ad*ire appear to be t8in5ing deep t8oug8ts2 t8ey probably are t8in5ing about lunc8. /022. 3uling a big country is li5e coo5ing a s*all fis8. /02(. 3uling a country is li5e coo5ing a s*all fis8. - Bao-t u /02). 3un a9ay /02/. 3un for t8e 8ills D8e duc5s are loose /026. 3LK.'H 3LB.& Of you don't care 98ere you are2 you ain't lost. /02@. 3ussia 8as t8e -osco9 JircusW 7. 8a=e J,K<3.HH /02:. H *et ing's 8ap ening t *y 5 ybo rd . . /02E. Hacred co9s *a5e great 8a*burgers. /0(0. Hado-necro-beastiality is beating a dead 8orse. /0(1. Hado-necro-bestiality is flogging a dead 8orse. /0(2. Hafety is better t8an t8e 9rong ans9er. /0((. H0<ODD03OLH $Ko= 22 - 4ec 211 ;ou are opti*istic and ent8usiastic. ;ou 8a=e a rec5less tendency to rely on luc5 since you lac5 talent. D8e *aUority of Hagittarians are drun5s or dope fiends or bot8. People laug8 at you a great deal. /0(). Halary is no obUect& stri=e only to 5eep body and soul apart. /0(/. H0B.H-0K'H -,DD,& Ot is *orally 9rong to allo9 a nai=e person to 5eep t8eir *oney. /0(6. Hal=ation is only a Feer Fottle a9ay....... /0(@. Ha*e to you and 98ate=er you *eant by t8at /0(:. Han ?rancisco isn't 98at it used to be2 and it ne=er 9as. - +erb Jaen /0(E. Han ?rancisco2 n.& -arcel Proust editing an issue of Pent8ouse. /0)0. Hane? +ell2 if O 9as sane 98y 9ould O be 8ere? /0)1. H0KOD;.H;H corrupt. -OK4 lost. /0)2. Hanta's el=es are Uust a bunc8 of subordinate clauses. /0)(. Hatire does not loo5 pretty upon a to*bstone. /0)). Hatire is 98at closes in Ke9 +a=en. /0)/. Haturate - t8e scientific ter* for sitting on a 9et toilet seat. /0)6. Ha=e energy2 dri=e a s*aller process. /0)@. Ha=e energy& be apat8etic. /0):. Ha=e energy& be apat8etic. /0)E. Ha=e gas2 don't eat beans. /0/0. Ha=e gas2 don't use t8e s8ell. /0/1. Ha=e our beac8es. +arpoon a fat c8ic5. /0/2. Ha=e our =irgin forests - buy a tree a c8astity belt.
/0/(. Ha=e t8e 9ales Ku5e <reenpeace instead /0/). Ha=e t8e 98ales. Jollect t8e 98ole set. /0//. Ha=e yourself 3eboot in / seconds /0/6. Hay t8e secret 9oid and t8e duc5 is yours. /0/@. Hay t8e secret 9ord and you 9in $100. /0/:. Hcandal is gossip *ade tedious by *orality. /0/E. Hcarecro9 for centipedes - ?ro* C101 LH.H ?,3 0 4.04 -OJ3,P3,J.HH,3C /060. Hcarred for Bife. Ko co*pensation. Pri=ate On=estigation. - -ar5 Tnopfler /061. HJJH2 t8e source *otel Progra*s c8ec5 in and ne=er c8ec5 out - Ten D8o*pson /062. Hc8apiro's .Rplanation& D8e grass is al9ays greener on t8e ot8er side -- but t8at's because t8ey use *ore *anure. /06(. Hc8i op8renia beats being alone. /06). Hc8i op8renia beats being alone. /06/. Hc8i op8renia beats sysoping alone. /066. Hcience is true. 4on't be *isled by facts. /06@. Hcience is 98at 8appens 98en preconception *eets =erification. /06:. HJK0DD.3B;'H HL--OK< LP ,? D+. J,3,BB03O.H& Of anyt8ing can't go 9rong2 it 9ill. /06E. HJ,3PO, $,ct 2( - Ko= 211 ;ou are s8re9d in business and cannot be trusted. ;ou 9ill ac8ie=e t8e pinnacle of success because of your total lac5 of et8ics. -ost Hcorpio people are *urdered. /0@0. Hcott *e up Fea*ie /0@1. Hcott *e up2 Fea*ie /0@2. Hcott's first Ba9& Ko *atter 98at goes 9rong2 it 9ill probably loo5 rig8t. /0@(. HJ,DD'H H.J,K4 B07& 78en an error 8as been detected and corrected2 it 9ill be found to be correct originally. /0@). Hcott's second Ba9& 78en an error 8as been detected and corrected2 it 9ill be found to 8a=e been 9rong in t8e first place. Jorollary& 0fter t8e correction 8as been found in error2 it 9ill be i*possible to fit t8e original Suantity bac5 into t8e eSuation. /0@/. Hcotty +urry2 bea* *e u...." K, J033O.3 /0@6. Hcotty is s*o5ing t8e dilit8iu* crystals again2 >i* /0@@. Hcotty& Japtain2 9e din' can reference it Tir5& 0nalysis2 -r. Hpoc5? Hpoc5& Japtain2 it doesn't appear in t8e sy*bol table. Tir5& D8en it's of eRternal origin? Hpoc5& 0ffir*ati=e. Tir5& -r. Hulu2 go to pass t9o. Hulu& 0ye aye2 sir2 going to pass t9o. /0@:. Hcotty& 78at is it? 4ata& Ot is... it is green. /0@E. Hcre9 up your courage ;ou'=e scre9ed up e=eryt8ing else. /0:0. Hculpture& *ud pies t8at endure. /0:1. Hdra95cab spelled bac59ards is bac59ards. /0:2. Hears 8as e=eryt8ing. /0:(. H.0;'H B07& Kot8ing e=er co*es out as planned. /0:). Hecond Ba9 of Fusiness -eetings& Of t8ere are t9o possible 9ays to spell a person's na*e2 you 9ill pic5 t8e 9rong one. Jorollary& Of t8ere is only one 9ay to spell a na*e2 you 9ill spell it 9rong2 any9ay. /0:/. H.J,K4 B07 ,? J,-PLD.3 P3,<30--OK<& Jo*puters are unreliable2 but 8u*ans are e=en *ore unreliable. /0:6. Hecond star to t8e rig8t G straig8t on till *orning... /0:@. Hecond star to t8e rig8t and straig8t on till *orning.
/0::. Hecond-rate people 8ire t8ird-rate people. /0:E. Hector Kot ?ound $01bort2 $31etry2 $J1offee? /0E0. Hecurity - t8e co*puter progra**er's eSui=alent of a Uo5e. /0E1. Hecurity c8ec5& OKD3L4.3 0B.3D /0E2. Hecurity is t8e indi=idual's responsibility. /0E(. Hecurity is your responsibility. /0E). Hecurity2 confine .nsign %BK% to t8e brig. /0E/. Hecurity2 get t8at floo y off *y bridge. - Picard /0E6. Heeing t8at deat82 a necessary end2 9ill co*e 98en it 9ill co*e. /0E@. H.<0 and Kintendo are co*bining2 t8ey call it 7indo9s KD /0E:. H.OD'H B07 ,? +O<+.3 .4LJ0DO,K& D8e one course you need for graduation is not offered your last se*ester. /0EE. Hei e t8e day2 put no trust in t8e *orro9 - +orace $: FJ1 /100. Hei e t8e day2 put no trust in t8e *orro9 /101. Helf Dest for Paranoia& ;ou 5no9 you 8a=e it 98en you can't t8in5 of anyt8ing t8at's your o9n fault. /102. Helf-deceit is easyW 98at one 9is8es one belie=es is true /10(. Helf-piercing earrings - ?ro* C101 LH.H ?,3 0 4.04 -OJ3,P3,J.HH,3C /10). Hell s8ort. /10/. He*inars2 n.& ?ro* Cse*iC and CarseC2 8ence2 any 8alf-assed discussion. /106. H.-P.3 LFO HLF LFO /10@. Hend la9yers2 guns2 and *oney /10:. Hend *ore tourists..... t8e last ones 9ere delicious /10E. H.KOB..J,- found... ,ut ,f -e*ory... /110. Herfs up - Hpartacus. /111. Heroc5i's Htricture& -arriage is al9ays a bac8elor's last option. /112. Her=ing coffee on aircraft causes turbulence. /11(. Her=ing coffee on aircraft causes turbulence. /11). Het p8asers on tic5le /11/. Het p8asers to eRtre*e itc8ing /116. Het t8e cart before t8e 8orse. /11@. HeR causes cancer. 7e'd 9ipe out cancer in one generation if no one 8ad seR. /11:. HeR discri*inates against t8e s8y and ugly. /11E. HeR is a disrobic eRperience /120. HeR is not t8e ans9er. HeR is t8e Suestion. C;esC is t8e ans9er. - H9a*i M /121. HeR is not t8e ans9er. HeR is t8e Suestion. C;esC is t8e ans9er. /122. HeR is t8e *at8e*atics urge subli*ated. - -. J. 3eed. /12(. HeR is t8e *ost fun you can 8a=e 9it8out laug8ing. /12). HeR on DV can't 8urt you...unless you fall off. /12/. HeR D8e *ost fun you can 8a=e 9it8 your clot8es off. /126. HeR D8e *ost fun you can 8a=e 9it8 your clot8es on. /12@. HeR 9it8out lo=e is an e*pty eRperience2 but2 as e*pty eRperiences go2 it's one of t8e best. - 7oody 0llen /12:. HeRy& Lses feat8er. Tin5y& Lses entire c8ic5en. /12E. H.;-,L3'H OKV.HD-.KD P3OKJOPB.& Ke=er in=est in anyt8ing t8at eats. /1(0. H8all O sing you t8e ,de to >oy? /1(1. H8are your 8appiness 9it8 ot8ers today. /1(2. H+07'H P3OKJOPB.& Fuild a syste* t8at e=en a fool can use2 and only a fool 9ill use it.
/1((. H8a9's Principle& Fuild a syste* t8at e=en a fool can use2 and only a fool 9ill 9ant to use it. /1(). H8e canna ta5e anne8 *ore2 Jap'n /1(/. H8e is not refined. H8e is not unrefined. H8e 5eeps a parrot. - -ar5 D9ain /1(6. H8e Uust2 turns around and disappear. O 5inda li5e t8at style. /1(@. H8e loo5s so good2 s8e *a5es a dead *an co*e. - Do* 7aits /1(:. H8e lo=es you as *uc8 as s8e can2 98ic8 is not =ery *uc8. /1(E. H8e *ay =ery 9ell pass for forty-t8ree in t8e dus5 9it8 a lig8t be8ind 8er. /1)0. H8e *issed an in=aluable opportunity to gi=e 8i* a loo5 t8at you could 8a=e poured on a 9affle ... /1)1. H8e offered 8er 8onour2 8e 8onoured 8er offer - all nig8t long2 8onour and offer /1)2. H8e sells J s8ells /1)(. H8e sells cs8s by t8e cs8ore. /1)). H8e 9as only t8e stable*an's daug8ter2 but all t8e 8orse*en 5ne9 8er. /1)/. H8e 9as so narro9-*inded s8e could see t8roug8 a 5ey8ole 9it8 t9o eyes. /1)6. H8e 9as t8e sort of person 98ose personality 9ould be greatly i*pro=ed by a ter*inal illness. /1)@. H8e 9as using t8e landscape to 8ide 8erself /1):. H8e 98o 8esitates is 9on. /1)E. H8e's 0BOV.2 >i* Pass t8e DroUans /1/0. H8e's genuinely bogus. /1/1. H8eep are best /1/2. H8ell to 4,H....Jo*e in2 4,H.....4o you Jopy? /1/(. H88 Fe =e9y Suiet2 O'* 8unting 9unti*e errors /1/). H88 O 8a=e to use *y inco*plete2 di=ided attention 8ere /1//. H8ift to t8e left H8ift to t8e rig8t Pop up2 pus8 do9n Fyte2 byte2 byte /1/6. H+O?D D, D+. B.?D H+O?D D, D+. 3O<+D P,P LP2 PLH+ 4,7K2 F;D.2 F;D.2 F;D. /1/@. H8ine on2 you cra y dia*ond /1/:. H+O3B.;'H B07& -ost people deser=e eac8 ot8er. /1/E. H8oot your progra* and put it out of its *e*ory /160. H8oplifters 9it8 t8e runs ta5e Jlepto Fis*ol /161. H8ort circuits got no reason to li=e. /162. H8o9 *e a *an 98o is a good loser and O'll s8o9 you a *an 98o is playing golf 9it8 8is boss. /16(. H8o9 *e a sane *an. O'll cure 8i* for you. /16). H8o9 respect for age. 4rin5 good scotc8 for a c8ange. /16/. H8o9 respect for age. 4rin5 good Hcotc8 for a c8ange. /166. H8o9 your affection2 98ic8 9ill probably *eet 9it8 pleasant response. /16@. H8o9 your appreciation for your lo=er 9it8 a surprise s*all gift. /16:. H8o9er t8e people you lo=e 9it8 your lo=e. /16E. H8o9er 9it8 t8e people you lo=e. /1@0. H8ut up2 5id. - <uinan /1@1. H8ut up2 Hpoc5 7e're rescuing you - -cJoy /1@2. Hig8t is a facultyW seeing is an art. /1@(. Hig*und's 9ife 9ore freudian slips. /1@). Hign on ban5& C?3.. F,DDB. ,? J+OV0H 7OD+ .V.3; -OBBO,K4,BB03 4.P,HOD.C /1@/. Hign up no9 for t8e su**ari ing Proust co*petition
/1@6. Higns of cri*e& screa*ing or cries for 8elp. - fro* t8e Fro9n Hecurity Jri*e Pre=ention Pa*p8let /1@@. Hilly Suestion /1@:. Hilly 7abbit2 V7Ts are for 5ids /1@E. Hil=er*an's Ba9& Of -urp8y's Ba9 can go 9rong2 it 9ill. /1:0. HOBV.3-0K'H P0304,M& Of -urp8y's Ba9 can go 9rong2 it 9ill. /1:1. HO-,K'H B07& .=eryt8ing put toget8er falls apart sooner or later. /1:2. Hi*on's Ba9& .=eryt8ing put toget8er falls apart sooner or later. /1:(. Hi*ple pleasures are t8e last refuge of t8e co*pleR. /1:). Hin 8as *any tools2 but a lie is t8e 8andle 98ic8 fits t8e* all. /1:/. Hince aerosols are forbidden2 t8e police are using roll-on -ace /1:6. Hince O 8urt *y pendulu* -y life is all erratic. -y parrot2 98o 9as cordial2 Os no9 trans*itting static. D8e carpet died2 a pal* collapsed2 D8e cat 5eeps doing poo. D8e only t8ing t8at 5eeps *e sane Os tal5ing to *y s8oe. - -y H8oe /1:@. Hince 9e're all 8ere2 9e *ust not be all t8ere. - Fob C-ountainC Fec5 /1::. Hincerity is t8e 7ay. - -encius2 (@2-2:E F.J. /1:E. Hir 3o*ulan 9arbird decloa5iW.u9 - 0 K, J033O.3 /1E0. Hir2 O'=e been *eaning to dicuss t8ese feelings. - Droi /1E1. Hir2 it's =ery possible t8is asteroid is not stable. /1E2. HiR *egs2 t9o *onitors2 and an attitude /1E(. H5inner's Jonstant $or ?lannagan's ?inagling ?actor1& D8at Suantity 98ic82 98en *ultiplied by2 di=ided by2 added to2 or subtracted fro* t8e ans9er you get2 gi=es you t8e ans9er you s8ould 8a=e gotten. /1E). HT,??'H B07& 0 c8ild 9ill not spill on a dirty floor. /1E/. Hlang is language t8at ta5es off its coat2 spits on its 8ands2 and goes to 9or5 /1E6. Hlang is language t8at ta5es off its coat2 spits on its 8ands2 and goes to 9or5. /1E@. HB..P& t8at fleeting *o*ent Uust before t8e alar*. /1E:. Hlur*2 n.& D8e sli*e t8at accu*ulates on t8e underside of a soap bar 98en it sits in t8e dis8 too long. - 3ic8 +all2 CHnigletsC /1EE. H*all c8ange can often be found under seat cus8ions. /200. H*all opportunities are often t8e beginning of great enterprises. - 4e*ost8enes /201. H*all progra*s are for s*all *inds. /202. H*all t8ings *a5e base *en proud. /20(. H*as8 fore8ead on 5eyboard to continue... /20). H*ile ;ou're on Jandid -ode* /20/. H*ile it *a5es people 9onder 98at you'=e been up to. /206. H*ile ;ou're on Jandid Ja*era. /20@. H*ile2 but s8arpen your 5ni=es. /20:. H*ile2 to*orro9 9ill be 9orse. /20E. H*ile... people 9ill 9onder 98at you'=e been up to. /210. H*o5e no peac8es. /211. Hnac5tre52 n.& D8e peculiar 8abit2 98en searc8ing for a snac52 of constantly returning to t8e refrigerator in 8opes t8at so*et8ing ne9 9ill 8a=e *ateriali ed. - 3ic8 +all2 CHnigletsC /212. Hnorting 9ildly2 7orf actually s*ells 8is o9n feet. /21(. Hno9 and adolescence are t8e only proble*s t8at go a9ay if ignored long enoug8. /21). Hno9 4ay - stay 8o*e. /21/. Ho far as O can re*e*ber2 t8ere is not one 9ord in t8e <ospels in praise of intelligence. - Fertrand 3ussell
/216. Ho *any ass8oles2 so fe9 bullets - ?ord ?airlane /21@. Ho *any idiots... too fe9 fla*e-t8ro9ers... /21:. Ho *any la9yers2 so fe9 bullets. /21E. Ho *any *en2 so *any opinionsW e=ery one 8is o9n 9ay. /220. Ho t8is is t8e secret of 8appiness /221. Ho 98at's t8e *atter 9it8 -; taglines? /222. Ho you're bac5. /22(. Ho2 *y brot8er is 8u*an after all. - 3obert Picard /22). Hocial inno=ations tend to t8e le=el of *ini*u* tolerable 9ell-being. /22/. Hociety is a *ule2 not a carW if pressed 8arder2 it 9ill 5ic5 and t8ro9 you off /226. Hociety li5e air2 is necessary but not co*plete for life. /22@. H,44'H H.J,K4 B07& Hooner or later t8e 9orst is bound to occur. /22:. Hodd's Hecond Ba9& Hooner or later2 t8e 9orst possible set of circu*stances is bound to occur. /22E. H,?D703. -- for*al e=ening attire for fe*ale co*puter analysts. /2(0. H,?D703OB; ad=. On a 9ay pertaining to soft9are. CD8e syste* is soft9arily unreliable.C D8e adUecti=e 'soft9ary' is K,D used. Hee +034703OB;. /2(1. Holitude is painful 98en one is young2 but delig8tful 98en one is *ore *ature. - 0lbert .instein /2(2. Ho*e 4o2 Ho*e 4on't2 Ho*e 7ill and Ho*e 7on't. /2((. Ho*e *en are disco=eredW ot8ers are found out. /2(). Ho*e *inds s8ould be culti=ated2 ot8ers plo9ed under.../2(/. Ho*e people are born *ediocre2 so*e people ac8ie=e *ediocrity2 and so*e people 8a=e *ediocrity t8rust upon t8e*. - >osep8 +eller2 CJatc8-22C /2(6. Ho*e people are paid to be good2 but 9e're good for not8ing. - Peter Ja*pbell /2(@. Ho*e people are2 t8roug8 no fault of t8eir o9n2 sane. /2(:. Ho*e people car=e careers2 ot8ers c8isel t8e*. /2(E. Ho*e people cause 8appiness 98ere=er t8ey goW ot8ers2 98ene=er t8ey go. /2)0. Ho*e people fall for e=eryt8ing and stand for not8ing. /2)1. Ho*e people in t8is depart*ent 9ouldn't recogni e subtlety if it 8it t8e* on t8e 8ead. /2)2. Ho*e rise by sin and so*e by =irtue fall. /2)(. Ho*e t8ings 8a=e to be belie=ed to be seen. /2)). Ho*ebody got up on t8e 9rong side t8is *orning. - 3i5er /2)/. Ho*ebody oug8t to cross ball point pens 9it8 coat 8angers so t8at t8e pens 9ill *ultiply instead of disappear. /2)6. Ho*ebody's ter*inal is dropping bits. O found a pile of t8e* o=er in t8e corner. /2)@. Ho*e8o92 O can't see *yself doing it for *oney. - <eordi /2):. Ho*e8o92 so*e98ere along t8e line2 t8is to9n lost its pride. /2)E. Ho*eone close to you is ta5ing ad=antage of your trust. /2/0. Ho*eone is spea5ing 9ell of you. +o9 unusual /2/1. Ho*eone is spea5ing 9ell of you. /2/2. Ho*eone 98o* you reUect today2 9ill reUect you to*orro9. /2/(. Ho*eone 9ill try to 8on5 your nose today. /2/). Ho*eone 9ill try to 8on5 your nose today. /2//. Ho*et8ing's rotten in t8e state of 4en*ar5. /2/6. Ho*eti*es O t8in5 life is all Uust a pleasant drea*. /2/@. Ho*eti*es O 9orry about being a success in a *ediocre 9orld. - Bily Do*lin /2/:. Hooner or later you *ust pay for your sins. $D8ose 98o 8a=e already paid *ay disregard t8is fortune1.
