B A

UNIVERSITY STUDIO PRESS

 - B M

B A
K

PTO TOMO

UNIVERSITY STUDIO PRESS

E E B

EAONIKH 2006
 UNIVERSITY STUDIO PRESS
E E B &

: 1997 ISBN 960-12-0610-8

: 2006 ISBN set: 960-12-1497-6
A 960-12-1498-4

H '
, ,
, .

IPO OYNTZHA T. 2310 991547, 2310 693959 - Fax 2310 683136

BAIH MAPMOYNH T. 210 4124378 - Fax 210 4135588

UNIVERSITY STUDIO PRESS A.E.

A 32, 546 35 EAONIKH
T. 2310 208731, 209637, 209837 Fax 2310 216647
e-mail: info@universitystudiopress.gr
H : www.universitystudiopress.gr
TOA TOY BIBIOY 5, 105 64 AHNA T. & Fax 210 3211097


V
 8
HN AP APH, IANPIH, APETI KAI IOTEXNIH.

, .

VII


H
. -
, .

. -
.
O
O. -
, -
-
, , O -
.
O -
-
. H
.
-
,
O. -
.

.
.
O .
.
, , -
. .

.
-
.
.
,
.

1997

- IX -


M

. -
, -
. O
.
O ,
, , -
O -
, -
. O , , ,
. -
, ,
, . -
2,5 . ,

, , ,
, .
, -
, . ,
. -
O
. -


, -
. A

. -
. ,
, , , , -
, .
,
,
O .

, , -
,
, , , ,
.
,

- XI -
 , ,
-
.
O , , -
, -
O.
, .

, -
.
,
,
O. -
, ,
.
(burn out syndrome).

.
. O
,
,
() , -
/ . O -
,
.
, ,
. , -
,
,
.

. -
,
, .
, -
. .
O -
, -
, -
, -
, M
.

2006

- XII -
 ..

. . -
, -
,
.
O 1.130 ,
, , , , , ,
, , ,
, , , ,
.
72
6.000(!) .
, -
, -
, . -
: ) ,

, )
)

.
, -
.
,
,
, .

.
,
.

, ,

, .

.

, ,
.

- XIII -
 ,

,
,
.
, , , -
,
,
-
. O ,
.

. .

- XIV -


.
- -

.
-O

XV


. AEAKH, -O, E B, . KOYBA, -O, B O K-

T -O, - , N E N
N H X. KOOTA, A-O, A-
. O, -O, . - O, Staedtische Kliniken Of-
, O T, ON A fenbach, Strahlenklinik, Offenbach, Germany
M. BAIOMANAKH, -O, A. E. KONTOIANNH, PhD, M B, -
B K, N , I & Y
A IVF & Genetics
E. BREE, E K X, K . KOYMAKH, -O, . -
X O, I ,
K

B. EPOYIA, K -O, . OOYO, -O, A O-

K N YEIA

. AMIO, E K I E. INAPOY, -O, E A,

I I, Y T O, N Metro-
M -O N- politan
I E. MANTAAKH, , A, O,
. AKAOOYOY, K, A. - E K A-O-
, K E, N O N H
. MAYPOYH, E K -
O,
N. HMHTPOOYO, A,
A T EUROMEDICA . MAXAIPA, PhD, -, -
,
. HMHTPOYOOYO, , -

K AONA O
. MOYTZOYPH, E K O -

E. EYTYXIOY, A, A K M-
A, A . MATA, Staedtische Kliniken Offenbach, Strahlen-
klinik, Department of Medical Physics and Engineering,
N. ZAMOOY, A, K A- Offenbach, Germany
O, Staedtische Kliniken Offen-
bach, Strahlenklinik, Offenbach, Germany A. MAMIA, -O, -
A
A. ZMA, A, T K A,
N A . K.N. MAEBANH, B, PhD, K A-
A K, N O
M. ZTOY, A, A. , AONA
O
B. MAPMOYNH, -O, A. -
X.. KAONO, A. K, O- , B K AONA O -
T K -
N
E. MEKPH, B, PhD, K A
E. KAMETA, , E B, O- A K, N O
K N I
N.K. KAPAMANO, B N.. MOYNTOYPOOY, E. I A-
O, AAN M
M.B. KAPAMOYZH, -O, A - S. MURRAY, M B, T M B-
K, AONA O , N etropolitan

