Chapter 17.

7 Point mutations can affect protein structure and function

What we are learning today!

Mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in an encoded protein In other words,

MUTATIONS are BAD for us & GOOD for us

Pink dolphins in the Amazon

Mutant Fruit Flies

Mutant Frog

Human Phalangial Polydactyly

Trisomy 21

POP QUIZ
1. 2.

3.
4. 5. 6.

What is a chromosomal mutation? When does chromosomal mutation occur? (hint mitosis/meiosis) Definition of Aneuploidy & Polyploidy? Definition of Monosomic & Trisomic? Definition of Deletion & Duplication? Define inversion & translocation?

Chromosomal mutation
Occur during meiosis causing either a change in the chromosome number or an alteration of a chromosome.

Nondisjunctio n

pair of homologous chromosomes dont move apart Aneuploidy: Xtra copy or one less copy Trisomic: Chromosome in triplicate (nonlethal) Monosomic: Chromosome missing (always lethal) Polyploidy: more than 2 complete chromosome sets in a cell

Alteration of Chromosome

Cri-du-Chat <kree doo shah>

Gene Mutation: pg: 328-330

Mutation:

Change in the genetic material of a cell Occur on DNA/RNA levels that causes changes in proteins 2 main types:
Point mutations: Chemical changes in just one base pair of a gene

Frameshift mutations: Number of nucleotides added or deleted not a multiple of 3; cause improper grouping of codons

Point Mutations
Substitution:

replacement of one nucleotide pair

Silent mutation: doesnt affect

encoding of protein Missense mutation: still encodes of an amino acid but it may not be the right one. Nonsense mutation: creates a stop codon

Sickle Cell Anemia

The genetic disorder is due to the mutation of a single nucleotide, from a GAG to GTG codon mutation.

Frameshift Mutations
Insertions:

addition of one or more nucleotides Deletion: removal of one or more nucleotides

Mutagens

Physical and chemical agents that interact with DNA in ways that cause mutations

Take Home Message

Mutations GOOD:
Genetic Variations &

can be:

phenotype differences BAD: Cause disease, sickness, or death

Activity
Number 1 5TGGAGCCTTCTGATGCCTAACGTACGT3 Number 2 5TGCTCGCTCCTAATACCAGAGGTGCGG3