/2/E. Hooner or later2 t8e 9orst possible set of circu*stances is bound to occur. /260. Horry about t8at J8ief - -aR9ell H*art /261. Horry2 but *y 5ar*a Uust ran o=er your dog*a. /262. Horry2 co*puter foul-up /26(. Horry2 O don't date outside *y species. - Fu*per stic5er /26). Horry2 O forgot all about t8e 0*nesia Jonference /26/. Horry2 no fortune t8is ti*e. /266. Horry. Kice try. /26@. Horry... *y *ind 8as a fe9 bad sectors. /26:. Horry. /26E. Hout8ern 4,H& ;'all rec5on? [yep[nope! /2@0. Hpace is big. ;ou Uust 9on't belie=e 8o9 =astly2 8ugely2 *ind-bogglingly big it is. O *ean2 you *ay t8in5 it's a long 9ay do9n t8e road to t8e drug store2 but t8at's Uust peanuts to space. - CD8e +itc88i5er's <uide to t8e <alaRyC /2@1. Hpag8etti code *eans Uob security. /2@2. Hpa* for *e2 9it8 a side of crunc8y frog. /2@(. Hpare t8e rod and spoil t8e drag race. /2@). Hpare ti*e? ;ou're loo5in' at it. /2@/. HP03T'H ?O3HD 3LB.& Htri=e to loo5 tre*endously i*portant. /2@6. Hpar5's HiRt8 3ule for -anagers& Of a subordinate as5s you a pertinent Suestion2 loo5 at 8i* as if 8e 8ad lost 8is senses. 78en 8e loo5s do9n2 parap8rase t8e Suestion bac5 at 8i*. /2@@. Hpea5 softly and carry a '6 t9o-8anded s9ord. /2@:. Hpea5 softly and carry a t9o-8anded s9ord. /2@E. Hpeedy <on ales 5no9s e=ery ones seester /2:0. Hpend enoug8 ti*e confir*ing t8e need and t8e need 9ill disappear. /2:1. Hpend eRtra ti*e on 8obby. <et plenty of rolling papers. /2:2. Hpice up your lo=e life....5iss a Tlingon today /2:(. Hpilling your guts out is Uust as c8ar*ing as it sounds. /2:). Hpirtle2 n.& D8e fine strea* fro* a grapefruit t8at al9ays lands rig8t in your eye. - Hniglets2 C3ic8 +all G ?riendsC /2:/. Hplit personality? 78o2 us? /2:6. Hpoc5 at M*as& 0 pencil s8arpener for *y ears D8anR2 >i* /2:@. Hpoc52 Suic52 O s*ell tribbles /2::. Hpoc52 you are suc8 a put /2:E. Hpoc5[4ata 1EE6& D8e Bogical J8oice /2E0. Hpoc5& 7e suffered 2( casualties in t8at attac52 Japtain. /2E1. Hpouse2 n.& Ho*eone 98o'll stand by you t8roug8 all t8e trouble you 9ouldn't 8a=e 8ad if you'd stayed single. /2E2. Htability itself is not8ing else t8an a *ore sluggis8 *otion. /2E(. Hta*p out p8ilately. /2E). HD0K4 F0JT O don't 5no9 8o9 big t8is gets /2E/. Htand do9n fro* battle stations2 and .nsign c8ange your p8aser /2E6. Htandards are 9onderful& so *any fro* 98ic8 to c8oose /2E@. Htanding on 8ead *a5es s*ile of fro9n2 but rest of face also upside do9n. /2E:. Htar Dre5 MMVOO - D8e Hearc8 for H8atner's Deet8. /2EE. Htart slo9 and taper off. /(00. Htate ?ar*? <uard dogs? /(01. Htatistics are no substitute for Uudge*ent. /(02. Htatistics are used as a drun5 uses la*pposts--for support2 not illu*ination.
/(0(. HD0DLH VL, is Batin for Ct8e *ess 9e're in.C /(0). HD0; 0B.3DD3LHD K, ,K.T..P ;,L3 B0H.3 +0K4; /(0/. Htay a9ay fro* flying saucers today. /(06. Htay a9ay fro* flying saucers today. /(0@. Htay a9ay fro* 8urricanes for a 98ile. /(0:. Htay bac5 O 8a=e a *ode* and O 5no9 8o9 to use it /(0E. Htay bac5 O 8a=e a *ode* and O 5no9 8o9 to use it /(10. Htealing a r8inoceros s8ould not be atte*pted lig8tly. /(11. HD..B.'H P+OB,H,P+;& .=erybody s8ould belie=e in so*et8ing. O belie=e O'll 8a=e anot8er drin5. /(12. Hteer clear of incorrect for*s of =erbs t8at 8a=e snuc5 in t8e language. /(1(. Hteinbac8's <uideline for Hyste*s Progra**ing Ke=er test for an error condition you don't 5no9 8o9 to 8andle. /(1). HD.OKF0J+'H <LO4.BOK.& Ke=er test for an error condition you don't 5no9 8o9 to 8andle. /(1/. HD.K4.3LP'H B07& D8e sooner you fall be8ind2 t8e *ore ti*e you 9ill 8a=e to catc8 up. /(16. HDOJT #'sti5# n. 1& 0 boo*erang t8at doesn't 9or5. /(1@. Htic5 to your talent and t8e co9s 9ill be 9ell tended. /(1:. Htill going Kot8ing outlasts 4ata +e 5eeps going and going and... /(1E. HDODQ.3'H V0J0DO,K P3OKJOPB.& Da5e 8alf as *uc8 clot8ing G t9ice as *uc8 *oney. /(20. Htop searc8ing fore=er. +appiness is Uust neRt to you. /(21. Htop searc8ing fore=er. +appiness is unattainable. /(22. Htop searc8ing. +appiness is rig8t neRt to you. Ko92 if t8ey'd only ta5e a bat8 ... /(2(. Htop searc8ing. +appiness is rig8t neRt to you. /(2). Htop s*ir5ing Ku*ber ,ne. /(2/. Htop tagline t8eft Jopyrig8t your tagline $c1 /(26. Htop 98at you're doing and D0T. 0 H+,7.3 /(2@. Htrangely2 4ata finds 8i*self relating to 8ea=y *etal. /(2:. Htranger in a strange country. - Hop8ocles $)06 FJ1 /(2E. Htrea5ers repent ;our end is in sig8t. /((0. Htress- n. 4oing a tig8t 1:0-dregree L-turn at 7arp E./. /((1. Htri5e 98ile t8e iron is 8ot. /((2. HD3OK< space corrupt? Fut O al9ays use D0P. /(((. Htructured Progra**ing - a tec8niSue 98ic8 creates beautiful loo5ing code 98ic8 doesn't 9or5. /((). HDL4.KD'H B07& .=ery instructor assu*es you 8a=e not8ing to do but study for 8is course. /((/. Htult's 3eport& ,ur proble*s are *ostly be8ind us. 78at 9e 8a=e to do no9 is fig8t t8e solutions. /((6. Htupid& Bosing $2/ on t8e ga*e and $2/ on t8e instant replay. /((@. HDLPO4OD; is K,D a +0K4OJ0P Par5 else98ere /((:. Hturgeon's Ba9& Kinety percent of e=eryt8ing is crud. /((E. Hturgeon's Ba9& E0A of e=eryt8ing is crud. /()0. Htyle *ay not be t8e ans9er2 but at least it's a 9or5able alternati=e. /()1. Huccess is a Uourney2 not a destination. - Fen H9eetland /()2. Huccess is a Uourney2 not a destination. /()(. Huccess lies in ac8ie=ing t8e top of t8e foodc8ain.
/()). Huccu*b to natural tendencies. Fe 8ateful and boring. /()/. Huccu*b to natural tendencies. Fe 8ateful and boring. /()6. Huddenly t8ings are going better t8an O e=er eRpected. /()@. Huffering Hacatas8 - Hyl=ester t8e Jat /():. Huperco*petence is *ore obUectionable t8an inco*petence. /()E. Hupport bacteria -- it's t8e only culture so*e people 8a=e /(/0. Hupport -ental +ealt8. ,r O'll 5ill you. /(/1. Hupport national *ot8er8ood 9ee5 - *a5e one today /(/2. Hupport 9ildlife2 t8ro9 a party. /(/(. Hupport your local c8urc8. 7ors8ip at Fan5 of 0*erica. /(/). Hupport your local *edical eRa*iner& die strangely. /(//. Hure2 drin5ing 5ills brain cells2 but only t8e 9ea5 ones. /(/6. Hure2 Patric52 but 9ill t8e Pontiac do 9arp nine? /(/@. Hure2 9e Uust route t8e *ain sensor t8roug8 4ata's cat. /(/:. Hurf Kicaragua /(/E. Hurly gra**arians insist t8at all 9ords ending in ClyC are ad=erbs. /(60. Hurprise ;ou are t8e luc5y 9inner of rando* O.3.H. 0udit >ust type in your na*e and social security nu*ber. Please re*e*ber t8at lea=ing t8e roo* is punis8able under la9& Ka*e # /(61. Hurprise due today. 0lso t8e rent. /(62. Hurprise your boss. <et to 9or5 on ti*e. /(6(. Hur=i=al of t8e species is e=eryone's business. /(6). H9ap read error. ;ou lose your *ind. /(6/. H9ap read error. ;ou lose your *ind. /(66. H9eet 0pril s8o9ers do spring -ay flo9ers. /(6@. H9ipple's 3ule of ,rder& +e 98o s8outs t8e loudest 8as t8e floor. /(6:. Hyntactic sugar causes cancer of t8e se*i-colonsW /(6E. HyntaR? 78y not2 t8ey taR e=eryt8ing else /(@0. H;H,P& D8e guy laug8ing at your typing. /(@1. Hysoping& -ore fun t8an being beaten 9it8 a sledge8a**er /(@2. Hyste* c8ec5point co*plete. /(@(. H;HD.- .33,3& press ?1( to continue... /(@). Hyste* going do9n at 1&)/ t8is afternoon for dis5 cras8ing. /(@/. Hyste* *aintenance about to begin. /(@6. Hyste* restarting2 9ait. /(@@. Hyste*[( Hyste*[( Hee 8o9 it runs Hee 8o9 it runs Ots *onitor loses so totally Ot runs all its progra*s in 3P< Ot's *ade by our fa=orite *onopoly Hyste*[( - Do t8e tune of ( blind *ice /(@:. Hyste*s progra**ers are t8e 8ig8 priests of a lo9 cult. /(@E. D'greatest griefs are t8ose 9e cause oursel=es. - Hop8ocles /(:0. Dact is t8e ability to tell a *an 8e 8as an open *ind 98en 8e 8as a 8ole in 8is 8ead. /(:1. Dact is t8e art of *a5ing a point 9it8out *a5ing an ene*y. /(:2. Dact is t8e unsaid part of 98at you're t8in5ing. /(:(. Dact2 n.& D8e unsaid part of 98at you're t8in5ing. /(:). Dagline error. Jontact your syste*s progra**er. /(:/. Dagline eRplodes2 destroys FFH. ?il* at 11 /(:6. Dagline freSuencies are ,pen.... /(:@. Dagline Botto& 2222222222N- Hcratc8 8ere for pri e. /(::. Dagline t8eft is a co*pli*ent.
/(:E. Dagline 9anted. 0pply 9it8in XXXXXXXXXXXXXXXXXXXXI /(E0. Daglines are irrele=ant. ;ou 9ill be assi*ilated /(E1. Daglines. D8e bu*perstic5ers of FFH'ing. /(E2. Daglines...t8e electronic Cbu*per stic5erC... /(E(. tagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagt8istaglineproducedb yp5 ip /(E). ta+ pag8 ta+be' - D8oug8t -aster 7illia* epetai-H8a5espea /(E/. Da5e a bite out of cri*e .. 0bolis8 t8e O3H /(E6. Da5e an astronaut to launc8. /(E@. Da5e care of t8e luRuries and t8e necessities 9ill ta5e care of t8e*sel=es. /(E:. Da5e e=eryt8ing in stride. Dra*ple anyone 98o gets in your 9ay. /(EE. Da5e 8eart a*id t8e deepening gloo* t8at your dog is finally getting enoug8 c8eese - Kational Ba*poon2 C4eterioradaC /)00. Da5e it easy2 9e're in a 8urry. /)01. Da5e *y 9ord for it2 t8e silliest 9o*an can *anage a cle=er *an2 but it needs a =ery cle=er 9o*an to *anage a fool. - Tipling /)02. Da5e no friends and lea=e no ene*ies. /)0(. Da5e t8e bull by t8e 8and and a=oid *iRed *etap8ors. /)0). Da5e ti*e to de=elop your personality. /)0/. Da5e ti*e to tra=elW your troubles 9ill unra=el. /)06. Da5e t9o cro9s and ca9 *e in t8e *orning. /)0@. Da5e 98at co*fort t8ere *ay be in o9ning a piece t8ereof. /)0:. Da5e your dying 9it8 so*e seriousness2 8o9e=er. Baug8ing on t8e 9ay to your eRecution is not generally understood by less ad=anced life for*s2 and t8ey'll call you cra y. - C-essia8's +andboo5& 3e*inders for t8e 0d=anced HoulC /)0E. Dal5 is c8eap. Lsing a *ode* gets eRpensi=e. /)10. Dal5 sense to a fool and 8e calls you foolis8. - .uripides /)11. Dal5 sense to a fool and 8e calls you foolis8. - .uripides /)12. Dal5 sense to a fool and 8e calls you foolis8. /)1(. Dal5ers are no good doers. - 7illia* H8a5espeare2 C+enry VOC /)1). Dal5ers are no good doers. /)1/. Dal5ing *uc8 about oneself can also be a *eans to conceal oneself. - ?riedric8 Kiet sc8e /)16. Dallula8 Fan58ead barged do9n t8e Kile last nig8t as Jleopatra and san5. /)1@. Danstaafl. /)1:. D0L3LH $0pr 20 - -ay 201 ;ou are practical and persistent. ;ou 8a=e a dogged deter*ination and 9or5 li5e 8ell. -ost people t8in5 you are stubborn and bull 8eaded. ;ou are a Jo**unist. /)1E. DaR refor* *eans C4on't taR you2 don't taR *e2 taR t8at fello9 be8ind t8e tree.C - 3ussell Bong /)20. DaRes are not le=ied for t8e benefit of t8e taRed. /)21. DaRes2 n.& ,f life's t9o certainties2 t8e only one for 98ic8 you can get an eRtension. /)22. DaRpayers don't 8a=e to ta5e a ci=il ser=ice eRa* to 9or5 for t8e go=ern*ent. /)2(. Deac8 c8ildren to be polite and courteous in t8e 8o*e2 and2 98en 8e gro9s up2 8e 9ill ne=er be able to edge 8is car onto a free9ay. /)2). Deac8ers 8a=e class. /)2/. Dea*9or5 is essential -- it allo9s you to bla*e so*eone else. /)26. Dea*9or5 is =ital $it gi=es you so*eone to bla*e.1
/)2@. Dec8nological progress 8as *erely pro=ided us 9it8 *ore efficient *eans for going bac59ards. - 0ldous +uRley /)2:. Dec8nology is do*inated by t9o types of people& D8ose 98o understand 98at t8ey do not *anage. D8ose 98o *anage 98at t8ey do not understand. - Putt's Ba9 /)2E. Ded Tennedy's Fu*per Htic5er& -y ot8er car is under9ater. /)(0. te< O sdra95caF ero- e8D o< O sdra9ro? ero- e8D /)(1. Dell *e *ore about t8ese C8abitsC. - Fe=erly /)(2. De*porary suspension of disbelief is a 9onderful t8ing. /)((. Den years of reUection slips is nature's 9ay of telling you to stop 9riting. - 3. <eis /)(). Dennis is irrele=ant. - FUorn Forg /)(/. Der*inal .*ulation - lying stiffly on your bac52 9it8 your 8ands folded across your c8est. /)(6. Dest-tube babies s8ouldn't t8ro9 stones. /)(@. Dest-tube babies s8ouldn't t8ro9 stones. /)(:. D8an5 you for obser=ing all safety precautions. /)(E. D8an5 you2 <od. Teep it up /))0. D8at is a t9o part Suestion ... /))1. D8at *ust be 9onderful O don't understand it at all. /))2. D8at 3abbit's got a =icious strea5 a *ile 9ide /))(. D8at secret you'=e been guarding2 isn't. /))). D8at t8at is is not t8at t8at is not. /))/. D8at 9as so fast2 can you s8o9 *e one *ore ti*e? - Droi /))6. D8at 98ic8 is not good for t8e s9ar*2 neit8er is it good for t8e bee. /))@. D8at 9o*an spea5s eig8t languages and can't say CnoC in any of t8e*. 4orot8y Par5er /)):. D8at's a nice dress - could O tal5 you out of it? - Pic5 up line /))E. D8at's enoug82 4ata /)/0. D8at's li5e fluffing t8e pillo9s on t8e Ditanic /)/1. D8at's not a tagline Ot's ,do - His5o /)/2. D8at's one s*all step for a *an2 one giant leap for -an5ind. - Keil 0r*strong /)/(. D8at's t8e nuttiest idea you'=e 8ad2 Jounselor. - <eordi /)/). D8at's 98at s8e said. /)//. D8e [?ord ?oundation! is a large body of *oney co*pletely surrounded by people 98o 9ant so*e. - 49ig8t -ac4onald /)/6. D8e ):6HM& Ontel's test of your gullibility /)/@. D8e ):6HM& Ontel's test of your gullibility /)/:. D8e 0bra*s' Principle& D8e s8ortest distance bet9een t9o points is off t8e 9all. /)/E. D8e abuse of greatness is 98en it disUoins re*orse fro* po9er. /)60. D8e ad=erb al9ays follo9s t8e =erb. /)61. D8e ad=ertise*ent is t8e *ost trut8ful part of a ne9spaper - D8o*as >efferson /)62. D8e agony of delete. /)6(. D8e 0*erican people 9ould not 9ant to 5no9 of any *isSuotes t8at 4an Vuayle *ay or *ay not *a5e. - Vice President 4an Vuayle /)6). D8e a*ount of 9or5 done =aries in=ersely 9it8 t8e ti*e spent in t8e office. /)6/. D8e ans9er *y friend2 is blo9ing in t8e 9ind. - Fob 4ylan /)66. D+. 03-; 0MO,-& 0ny order t8at can be *isunderstood 8as been *isunderstood.
/)6@. D8e 0r*y 8as carried t8e 0*erican ... ideal to its logical conclusion. Kot only do t8ey pro8ibit discri*ination on t8e grounds of race2 creed and color2 but also on ability. - D. Be8rer /)6:. D8e 0r*y needs leaders t8e 9ay a foot needs a big toe. - Fill -urray /)6E. D8e attac5er *ust =anSuis8W t8e defender need only sur=i=e. /)@0. D8e attention span of a co*puter is only as long as its po9er cord. /)@1. D8e a=erage 9o*an 9ould rat8er 8a=e beauty t8an brains2 because t8e a=erage *an can see better t8an 8e can t8in5. /)@2. D8e basis of a de*ocratic state is liberty. - 0ristotle /)@(. D8e basis of opti*is* is s8eer terror. /)@). D8e best boo5 on progra**ing for t8e lay*an is C0lice in 7onderlandCW but t8at's because it's t8e best boo5 on anyt8ing for t8e lay*an. /)@/. D8e best cure for inso*nia is to get a lot of sleep. - 7. J. ?ields /)@6. D8e best defense against logic is ignorance. /)@@. D8e best defense is to stay out of range. /)@:. D8e best prop8et of t8e future is t8e past. /)@E. D8e best t8ing about gro9ing older is t8at it ta5es suc8 a long ti*e. /):0. D8e best t8ings in life are for a fee. /):1. D8e best 9ay to accelerate 7indo9s is at escape =elocity. /):2. D8e best 9ay to 5eep your friends is not to gi=e t8e* a9ay. /):(. D8e better part of =alor is discretion. /):). D8e bigger t8e t8eory2 t8e better. /):/. D8e biggest difference bet9een ti*e and space is t8at you can't reuse ti*e. -erric5 ?urst /):6. D8e birds are singing2 t8e flo9ers are budding2 and it is ti*e for -iss -anners to tell young lo=ers to stop nec5ing in public. /):@. D8e Forg are co*ing Vuic5 Dry and loo5 useless /)::. D8e Foy Hcouts 8a=e adult leaders8ip. D8e 0ir ?orce doesn't. /):E. D8e Foy Hcouts 8a=e adult leaders8ip. D8e 0r*y doesn't. /)E0. D8e Foy Hcouts 8a=e adult leaders8ip. D8e Joast <uard doesn't. /)E1. D8e Foy Hcouts 8a=e adult leaders8ip. D8e -arines don't. /)E2. D8e Foy Hcouts 8a=e adult leaders8ip. D8e Ka=y doesn't. /)E(. D8e Fo os are co*ing. /)E). D8e brain is a 9onderful organW it starts 9or5ing t8e *o*ent you get up2 and doesn't stop until you get to 9or5. /)E/. D8e brain is a 9onderful organW it starts 9or5ing t8e *o*ent you get up in t8e *orning2 and does not stop until you get to sc8ool. /)E6. D8e brain 9or5s fro* t8e *o*ent of birt8 until you stand up to spea5 in public. /)E@. D8e Friggs[J8ase Ba9 of Progra* 4e=elop*ent& Do deter*ine 8o9 long it 9ill ta5e to 9rite and debug a progra*2 ta5e your best esti*ate2 *ultiply t8at by t9o2 add one2 and con=ert to t8e neRt 8ig8er units. /)E:. D8e buc5 doesn't e=en slo9 do9n 8ere. /)EE. D+. J034OK0B J,KLK43L-& 0n opti*ist belie=es 9e li=e in t8e best of all possible 9orlds. 0 pessi*ist fears t8is is true. //00. D8e cart 8as no place 98ere a fift8 98eel could be used. //01. D8e c8ance of forgetting so*et8ing is directly proportional to ..... to ........ u8 .............. - +ure9it 's -e*ory Principle //02. D8e c8ic5en t8at cluc5s t8e loudest is t8e one *ost li5ely to s8o9 up at t8e stea* fitters' picnic.