XVII
XVIII OY

N. NTOMPO, MD, FR CPC, FACP, K - H.E. ANIA, E K X, K-

, A X O, I -
K
. YNOOYO, , A.
K AONA O B. IAAKA, , M -O -
N I
.B. OIKONOMOY, K , E
O T A. KANAH, A, A K, N-
N YEIA
A.. AH, E , -O- . KAPO, -O, A. E K-
- A, B O-
K N
X. ANOOYO, -O, E I. OYKAKO, -O, T K-
A, B K, AONA O , O K
EANH
E.. ANOTOOYOY, PhD, B, Y T-
I, K . . YPIOOYO, I, Y -
AONA O A, A N

. ANTEIOY, , , - N.E. TAAKH, -O, K I-

,

M. AAMIXAH, MD, PhD, A, N. THPIAOY, B, PhD, K A

A K, N O -
K A A

K, N O
. TZANINH, -O, I K
E. APAKEYA, E K
A
A, K AONA
O E. TIMOEAOY, -O, I-

E. ATHPAKH-KOYPMANH, E K
N T A X. TOH, -O, E A, O-
T N I
N. AYIH, -O, K I-
I K. TAMAKIH, , E A -
K AONA O
. EKTAIH, -O, A. K-
I A K. TATAA, K I

. ENEPOYAKH, -O, E-
B, O K I N. TEH, A, A-
O, Staedtische Kliniken Offenbach, Strah-
E. ETPIOY, MD, MPH, - lenklinik, Offenbach, Germany
& , & -
, HM.-AN. TITH, K X, -
K X O, I
. , - K
O, T , -
. OYNTZHA, -O, K

I , A -
A.E. POYIH, PhD, , K O,
I. PMANO, E K X, K- N
X O, I - . XATZHAKH, B, T K ,
K O K EANH
.. AMEH, -O, A. - X. XPITOOYOY, -O, A. -
, O M, I N- B O K N E-
A N
. AMNH, -O, , M. XPITOYAKH, E A, K X-
K I O, N H-
K


POOO EKOH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
POOO EYTEPH EKOH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
POOO .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
OH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . XV
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . XV

Ba (Prognostic) (Predictive)
.............................................................................. 24
.......................................................................... 26
H XEI ................................................................................ 27
5 ............................................ 28
.................................................................................... 5 .................................................................................. 28
O O O OOO ................ 6 / ...................................................... 28
.............................................................................. 8 ........................................................................ 29
O OO O OOO .................. 9 - ...... 29
.................................................................................. 9 .................................. 30
O .................................................. 9 ................ 30
O .............. 10 ................................................ 31
O .................... 12 ............................................................................ 32
O ................ 13 O O O .................. 33
O OOOO-OO H .............................. 14 ............................................................................ 33
............................................................................ 16 ...................................................................... 33
O OO O O OO o oo-o .... 33
OOOO .............................................................................. 17 .......................... 34
................................................................................ 17 () .................. 35
.......................................................... 17
.......................................................... 17 (Isolation Perfusion) ............................................................ 37
...................................................... 18 / / ............................................ 37
............................................ 18 (Isolated Limb Perfusion ILP) ............................ 38
.................................................... 19 (Radiofrequency ablation RF) .... 41
...................................................... 19 ...................... 41
.................................................. 19 ............................................................................ 43
................................................................................ 19 O OO IO O OOOO H ........ 43
.................................................. 19 .......................... 44
................................ 20 .............................................................. 44
............................................................ 22 ...................................................... 44
.................. 22 .............................................................. 45
O () ...................................................... 45
O .......................................................................... 23 .............................................................. 46