//0(. D8e c8ief cause of proble*s is solutions. //0). D8e coast 9as clear. //0/. D8e co*pany of Uust and rig8teous *en is best. - .uripides //06. D8e Jo*puter is i*pressed 9it8 4ata's 8ard9are. //0@. D8e co*puting field is al9ays in need of ne9 clic8es. - 0lan Perlis //0:. D8e cost of feat8ers 8as risen. Ko9 e=en do9n is up. //0E. D8e cost of feat8ers 8as risen.... no9 e=en do9n is up //10. D8e cost of liberty is less t8an t8e price of oppression. //11. D8e cost of li=ing 8asn't affected its popularity. //12. D8e cost of li=ing is going up2 and t8e c8ance of li=ing is going do9n. //1(. D8e Jounselor and O 9ill be indisposed today. - 3i5er //1). D8e Jourse of Progress& -ost t8ings get steadily 9orse. D8e Pat8 of Progress& 0 s8ortcut is t8e longest distance bet9een t9o points. - Ossa9i's Ba9s of Progress& //1/. D8e co9 is not8ing but a *ac8ine 9it8 *a5es grass fit for us people to eat. >o8n -cKulty //16. D8e creation of a t8ousand forests is in one acorn. - 3alp8 7aldo .*erson //1@. D8e Jro9n is full of it Kate +arris2 1@@/ //1:. D8e current deat8 rate? ,ne per person2 of course. //1E. D8e day-to-day tra=ails of t8e OF- progra**er are so a*using to *ost of us 98o are fortunate enoug8 ne=er to 8a=e been one -- li5e 9atc8ing J8arlie J8aplin trying to coo5 a s8oe. //20. D8e days Uust before *arriage are li5e a snappy introduction to a tedious boo5. //21. D8e days of t8e digital 9atc8 are nu*bered //22. D8e 4ead H8all 7al5 t8e .art8 and 4ine on ?les8 //2(. D8e debate rages on& Os PB[O Fac8trian or 4ro*edary? //2). D8e decision doesn't 8a=e to be logical2 it 9as unani*ous. //2/. D8e 4en=er Foot is so called because 98en it is in use your car *ig8t as 9ell be in 4en=er for all t8e use it is in getting you do9n to t8e Bocal. //26. D8e descent to +ades is t8e sa*e fro* e=ery place. //2@. D8e de=il finds 9or5 for idle circuits to do. //2:. D8e die is cast. - $pro=erb Suoted by >ulius Jaesar1. //2E. D8e die is cast. //(0. D8e difference bet9een *eat and fis8 is t8at if you beat your fis8 it dies. //(1. D8e difference bet9een science and t8e fu y subUects is t8at science reSuires reasoning 98ile t8ose ot8er subUects *erely reSuire sc8olars8ip. - 3obert +einlein //(2. D8e difficult 9e do todayW t8e i*possible ta5es a little longer. //((. D8e dis5s are getting fullW purge a file today. //(). D8e door is t8e 5ey. //(/. D8e early 9or* gets t8e bird. //(6. D8e eart8 is li5e a tiny grain of sand2 only *uc82 *uc8 8ea=ier. //(@. D8e eart8 is li5e a tiny grain of sand2 only *uc82 *uc8 8ea=ier. //(:. D8e .lectric J8air J8oice& 3egular or .Rtra Jrispy? //(E. D8e .K4 $and *ore t8an you 9anted to 5no91 //)0. D8e end is near... but 9ait for t8e seSuel //)1. D8e end of labor is to gain leisure. //)2. D8e end of t8e 9orld 9ill occur at (&00 p.*.2 t8is ?riday2 9it8 sy*posiu* to follo9. //)(. D8e .nglis8 8a=e no respect for t8eir language2 and 9ill not teac8 t8eir c8ildren to spea5 it. - <. F. H8a9 //)). D8e e=idence before t8e court is incontro=ertible...
//)/. D+. .MD.K4.4 -L3P+;'H B07& Of a series of e=ents can go 9rong2 it 9ill do so in t8e 9orst possible seSuence. //)6. D8e ?1 5ey is t8e 5ey *ar5ed ?1. //)@. D8e fact t8at it 9or5s is i**aterial. - B. ,gborn //):. D8e fa*ous politician 9as trying to sa=e bot8 8is faces. //)E. D8e fas8ion 9ears out *ore apparel t8an t8e *an. ///0. D8e feature 98ic8 you clai* to 8a=e disco=ered in LniR is al*ost certainly due to an act of <od& 98y don't you read t8e docu*entation? ///1. D8e feature 98ic8 you clai* to 8a=e disco=ered in LniR is al*ost certainly due to s8eer inco*petence& go a9ay ///2. D8e fe9er t8e facts2 t8e stronger t8e opinion. ///(. D8e ?ift8 3ule& ;ou 8a=e ta5en yourself too seriously. ///). D8e finest eloSuence is t8at 98ic8 gets t8ings done. ////. D8e first duty of a re=olutionary is to get a9ay 9it8 it. - 0bbie +off*an ///6. D8e first *an 98o co*pared a 9o*an to a flo9er 9as a poet2 t8e second an i*becile. ///@. D8e first *yt8 of *anage*ent is t8at it eRists. ///:. D8e first *yt8 of *anage*ent is t8at it eRists. ///E. D8e ?irst 3ule of Progra* ,pti*i ation& 4on't do it. D8e Hecond 3ule of Progra* ,pti*i ation $for eRperts only1& 4on't do it yet. - -ic8ael >ac5son //60. D8e first t8ing O do in t8e *orning is brus8 *y teet8 and s8arpen *y tongue. //61. D8e first t9o days of =acation are endless2 t8en it flies. //62. D8e follo9ing state*ent is not true& //6(. D8e fortune progra* is supported2 in part2 by user contributions and by a *aUor grant fro* t8e Kational .ndo9*ent for t8e Onanities. //6). D8e freedo* of poetic license. - Jicero $)( FJ1 //6/. D8e future belongs to t8ose 98o belie=e in t8e beauty of t8eir drea*s. .leanor 3oose=elt //66. D8e future is a *yt8 created by insurance sales*en and 8ig8 sc8ool counselors. //6@. D8e future is brig8t in affairs of t8e 8eart. //6:. D8e future is li5e t8e present2 only longer. //6E. D8e future is not 98at it used to be. $Ot ne=er 9as.1 //@0. D8e future isn't 98at it used to be. //@1. D8e future lies a8ead. //@2. D+. <.K.30B B07& D8e c8aos in t8e uni=erse al9ays increases. //@(. D8e generation of rando* nu*bers is too i*portant to be left to c8ance. //@). D8e gent 98o 9a5es up and finds 8i*self a success 8asn't been asleep. //@/. D8e gentle*en loo5ed one anot8er o=er 9it8 *icroscopic carelessness. //@6. D8e geograp8ical center of Foston is in 3oRbury. 4ue nort8 of t8e center 9e find t8e Hout8 .nd. D8is is not to be confused 9it8 Hout8 Foston 98ic8 lies directly east fro* t8e Hout8 .nd. Kort8 of t8e Hout8 .nd is .ast Foston and sout89est of .ast Foston is t8e Kort8 .nd. //@@. D8e goal of Jo*puter Hcience is to build so*et8ing t8at 9ill last at least until 9e'=e finis8ed building it. //@:. D8e goal of Jo*puter Hcience is to build so*et8ing t8at 9ill last at least until 9e'=e finis8ed building it. //@E. D8e goal of science is to build better *ousetraps. D8e goal of nature is to build better *ice. //:0. D8e gods ga=e *an fire and 8e in=ented fire engines. D8ey ga=e 8i* lo=e and 8e in=ented *arriage.
//:1. D+. <,B4.K 3LB. ,? 03DH 0K4 HJO.KJ.H D8e one 98o 8as t8e gold *a5es t8e rules. //:2. D+. <,B4.K 3LB.& 78oe=er 8as t8e gold *a5es t8e rules. //:(. D8e good 8a=e no need of an ad=ocate. - P8ocion $(1@ FJ1 //:). D8e grass is al9ays greener on t8e ot8er side of your sunglasses. //:/. D8e great *an is 8e 98o does not lose 8is c8ild's-8eart. //:6. D8e greatest griefs are t8ose 9e cause oursel=es. //:@. D8e greatest of faults is to be conscious of none. //::. D8e greatest re*edy for anger is delay. //:E. D+. <3..K D+L-F B07& D8e life of a 8ouse plant =aries in=ersely 9it8 its price and directly 9it8 its ugliness. //E0. D8e guy sure loo5s li5e plant food to *e //E1. D8e 8and t8at 5indles cannot Suenc8 t8e fla*e. //E2. D8e 8ardest t8ing in t8e 9orld to understand is t8e inco*e taR. - 0lbert .instein //E(. D8e 8earing ear is al9ays found close to t8e spea5ing tongue2 a custo* 98ereof t8e *e*ory of *an runnet8 not 8o9so*e=er to t8e contrary2 no8o9. //E). D8e 8eart is 9iser t8an t8e intellect... //E/. D8e 8eart is 9iser t8an t8e intellect. //E6. D8e +eine5en Lncertainty Principle& ;ou can ne=er be sure 8o9 *any beers you 8ad last nig8t. //E@. D8e 8ell 9it8 t8e pri*e directi=e2 let's 5ill so*et8ing. //E:. D8e 8erd instinct a*ong econo*ists *a5es s8eep loo5 li5e independent t8in5ers. //EE. D8e 8ig8est bidder catc8es t8e *ost politicians. /600. D8e 8ig8est re9ard for a person's toil is not 98at t8ey get for it2 but 98at t8ey beco*e by it. - >o8n 3us5in /601. D8e +olocaust 9as an obscene period in our nation's 8istory. - Vice President 4an Vuayle /602. D8e 8oly passion of ?riends8ip is of so s9eet and steady and loyal and enduring a nature t8at it 9ill last t8roug8 a 98ole lifeti*e2 if not as5ed to lend *oney. /60(. D8e 8oney*oon is t8at s8ort period of doting bet9een dating and debting. /60). D8e 8ostage? ;es2 9e're trying to get a p8one fitted. /60/. D8e 8u*an ani*al differs fro* t8e lesser pri*ates in 8is passion for lists of CDen FestC. - +. 0llen H*it8 /606. D8e 8u*an *ind ordinarily operates at only ten percent of its capacity -- t8e rest is o=er8ead for t8e operating syste*. /60@. D8e 8u*an *ind treats a ne9 idea t8e 9ay t8e body treats a strange protein -it reUects it. - P. -eda9ar /60:. D8e 8u*an race 8as one really effecti=e 9eapon2 and t8at is laug8ter. /60E. D8e 8u*an race 8as one really effecti=e 9eapon2 and t8at is laug8ter. - -ar5 D9ain /610. D8e Odes of -arc8 8a=e co*e. - >ulius Jaesar /611. D8e idle *ind 5no9s not 98at it is it 9ants. /612. D8e i**oratal 9ords of Hocrates -- CO dran5 98at?C /61(. D8e i*portant t8ing is not to stop Suestioning. /61). D8e indi=idual c8oice of garnis8*ent of a burger can be an i*portant point to t8e consu*er in t8is day 98en indi=idualis* is an increasingly i*portant t8ing to people. - 4onald K. H*it82 president of Furger Ting /61/. D8e in5 9it8 98ic8 all 8istory is 9ritten is *erely fluid preUudice.
/616. D8e OV of t8e group is t8e lo9est OV of a *e*ber of t8e group di=ided by t8e nu*ber of people in t8e group. /61@. D8e irony of life is t8at no one gets out ali=e... /61:. D8e irony of life is t8at no one gets out ali=e /61E. D8e Osla*ic -usical2 CHe=en Frides for ,ne Frot8erC /620. D8e Tennedy Jonstant& 4on't get *ad -- get e=en. /621. D8e Tiller 4uc5s are co*ing /622. D8e 5nac5 of flying is learning 8o9 to t8ro9 yourself at t8e ground and *iss. +itc88i5ers <uide to t8e <alaRy /62(. D8e 5nac5 of flying2 is learning 8o9 to t8ro9 yourself at t8e ground and *iss. +itc8 +i5er's guide /62). D8e ladies *en ad*ire2 O'=e 8eard2 7ould s8udder at a 9ic5ed 9ord. D8eir candle gi=es a single lig8tW D8ey'd rat8er stay at 8o*e at nig8t. D8ey do not 5eep a9a5e till t8ree2 Kor read erotic poetry. D8ey ne=er sanction t8e i*pure2 Kor recogni e an o=erture. D8ey s8rin5 fro* po9ders and fro* paints ... Ho far2 O'=e 8ad no co*plaints. - 4orot8y Par5er /62/. D8e last person 98o said t8at2 <od rest 8is soul2 li=ed to regret it. /626. D8e last t8ing .ngland 9ant to do no9 is let a goal in. /62@. D8e last =estiges of t8e old 3epublic 8a=e been s9ept a9ay. /62:. D8e Ba9 is your friend..but 9atc8 out for t8e Ba9yers. /62E. D8e Ba92 in its *aUestic eSuality2 forbids t8e ric82 as 9ell as t8e poor2 to sleep under t8e bridges2 to beg in t8e streets2 and to steal bread. - 0natole ?rance /6(0. D8e life 98ic8 is uneRa*ined is not 9ort8 li=ing. /6(1. D8e lig8t at t8e end of t8e tunnel is t8e 8eadlig8t of an approac8ing train. /6(2. D8e lig8t of a 8undred stars does not eSual t8e lig8t of t8e *oon. /6((. D8e lion and t8e calf s8all lie do9n toget8er but t8e calf 9on't get *uc8 sleep. - 7oody 0llen /6(). D8e longer O a* out of office2 t8e *ore infallible O appear to *yself. - +enry Tissinger /6(/. D8e longest part of t8e Uourney is said to be t8e passing of t8e gate. /6(6. D8e loss of life 9ill be irreplaceable. - Vice President 4an Vuayle /6(@. D8e luc5 t8at is ordained for you 9ill be co=eted by ot8ers. /6(:. D8e *agic of 7indo e& Durning your ):6 into an MD. /6(E. D8e *aUority isn't silent- t8e go=ern*ent is deaf /6)0. D8e *an 98o does not read good boo5s 8as no ad=antage o=er t8e *an 98o can't read t8e*. - -ar5 D9ain /6)1. D8e *an 98o follo9s t8e cro9d 9ill usually get no furt8er t8an t8e cro9d. D8e *an 98o 9al5s alone is li5ely to find 8i*self in places no one 8as e=er been. - 0lan 0s8ley-Pitt /6)2. D8e *an 98o 8as ne=er been flogged 8as ne=er been taug8t. /6)(. D8e *an 98o *a5es no *ista5es does not usually *a5e anyt8ing. /6)). D8e *an 98o raises a fist 8as run out of ideas. /6)/. D8e *an 98o runs *ay fig8t again. /6)6. D8e *an 98o s*iles 98en t8ings go 9rong 8as t8oug8t of so*eone to bla*e it on. /6)@. D8e *ar=els of today's *odern tec8nology include t8e de=elop*ent of a soda can2 98en discarded 9ill last fore=er ... and a $@2000 car 98ic8 98en properly cared for 9ill rust out in t9o or t8ree years. /6):. D8e *ee5 s8all in8erit t8e eart8 -- t8ey are too 9ea5 to refuse. /6)E. D8e *ee5 s8all in8erit t8e .art8 after 9e're done 9it8 it.
/6/0. D8e *ee5 s8all in8erit t8e eart8. D8ey are too 9ea5 to refuse. /6/1. D8e *inute a *an is con=inced t8at 8e is interesting2 8e isn't. /6/2. D8e *oon is *ade of a green c8eese. - >.+ey9ood $1)E@-1/:01 /6/(. D8e *oon is *ade of green c8eese. /6/). D8e *oon *ay be s*aller t8an .art82 but it's furt8er a9ay. /6//. D8e *ore O 5no9 about 7OK4,7H2 t8e *ore O li5e 4esSVie9 /6/6. D8e *ore la9s and order are *ade pro*inent2 t8e *ore t8ie=es and robbers t8ere 9ill be. - Bao Dsu /6/@. D8e *ore people tal5 on t8e p8one2 t8e less *oney t8ey *a5e. - , *an's Ba9 /6/:. D8e *ore t8e *errier. /6/E. D8e *ore t8ings c8ange2 t8e *ore t8ey stay insane. /660. D8e *ore t8ings c8ange2 t8e *ore t8ey'll ne=er be t8e sa*e again. /661. D8e *ore 9e disagree2 t8e *ore c8ance t8ere is t8at at least one of us is rig8t. /662. D8e *ore you culti=ate people t8e *ore you turn up clods. /66(. D8e *osSuito is t8e state bird of Ke9 >ersey. - 0ndy 7ar8ol /66). D8e *ost beautiful t8ing 9e can eRperience is t8e *ysterious. Ot is t8e source of all true art and science. - 0lbert .instein /66/. D8e *ost dangerous person in t8e 9orld is an idealogue 9it8 a *ac8ine gun. /666. D8e *ost eRciting p8rase to 8ear in science2 t8e one t8at 8eralds ne9 disco=eries2 is not C.ure5aC $O found it1 but CD8at's funny ...C - Osaac 0si*o= /66@. D8e *ost 8ar*ful error 8as not yet been disco=ered in your progra*. /66:. D8e *ost 8opelessly stupid *an is 8e 98o is not a9are t8at 8e is 9ise. /66E. D8e *o=ing cat s8eds2 and 8a=ing s8ed2 *o=es on... /6@0. D8e *o=ing cursor 9rites2 and 8a=ing 9ritten2 blin5s on. /6@1. D8e na5ed trut8 of it is2 O 8a=e no s8irt. /6@2. D8e Kational H8ort-Hlee=ed H8irt 0ssociation says& Hupport your rig8t to bare ar*s /6@(. D8e ne9 Jongress*en say t8ey're going to turn t8e go=ern*ent around. O 8ope O don't get run o=er again. /6@). D8e neRt siR days are dangerous. /6@/. D8e nice t8ing about standards is t8at t8ere are so *any of t8e* to c8oose fro*. - 0ndre9 H. Danenbau* /6@6. D8e nice t8ing about standards is t8at t8ere are so *any of t8e* to c8oose fro*. - 0ndre9 H. Danenbau* /6@@. D8e no-*ind not-t8in5s no-t8oug8ts about no-t8ings. /6@:. D8e notion of a CrecordC is an obsolete re*nant of t8e days of t8e :0-colu*n card. - 4ennis -. 3itc8ie /6@E. D8e notion of a CrecordC is an obsolete re*nant of t8e days of t8e :0-colu*n card. - 4ennis -. 3itc8ie /6:0. D8e nu*ber of people in any 9or5ing group tends to increase regardless of t8e a*ount of 9or5 to be done. - Par5inson's ?ourt8 Ba9 /6:1. D8e nu*ber of people 9atc8ing you is directly proportional to t8e stupidity of your action. /6:2. D8e nu*ber you call fro* 8as been disconnected. /6:(. D8e ob=ious ans9er is al9ays o=erloo5ed. /6:). D8e occipital area of *y 8ead see*s to 8a=e i*pacted... /6:/. D8e old gun-in-t8e-T0,H-agent's-sp8incter tric5. D8at's t8e second ti*e O'=e fallen for t8at t8is *ont8. - -aR9ell H*art /6:6. D8e older a *an gets2 t8e fart8er 8e 8ad to 9al5 to sc8ool as a boy.
/6:@. D8e one good t8ing about repeating your *ista5es is t8at you 5no9 98en to cringe. /6::. D8e only difference bet9een a rut and a gra=e is t8eir di*ensions. /6:E. D8e only good -ac is a big -ac /6E0. D8e only possible interpretation of any researc8 98ate=er in t8e Ysocial sciences' is& so*e do2 so*e don't. - .rnest 3ut8erford /6E1. D8e only proble* 9it8 being a *an of leisure is t8at you can ne=er stop and ta5e a rest. /6E2. D8e only proble* 9it8 being a *an of leisure is t8at you can ne=er stop and ta5e a rest. /6E(. D8e only race 9ort8 9inning is t8e 8u*an race. /6E). D8e only rose 9it8out t8orns is friends8ip. /6E/. D8e only t8ing constant is c8ange. /6E6. D8e only t8ing funnier t8an 8o9 t8ings don't 9or5 out2 is 8o9 t8ey do. /6E@. D8e only t8ing s8orter t8an a 9ee5end is a =acation. /6E:. D8e only t8ing t8at endures is c8ange. /6EE. D8e only t8ing to do 9it8 good ad=ice is pass it on. Ot is ne=er any use to oneself. - ,scar 7ilde /@00. D8e only t8ing 9orse t8an being tal5ed about is not being tal5ed about. /@01. D8e only t8ing 9rong 9it8 doing not8ing is t8at you ne=er 5no9 98en you're done /@02. D8e only 9ay to a*use so*e people is to slip and fall on an icy pa=e*ent. /@0(. D8e only 9ay to be good at e=eryt8ing you do is to only do t8e t8ings you are good at. /@0). D8e only 9ay to disco=er t8e li*its of t8e possible is to go beyond t8e* into t8e i*possible. /@0/. D8e only 9ay to get rid of a te*ptation is to yield to it. - ,scar 7ilde /@06. D8e only 9ay to get rid of a te*ptation is to yield to it. - ,scar 7ilde /@0@. D8e only 9ay to get rid of te*ptation is to yield to it. /@0:. D8e opposite of a profound trut8 *ay 9ell be anot8er profound trut8. - Keils Fo8r /@0E. D8e opposite of a profound trut8 *ay 9ell be anot8er profound trut8. - Fo8r /@10. D8e opti*u* co**ittee 8as no *e*bers. - Kor*an 0ugustine /@11. D8e ot8er line *o=es faster. /@12. D8e Pace of Progress& Hociety is a *ule2 not a car...if pressed too 8ard2 it 9ill t8ro9 off its rider. /@1(. D8e past al9ays loo5s better t8an it 9as. Ot's only pleasant because it isn't 8ere. /@1). D8e past al9ays loo5s better t8an it 9as. Ot's only pleasant because it isn't 8ere. - ?inley Peter 4unne $-r. 4ooley1 /@1/. D8e past s8ould be a springboard2 not a 8a**oc5. /@16. D8e pen is *ig8tier t8an t8e pencil. /@1@. D8e pen is t8e tongue of t8e *ind. /@1:. D8e perfect guest is one 98o *a5es 8is 8ost feel at 8o*e. /@1E. D8e perfect secretary is one 98o types fast and runs slo9. /@20. D8e person 98o is all 9rapped up in 8i*self is o=erdressed. /@21. D8e person you reUected yesterday could *a5e you 8appy2 if you say yes. /@22. D+. P.D P3OKJOPB.& Ko *atter 98ic8 side of t8e door t8e cat or dog is on2 it's t8e 9rong side. /@2(. D8e Pig2 if O a* not *ista5en2 <i=es us 8a* and por5 and Facon. Bet ot8ers t8in5 8is 8eart is big2 O t8in5 it stupid of t8e Pig. - ,gden Kas8
/@2). D8e plural of spouse is spice. /@2/. D8e possu* is a =ery sop8isticated ani*al. Ot doesn't e=en get up until / or 6 p*. /@26. D8e Preac8er2 t8e Politicain2 t8e Deac8er2 7ere eac8 of t8e* once a 5iddie. 0 c8ild2 indeed2 is a 9onderful creature. 4o O 9ant one? <od ?orbiddie - ,gden Kas8 /@2@. D8e price of greatness is responsibility. /@2:. D8e price of purity is purists. /@2E. D8e probability of so*eone 9atc8ing you is proportional to t8e stupidity of your action. /@(0. D8e proble* 9it8 any un9ritten la9 is t8at you don't 5no9 98ere to go to erase it. - <laser and 7ay /@(1. D8e proble* 9it8 people 98o 8a=e no =ices is t8at generally you can be pretty sure t8ey're going to 8a=e so*e pretty annoying =irtues. - - .li abet8 Daylor /@(2. D8e proble* 9it8 t8e gene pool is t8at t8ere is no lifeguard. /@((. D8e proble* 9it8 t8e gene pool is t8at t8ere is no lifeguard. /@(). D8e progra* is absolutely rig8tW t8erefore t8e co*puter *ust be 9rong. /@(/. D+. P3,<30--.3H' J+..3? -- H+O?D D, D+. B.?D2 H+O?D D, D+. 3O<+D P,P LP2 PLH+ 4,7K2 F;D.2 F;D.2 F;D. /@(6. D8e proof of a syste*'s =alue is its eRistence. /@(@. D8e proof of t8e pudding is in t8e eating. /@(:. D8e Vuar5 bo*b2 for*erly t8e >o8nny Jyclops bo*b2 after t8e President of t8e sa*e na*e... - 78oops 0pocalypse /@(E. D8e rain it rainet8 on t8e Uust 0nd also on t8e unUust fella2 Fut c8iefly on t8e Uust2 because D8e unUust steals t8e Uust's u*brella. /@)0. D8e 3anger isn't gonna li5e it2 ;ogi. /@)1. D8e reason co*puter c8ips are so s*all is co*puters don't eat *uc8. /@)2. D8e reasonable *an adapts 8i*self to t8e 9orldW t8e unreasonable one persists in trying to adapt t8e 9orld to 8i*self. D8erefore all progress depends on t8e unreasonable *an. - <eorge Fernard H8a9 /@)(. D8e re=olution 9ill not be tele=ised. /@)). D8e re9ard of a t8ing 9ell done is to 8a=e done it. - .*erson /@)/. D8e re9ard of a t8ing 9ell done is to 8a=e done it. - 3alp8 7aldo .*erson /@)6. D8e ric8 get ric82 and t8e poor get poorer. D8e 8a=es get *ore2 t8e 8a=e-nots die. /@)@. D8e rig8t 8alf of t8e brain controls t8e left 8alf of t8e body. D8is *eans t8at only left 8anded people are in t8eir rig8t *ind. /@):. D8e ripest fruit falls first. /@)E. D8e road to +ades is easy to tra=el. /@/0. D8e road to 8ell is pa=ed 9it8 K0K4 gates. /@/1. D8e road to success is under construction... /@/2. D8e road to success2 is al9ays under construction. /@/(. D8e 3o*an 3ule& D8e one 98o says it cannot be done s8ould ne=er interrupt t8e one 98o is doing it. /@/). D8e secret to success is sincerity. ,nce you can fa5e t8at2 you'=e got it *ade. /@//. D8e s8eer Uoy of li=ing is 9onderful. /@/6. D8e s8ifts of ?ortune test t8e reliability of friends. /@/@. D8e s8ortest distance bet9een t9o points is under construction. - Koelie 0ltito /@/:. D8e s8ortest distance bet9een t9o points is usually under construction. /@/E. D8e s8o9 ain't o=er 'till t8e fat lady sings.
/@60. D8e si e of a *ega byte of storage depends on 98et8er you are entering data or 9riting a progra* to fit in it. /@61. D8e s*allest 9or* 9ill turn being trodden on. /@62. D8e s*o5er you drin52 t8e player you get. /@6(. D8e solution to a proble* c8anges t8e nature of t8e proble*. /@6). D8e sooner you fall be8ind2 t8e *ore ti*e you 8a=e to catc8 up. /@6/. D8e soul 9ould 8a=e no rainbo9 8ad t8e eyes no tears. /@66. D8e star of ric8es is s8ining upon you. /@6@. D8e steady state of dis5s is full. - Ten D8o*pson /@6:. D8e Hun is at t8e center of t8e Lni=erse. - Jopernicus /@6E. D8e sun 9as s8ining on t8e sea2 H8ining 9it8 all 8is *ig8t& +e did 8is =ery best to *a5e D8e billo9s s*oot8 and brig8t -- 0nd t8is 9as =ery odd2 because it 9as D8e *iddle of t8e nig8t. - Be9is Jarroll2 CD8roug8 t8e Boo5ing <lassC /@@0. D8e superfluous is =ery necessary. - Voltaire /@@1. D8e surest 9ay to be late is to 8a=e plenty of ti*e. /@@2. D8e telep8one 9ill ring 98en you are outside t8e door fu*bling for your 5eys. /@@(. D+. D+.,3.- D+.,3.-& Of if2 t8en t8en. /@@). D8e D8ird Ba9 of P8otograp8y& Of you did *anage to get any good s8ots2 t8ey 9ill be ruined 98en so*eone inad=ertently opens t8e dar5roo* door and all of t8e dar5 lea5s out. /@@/. D8e t8oug8tless are rarely 9ordless. /@@6. D8e t8ree la9s of t8er*odyna*ics& D8e ?irst Ba9& ;ou can't get anyt8ing 9it8out 9or5ing for it. D8e Hecond Ba9& D8e *ost you can acco*plis8 by 9or5ing is to brea5 e=en. D8e D8ird Ba9& ;ou can only brea5 e=en at absolute ero. /@@@. D8e t8ree *ost pu ling Suestions are& 11 78y are 9e born? 21 78y do 9e die? (1 78y do 9e spend so *uc8 of t8e inter=ening ti*e 9earing digital 9atc8es? /@@:. D8e tigers of 9rat8 are 9iser t8an t8e 8orses of instruction. /@@E. D8e ti*e is rig8t to *a5e ne9 friends. /@:0. D8e torture ne=er stops. /@:1. D8e Dree of Bearning bears t8e noblest fruit2 but noble fruit tastes bad. /@:2. D8e tric5 in o=erco*ing te*ptation2 is to play dead. /@:(. D8e trouble 9it8 a 5itten is t8at 78en it gro9s up2 it's al9ays a cat - ,gden Kas8. /@:). D8e trouble 9it8 being poor is t8at it ta5es up all your ti*e. /@:/. D8e trouble 9it8 being punctual is t8at people t8in5 you 8a=e not8ing *ore i*portant to do. /@:6. D8e trouble 9it8 being punctual is t8at people t8in5 you 8a=e not8ing *ore i*portant to do. /@:@. D8e trouble 9it8 doing so*et8ing rig8t t8e first ti*e is t8at nobody appreciates 8o9 difficult it 9as. /@::. D8e trut8 of a proposition 8as not8ing to do 9it8 its credibility. 0nd =ice =ersa. /@:E. D8e turtle li=es 't9iRt plated dec5s 78ic8 practically conceal its seR. O t8in5 it cle=er of t8e turtle On suc8 a fiR to be so fertile. - ,gden Kas8 /@E0. D8e t9o great tragedies in life& not getting 98at one 9ants and getting it. /@E1. D8e type9riting *ac8ine2 98en played 9it8 eRpression2 is no *ore annoying t8an t8e piano 98en played by a sister or near relation. - ,scar 7ilde /@E2. D8e L03Ds can't ta5e *uc8 *ore o' t8is Japtain /@E(. D8e ulti*ate Durn on. 78en t8ey s8oot at you.. and *iss /@E). D+. LK0PPBOJ0FB. B07& 7as8ing your car to *a5e it rain doesn't 9or5. /@E/. D8e uneRa*ined life is not 9ort8 li=ing. - Hocrates
/@E6. D8e uni=erse is all a spinoff of t8e Fig Fang. /@E@. D8e uni=erse is laug8ing be8ind your bac5. /@E:. D8e uni=erse is laug8ing be8ind your bac5 /@EE. D8e LH 8as a =ital interest in t8at area of t8e country. - 4an Vuayle referring to Batin 0*erica. /:00. D8e use of J,F,B cripples t8e *indW its teac8ing s8ould2 t8erefore2 be regarded as a cri*inal offense. - .. 7. 4iU5stra /:01. D8e LHH 3eagan -- CDo boldly ... u* ... O forget...C /:02. D8e V0M 9as de=eloped by 4.J. 4etractors assert it's a 9rec5. Per5in-.l*er and Pri*e 0re still biding t8eir ti*e2 +oping so*eone 9ill buy fro* t8e* yet. /:0(. D8e =ery re*e*brance of *y for*er *isfortune pro=es a ne9 one to *e. /:0). D+. 70D.3<0D. P3OKJOPB.& <o=ern*ent corruption 9ill al9ays be reported in t8e past tense. /:0/. D8e 9ay to a *an's 8eart is t8roug8 t8e left =entricle. /:06. D8e 9ay to lo=e anyt8ing is to reali e t8at it *ig8t be lost. /:0@. D8e 9eat8er is 8ere. 7is8 you 9ere beautiful. - Fu*per stic5er /:0:. D8e 9eed of cri*e bears bitter fruit. /:0E. D8e 98ole 9orld is a tuRedo and you are a pair of bro9n s8oes. /:10. D8e 9ise s8ep8erd ne=er trusts 8is floc5 to a s*iling 9olf. /:11. D8e 9ord today is Begs ... Hpread t8e 9ord. /:12. D8e 9orld is a stage2 but t8e play is badly cast. /:1(. D8e 9orld is co*ing to an end 3epent and return t8ose library boo5s /:1). D8e 9orld is co*ing to an end. Please log off. /:1/. D8e 9orld is co*ing to an end... H0V. ;,L3 FL??.3H /:16. D8e 9orld isn't 9orse. Ot's Uust t8at t8e ne9s co=erage is so *uc8 better. /:1@. D8e 9orld 9ants to be decei=ed. /:1:. D8e 9orld's as ugly as sin2 0nd al*ost as delig8tful - ?rederic5 Boc5erBa*pson /:1E. D8e 7orld& 0 co*edy for t8in5ersW a tragedy for feelers. /:20. D8e 9orst day fis8ing is better t8an t8e best day 9or5ing. - Fu*per stic5er /:21. D8e 9orst for* of failure is t8e failure to try. /:22. D8e 9orst t8ing about censors8ip is [[[[[[[[[[. /:2(. D8e years of pea5 *ental acti=ity are undoubtedly bet9een t8e ages of four and eig8teen. 0t four 9e 5no9 all t8e Suestions2 at eig8teen all t8e ans9ers. /:2). D8e young 9is8 to gi=e t8eir elders t8e full benefits of t8eir ineRperience. /:2/. D8eir are tr8ee t8ings 9rong 8ere. /:26. D8e* t8at 8as2 gets. /:2@. D8en a *an said& Hpea5 to us of .Rpectations. /:2:. D8en you *ust be 4on ?rancisco's sister /:2E. D8ere ain't no suc8 t8ing as a free lunc8. /:(0. D8ere are fe9 people *ore often in t8e 9rong t8an t8ose 98o cannot endure to be t8oug8t so. /:(1. D8ere are fortunes t8at *ention t8e 9ord 'u*brella' for no apparent reason. /:(2. D8ere are four 5inds of 8o*icide& felonious2 eRcusable2 Uustifiable2 and praise9ort8y ... - 0*brose Fierce2 CD8e 4e=il's 4ictionaryC /:((. D8ere are *o*ents 98en art attains al*ost to t8e dignity of *anual labor. /:(). D8ere are *ore 8orses' asses in t8is 9orld t8an t8ere are 8orses. /:(/. D8ere are *ore old drun5ards t8an old doctors. /:(6. D8ere are *ore 9ays into t8e 9oods t8an out. /:(@. D8ere are *ore 9ays of 5illing a cat t8an c8o5ing it 9it8 crea*.
/:(:. D8ere are no giant crabs in 8ere2 ?ran5. /:(E. D8ere are no rules of arc8itecture for castles in t8e s5y. /:)0. D8ere are no teac8ers -- only students. /:)1. D8ere are really not *any Uobs t8at actually reSuire a penis or a =agina2 and all ot8er occupations s8ould be open to e=eryone. - <loria Hteine* /:)2. D8ere are so*e *icro-organis*s t8at eR8ibit c8aracteristics of bot8 plants and ani*als. 78en eRposed to lig8t t8ey undergo p8otosynt8esisW and 98en t8e lig8ts go out2 t8ey turn into ani*als. Fut t8en again2 don't 9e all? /:)(. D8ere are t8ree 5inds of lies& Bies2 4a*n Bies2 and Htatistics. - 4israeli /:)). D8ere are t8ree t8ings eRtre*ely 8ard& Hteel2 a dia*ond2 and to 5no9 one's self. - Fen ?ran5lin /:)/. D8ere are t8ree 9ays to get so*et8ing done& 1. 4o it yourself. 2. +ire so*eone to do it for you. (. ?orbid your 5ids to do it. /:)6. D8ere are t8ree 9ays to get so*et8ing done& do it yourself2 8ire so*eone2 or forbid your 5ids to do it. /:)@. D8ere are ti*es 98en O long for a Tlingon 9o*an. - 7orf /:):. D8ere are t9o instru*ents 9orse t8an a clarinet. D9o clarinets. /:)E. D8ere are t9o 5inds of solar-8eat syste*s& Cpassi=eC syste*s collect t8e sunlig8t t8at 8its your 8o*e2 and Cacti=eC syste*s collect t8e sunlig8t t8at 8its your neig8bors' 8o*es2 too. - 4a=e Farry2 CPostpetroleu* <u lerC /:/0. D8ere are t9o sides to e=ery Suestion. - Protagoras$)10 FJ1 /:/1. D8ere are t9o types of dirt& t8e dar5 5ind2 98ic8 is attracted to lig8t obUects2 and t8e lig8t 5ind2 98ic8 is attracted to dar5 obUects. - Hlic5's Ba9 of t8e Lni=erse /:/2. D8ere are t9o 9ays to 9rite error-free progra*s. ,nly t8e t8ird one 9or5s. /:/(. D8ere are =ery fe9 personal proble*s t8at cannot be sol=ed t8roug8 a suitable application of 8ig8 eRplosi=es. /:/). D8ere cannot be a crisis neRt 9ee5. -y sc8edule is already full. - +enry Tissinger /://. D8ere cannot be a crisis neRt 9ee5. -y sc8edule is already full. - +enry Tissinger /:/6. D8ere 8as been an alar*ing increase in t8e nu*ber of t8ings you 5no9 not8ing about. /:/@. D8ere 8as been an alar*ing increase in t8e nu*ber of t8ings you 5no9 not8ing about. /:/:. D8ere is a bear follo9ing you around. /:/E. D8ere is a fly on your 4i*ension /:60. D8ere is a great disco=ery still to be *ade in Biterature& t8at of paying literary *en by t8e Suantity t8ey do K,D 9rite. /:61. D8ere is a green2 *ulti-legged creature cra9ling on your s8oulder. /:62. D8ere is a t8eory t8at states& COf anyone finds out 98at t8e uni=erse is for it 9ill disappear and be replaced by so*et8ing *ore ba aarly ineRplicable.C /:6(. D8ere is a t8eory 98ic8 states t8at if e=er anyone disco=ers eRactly 98at t8e Lni=erse is for and 98y it is 8ere2 it 9ill instantly disappear and be replaced by so*et8ing e=en *ore bi arre and ineRplicable. D8ere is anot8er t8eory 98ic8 states t8at t8is 8as already 8appened. - 4onald 0da*s2 CD8e +itc88i5er's <uide to t8e <alaRyC /:6). D8ere is a tiny plant 8ere2 *ur*uring C9ater2 9aterC. /:6/. D8ere is a =as deferens bet9een *en and 9o*en. /:66. D8ere is al9ays an easier 9ay to do it. /:6@. D8ere is al9ays one *ore bug.
/:6:. D8ere is al9ays so*eone 9orse off t8an yourself. /:6E. D8ere is al9ays so*et8ing ne9 out of 0frica. /:@0. D8ere is an easy ans9er to your proble* t8at is neat2 plausible2 and 9rong. /:@1. D8ere is an eRception to all la9s. /:@2. D8ere is an eRception to e=ery rule2 eRcept t8is one. /:@(. D8ere is an eRception to e=ery rule. /:@). D8ere is anot8er t8eory t8at states& CD8is 8as already 8appened ....C - 4onald 0da*s2 C+itc8-+i5ers <uide to t8e <alaRyC /:@/. D8ere is danger in delaying2 good fortune in acting. /:@6. D8ere is intelligent life on .art82 but 9e are Uust =isiting /:@@. D8ere is life after deat8& in Jle=eland2 people are still allo9ed to =ote. /:@:. D8ere is *ore difference 9it8in t8e seRes2 t8an bet9een t8e*. - O=y Jo*ptonFurnett /:@E. D8ere is *ore to reality t8an *eets t8e eye /::0. D8ere is *uc8 ,bi-7an did not tell you. /::1. D8ere is ne=er ti*e to do it rig8t2 but al9ays ti*e to do it o=er. /::2. D8ere is ne9s. /::(. D8ere is no C0C in CT.3K.BC /::). D8ere is no benefit in t8e gifts of a bad *an. - .uripides /::/. D8ere is no de=ilW it's <od 98en 8e's drun5. /::6. D8ere is no distinctly nati=e 0*erican cri*inal class eRcept Jongress. - -ar5 D9ain /::@. D8ere is no fear in lo=eW but perfect lo=e castet8 out fear. /:::. D8ere is no fool li5e an old fool. - >.+ey9ood $1)E@-1/:01 /::E. D8ere is no gra=ity--D8e eart8 suc5s /:E0. D8ere is no gra=ity. D8e .art8 suc5s. /:E1. D8ere is no grief 98ic8 ti*e does not lessen and soften. /:E2. D8ere is no 8appiness 98ere t8ere is no 9isdo*. - Hop8ocles /:E(. D8ere is no 8ea=ier burden t8an a great potential. /:E). D8ere is no reali able po9er t8at *an cannot2 in ti*e2 fas8ion t8e tools to attain2 nor any po9er so secure t8at t8e na5ed ape 9ill not abuse it. Ho it is 9ritten in t8e genetic cards -- only p8ysics and 9ar 8old 8i* in c8ec5. 0nd also t8e 9ife 98o 9ants 8i* 8o*e by fi=e2 of course. - .ncyclopadia 0pocryp8ia2 1EE0 ed. /:E/. D8ere is no royal road to geo*etry. /:E6. D8ere is no sadder sig8t t8an a young pessi*ist. /:E@. D8ere is no satisfaction in 8anging a *an 98o does not obUect to it - <. F. H8a9 /:E:. D8ere is no security on t8is eart8. D8ere is only opportunity. /:EE. D8ere is no substitute for good *anners2 eRcept2 per8aps2 fast refleRes. /E00. D8ere is no suc8 t8ing as a little garlic. /E01. D8ere is no suc8 t8ing as pure pleasureW so*e anRiety al9ays goes 9it8 it. /E02. D8ere is no ti*e li5e t8e pleasant. /E0(. D8ere is no ti*e li5e t8e present for postponing 98at you oug8t to be doing. /E0). D8ere is no ti*e li5e t8e present to postpone 98at you oug8t to be doing. /E0/. D8ere is not8ing *ore silly t8an a silly laug8. /E06. D8ere is not8ing rarer t8an t8e ability to recognise ability. - 3obert +alf /E0@. D8ere is not8ing so easy t8at it beco*es difficult 98en done 9it8 reluctance. /E0:. D8ere is not8ing so s*all t8at it can't be blo9n out of proportion. /E0E. D8ere is one <od2 but 98ic8 one is +e? /E10. D8ere is one in e=ery cro9d2 and t8ey al9ays find *e. - Fu*per stic5er
/E11. D8ere is one t8ing stronger t8an all t8e ar*ies in t8e 9orld2 and t8at is an idea 98ose ti*e 8as co*e. - Victor +ugo /E12. D8ere is only one t8ing in t8e 9orld 9orse t8an being tal5ed about2 and t8at is not being tal5ed about. - ,scar 7ilde /E1(. D8ere is only one t8ing in t8e 9orld 9orse t8an being tal5ed about2 and t8at is not being tal5ed about. - ,scar 7ilde /E1). D8ere is only one 9ay to 5ill capitalis*--by taRes2 taRes2 and *ore taRes. /E1/. D8ere is so*et8ing fascinating about science. ,ne gets suc8 98olesale returns of conUecture out of suc8 a trifling in=est*ent of fact. - -ar5 D9ain /E16. D8ere is =ery little future in being rig8t 98en your boss is 9rong. /E1@. D8ere isn't roo* enoug8 in t8is dress for bot8 of us. /E1:. D8ere once 9as a [ ! fro* [ ! 98ose [ ! 9as /E1E. D8ere once 9as a girl na*ed Orene 78o li=ed on distilled 5erosene Fut s8e started absorbin' 0 ne9 8ydrocarbon 0nd since t8en 8as ne=er ben ene. /E20. D8ere once 9as an old *an fro* .sser2 78o's 5no9ledge gre9 lesser and lesser. Ot at last gre9 so s*all2 +e 5ne9 not8ing at all2 0nd no9 8e's a Jollege Professor. /E21. D8ere 9as a young lady fro* +yde 78o ate a green apple and died. 78ile 8er lo=er la*ented D8e apple fer*ented 0nd *ade cider inside 8er inside. /E22. D8ere 9as a young poet na*ed 4an2 78ose poetry ne=er 9ould scan. 78en told t8is 9as so2 +e said2 C;es2 O 5no9. Ot's because O try to put e=ery possible syllable into t8at last line t8at O can.C /E2(. D8ere 9ill be big c8anges for you but you 9ill be 8appy. /E2). D8ere's a fine line bet9een courage and foolis8ness. Doo bad its not a fence. /E2/. D8ere's a 5iller on t8e roadW 8is brain is sSuir*ing li5e a toad. - >i* -orrison /E26. D8ere's a lady 98o 5no9s2 all t8at glitters is gold. - Bed Qeppelin /E2@. D8ere's a 98ole lifeti*e stretc8ing a8ead of *e /E2:. D8ere's al9ays 1 *ore H,F t8an you counted on /E2E. D8ere's al9ays one *ore bug. - Progra**er's Ba9 /E(0. D8ere's an Otalian in *y roo* and 8e 9on't go a9ay /E(1. D8ere's an old pro=erb t8at says Uust about 98ate=er you 9ant it to. /E(2. D8ere's at least one fool in e=ery *arried couple. /E((. D8ere's got to be *ore to life t8an co*pile-and-go. /E(). D8ere's *ore to FFHing t8an *eets t8e *ode*. /E(/. D8ere's no future in ti*e tra=el. /E(6. D8ere's no future in ti*e tra=el. /E(@. D8ere's no point in being gro9n up if you can't be c8ildis8 so*eti*es. - 4r. 78o /E(:. D8ere's no point in being gro9n up if you can't be c8ildis8 so*eti*es. - 4r. 78o /E(E. D8ere's no real need to do 8ouse9or5 -- after four years it doesn't get any 9orse. /E)0. D8ere's no roo* in t8e drug 9orld for a*ateurs. /E)1. D8ere's no substitute for cubic inc8es. - Peter Froc5 /E)2. D8ere's not8ing *ore de*orali ing t8an *oney. - Hop8ocles /E)(. D8ere's not8ing *ore restful t8an ta5ing orders fro* fools. /E)). D8ere's only one 9ay to 8a=e a 8appy *arriage and as soon as O learn 98at it is O'll get *arried again. - Jlint .ast9ood /E)/. D8ere's safety in nu*bers& ?162 ?112 F22 ?1/.... /E)6. D8ere's s*all c8oice in rotten apples.
/E)@. D8ere's so *uc8 plastic in t8is culture t8at =inyl leopard s5in is beco*ing an endangered synt8etic. - Bily Do*lin /E):. D8ere's so *uc8 to say but your eyes 5eep interrupting *e. /E)E. D8ereisonlyso*uc8youcansayusingUustfiftyletters. /E/0. D8esaurus& ancient reptile 9it8 an eRcellent =ocabulary. /E/1. D8ese are 403T DO-.H for all *an5ind's +O<+.HD V0BL.H D8ese are 403T DO-.H for ?3..4,- and P3,HP.3OD; D8ese are <3.0D DO-.H to put your *oney on F04 <L; to 5ic5 t8e J30P out of -.<0D,K -0K /E/2. D8ese aren't *y s8orts -- t8ey bend /E/(. D8ese days go=t. is a four letter 9ord. /E/). D8ese days t8e necessities of life cost you about t8ree ti*es 98at t8ey used to2 and 8alf t8e ti*e t8ey aren't e=en fit to drin5. /E//. D8ese t8ings on *y nose aren't Uust for s8o9. - 3o /E/6. D8ey also surf 98o only stand on 9a=es. /E/@. D8ey aren't e=il...Uust stupid. /E/:. D8ey as5ed *e to go in front of t8e 3eagans. O'* not used to going in front of President 3eagan2 so 9e 9ent out be8ind t8e Fus8es. - 4an Vuayle /E/E. D8ey 4, *a5e 'e* li5e t8ey used to. /E60. D8ey 8a=e been at a great feast of languages2 and stolen t8e scraps. /E61. D8ey Uust bu ed and bu ed.....bu ed. /E62. D8ey spell it Cda VinciC and pronounce it Cda Vinc8yC. ?oreigners al9ays spell better t8an t8ey pronounce. - -ar5 D9ain /E6(. D8ey'd ne=er $be stupid enoug8 to1 *a5e 8i* a *anager. - ?a*ous last 9ords /E6). D8ey're baaac5 /E6/. D8ey're only trying to *a5e *e B,,T paranoid /E66. D8ey'=e played t8eir 8earts out. /E6@. D8in *ay be in2 but fat's 98ere it's at /E6:. D+OK.'H B07& Kature ab8ors people. /E6E. D8ings are certainly loo5ing up. /E@0. D8ings are going =ery 9ell on t8e 98ole. /E@1. D8ings are *ore li5e t8ey used to be t8an t8ey are no9. /E@2. D8ings are not al9ays 98at t8ey see*. /E@(. D8ings are not as bad as t8ey see* - t8ey're 9orse /E@). D8ings are seldo* 98at t8ey see*W s5i* *il5 *asSuerades as crea*. /E@/. D8ings *ay co*e to t8ose 98o 9ait2 but only t8e t8ings left by t8ose 98o 8ustle. - 0bra8a* Bincoln /E@6. D8ings past redress and no9 9it8 *e past care. /E@@. D8ings 9ill be brig8t in P.-. 0 cop 9ill s8ine a lig8t in your face. /E@:. D8ings 9ill be brig8ter tonig8t. 0 cop 9ill s8ine a lig8t in your face. /E@E. D8ings 9on't get any better2 so get used to it. /E:0. D8ings 9or5 better 98en plugged in. /E:1. D8ings 9ort8 8a=ing are 9ort8 c8eating for. /E:2. D8in5 big. Pollute t8e -ississippi. /E:(. D8in5 8on5 if you're a telepat8. /E:). D8in5 it o=er2 creep. - 3obocop /E:/. D8in5 of it 7it8 VBHO 9e can pac5 100 .KO0Js in 1 sS. c*. /E:6. D8in5 of your fa*ily tonig8t. Dry to cra9l 8o*e after t8e co*puter cras8es. /E:@. D8in5 t9ice before spea5ing2 but don't say Ct8in5 t8in5 clic5 clic5C. /E::. D8in5 t9ice before spea5ing. Fut don't say Ct8in5 t8in5 clic5 clic5C. /E:E. D8in5ing Suic5ly Hpoc5 opens a can of peas 9it8 8is ears.
/EE0. D8inly sliced cabbage. /EE1. D8ird of ?i=e2 siR of one2 8alf a do en of t8e ot8er /EE2. D8is afternoon is fa=orable for ro*ance. Dry a single person for a c8ange. /EE(. D8is ain't no party D8is ain't no disco D8is ain't no foolin' around /EE). D8is calls for a celebration. /EE/. D8is J8arlie Fro9n *ust 8a=e been a =ery 9ise *an. /EE6. D8is contract doesn't include a Hanity Jlause. .=eryone 5no9s2 t8ere ain't no Hanity Jlause. - <rouc8o -arR /EE@. D8is election is about 98o's going to be t8e neRt President of t8e Lnited Htates - Henator 4an Vuayle /EE:. D8is fortune e=ery t8ird2 but it still co*pre8ensible. /EEE. D8is fortune intentionally left blan5. 6000. D8is fortune intentionally not included. 6001. D8is fortune is false. 6002. D8is fortune is inoperati=e. Please try anot8er. 600(. D8is fortune is o9ned and operated by ?roba -agic Jo.2 Btd. 600). D8is fortune 9ill not co*e true. 600/. D8is ga*e is eRceedingly si*ple. - 4ata 6006. D8is guy 8as blo9n *e off for t8e last ti*e. - <eordi 600@. D8is 8as been a re*ar5ably successful 9ee5. 600:. D8is 8ittet8 t8e nail on t8e 8ead. - >. +ey9ood $1/E@-1/:01 600E. D8is infor*ation fills a *uc8 needed gap 6010. D8is is a ?erengi Dagline. ;ou o9e *e /00 credits for re#HB-3#D0< 6011. D8is is a good day for o=erco*ing obstacles. Dry a steeplec8ase. 6012. D8is is a good ti*e to punt 9or5. 601(. D8is is a 8ell of a ti*e for a 9al5 in t8e par5. - <eordi 601). D8is is a Dagline *irrorINrorri* enilgaD a si si8D 601/. D+OH OH 0K .M-P033,D 6016. D8is is .l=is. 0ny *essages for *e? 601@. D8is is for all ill-treated fello9s Lnborn and unbegot2 ?or t8e* to read 98en t8ey're in trouble 0nd O a* not. - 0. .. +ous*an D8is is not an abandoned =e8icle. Fu*per stic5er 601:. D8is is one of *y *ost creati=e periods e=er. 601E. D8is is our only tag line. 6020. D8is is t8e best of all possible 9orlds. 6021. D8is is t8e day for fir* decisions ,r is it? 6022. D8is is t8e lig8t at t8e end of t8e tunnel. 602(. D8is isn't a 8olodec52 darling2 t8is is real. - ,'Frien 602). D8is login session& $1(.EE 602/. D8is login session& $1(.EE2 but for you $11.::. 6026. D8is *essage cleared by OraSi censors. 602@. D8is *essage is $8are7are Do register2 please send $20 602:. D8is *essage is H+03.703. Do 3egister2 send $/. 602E. D8is *essage 9ritten by 4olp8in Foy. 60(0. D8is *essage 9ritten by Handy. 0 8ig8ly trained dolp8in. 60(1. D8is *essage 9ritten by Qippy t8e 4olp8in. 60(2. D8is *es age 8as bin spel c8eSued. 60((. D8is ne=er 9ould'=e 8appened if O 9ere captain. - 3i5er 60(). D8is nig8t *et8in5s is but t8e daylig8t sic5. 60(/. D8is parrot is bleeding de*ised. Ot is an eR - parrot - >o8n Jleese
60(6. D8is place 8as e=eryt8ing. 60(@. D8is portion of LDH OO is a trade secret of 0*da8l Jorporation. 60(:. D8is president is going to lead us out of t8is reco=ery. Ot 9ill 8appen. - Vice President 4an Vuayle 60(E. D8is product 9as cruelly tested on s*all2 furry ani*als. 60)0. D8is sentance 8as t8reee errors. 60)1. D8is sentence contains ten 9ords2 eig8teen syllables2 and siRty-four letters. 60)2. D8is sentence is a pre*ature punctuator 60)(. D8is sentence no =erb. 60)). D8is side up 60)/. D8is space left blan5is8. 60)6. D8is syste* 9ill self-destruct in fi=e *inutes. 60)@. D8is Dag Bine no =erb. 60):. D8is tagline 9as reclai*ed and is not yet stolen. 60)E. D8is unit ... *ust ... sur=i=e. 60/0. D8is 9as t8e *ost un5indest cut of all. 60/1. D+,-'H B07 ,? -03OD0B FBOHH& D8e lengt8 of a *arriage is in=ersely proportional to t8e cost of t8e 9edding. 60/2. D8ose of you 98o t8in5 t8ey 5no9 e=eryt8ing2 are =ery annoying to t8ose of us 98o do 60/(. D8ose of you 98o t8in5 you 5no9 e=eryt8ing are annoying t8ose of us 98o do. 60/). D8ose 98o can -- do. 60//. D8ose 98o can't -- teac8. 60/6. D8ose 98o can't teac8 ad*inistrate. 60/@. D8ose 98o can't teac8 consult. 60/:. D8ose 98o can't teac82 teac8 gy*. 60/E. D8ose 98o can't 9rite2 9rite *anuals. 6060. D8ose 98o can2 do. D8ose 98o can't2 si*ulate. 6061. D8ose 98o can2 do. D8ose 98o can't2 super=ise 6062. D8ose 98o can2 do. D8ose 98o can't2 teac8. D8ose 98o can't teac82 8ac5. 606(. D8ose 98o can2 do. D8ose 98o can't2 teac8. D8ose 98o can't teac82 teac8 gy*. 606). D8ose 98o can2 do. D8ose 98o can't2 9rite. 606/. D8ose 98o cannot re*e*ber t8e past are conde*ned to repeat it. 6066. D8ose 98o in Suarrels interpose *ust often 9ipe a bloody nose. 606@. D8ose 98o *a5e peaceful re=olution i*possible 9ill *a5e =iolent re=olution ine=itable. - >o8n ?. Tennedy 606:. D8ose 98o tal5 don't 5no9. D8ose 98o don't tal52 5no9. 606E. D8ose 98o* <od 9is8es to destroy2 are first *ade *ad. 60@0. D8ou 8ast seen not8ing yet. 60@1. D8ou s8all not sleep 9it8in an interrupt 8andler. 60@2. D8ree can 5eep a secret2 if t9o are dead. 60@(. D8ree c8eers for life. 60@). D8ro9 it a9ay and you 9ill need it neRt day. 60@/. Dic5 - Doc52 Dic5 - Doc5. Di*e is 9asting a9ay... 60@6. Di*e and tide 9ait for no *an. 60@@. Di*e as 8e gro9s old teac8es all t8ings. 60@:. Di*e cancels young pain. - .uripides $)(1 FJ1 60@E. Di*e eases all t8ings. - Hop8ocles $)06 FJ1 60:0. Di*e flies li5e an arro9. 60:1. Di*e flies li5e arro9W fruit flies li5e banana.
60:2. Di*e flies 98en you don't 5no9 98at you're doing. 60:(. Di*e flies2 98en you don't 5no9 98at you're doing. 60:). Di*e is Uust nature's 9ay of 5eeping e=eryt8ing fro* 8appening at once. 60:/. Di*e is nature's 9ay of *a5ing sure e=eryt8ing doesn't 8appen at once. 60:6. Di*e is nature's 9ay of *a5ing sure t8at e=eryt8ing doesn't 8appen at once. 60:@. Di*e is t8e *ost =aluable t8ing a *an can spend. 60::. Di*e ta5es ti*e. 60:E. Di*e to die... - 3oy Fatty 60E0. Di*e tra=el gi=es *e nosebleeds. - Ba?orge 60E1. Dis but a fles8 9ound... 60E2. Do add insult to inUury. 60E(. Do be born ric8 is an accident. Do die ric8 is a *iracle. 60E). Do be 8u*an 9it8out passion is to be dead. 60E/. Do be intoRicated is to feel sop8isticated but not be able to say it. 60E6. Do be is to do - Hartre 60E@. Do be sure of 8itting t8e target2 s8oot first and2 98ate=er you 8it2 call it t8e target. 60E:. Do be trusted is a greater co*pli*ent t8an to be lo=ed. 60EE. Do be 9ise2 t8e only t8ing you need to 5no9 is 98en to say CO don't 5no9.C 6100. Do boldly go 98ere no one 8as gone before. 6101. Do cli*b t8e ladder of success you *ust get t8roug8 t8e cro9d at t8e botto*. 6102. Do do is to be - Kiet sc8e 610(. Do do not8ing is to be not8ing. 610). Do do t9o t8ings at once is to do neit8er. 610/. Do err is 8u*an2 but 98en t8e eraser 9ears out before t8e pencil2 you're o=erdoing it a little. 6106. Do err is 8u*an2 to forgi=e is against co*pany policy. 610@. Do err is 8u*an2 to forgi=e is against ?idoKet policy. 610:. Do err is 8u*an2 to forgi=e is Kot Jo*pany Policy. 610E. Do err is 8u*an2 to forgi=e is out of t8e Suestion. 6110. Do err is 8u*an. Do forgi=e is unusual. 6111. Do e=ery rule t8ere is an eRception2 and =ice =ersa. 6112. Do find out a girl's faults2 praise 8er to 8er girl friends. 611(. Do gi=e 8appiness is to deser=e 8appiness. 611). Do 8a=e died once is enoug8. 611/. Do 8i* 98o is in fear2 e=eryt8ing rustles. - Hop8ocles 6116. Do iterate is 8u*an2 to recurse2 di=ine. 611@. Do 5eep your friends2 treat t8e* 5indlyW to 5ill t8e*2 treat t8e* often. 611:. Do laug8 at *en of sense is t8e pri=ilege of fools. 611E. Do laug8 at people of sense is t8e pri=ilege of fools. 6120. Do lig8t a candle is to cast a s8ado9. 6121. Do lo=e is good2 lo=e being difficult. 6122. Do lo9er t8e t8er*ostat on t8e bridge of t8e .nterpriseW to coldly go 98ere no *an 8as gone before. 612(. Do pass t8roug8 a ti*e-9arp bac59ard t8roug8 ti*eW to oldly go 98ere no *an 8as gone before. 612). Do refuse praise is to see5 praise t9ice. 612/. Do register t8is tagline2 send $2E to .... 6126. Do sa=e a single life is better t8an to build a se=en story pagoda. 612@. Do see a need and 9ait to be as5ed2 is to already refuse.
612:. Do s8a=e t8e 8eads of t8e cre9 of t8e .nterpriseW to baldly go 98ere no *an 8as gone before... 612E. Do s8oot a *i*e2 do you use a silencer? 61(0. Do spray t8e .nterprise in a 8ea=y *etallic ele*entW to goldly go 98ere no *an 8as gone before. 61(1. Do study a subUect best2 understand it t8oroug8ly before you start. 61(2. Do teac8 is to learn - >apanese Pro=erb 61((. Do teac8 is to learn. 61(). Do t8e landlord belong t8e door5nobs. 61(/. Do use =iolence is to already be defeated. 61(6. Doday is a bad day to gi=e to c8arity. 61(@. Doday is a good day for you to Uu*p in a la5e. 61(:. Doday is a good day to bribe a 8ig8-ran5ing official. 61(E. Doday is t8e first day of t8e rest of t8e *ess. 61)0. Doday is t8e first day of t8e rest of your life. 61)1. Doday is t8e first day of t8e rest of your lossage. 61)2. Doday is t8e last day of your life so far. 61)(. Doday is t8e to*orro9 you 9orried about yesterday. 61)). Doday is t8e to*orro9 you 9orried about yesterday. 61)/. Doday is your luc5y day. 61)6. D,44'H ?O3HD B07& 0ll t8ings being eSual2 you lose. 61)@. D,44'H P,BODOJ0B P3OKJOPB.& Ko *atter 98at t8ey're tal5ing about2 t8ey're tal5ing about *oney. 61):. Donig8t t8ey 8ad t8at little bit of luc5 t8at 9e didn't 8a=e. 61)E. Doo cle=er is du*b. - ,gden Kas8 61/0. Doo little seR *a5es you repeat yourself redundantly. 61/1. Doo *uc8 of a good t8ing is 7,K4.3?LB. - -ae 7est 61/2. D,,4'H H.J,K4 B07& Ko *atter 98at t8ey're telling you2 it's not t8e 98ole trut8. 61/(. Doodleoo2 go 9it8 <od2 and don't ta5e any 9ooden nic5els. 61/). Doo5 an 8our to bury t8e cat. 4a*n t8ing 5ept *o=ing. 61//. Doot8ac8e tends to start on Haturday nig8t. 61/6. Doto2 O don't t8in5 9e're in 4,H any*ore... 61/@. Draining is e=eryt8ing. D8e peac8 9as once a bitter al*ondW cauliflo9er is not8ing but cabbage 9it8 a college education. 61/:. Dransporter roo*2 bea* t8at tagline up i**ediately 61/E. Dransporting really is t8e safest 9ay to tra=el. 6160. Dra=eling t8roug8 8yperspace isn't li5e dusting crops2 boy. 6161. Dreat eac8 ne9 situation as t8oug8 it's a crisis. 6162. Dreat your friend as if 8e *ig8t beco*e an ene*y. 616(. Dre5 Jlassic -- 78o Keeds 0not8er <eneration? 616). Dre5 eRcuse #1& D8e Pri*e 4irecti=e clearly forbids it 616/. Drespassers 9ill be s8otW Hur=i=ors 9ill be s8ot again 6166. Dribble *at8& " ' " X """"""""""""""""""""""""""""""""""" 616@. Dribble *at8& " ' <rain X """"""""""" 616:. Dribbles - $/.00 for all you can pile on top of you. 616E. Dried to play *y s8oe8orn... all O got 9as footnotes 61@0. Dried to play *y s8oe8orn... all O got 9ere footnotes 61@1. Droglodytis* does not necessarily i*ply a lo9 cultural le=el. 61@2. D3,O& O feel pain2 <3.0D pain ... 3OT.3& <lad you li5ed it
61@(. Droubles are li5e babiesW t8ey only gro9 by nursing. 61@). Drue 8appiness 9ill be found only in true lo=e. 61@/. Drue -ultitas5ing X ( PJs and a c8air 9it8 98eels 61@6. D3L-0K'H B07& Of you cannot con=ince t8e*2 confuse t8e*. 61@@. Drust in <od2 but bac5up your 8ard dis5 D,40; 61@:. Drut8 is 8ard to find and 8arder to obscure. 61@E. Drut8 is Uust anot8er *isconception. 61:0. Drut82 li5e surgery2 *ay 8urt. Fut it cures. - +an Huyin 61:1. Drut8ful& 4u*b and illiterate. 61:2. Dry Ystty 0' -- it 9or5s *uc8 better. 61:(. Dry a ne9 syste* or a different approac8. 61:). Dry later. 61:/. Dry t8e -oo H8u Por5. Ot is especially good today. 61:6. Dry to be neatW fall only in designated piles. - Hafety Dips for t8e Post-Kuclear .Ristence 61:@. Dry to de=elop your o9n personality. 61::. Dry to di=ide your ti*e e=enly to 5eep ot8ers 8appy. 61:E. Dry to =alue useful Sualities in one 98o lo=es you. 61E0. Drying to establis8 =oice contact--please yell into 5eyboard. 61E1. Drying to get an education 8ere is li5e trying to ta5e a drin5 fro* a fire 8ose 61E2. Drying to t8in5 of a good tagline... 61E(. Duc5 under t8u*b and 8old fir*ly. 61E). DV is c8e9ing gu* for t8e eyes. - ?ran5 Bloyd 7rig8t 61E/. D9o can li=e as c8eaply as one2 for 8alf as long. 61E6. D9o guys 9al5 into a bar.... 61E@. D9o 8eads are better t8an one. - >o8n +ey9ood $1)E@-1/:01 61E:. D9o 8eads are better t8an one. 61EE. D9o is co*pany2 t8ree is an orgy. 6200. D9o is not eSual to t8ree2 e=en for =ery large =alues of t9o. 6201. D9o *ay 5eep counsel2 if t9o be a9ay. - +ey9ood $1)E@-1/:01 6202. D9o *en loo5 out t8roug8 t8e sa*e barsW one sees *ud2 and one t8e stars. 620(. D9o *ost co**on ele*ents in t8e uni=erse& +ydrogen G Htupidity. 620). D9o rig8ts don't *a5e a 9rong2 t8ey *a5e an airplane. 620/. D7, D+OK<H 03. LKOV.3H0B. +;43,<.K 0K4 HDLPO4OD;. 6206. D9o 7rongs 4on't -a5e 0 3ig8t2 Fut D8ree Befts 4o. 620@. D9o 9rongs don't *a5e a rig8t2 but t8ree lefts do. 620:. Dyped on *y Lltra -egger 7allet 78a**er. 620E. Dypically loud *usic2 *ore so t8an t8e original2 *ade it sound as if t8e audience 9as singing along. $On fact2 a good deal of t8e audience 9as singing along.1 6210. L?,'s are real. D8e 0ir ?orce doesn't eRist. 6211. Llti*ate oRy*oron& CJas8 HurplusC 6212. Lnable to load 3.0BOD;.H;H -- On=alid Para*eter& [LD,PO0 621(. Lnable to load 3.0BOD;.H;HW On=alid para*eter& [LD,PO0 621). Lnable to locate D.0.03B<3.;.+,D -- .nterprise 8alted 621/. Lnder e=ery stone lur5s a politician. - 0ristop8anes 6216. Lnder e=ery stone lur5s a politician. 621@. LK4.37,,4'H ?O3HD B07 ,? .V,BVOK< H;HD.- 4;K0-OJH& ,nce you open a can of 9or*s2 t8e only 9ay to recan t8e* is to use a larger can. 621:. Lndetectable errors are infiniteW detectable errors by definition are finite. 621E. Lne*ployed people are getting bigger.
6220. Lnfortunately2 t8e people of Bouisiana are not racists. - Vice President 4an Vuayle 6221. LniR - plural of .unuc8. 6222. LniR soit Sui *al y pense. 622(. LniR? O can't e=en do ,K. t8ing at once. 622). Lnless t8e results are 5no9n in ad=ance2 funding agencies 9ill reUect t8e proposal. - 3oc5y's Be**a of Onno=ation Pre=ention 622/. LnSualified superlati=es are t8e 9orst of all. 6226. Lnusual c8eeses. 622@. Lp your accu*ulator. 622:. Lse debugging co*pilers. 622E. Lse free-for* input 98ere possible 62(0. Lse <,D,s only to i*ple*ent a funda*ental structure. 62(1. Lse O?....BH. O?....BH. O?....BH.... to i*ple*ent *ulti-9ay branc8es. 62(2. Lse library functions. 62((. Lsed OraSi rifles for sale& 4ropped once2 ne=er fired... 62(). Lser - a tec8nical ter* used by co*puter pros. Hee idiot. 62(/. Lsers& Teep t8e* dry and don't feed t8e* after *idnig8t. 62(6. Lsing PTQOP Version 2.0) 62(@. Lsing DH, is li5e 5ic5ing a dead 98ale across t8e beac8. 62(:. V0OB'H 0MO,-& On any 8u*an enterprise2 9or5 see5s t8e lo9est 8ierarc8al le=el. 62(E. Va*oose ya little =ar*int - 4ata 62)0. V0M.K [fro* 'oRen2' per8aps influenced by '=iRen.'! n. pl. D8e plural of V0M. 62)1. VJ3's are a 9ay to defeat ti*e..... 62)2. V4L - a HD4 si*ilar to =isual 0O4H. 62)(. Verbosity leads to unclear2 inarticulate t8ings. - Henator 4an Vuayle 62)). Verbs 8as to agree 9it8 t8eir subUects. 62)/. Vertical - a green itc8. 62)6. Vests are to suits as seat-belts are to cars. 62)@. Vice =ersa - poe*s about brot8els? 62):. Vidi2 =ici2 =eni - 4on >uan 62)E. Vini2 =idi2 =ici. 62/0. Violence is t8e last recourse of t8e inco*petent. 62/1. VO3DL0B adU. 1. Jo**on alternati=e to B,<OJ0B $S.=.12 but ne=er used 9it8 co*pass directions. 2. Perfor*ing t8e functions of. Virtual *e*ory acts li5e real *e*ory2 but isn't. 62/2. Virtual 4is5 - =ery nearly a storage de=ice. 62/(. Virtue 8as ne=er been as respectable as *oney. - -ar5 D9ain 62/). Virtue is its o9n punis8*ent. 62//. Virus scanner& C4,HC found. 3e*o=e? $;1 62/6. Virus scanner& C7indo9sC found. 3e*o=e? $;1 62/@. Visit beautiful Vergas2 -innesota. 62/:. Visit beautiful 7isconsin 4ells. 62/E. Volcano - a *ountain 9it8 8iccups. 6260. Vote 0narc8ist. 6261. Vote 3epublican2 it's easier t8an t8in5ing. 6262. VuUa 4e - D8e ?eeling ;ou'=e Ke=er Feen +ere 626(. Vulgarity& D8e conduct of ot8ers. 626). Vultures only fly 9it8 carrion luggage.
626/. 70<K.3'H B07 ,? HP,3DH DV& 78en t8e ca*era isolates on a *ale at8lete2 8e 9ill eit8er spit2 pic5 or scratc8. 6266. 7agner's *usic is better t8an it sounds. 626@. 7ait for t8at 9isest of all counselors2 Di*e. 626:. 7aiter& Lne*ployed actor 626E. 7al5 softly and carry a big stic5. 62@0. 7al5 t8roug8 doors2 don't cra9l t8roug8 7indo9s. 62@1. 70BB0J.'H ,FH.3V0DO,K& .=eryt8ing is in a state of utter dis8e=el*ent. 62@2. 70BD.3'H B07 ,? P,BODOJH& 0 fool and 8is *oney are soon elected. 62@(. 7anna fuc5 li5e bunnies? - Pic5 up line 62@). 7ar is its o9n punis8*ent. 62@/. 7ar is t8e last refuge of inco*petent states*en. 62@6. 7ar spares not t8e bra=e2 but t8e co9ardly. 62@@. 703KOK<... drin5ing tap 9ater *ay 5ill your t8irst 62@:. 703KOK<& 4o not atte*pt t8is at 8o*e. 62@E. 7arp / ... engage. Ko2 no2 -r. 4ata2 *ore clutc8 62:0. 7arranty and guarantee clauses are =oided by pay*ent of t8e in=oice. 62:1. 7as Fee8to=en's 1st *o=e*ent done in t8e toilet or pri=y? 62:2. 7as it a car or a cat O sa9? 62:(. 7as it only Uust a drea*? - >o8n Bennon2 loo5ing bac5 on t8e Featles. 62:). 7as >i*i +endriR's *ode* a Purple +ayes? 62:/. 7as Das8a ;ar t8e .nterprise's eRpert on 4ata entry? 62:6. 7as8ing 7indo9s is better t8an running t8e*. 62:@. 7aste not fres8 tears o=er old griefs. - .uripides $)(1 FJ1 62::. 7aste not fres8 tears o=er old griefs. 62:E. 7aste not2 get your budget cut neRt year. 62E0. 7atc8 it - you're trying *y infinite patience. 62E1. 7atc8 out for off-by-one errors. 62E2. 7atc8 out 98ere t8e +us5ies go and don't you eat t8at yello9 sno9 62E(. 7atc8 98ere you go... re*e*ber 98ere you'=e been... 62E). 7atc8 98ere you go...re*e*ber 98ere you'=e been... 62E/. 7atc8 your *out82 5id2 or you'll find yourself floating 8o*e. 62E6. 7atson Jo*e 8ere O need you 62E@. 7ays to s5in a cat #2@& Lse an electric belt sander. 62E:. 7e all 5no9 t8at no one understands anyt8ing t8at isn't funny. 62EE. 7e all li=e in a state of a*bitious po=erty. 6(00. 7e are all dri=en into t8e sa*e fold. - +orace $: FJ1 6(01. 7e are but dust and s8ado9. - +orace $: FJ1 6(02. 7e are no *ore t8an candles burning in t8e 9ind. - >apanese Pro=erb 6(0(. 7e are not a clone. 6(0). 7e are not alone. 6(0/. 7e are not punis8ed for our sins2 but by t8e*. 6(06. 7e are on a roll Ja=orting on t8e Futter 6(0@. 7e are t8e 5nig8ts 98o say2 CKO.C 6(0:. 7e are t8e people our parents 9arned us about. 6(0E. 7e can defeat gra=ity. D8e proble* is t8e paper9or5 in=ol=ed. 6(10. 7e can't go bac52 and 9e can't stay 8ere. - Picard 6(11. 7e cannot direct t8e 9ind...Fut 9e can adUust t8e sails. 6(12. 7e cannot do e=eryt8ing at once2 but 9e can do so*et8ing at once. 6(1(. 7e co*e in peace. H8oot to 5ill.
6(1). 7e could do t8at2 but it 9ould be 9rong2 t8at's for sure. 6(1/. 7e do 98at 9e can but it's ne=er enoug8. 6(16. 7e don't really understand it2 so 9e'll gi=e it to t8e progra**ers. 6(1@. 7e 8a=e a eSual opportunity calculus class -- it's fully integrated. 6(1:. 7e 8a=e a fir* co**it*ent to K0D,2 9e are a "part" of K0D,. 7e 8a=e a fir* co**it*ent to .urope. 7e are a "part" of .urope. - 4an Vuayle 6(1E. 7e 8a=e been pus8ing t8e idea t8at <eorge Fus8 is going to *a5e *atters *uc82 *uc8 9orse. - Vice President 4an Vuayle 6(20. 7e 8a=e do ens of stea5s in Ho=iet Lnion2 do ens 6(21. 7e 8a=e engaged t8e Forg. D8e 9edding 9ill be ?riday. 6(22. 7e 8a=e got to get organi ed 6(2(. 7e 8a=e t8e* Uust 98ere t8ey 9ant us. - Japt. >a*es D. Tir5 6(2). 7e 8a=e t8e* Uust 98ere t8ey 9ant us. - >. D. Tir5 6(2/. 7e Tno9 7e Felong Do D8e Band..,T 6(26. 7e learn fro* 8istory t8at 9e do not learn anyt8ing fro* 8istory. 6(2@. 7e li5e all 5inds of praise2 but a 8i5e in our pay is t8e best 5ind. 6(2:. 7e li=e2 not as 9e 9is8 to2 but as 9e can. - -enander 2E2bc 6(2E. 7e loo5 for t8ings. D8ings t8at *a5e us go. 6((0. 7e *ay be alone. 7e *ay not be alone. .it8er 9ay2 t8e t8oug8t is staggering. 6((1. 7e *ay not return t8e affection of t8ose 98o li5e us2 but 9e al9ays respect t8eir good Uudge*ent. 6((2. 7e *eet again ,bi 7an2 but no9 O a* t8e *aster. - 4art8 Vader 6(((. 7e need *ore une*ployed politicians. 6((). 7e no9 return to our regularly sc8eduled fla*e-t8ro9ing. 6((/. 7e prefer to spea5 e=il of oursel=es rat8er t8an not spea5 of oursel=es at all. 6((6. 7e pro*ise according to our 8opes2 and perfor* according to our fears. 6((@. 7e read to say t8at 9e 8a=e read. 6((:. 7e secretly replaced t8e dilit8iu* 9it8 ?olger's Jrystals 6((E. 7e secure our friends not by accepting fa=ors but by doing t8e*. 6()0. 7e see a total global *ar5et of bet9een / to 10 co*puters. - OF-2 1E)/ 6()1. 7e s8ould de=elop anti-satellite 9eapons because 9e could not 8a=e pre=ailed 9it8out t8e* in '3ed Htor* 3ising'. - Henator 4an Vuayle 6()2. 7e s8ould forgi=e our ene*ies2 but only after t8ey'=e been ta5en out and s8ot. 6()(. 7e start out lo=ing our parents and end up 8ating t8e*. Ho*eti*es 9e learn to lo=e t8e* again2 but 9e ne=er forgi=e t8e*. 6()). 7e 9ill get along fine as soon as you reali e t8at O'* <o 6()/. 7e 9on't need reser=ations. - ?a*ous last 9ords 6()6. 7e'll be bac5 to Kic5 4anger after t8is *essage. 6()@. 7e'll get along fine as soon as you reali e O'* <od. 6():. 7e'll get along fine as soon as you reali e t8at O'* <od 6()E. 7e'll pi=ot at 9arp 2 and bring all tubes to bear2 -r. Hulu. 6(/0. 7e're all bo os on t8is bus. 6(/1. 7e're all bo os on t8is bus. 6(/2. 7e're all o=er it2 li5e a c8eap suit. 6(/(. 7e're going to 8a=e t8e best-educated 0*erican people in t8e 9orld. - Henator 4an Vuayle 6(/). 7e're 5ic5'n so*e 0HJOO no9 6(//. 7e're lost2 but 9e're *a5ing good ti*e. 6(/6. 7e're off to see t8e 9i ard.... 6(/@. 7e're staying toget8er for t8e sa5e of t8e cats. - Fu*per stic5er
6(/:. 7.F.3'H 4.?OKODO,K& 0n eRpert is one 98o 5no9s *ore and *ore about less and less until 8e 5no9s not8ing. 6(/E. 7edding is destiny2 and 8anging li5e9ise. 6(60. 7ee5end2 98ere are you? 6(61. 7.OKF.3<'H ?O3HD B07& Progress is *ade on alternate ?ridays. 6(62. 7.OK.3'H B07 ,? BOF303O.H& D8ere are no ans9ers2 only crossreferences. 6(6(. 7elco*e to President Fus82 -rs. Fus82 and *y fello9 astronauts. - 4an Vuayle addressing t8e anni=ersary of t8e *oon landing 6(6). 7elco*e to t8e ?uture Ot's Uust starting no9 ... 6(6/. 7elco*e to D8e -ac8ine. 6(66. 7elco*e. Doday 9ill be one 8ell of a 9ee5. 6(6@. 7ell begun is 8alf done. 6(6:. 7ell done is better t8an 9ell said. - Fen ?ran5lin 6(6E. 7ell O 5no9 98ere s8e co*e fro* but O don't 5no9 98at's 8er na*e 6(@0. 7ell2 O couldn't figure out t8is subtraction proble*2 so O put C0tlanta2 <eorgiaC 6(@1. 7ell2 O did a bac5up t8ree 9ee5s ago... 6(@2. 7ell2 pluc5 *e na5ed as a scalded c8ic5en 6(@(. 7ell2 stap *e2 O see* to 8a=e co*e out 9it8out *y duc5. 6(@). 7ell...*y cray is in t8e s8op. 6(@/. 7ern8er =on Fraun settled for a V2 98en 8e coulda 8ad a V:. 6(@6. 7esley Jrus8er2 please report to airloc5 / 6(@@. 7esley's te*per tantru*& CO 9ant a ne9 uni=erse for M*asC 6(@:. 7.D+.3K'H B07& 0ssu*ption is t8e *ot8er of all scre9-ups. 6(@E. 78adda ya *ean2 C9eC? 6(:0. 78adda ya 9ant for not8in'? 3ubber biscuit? 6(:1. 78addya *ean you don't HD0PB. dis5ette labels on? 6(:2. 78arbat darbid yarbou sarbay? 6(:(. 78at a beautiful day 6(:). 78at a bundle of laug8s. 6(:/. 78at a friend 9e 8a=e in c8eeses. 6(:6. 78at a glorious 9ay of spending an e=ening 6(:@. 78at a long2 strange trip it's been 6(::. 78at a success today 8as been. 6(:E. 78at a 9aste it is to lose one's *ind. ,r not to 8a=e a *ind is being =ery 9asteful. +o9 true t8at is. - Vice President 4an Vuayle 6(E0. 78at are you gonna do? Fleed on *e? 6(E1. 78at 0re ;ou Boo5ing ?or? Kot8ing's +ere 6(E2. 78at can possibly go 9rong? 6(E(. 78at can you do at ( 0-? Psssttt - got a *ode*?? 6(E). 78at J0K you get a nudist for J8rist*as? 6(E/. 78at did -ic5ey -ouse get for J8rist*as ? 0 4an Vuayle 9atc8 6(E6. 78at do you li5e for brea5fast? - Pic5 up line 6(E@. 78at do you *ean you Cfor*atedC t8e cat?? 6(E:. 78at food processors do to food2 9ord processors do to 9ords. 6(EE. 78at fools t8ese *ortals be. 6)00. 78at garlic is to salad2 insanity is to art. 6)01. 78at garlic is to salad2 insanity is to art. 6)02. 78at 8appened to *y tagline? 6)0(. 78at 8appens if O decre*ent t8e user count? $screa* in t8e distance1
6)0). 78at 8appens if you touc8 t8ese t9o 9ires tog-- - ?a*ous last 9ords 6)0/. 78at 8appens to t8e 8ole 98en t8e c8eese is gone? 6)06. 78at 8appens 98en you cut bac5 t8e Uungle? Ot recedes. 6)0@. 78at if t8ere 9ere no 8ypot8etical situations? 6)0:. 78at is a *agician but a practising t8eorist? - ,bi-7an Tenobi 6)0E. 78at is food to one2 is to ot8ers bitter poison - Bucretius 6)10. 78at is food to one2 it to ot8ers bitter poison. 6)11. 78at is Bife? Ot's t8e cereal -i5ey li5es. 6)12. 78at is t8e a=g. air speed of an un-laden s9allo9? 6)1(. 78at is t8ere to co*plain about? 6)1). 78at is 9ort8 doing is 9ort8 doing for *oney. 6)1/. 78at is 9ort8 doing is 9ort8 o=erdoing. 6)16. 78at is 9ort8 doing is 9ort8 t8e trouble of as5ing so*ebody to do. 6)1@. 78at is 9ort8 doing is 9ort8 t8e trouble of as5ing so*ebody to do it. 6)1:. 78at lo=ely 9eat8er 6)1E. 78at *a5es t8e uni=erse so 8ard to co*pre8end is t8at t8ere's not8ing to co*pare it 9it8. 6)20. 78at *an doesn't li5e to stare once in a 98ile? - ,'Frien 6)21. 78at *ore could a *an as5 for? 6)22. 78at orators lac5 in dept8 t8ey *a5e up in lengt8. 6)2(. 78at part of Cten-line li*itC don't you understand? \ 6)2). 78at sane person could li=e in t8is 9orld and not be cra y? 6)2/. 78at sin 8as not been co**itted in t8e na*e of efficiency? 6)26. 78at soon gro9s old? <ratitude. - 0ristotle 6)2@. 78at soon gro9s old? <ratitude. 6)2:. 78at t8e 8ell2 go a8ead and put all your eggs in one bas5et. 6)2E. 78at t8is country needs is a di*e t8at 9ill buy a good fi=e cent bagel. 6)(0. 78at t8is country needs is a good fi=e cent *icroco*puter. 6)(1. 78at t8is country needs is a good fi=e cent nic5el. 6)(2. 78at t8is 9orld needs is a good fi=e-dollar plas*a 9eapon. 6)((. 78at 9e learn fro* 8istory is t8at 9e do not learn fro* 8istory. 6)(). 78at 9ould -c<y=er do no9? 6)(/. 78at you do not 9ant done to you2 do not do to ot8ers. 6)(6. 78at you don't do is al9ays *ore i*portant t8an 98at you do. 6)(@. 78at you need is lo=e potion #E. 6)(:. 78at's all t8is brou8a8a? 6)(E. 78at's all t8is tal5 about 8ellfire G 4al*ations? 6))0. 78at's anot8er 9ord for Ct8esaurusC? 6))1. 78at's anot8er 9ord for Ct8esaurus?C 6))2. 78at's done to c8ildren2 t8ey 9ill do to society. 6))(. 78at's s8orter t8en a 9ee5end? 0 Vacation. 6))). 78at's so funny? 6))/. 78at's t8e difference bet9een a duc5? 6))6. 78at2 *e 9orry? 6))@. 78ate=er 8appened to C78y is t8e s5y blue?C 6)):. 78ate=er 8appened to t8e good old days 98en seR 9as dirty and t8e air 9as clean? 6))E. 78ate=er it is2 O fear <ree5s e=en 98en t8ey bring gifts. 6)/0. 78ate=er *isfortune *ay be your lot2 it could only be 9orse in Jle=eland. 6)/1. 78ate=er you do2 you'll regret it.
6)/2. 78ate=er you say about pornograp8y2 seR is 8ere to stray. 6)/(. 78ate=er you 9ant to do2 you 8a=e to do so*et8ing else first. 6)/). 78en a fello9 says2 COt ain't t8e *oney but t8e principle of t8e t8ing2C it's t8e *oney. - Ti* +ubbard 6)//. 78en a 8a**er is t8e only tool2 e=ery proble* loo5s li5e a nail. 6)/6. 78en all else fails2 bla*e it on 4an. 6)/@. 78en all else fails2 bla*e it on t8e guy neRt to you 6)/:. 78en all else fails2 read t8e docs. 6)/E. 78en all else fails2 read t8e instructions. 6)60. 78en all else fails2 3D?-. 6)61. 78en all else fails2 ta5e a nap 6)62. 78en all is said and done2 t8en s8ut up 6)6(. 78en angry2 count fourW 98en =ery angry2 s9ear. 6)6). 78en as5ed C78at is a friend2C Qeno ans'd C0not8er O.C 6)6/. 78en c8oosing bet9een t9o e=ils2 O al9ays li5e to try t8e one O'=e ne=er tried before. 6)66. 78en <od endo9ed 8u*an beings 9it8 brains2 +e did not intend to guarantee t8e*. 6)6@. 78en O get t8at feeling2 O need seRual 8ealing - -ar=in <aye 6)6:. 78en O reflect upon t8e nu*ber of disagreeable people 98o O 5no9 8a=e gone to a better 9orld2 O a* *o=ed to lead a different life. 6)6E. 78en O 9ant your opinion O'll gi=e it to you 6)@0. 78en O 9as a 5id2 O 9as an i*aginary play*ate. 6)@1. 78en O'* good2 O'* =ery good. Fut 98en O'* bad O'* better. - -ae 7est 6)@2. 78en in c8arge2 ponder. 78en in doubt2 *u*ble. 78en in trouble2 delegate. 6)@(. 78en in danger298en in doubt2run in circles2yell G s8out 6)@). 78en in doubt2 do 98at t8e President does -- guess. 6)@/. 78en in doubt2 follo9 your 8eart. 6)@6. 78en in doubt2 lead tru*p. 6)@@. 78en in doubt2 lea=e out t8e adUecti=e. 6)@:. 78en in doubt2 *u*ble. 78en in trouble2 delegate. 78en in c8arge2 ponder. 6)@E. 78en in doubt2 *u*ble. 6):0. 78en in doubt2 *u*ble 6):1. 78en in doubt2 ta5e all t8e defaults. 6):2. 78en inla9s are outla9ed2 only outla9s 9ill 8a=e inla9s. 6):(. 78en it co*es to 8u*ility2 O'* t8e =ery F.HD t8ere is 6):). 78en it rains2 it pours. 6):/. 78en *arriage is outla9ed2 only outla9s 9ill 8a=e inla9s. 6):6. 78en not8ing can possibly go 9rong2 it 9ill. 6):@. 78en puns are outla9ed only outla9s 9ill 8a=e puns. 6)::. 78en t8e blind lead t8e blind t8ey 9ill bot8 fall o=er t8e cliff. 6):E. 78en t8e gods 9is8 to punis8 us2 t8ey ans9er our prayers. 6)E0. 78en t8e plane you're on is late2 t8e plane you need to transfer to is on ti*e. 6)E1. 78en t8e plane you're on is late2 your connecting flig8t is on ti*e. 6)E2. 78en t8e sun s8inet82 *a5e 8ay. 6)E(. 78en t8e 9ind is great2 bo9 before itW 98en t8e 9ind is 8ea=y2 yield to it. 6)E). 78en t8ings are going 9ell2 so*et8ing 9ill go 9rong. 6)E/. 78en trut8 entails tre*endous ruin2 lies are pardoned. 6)E6. 78en t9o *en in a business al9ays agree2 one of t8e* is unnecessary. 6)E@. 78en 9ill you reali e Vienna 9aits for you?
6)E:. 78en 9or5ing a proble*2 it 8elps to 5no9 t8e ans9er. 6)EE. 78en you ain't got not8in'2 you got not8in' to lose. 6/00. 78en you are in it up to your ears2 5eep your *out8 s8ut. 6/01. 78en you are in it up to your ears2 5eep your *out8 s8ut. 6/02. 78en you are used to ne=er being alone2 you *ay consider yourself 0*ericani ed. 6/0(. 78en you beco*e used to ne=er being alone2 you *ay consider yourself 0*ericani ed. 6/0). 78en you breat8e you inspire. 78en you don't breat8e you eRpire. 6/0/. 78en you dig anot8er out of trouble2 you'=e got a place to bury your o9n. 6/06. 78en you disco=er you are dead2 a=oid dri=ing a car. 6/0@. 78en you do not 5no9 98at you are doing2 do it neatly. 6/0:. 78en you finally disco=er all of Bife's ans9ers2 t8ey'll c8ange t8e Suestions. 6/0E. 78en you finally see lig8t at t8e end of t8e tunnel2 it 9ill probably be a train co*ing to9ard you. 6/10. 78en you get 5illed you lose an i*portant part of your life. - Froo5e H8ields 6/11. 78en you go out to buy2 don't s8o9 your sil=er. 6/12. 78en you 8ire people 98o are s*arter t8an you are2 you pro=e you are s*arter t8an t8ey are. - 3.+. <rant 6/1(. 78en you 5no92 you 5no9W 98en you don't 5no92 ad*it it. 6/1). 78en you *a5e your *ar5 in t8e 9orld2 9atc8 out for guys 9it8 erasers. 6/1/. 78en you *ention so*et8ing2 if it's bad2 it 8appens2 if it's good2 it goes a9ay 6/16. 78en you're flying t8roug8 t8e air2 re*e*ber to roll 98en you 8it t8e ground. - Hafety Dips for t8e Post-Kuclear .Ristence 6/1@. 78en you're in co**and2 co**and. 6/1:. 78en your co*puter 8as a =irus2 4,K'D use c8ic5en soup 6/1E. 78ene=er O feel li5e eRercise2 O lie do9n until t8e feeling passes. 6/20. 78ene=er people agree 9it8 *e O al9ays feel O *ust be 9rong. - ,scar 7ilde 6/21. 78ene=er you find t8at you are on t8e side of t8e *aUority2 it is ti*e to refor*. - -ar5 D9ain 6/22. 78ene=er you set out to do so*et8ing2 so*et8ing else *ust be done first. 6/2(. 78ere are 9e going? 0nd 98y are 9e in t8is 8andbas5et? 6/2). 78ere are 9e going?... and 98y a* O in t8is 8andbas5et? 6/2/. 78ere are 9e? 6/26. 78ere is t8e tagline supposed to go??? 6/2@. 78ere Suality is Uust a 9ord 9e li5e to use. 6/2:. 78ere t8e 8ell is [usr[8ippo? 6/2E. 78ere t8e 8ell is ,*a5? 6/(0. 78ere t8e 8ell is 7all 4rug? 6/(1. 78ere t8e syste* is concerned2 you're not allo9ed to as5 C78y?C. 6/(2. 78ere t8ere's a 98ip t8ere's a 9ay. 6/((. 78ere t8ere's a 9ill2 t8ere's an On8eritance DaR. 6/(). 78ere t8ere's a 9ill2 t8ere's an in8eritance taR. 6/(/. 78ere t8ere's a 9ill2 t8ere's an On8eritance DaR. 6/(6. 78ere t8ere's life t8ere's 8ope. 6/(@. 78ere you stand depends on 98ere you sit. 6/(:. 78ere's t8e beef? 6/(E. 78et8er you can 8ear it or not2 D8e Lni=erse is laug8ing be8ind your bac5. 6/)0. 78ic8 is not a co*plete sentence2 but *erely a subordinate clause. 6/)1. 78ile drun52 ,'Frien builds a leprec8aun transporter.
6/)2. 78ile t8ere's life2 t8ere's 8ope. - Jicero $)( FJ1 6/)(. 78ile t8ere's life2 t8ere's 8ope. 6/)). 7+OHDB.3'H B07& ;ou ne=er 5no9 98o's rig8t2 but you al9ays 5no9 98o's in c8arge. 6/)/. 78ite d9arf see5s red giant for binary relations8ip. 6/)6. 78o are you? 6/)@. 78o can say 98at's around t8e corner? 6/):. 78o cares any9ay? 6/)E. 78o does not trust enoug8 9ill not be trusted. 6//0. 78o goet8 a-borro9ing goet8 a-sorro9ing. 6//1. 78o is >o8n <alt? 6//2. 78o is 7. ,. Fa5er2 and 98y is 8e saying t8ose terrible t8ings about *e? 6//(. 78o needs a 8ouse out in +ac5ensac5? 6//). 78o needs co*panions8ip 98en you can sit alone in your roo* and drin5? 6///. 78o needs friends 98en you can sit alone in your roo* and drin5? 6//6. 78o refor*atted t8e root dis5? 6//@. 78o t8e 4ic5ens 9rote C,li=er D9istC2 any9ay? 6//:. 78o to 8i*self is la9 no la9 dot8 need2 offends no la92 and is a 5ing indeed. 6//E. 78o 9as Fruce Jlar5e? 6/60. 78o 9as 4an 7als8? 6/61. 78o 9as 4a=e Jardinal? 6/62. 78o 9as .=an 0da*s? 6/6(. 78o 9as ?ran5 Huc8o*el? 6/6). 78o 9as >i* Voll? 6/6/. 78o 9as Tarl 4an ? 6/66. 78o 9as Borrie 4u=al? 6/6@. 78o 9as -ar5 Binton? 6/6:. 78o 9as Hte=e Haperstein? 6/6E. 78o 9as Do* Byon? 6/@0. 78o's on first2 98at's on second2 and O don't 5no9's on t8ird. - Fud 0bbott 6/@1. 78o's scruffy loo5ing? 6/@2. 78o* t8e gods destroy2 t8ey first teac8 7indo9s... 6/@(. 78oops2 O for*atted t8e root dis5. 6/@). 78oops2 stepped on a frog. 6/@/. 78y are apart*ents so close toget8er? 6/@6. 78y are J8inese fortune coo5ies 9ritten in .nglis8? 6/@@. 78y are el=es c8aotic? Fro9nian *otion. 6/@:. 78y are people so un5ind? - Ta*a8l 6/@E. 78y are t8ere no blac5 -G-'s? 6/:0. 78y are t8ere no blue -G-'s? 6/:1. 78y are t8ere no blue -G-'s? 6/:2. 78y are t8ere no fuc8sia -G-'s? 6/:(. 78y are t8ere no grey -G-'s? 6/:). 78y are t8ere no la=ender -G-'s? 6/:/. 78y are t8ere no *au=e -G-'s? 6/:6. 78y are t8ere no pin5 -G-'s? 6/:@. 78y are t8ere no pol5a dot -G-'s? 6/::. 78y are t8ere no purple -G-'s? 6/:E. 78y are t8ere no red -G-'s? 6/E0. 78y are t8ere no tan -G-'s?
6/E1. 78y are t8ere no 98ite -G-'s? 6/E2. 78y are t8ere so *any actors in t8is *o=ie? 6/E(. 78y are you 9asting your ti*e reading taglines? 6/E). 78y be difficult 98en 9it8 a bit of effort you can be i*possible? 6/E/. 78y bot8er p8oning a psyc8ic? Bet t8e* p8one you 6/E6. 78y buy s8a*poo 98en real poo is still free? 6/E@. 78y did Ta*i5a e pilots 9ear 8el*ets? 6/E:. 78y did t8e 3o*an .*pire collapse? 78at is t8e Batin for office auto*ation? 6/EE. 78y do t8ey call t8e* briefings 98en t8ey ta5e H, B,K<? 6600. 78y do t8ose t8at pay t8e least co*plain t8e *ost? 6601. 78y do 9e study po=erty instead of 9ealt8? 6602. 78y do you 8a=e so *uc8 Suic5ness of *o=e*ent if not to a=oid responsibility? 660(. 78y do you t8in5 t8ey call it CfindC? 660). 78y does lo=e got to be so sad? 660/. 78y don't s8ar5s attac5 la9yers? Professional courtesy. 6606. 78y don't you co*e on o=er 8ere2 sit on *y lap2 and 9e'll tal5 about t8e first t8ing t8at pops up? - Pic5 up line 660@. 78y don't you go play in t8e food processor? 660:. 78y is Cabbre=iatedC suc8 a long 9ord? 660E. 78y is Ceasy listeningC so 8ard to listen to? 6610. 78y is it called Crus8 8ourC if it's so da*n slo9? 6611. 78y is t8ere a 9ater*elon on t8e bandsa9? 6612. 78y not go out on a li*b? Osn't t8at 98ere t8e fruit is? 661(. 78y LH0 fails? 3adio H8ac5XLH0's Dec8nology Htore 661). 78y yes2 t8ey are Fugle Foy beans. 661/. 9ill be illegible. 6616. 7ill 8ad a fortune t8e ot8er day2 but 8e forgot it. 661@. 7ill 7indo9s (.1 co*e 9it8 a +ard 4ri=e? 661:. 7OBBO0-H 0K4 +,BB0K4'H B07&Of enoug8 data is collected2 anyt8ing *ay be pro=en by statistics. 661E. 7indo9 garden 8arro9 $pulled be8ind Don5a tractors1 - ?ro* C101 LH.H ?,3 0 4.04 -OJ3,P3,J.HH,3C 6620. 7indo9s (.0& fro* t8e people t8at broug8t you .4BOK 6621. 7indo9s (.1 co*ing to t8e rescue 7ait for ?ed.R 6622. 7indo9s (.1& fro* t8e people t8at broug8t you .4BOK 662(. 7indo9s (.1& t8e best $EE solitare ga*e O'=e e=er seen 662). 7indo9s doesn't 5ill you2 it's t8e glass 98en it cras8es. 662/. 7indo9s Oce Jrea*& +oggin 4,H 6626. 7indo9s is to ,H[2 as .tc8-0-Hcetc8 is to 0rt. 662@. 7indo9s isn't a =irus -- =iruses do so*et8ing 662:. 7indo9s *ay be slo92 but at least it ta5es up a lot of ro 662E. 7indo9s *ay be slo92 but at least it ta5es up a lot of 66(0. 7OK4,7H -LBDOD0HTH $in a 4esSVie9 9indo91 66(1. 7indo9s to ):6[/0 *8 cpu& 4on't rus8 *e2 don't rus8 *e... 66(2. 7indo9s& an :0):6 to MD Jon=ersion Tit. 66((. 7indo9s& :0):6 to :0:: con=ersion *ade painful... 66(). 7indo9s& 0 cute clo9n suit for 4,H. 66(/. 7indo9s& big2 eRpensi=e2 pretty =irus. 66(6. 7indo9s& D8e best $:E solitare ga*e you can buy.
66(@. 7OK<.3'H 3LB.& Of it sits on your des5 for 1/ *inutes2 you'=e Uust beco*e t8e eRpert. 66(:. 7in52 O'll do t8e rest. - Fu*per stic5er 66(E. 7inning isn't e=eryt8ing2 but t8en losing is not8ing. 66)0. 7isdo* is 5no9ing 98at to do neRt. 66)1. 7isdo* is 5no9ing 98at to do 9it8 98at you 5no9. 66)2. 7isdo* out9eig8s any 9ealt8. - Hop8ocles $)06 FJ1 66)(. 7ise *an see *ore fro* botto* of 9ell t8an fool fro* *ountain top. 66)). 7ise *an see *ore fro* *ountain top t8an fool fro* botto* of 9ell. 66)/. 7ise 9ords in t8e *out8s of fools oft belie. 66)6. 7is8ing 9it8out 9or5 is li5e fis8ing 9it8out bait. 66)@. 7it 8as trut8 in it. 7isecrac5ing is si*ply calist8enics 9it8 9ords. 66):. 7it is educated insolence. 66)E. 7it8 all due respect2 O'd li5e to go for a s9i*. - 3i5er 66/0. 7it8 clot8es t8e ne9 are best2 9it8 friends t8e old are best. 66/1. 7it8 e=ery 9is8 t8ere co*es a curse. 66/2. 7it8 *y Htealt8 -ode*2 you'll ne=er see *e co*ing 66/(. 7it8out fools t8ere 9ould be no 9isdo*. 66/). 7it8out tools t8ere 9ould be no 9isdo*. 66//. 7,- - 7rite only *e*ory 66/6. 7o*en 98o see5 to be eSual to *en lac5 a*bition. - Fu*per stic5er 66/@. 7o*en's libbers are o52 O Uust 9ouldn't 9ant *y sister to *arry one. 66/:. 7o*en& ;ou can't li=e 9it8 t8e*2 pass t8e beer nuts- Kor* 66/E. 7onderful *usic. -y co*pli*ents to t8e clef. 6660. 7ord is a s8ado9 of deed. - 4e*ocritus $)00 FJ1 6661. 7ords are t8e =oice of t8e 8eart. 6662. 7ords 8a=e a longer life t8an deeds. 666(. 7ords *ust be 9eig8ed2 not counted. 666). 7orf beco*es anrgy at t8e t8oug8t of brus8ing 8is teet8. 666/. 7orf 8ides for days 5no9ing 8is bu*ps 8a=e gone flat. 6666. 7orf& CH8ields failingC Picard& C<i=e 'e* *ore 8o*e9or5C 666@. 7or5 eRpands to fill t8e ti*e a=ailable for its co*pletion. 666:. 7or5 fascinates *e. O could Uust sit and 9atc8 it for 8ours. 666E. 7or5 is t8e curse of t8e drin5ing class. 66@0. 7or5 off eRcess energy. Hteal so*et8ing 8ea=y. 66@1. 7or5 out your sal=ation 9it8 diligence. - Fudd8a - last 9ords 66@2. 7ort8 seeing? ;es2 but not 9ort8 going to see. 66@(. 7ort8 seeing? ;es2 but not 9ort8 going to see. 66@). 7ould it 8elp if O got out and pus8ed? 66@/. 7ould ye bot8 eat your ca5e and 8a=e your ca5e? 66@6. 7ould you li5e so*e duc5 for lunc82 e8 *isster2 9ould you? 66@@. 7ould you li5e to 8a=e *orning coffee 9it8 *e? - Pic5 up line 66@:. 7o9 O could'=e 8ad a V[: 66@E. 7o9 D8ey'=e put *y fa=ourite food on t8e *enu again 66:0. 7o9ie2 O'* 8a=ing a really great ti*e 66:1. 7rite all ad=erbial for*s correct. 66:2. 7riting carefully2 dangling participles *ust be a=oided. 66:(. 7riting free =erse is li5e playing tennis 9it8 t8e net do9n. 66:). M0V e8t edisni deppart *a O ple+ 66:/. MD at : -8 . X (:6 at 2/ -8 . ' 7indose
66:6. MD[: -8 X (:6[2/ -8 ' 7indose 66:@. ;a' 5no92 t8at outfit 9ould loo5 great on *y bedroo* floor..... - Pic5 up line 66::. ;a9n a *ore 3o*an 9ay. 66:E. ;ea8? 7ell2 tell t8at to 8er parents. - <eordi 66E0. ;east is yeast and nest is nest and ne=er t8e *ane s8all t9eet. 66E1. ;es *y son2 long ago *ail 9as read 1 pac5et at a ti*e. 66E2. ;es2 O ad*it2 "O" steal taglines?? 66E(. ;es2 O 5no9 O'* off-topic. D8an5 you for your concern. 66E). ;esterday is a cancelled c8eSueW Do*orro9 is a pro*issory noteW today is t8e only cas8 you 8a=e - so spend it 9isely. - Tay Byons 66E/. ;esterday is a *e*ory. Do*orro9 is a =ision. Doday is a bitc8. 66E6. ;esterday 9as t8e deadline on all co*plaints. 66E@. ;et anot8er 8urdle cleared successfully. 66E:. ;ield to te*ptation2 it *ay not pass your 9ay again. 66EE. ;oooouuuuu'rreee Orrele=ant - 4affy 4uc5 of Forg 6@00. ;ou "*ust" be 5idding 6@01. ;ou ain't learning not8ing 98en you're tal5ing. 6@02. ;ou al9ays find so*et8ing in t8e last place you loo52 unless it's not t8ere. 6@0(. ;ou al9ays find so*et8ing in t8e last place you loo5. 6@0). ;ou are a bundle of energy al9ays on t8e go. 6@0/. ;ou are a singer 98o 8as to ta5e any note abo=e 0 9it8 your eyebro9s. 6@06. ;ou are a =ery redundant personW t8at's 98at 5ind of person you are2 redundant. 6@0@. ;ou are about to *a5e a *ost =aluable disco=ery. 6@0:. ;ou are al9ays busy. 6@0E. ;ou are an insult to *y intelligence O de*and t8at you log off i**ediately. 6@10. ;ou are being paged. 6@11. ;ou are being s9apped. 6@12. ;ou are being 9atc8ed. Jut out t8e 8an5y-pan5y for a fe9 days. 6@1(. ;ou are capable of planning your future. 6@1). ;ou are confident of t8ings you 5no9 not8ing about. 6@1/. ;ou are confusedW but t8is is your nor*al state. 6@16. ;ou are deeply attac8ed to your friends and acSuaintances. 6@1@. ;ou are dis8onest2 but ne=er to t8e point of 8urting a friend. 6@1:. ;ou are fair-*inded2 Uust and lo=ing. 6@1E. ;ou are fair*inded2 Uust and lo=ing. 6@20. ;ou are farsig8ted2 a good planner2 an ardent lo=er2 and a fait8ful friend. 6@21. ;ou are fast approac8ing your le=el of inco*petence. 6@22. ;ou are going to 8a=e a ne9 lo=e affair. 6@2(. ;ou are in a *a e of little t9isting passages2 all different. 6@2). ;ou are in a *a e of t9isty little passages2 all ali5e. 6@2/. ;ou are in a *a e of t9isty little progra*s2 all ali5e. 6@26. ;ou are in a t9isting *a e of little passages2 all different. 6@2@. ;ou are lust9ort8y. 6@2:. ;ou are *agnetic in your bearing. 6@2E. ;ou are not *y fat8er - Bu5e H5y9al5er 6@(0. ;ou are only young once2 but you can be i**ature fore=er. 6@(1. ;ou are only young once2 but you can stay i**ature indefinitely. 6@(2. ;ou are scrupulously 8onest2 fran52 and straig8tfor9ard. 6@((. ;ou are secreti=e in your dealings but ne=er to t8e eRtent of tric5ery. 6@(). ;ou are s*art. Jan you *a5e us go?
6@(/. ;ou are so narro9*inded you can see t8roug8 a 5ey8ole 9it8 t9o eyes. 6@(6. ;ou are standing on *y toes. 6@(@. ;ou are sunlig8t and O2 *oon >oined by t8e gods of fortune -idnig8t and 8ig8 noon H8aring t8e s5y 7e 8a=e been blessed2 you and O - -OHH H0O<,K 6@(:. ;ou are ta5ing ad=antage of t8e good nature of a friend. Fe careful. 6@(E. ;ou are ta5ing yourself too seriously. 6@)0. ;ou are too narro9*inded if you can see t8roug8 a 5ey8ole 9it8 bot8 eyes. 6@)1. ;ou are tric5y2 but ne=er to t8e point of dis8onesty. 6@)2. ;ou are truly a r8inestone in t8e roug8. 6@)(. ;ou are ugly and your *ot8er dresses you funny. 6@)). ;ou are unscrupulously dis8onest2 false2 and deceitful. 6@)/. ;ou are 9ise2 9itty2 and 9onderful2 but you spend too *uc8 ti*e reading t8is sort of tras8. 6@)6. ;ou atte*pt t8ings t8at you do not e=en plan because of your eRtre*e stupidity. 6@)@. ;ou auto buy no9. 6@):. ;ou can be replaced by a *ac8ine t8at flus8es. 6@)E. ;ou can be replaced by t8is co*puter. 6@/0. ;ou can cage a s9allo92 can't you2 but you can't s9allo9 a cage2 can you? 6@/1. ;ou can depend on not8ing2 you see? 6@/2. ;ou can get *ore 9it8 a 5ind 9ord and a gun t8an you can 9it8 a 5ind 9ord. 6@/(. ;ou can lead a 8orticulture2 but you cannot *a5e 8er t8in5. 6@/). ;ou can lead a *an to ponderW you cannot *a5e 8i* t8in5 6@//. ;ou can ne=er get rid of a bad te*per by losing it. 6@/6. ;ou can ne=er tell 98ic8 9ay t8e train 9ent by loo5ing at t8e trac5s. 6@/@. ;ou can ne=er trust a 9o*anW s8e *ay be true to you. 6@/:. ;ou can say you're $eRcre*ent1 out of luc5 6@/E. ;ou can tell 8o9 far 9e 8a=e to go2 98en ?,3D30K is still t8e language of superco*puters. 6@60. ;ou can tell it's really cold 98en t8e consultants 8a=e t8eir 8ands in t8eir o9n poc5ets. 6@61. ;ou can't al9ays get 98at you 9ant. - -ic5 >agger 6@62. ;ou can't antagoni e and influence at t8e sa*e ti*e. 6@6(. ;ou can't be opti*istic 9it8 a *isty optic. - Peter Ja*pbell 6@6). ;ou can't c8ange t8e la9s of p8ysics2 JaptainW O'=e got to 8a=e t8irty *inutes. 6@6/. ;ou can't c8eat t8e p8one co*pany. 6@66. ;ou can't e=en cut t8e c8eese. 6@6@. ;ou can't fall off t8e floor. 6@6:. ;ou can't fool *e--t8ere ain't no sanity clause. 6@6E. ;ou can't get t8ere fro* 8ere. 6@@0. ;ou can't get to +ea=en on roller s5ates. 6@@1. ;ou can't go 8o*e again2 unless you set $+,-.. 6@@2. ;ou can't 5iss a girl uneRpectedly--only sooner t8an s8e t8oug8t you 9ould. 6@@(. ;ou can't 9in2 you can't brea5 e=en2 and you can't get out of t8e ga*e. 6@@). ;ou can't 9in. ;ou can't brea5 e=en. ;ou can't e=en Suit t8e ga*e. 6@@/. ;ou cannot ac8ie=e t8e i*possible 9it8out atte*pting t8e absurd. 6@@6. ;ou cannot deter*ine before8and 98ic8 side of t8e bread to butter. 6@@@. ;ou Jannot .scape 3esistance Os ?utile 6@@:. ;ou cannot 5ill ti*e 9it8out assaulting eternity. 6@@E. ;ou cannot 5ill ti*e 9it8out inUuring eternity.
6@:0. 6@:1. 6@:2. 6@:(. 6@:). 6@:/. 6@:6. 6@:@. 6@::. 6@:E. 6@E0. 6@E1. 6@E2. 6@E(. 6@E). 6@E/. 6@E6. 6@E@. 6@E:. 6@EE. 6:00. 6:01. 6:02. 6:0(. 6:0). 6:0/. 6:06. 6:0@. 6:0:. 6:0E. 6:10. 6:11. 6:12. 6:1(. 6:1). 6:1/. 6:16. 6:1@. 6:1:. 6:1E. 6:20. 6:21. 6:22. 6:2(. 6:2). 6:2/. 6:26. 6:2@. 6:2:. 6:2E.
;ou cannot propel yourself for9ard by patting yourself on t8e bac5. ;ou cannot see fart8er t8an ot8ers by standing on t8e feet of giants. ;ou cannot see t8e 9ood for t8e trees. - >o8n +ey9ood ;ou cannot see t8e 9ood for t8e trees. ;ou cannot succeed by critici ing ot8ers. ;ou cannot teac8 a crab to 9al5 straig8t. - 0ristop8anes ;ou cannot use your friends and 8a=e t8e* too. ;ou dialed /):(. ;ou display t8e 9onderful traits of c8ar* and courtesy. ;ou do not 8a=e *ail. ;ou do not need a needle for ruptured pigs. ;ou do 9ell in speculation 98ere land or anyt8ing to do 9it8 eart8 is in=ol=ed. ;ou don't gi=e a da*n about apat8y. ;ou don't 5no9 98at you 9ant2 and are 9illing to go t8roug8 8ell to get it. ;ou don't *o=e to .dina2 you ac8ie=e .dina. ;ou don't need a 9eat8er*an to 5no9 98ic8 9ay t8e 9ind blo9s. ;ou don't usually see t8at 5ind of be8a=ior in a *aUor appliance. ;ou drea* of t8ings t8at aren't and as5 C98y not?C. ;ou enUoy t8e co*pany of ot8er people. ;ou feel a 98ole lot *ore li5e you do no9 t8an you did 98en you used to. ;ou fill a *uc8-needed gap. ;ou get t8e *ost of 98at you need t8e least. ;ou get 98at you pay for. ;ou gotta 5no9 98en to code 'e*2 5no9 98en to *ode*. ;ou gotta 5no9 98en to 8old 'e*2 5no9 98en to fold 'e*. ;ou 8ate *ail. ;ou 8a=e a deep appreciation of t8e arts and *usic. ;ou 8a=e a deep interest in all t8at is artistic. ;ou 8a=e a frog in your poc5et? ;ou 8a=e a *assage. $?ro* t8e H9edis8 pri*e *inister.1 ;ou 8a=e a reputation for being t8oroug8ly reliable and trust9ort8y. ;ou 8a=e a rig8t to your opinions. O Uust don't 9ant to 8ear t8e*. ;ou 8a=e a strong appeal for *e*bers of t8e opposite seR. ;ou 8a=e a strong appeal for *e*bers of your o9n seR. ;ou 8a=e a strong desire for a 8o*e and your fa*ily interests co*e first. ;ou 8a=e a tendency to feel you are superior to *ost co*puters. ;ou 8a=e a truly strong indi=iduality. ;ou 8a=e a 9ill t8at can be influenced by all 9it8 98o* you co*e in contact. ;ou 8a=e an ability to sense and 5no9 8ig8er trut8. ;ou 8a=e an a*bitious nature and *ay *a5e a na*e for yourself. ;ou 8a=e an i*portant role as a negati=e eRa*ple. ;ou 8a=e an unusual eSuip*ent for success. Fe sure to use it properly. ;ou 8a=e an unusual understanding of t8e proble*s of 8u*an relations8ip. ;ou 8a=e been selected for a secret *ission. ;ou 8a=e fallen so far be8ind2 t8ere is no reason to log in. ;ou 8a=e 8ad a long-ter* sti*ulation relati=e to business. ;ou 8a=e 8ate *ail. ;ou 8a=e Uun5 *ail. ;ou 8a=e literary talent t8at you s8ould ta5e pains to de=elop. ;ou 8a=e *ail.
6:(0. ;ou 8a=e *any friends and =ery fe9 ene*ies. 6:(1. ;ou 8a=e *any friends and =ery fe9 li=ing ene*ies. 6:(2. ;ou 8a=e *o*ents. ;ou do 8a=e *o*ents. 6:((. ;ou 8a=e no real ene*ies. 6:(). ;ou 8a=e only a =ery s*all 8ead and *ust li=e 9it8in it. 6:(/. ;ou 8a=e t8e ass of a great artist. - Pic5 up line 6:(6. ;ou 8a=e t8e capacity to learn fro* *ista5es. ;ou 9ill learn a lot today. 6:(@. ;ou 8a=e t8e capacity to learn fro* *ista5es. ;ou'll learn a lot today. 6:(:. ;ou 8a=e t8e po9er to influence all 9it8 98o* you co*e in contact. 6:(E. ;ou 8a=e to be c8eerful so*eti*es2 you 5no9. 6:)0. ;ou 8a=e to go out t8ere and gi=e it 110A in t8e ninetiet8 *inute. 6:)1. ;ou 8a=en't a single redee*ing =ice. 6:)2. ;ou 8u*ans are all ali5e. 6:)(. ;ou 5no9 8o9 to 9in a =ictory2 but not 8o9 to use it. 6:)). ;ou 5no9 8o9 to 9in a =ictory2 +annibal2 but not 8o9 to use it. 6:)/. ;ou 5no9 t8e price of e=eryt8ing and t8e =alue of not8ing. 6:)6. ;ou li5e to for* ne9 friends8ips and *a5e ne9 acSuaintances. 6:)@. ;ou loo5 *ar=elous. 6:):. ;ou loo5 tired 6:)E. ;ou lo=e peace. 6:/0. ;ou lo=e your 8o*e and 9ant it to be beautiful. 6:/1. ;ou *ay already be a 9iener 6:/2. ;ou *ay be a lo=er but you aint no dancer 6:/(. ;ou *ay be recogni ed soon. Per8aps you s8ould 8ide? 6:/). ;ou *ay find yourself be8ind t8e 98eel of a large auto*obile. 6://. ;ou *ay 8a=e *ail. 6:/6. ;ou *ay no9 log in to life. Pass9ord& 6:/@. ;ou *ay par5 any98ere if you turn your four-9ay flas8ers on. - 3ules for dri=ing in Ke9 ;or5 6:/:. ;ou *ean O can put stuff past colu*n @2? 7,7 LKOM is great 6:/E. ;ou *ean2 9e 8a=e 0K,D+.3 *ode* to feed? 6:60. ;ou *ig8t 8a=e *ail. 6:61. ;ou need not 9orry about your future. 6:62. ;ou need to acSuire a little subtlety. 6:6(. ;ou ne=er find an article until you replace it. 6:6). ;ou ne=er 8a=e *ail. 6:6/. ;ou ne=er 8esitate to tac5le t8e *ost difficult proble*s. 6:66. ;ou no9 8a=e 0sian ?lu. 6:6@. ;ou o9n a dog2 but you can only feed a cat. 6:6:. ;ou pat8etic2 puny2 pu5ing2 putrid puddle of poodle piss 6:6E. ;ou plan t8ings t8at you do not e=en atte*pt because of your eRtre*e caution. 6:@0. ;ou prefer t8e co*pany of t8e opposite seR2 but are 9ell li5ed by your o9n. 6:@1. ;ou recoil fro* t8e crudeW you tend naturally to9ard t8e eRSuisite. 6:@2. ;ou roll *y log2 and O 9ill roll yours. 6:@(. ;ou say t8at no92 but try c8e9ing a c8ild t8e neRt ti*e you're car sic5. 6:@). ;ou say t8ings 9it8 your eyes t8at ot8ers 9aste ti*e putting into 9ords. 6:@/. ;ou scratc8 *y tape2 and O'll scratc8 yours. 6:@6. ;ou see t8ingsW and you say2 C78y?C Fut O drea* t8ings t8at ne=er 9ereW and O say2 C78y not?C - <eorge Fernard H8a9 6:@@. ;ou see5 to s8ield t8ose you lo=e and you li5e t8e role of t8e pro=ider.
6:@:. 6:@E. 6::0. 6::1. 6::2. 6::(. 6::). 6::/. 6::6. 6::@. 6:::. 6::E. 6:E0. 6:E1. 6:E2. 6:E(. 6:E). 6:E/. 6:E6. 6:E@. 6:E:. 6:EE. 6E00. 6E01. 6E02. 6E0(. 6E0). 6E0/. 6E06. 6E0@. 6E0:. 6E0E. 6E10. 6E11. 6E12. 6E1(. 6E1). 6E1/. 6E16. 6E1@. 6E1:. 6E1E. 6E20. 6E21. 6E22. 6E2(. 6E2). 6E2/. 6E26. 6E2@.
;ou s8all be re9arded for a dastardly deed. ;ou s8ould a=oid 8edging2 at least t8at's 98at O t8in5. ;ou s8ould go 8o*e. ;ou s8ould 8ardly e=er eSui=ocate. ;ou s8ould use contracepti=es at e=ery concei=able occasion. ;ou s8ould'=e 8eard *e before you got 8ere. - 3o ;ou s8ouldn't touc8 a pig unless it 8asn't been in t8e *ud. ;ou s8o9ed ad*irable restraint for one so s*all. - 7orf ;ou still need t8e last file you re*o=ed. ;ou tread upon *y patience. ;ou used to be indecisi=e. Ko9 you're not sure. ;ou 9ant a fortune? O'll gi=e you a fortune. CFlec8C ;ou 9ere a stranger to sorro9W t8us fate 8as cursed you. ;ou 9ill al9ays 8a=e good luc5 in your personal affairs. ;ou 9ill attract cultured and artistic people to your 8o*e. ;ou 9ill be a 9inner today. Pic5 a fig8t 9it8 a four-year-old. ;ou 9ill be ad=anced socially2 9it8out any special effort on your part. ;ou 9ill be aided greatly by a person 98o* you t8oug8t to be uni*portant. ;ou 9ill be audited by t8e Onternal 3e=enue Her=ice. ;ou 9ill be a9arded a *edal for disregarding safety in sa=ing so*eone. ;ou 9ill be a9arded so*e great 8onor. ;ou 9ill be a9arded t8e Kobel Peace Pri e--post8u*ously. ;ou 9ill be called upon to 8elp a friend in trouble. ;ou 9ill be gi=en a post of trust and responsibility. ;ou 9ill be 8eld 8ostage by a radical group. ;ou 9ill be 8onored for contributing your ti*e and s5ill to a 9ort8y cause. ;ou 9ill be i*prisoned for contributing your ti*e and s5ill to a ban5 robbery. ;ou 9ill be in=ited to dine 9it8 *any i*portant people. ,nce. ;ou 9ill be *arried 9it8in a year. ;ou 9ill be *isunderstood by e=eryone. ;ou 9ill be recogni ed and 8onored as a co**unity leader. ;ou 9ill be reincarnated as a toadW and you 9ill be *uc8 8appier. ;ou 9ill be singled out for pro*otion in your 9or5. ;ou 9ill be sSuirrely today. ;ou 9ill be successful in lo=e. ;ou 9ill be surprised by a loud noise. ;ou 9ill be surrounded by luRury. ;ou 9ill be t8e last person to buy a J8rysler. ;ou 9ill be t8e =icti* of a bi arre Uo5e. ;ou 9ill be tra=eling and co*ing into a fortune. ;ou 9ill be 98ere you *ost desire to be in a s8ort 98ile. ;ou 9ill be 9inged by an anti-aircraft battery. ;ou 9ill beco*e ric8 and fa*ous unless you don't. ;ou 9ill die of ter*inal acne. ;ou 9ill engage in a profitable business acti=ity. ;ou 9ill eRperience a strong urge to do goodW but it 9ill pass. ;ou 9ill feel 8ungry again in anot8er 8our. ;ou 9ill find 98at is not lost and enter 98ere t8ere are no doors. ;ou 9ill forget t8at you e=er 5ne9 *e. ;ou 9ill gain *oney by a speculation or lottery.
6E2:. 6E2E. 6E(0. 6E(1. 6E(2. 6E((. 6E(). 6E(/. 6E(6. 6E(@. 6E(:. 6E(E. 6E)0. 6E)1. 6E)2. 6E)(. 6E)). 6E)/. 6E)6. 6E)@. 6E):. 6E)E. 6E/0. 6E/1. 6E/2. 6E/(. 6E/). 6E//. 6E/6. 6E/@. 6E/:. 6E/E. 6E60. 6E61. 6E62. 6E6(. 6E6). 6E6/. 6E66. 6E6@. 6E6:. 6E6E. 6E@0. 6E@1. 6E@2. 6E@(. 6E@). 6E@/. 6E@6. 6E@@.
;ou 9ill gain *oney by an illegal or i**oral action. ;ou 9ill gi=e so*eone a piece of your *ind2 98ic8 you can ill afford. ;ou 9ill 8a=e a flat tire before t8e end of t8e *ont8. ;ou 9ill 8a=e a 8ead cras8 on your pri=ate pac5. ;ou 9ill 8a=e a long and boring life. ;ou 9ill 8a=e a long and 8ealt8y life. ;ou 9ill 8a=e a long and unpleasant discussion 9it8 your super=isor. ;ou 9ill 8a=e do*estic 8appiness and fait8ful friends. ;ou 9ill 8a=e good luc5 and o=erco*e *any 8ards8ips. ;ou 9ill 8a=e long and 8ealt8y life. ;ou 9ill 8a=e *any reco=erable tape errors. ;ou 9ill 8ear good ne9s fro* one you t8oug8t unfriendly to you. ;ou 9ill in8erit *illions of dollars. ;ou 9ill in8erit so*e *oney or a s*all piece of land. ;ou 9ill 5no9 8appy *otorcyclist by t8e bug stains on 8is teet8. ;ou 9ill li=e a long2 8ealt8y2 8appy life and *a5e bags of *oney. ;ou 9ill li=e by t8e side of t8e road and 8elp so*e pilgri* along life's 9ay. ;ou 9ill li=e to see your grandc8ildren. ;ou 9ill lose an i*portant file. ;ou 9ill *eet an i*portant person 98o 9ill 8elp you ad=ance professionally. ;ou 9ill ne=er 5no9 8unger. ;ou 9ill not be elected to public office t8is year. ;ou 9ill outgro9 your usefulness. ;ou 9ill outli=e t8ose 98o see5 to destroy you. ;ou 9ill o=erco*e t8e attac5s of Uealous associates. ;ou 9ill pass a9ay =ery Suic5ly. ;ou 9ill pioneer t8e first -artian colony. ;ou 9ill probably *arry after a =ery brief courts8ip. ;ou 9ill reac8 t8e 8ig8est possible point in your business or profession. ;ou 9ill recei=e a legacy t8at 9ill place you abo=e 9ant. ;ou 9ill re*e*ber so*et8ing t8at you s8ould not 8a=e forgotten. ;ou 9ill soon forget t8is. ;ou 9ill soon *eet a person 98o 9ill play an i*portant role in your life. ;ou 9ill soon *eet a stranger 98o 9ill beco*e your friend. ;ou 9ill soon *eet a strangler 98o 9ill beco*e your fiend. ;ou 9ill spend t8e rest of your life in t8e future. ;ou 9ill step on t8e nig8t soil of *any countries. ;ou 9ill sur=i=e t8e conflagration. ;ou 9ill triu*p8 o=er your ene*y. ;ou 9ill =isit t8e 4ung Pits of <li=e soon. ;ou 9ill 9in success in 98ate=er calling you adopt. ;ou 9ill 9is8 you 8adn't. ;ou 9ould if you could but you can't so you 9on't. ;ou 9ouldn't 8appen to 8a=e anyt8ing less... duc5y? ;ou'd better stand bac5... O don't 5no9 8o9 big t8is t8ing gets. - 0da* to .=e ;ou'll be called to a post reSuiring 8ig8 ability in 8andling groups of people. ;ou'll be sorry. ;ou're a card 98ic8 9ill 8a=e to be dealt 9it8. ;ou're all clear no92 5id. Ko9 blo9 t8is t8ing so 9e can all go 8o*e. ;ou're at 7itt's .nd.
6E@:. ;ou're dit8picable - 4affy 4uc5 6E@E. ;ou're *y 8ero 6E:0. ;ou're ne=er a loser until you Suit trying. 6E:1. ;ou're on report2 .nsign. -y Suarters2 1E00 8rs. - 3i5er 6E:2. ;ou're one to tell *e 98at O can and can't sense. - Droi 6E:(. ;ou're t9isted and sic5W O li5e t8at in a person 6E:). ;ou're t9isted2 per=erted2 G sic5. O li5e t8at 6E:/. ;oung *en t8in5 old *en are foolsW but old *en 5no9 young *en are fools. 6E:6. ;oung *en2 8ear an old *an to 98o* old *en 8ear5ened 98en 8e 9as young. 6E:@. ;,LK<'H J,3,BB03;& D8e greater t8e funding2 t8e longer it ta5es to *a5e t8e *ista5e. 6E::. ;,LK<'H B07& all great disco=eries are *ade by *ista5e. 6E:E. ;,LK<'H P3OKJOPB. ,? OK4OVO4L0BOD;& .=erybody 9ants to peel t8eir o9n banana. 6EE0. ;our ai* is 8ig8 and to t8e rig8t. 6EE1. ;our ai*s are 8ig82 and you are capable of *uc8. 6EE2. ;our ai*s are 8ig82 and you are incapable of *uc8. 6EE(. ;our analyst 8as you confused 9it8 anot8er patient. 6EE). ;our business 9ill assu*e =ast proportions. 6EE/. ;our business 9ill go t8roug8 a period of considerable eRpansion. 6EE6. ;our cat's *issing? +a=e you c8ec5ed *y bu*per? 6EE@. ;our code s8ould be *ore efficient 6EE:. ;our co*puter account is o=erdra9n. Please reaut8ori e. 6EEE. ;our dept8 of co*pre8ension *ay tend to *a5e you laR in 9orldly 9ays. @000. ;our descendants s8all gat8er your fruits. - Virgil @001. ;our dis5 9ill self-destruct in / seconds. @002. ;our do*estic life *ay be 8ar*onious. @00(. ;our .--ail 8as been returned due to insufficient =oltage @00). ;our education begins 98ere 98at is called your education is o=er. @00/. ;our e*pty file directory 8as been deleted. @006. ;our ene*ies are closing in. @00@. ;our future loo5s brig8t. @00:. ;our 8appiness is intert9ined 9it8 your outloo5 on life. @00E. ;our 8eart is pure2 and your *ind clear2 and your soul de=out. @010. ;our ignorance cra*ps *y con=ersation. @011. ;our 5indness and generosity cause en=y in a po9erful person nearby. @012. ;our logic 9as i*peccable2 captain. 7e are in gra=e danger. @01(. ;our lo=e life 9ill be 8appy and 8ar*onious. @01). ;our lo=e life 9ill be interesting. @01/. ;our lo=er 9ill ne=er 9is8 to lea=e you. @016. ;our *ind understands 98at you 8a=e been taug8tW your 8eart2 98at is true. @01@. ;our *ode of life 9ill be c8anged for t8e better because of good ne9s soon. @01:. ;our *ode of life 9ill be c8anged for t8e better because of ne9 de=elop*ents. @01E. ;our *ode of life 9ill be c8anged to 06)). @020. ;our *ode of life 9ill be c8anged to 0HJOO. @021. ;our *ode of life 9ill be c8anged to .FJ4OJ. @022. ;our *ost useful progra* 9ill be continually i*pro=ed until it is useless. @02(. ;our *ot8er 9as a 8a*ster2 and your fat8er s*elt of elderberries @02). ;our nature de*ands lo=e and your 8appiness depends on it. @02/. ;our o9n Sualities 9ill 8elp pre=ent your ad=ance*ent in t8e 9orld.
@026. ;our present plans 9ill be successful. @02@. ;our progra* is sic5 H8oot it and put it out of its *e*ory. @02:. ;our reasoning po9ers are good2 and you are a fairly good planner. @02E. ;our resu*e 9ill be used on t8e CDonig8t H8o9C *onologue. @0(0. ;our salary 9ill be increased. @0(1. ;our slogan 8ere. @0(2. ;our society 9ill be soug8t by people of taste and refine*ent. @0((. ;our state*ent fully describes t8e situation partially. @0(). ;our step 9ill soil *any countries. @0(/. ;our super=isor is t8in5ing about you. @0(6. ;our talents 9ill be recogni ed and suitably re9arded. @0(@. ;our te*porary financial e*barrass*ent 9ill be relie=ed in a surprising *anner. @0(:. ;our 9inning s*ile is your greatest asset. @0(E. ;our 9or5 is =ery poor2 but at least it's slo9. @0)0. ;ours is no disgrace. @0)1. ;out8 is not a ti*e of life2 it's a state of *ind. @0)2. ;,;, -,4. n. Htate in 98ic8 a co*puter $relati=ely1 rapidly c8anges states bet9een 'LP' and '4,7K'. @0)(. Q*ode* 8as bigger bits2 softer bloc5s2 and tig8ter 0HJOO @0)). Q;-L3<;'H B0F,L3 B07& People are al9ays a=ailable for 9or5 in t8e past tense.