XIX
XX OY

O O .......................... 67
.................................................................................... 46
............................................................................ 47 .................................................................... 70
O OO OOOO - O OO
O O O O; ...... 48 (IMRT) ...................................................................................... 70
............................................................................ 51 ............................................................................ 71
O OOO O
............................................................................ 51
: ,
............................................................................ 53
73
OO O O OOOO
.................................................................................. 53 OI OH ........................................................ 73
............................................................................ 54 .................................. 73
................................................................ 73
.......................................................................... 73
55 .......................................................... 73
- .......................................................................... 73
O
- .......................................................................... 74
O O ................................................ 55
+- ........................................................................ 74
................................................................................ 55
(Electron Capture EC) ................ 74
O O I ...................................................... 56
OO O ........................ 57 .......................................................................... 75
(Internal Conversion IC) .................... 75
............................ 57
) ............................ 57 .................................... 75
) (-60, -137) .... 57 .............................................................................. 76
) ........................................................ 57 Rntgen .............................................................. 76
...................................................................... 58 Rntgen-remsstrahlung ........................................................ 76
........................................ 59 Rntgen ...................................... 76
OO O ............................ 59 .................................................... 77
........................................................ 59 J ...................................................................... 77
................................ 59 ........................................................ 77
............................ 60 KERMA (Kinetic Energy Released in Material) ........................ 77
O Bergonie-Tribondeau .............................................. 61 KERMA ...................................................................... 77
O O .................. 61 D
( ) ...................................................... 77
4R OO .................... 62
D
........................................................ 62
( ) ...................................... 77
OO
E I ........................................................ 77
OO .................................................................. 63
...... 77
...... 64
O O (DOSE FRACTIONATION) ................ 65 ................................................................ 78
Y (yperfractionation) ................................ 65 () .................................................... 78
(ccelerated fractionation) .... 65 ................................................................................ 78
(ypofractionation) .................................... 65 ............................................................................ 79
O .................................................................. 79
O .................................................................. 66 -106 .......................................................................... 79
Gross Tumor Volume (GTV) ...................................................... 66 -90 ............................................................................ 79
Clinical Target Volume (CTV) .................................................... 67 -226 ................................................................................ 79
Planning Target Volume (PTV) .................................................. 67 -60 ............................................................................ 79
Organs at risk (OAR) .................................................................. 67 -137 .............................................................................. 80
Treated Volume (TV) ................................................................ 67 -125 ................................................................................ 80
Irradiated Volume (IV) .............................................................. 67 -103 ........................................................................ 80
 OY XXI

-192 ................................................................................ 80 .............................................. 98

........................................................................ 80 ............................ 99
...................................................... 81
........................................................ 82 ........................................................................................ 99
I O O OO .... 82 ........................ 100
................................................................................ 82 .......................... 100
.................................... 83
................................................ 83 .................................................................. 101
................................................ 84
...................................................... 84 .............................................................. 101
.................. 85
.............. 85 ............................................................................ 102
.............. 85
................ 86 ............................................................................ 103
.................... 87 .............................................................. 103
............................................................................ 87 OO .............................................................................. 103
.......................................................................... 104
-
- 107
91
I ................................................................................ 107
................................................................................ 91
O O O .................................... 107
O O
O OO O ...................................... 91 O ............................................................ 107
- .................................................................... 91
O - (cell cycle checkpoints) .......................................................... 109
( cell receptor TCR) ............................................................ 92 G1 S ........................................ 109
- .................................. 92 S ........................................................ 109
OOO G2 S ........................................ 109
O .............................................................................. 93 .............................. 109
OKTONA ............................................ 94
.......... 94 (-Pulse Labeled Mitoses) ................................................ 110
............................................................ 111
.............................................................................. 95 O OO .......................................................... 112
(Growth Fraction GF) .................... 112
.......................................................... 96
(CELL LOSS) .......................................... 112

...................................... 112
.......................................................... 96
Fc A Gompertz .................................. 113
.................................................................... 96
OO (Log Kill) .................... 114
OO O O .................................... 96 .................................................. 116
...................................................... 96 .......................................................................... 116
- Goldie Coldman .................................... 116
.............................................................. 96 O OO O
TIL IL-2 ................................................ 97 (DOSE INTENSITY) .................................................................. 117
TIL TNF- ................ 97 ........................................................................ 119
- .......................................................................... 119
.................................................................. 98
............................................................ 98
XXII OY

Ba .................................................. 127
/ ................................ 128
O O ............................ 128
1.
.............................................................................. 129
OI KINIKE OKIME 123
2. .................................. 139
............................................................ 123 3. T Cockcroft
.......................................... 123 Gault (Clcr).... 139
; ...................................................... 123 4.
Devine ........................................................ 139
O ...................................................................... 123 5.
.................................................... 123 .......................................................................... 140
M I ............................................................ 123 6. DUBOIS
(BSA) (sqM) .... 140
M ............................................................ 123
7. ...................... 140
M .......................................................... 124
.......................................................................... 144
........................................................................ 124
O (Good Clinical Practice GCP) ........ 124
................................................ 124 CH GCP
.......................................................................... 124 145
(CRF) ...................................... 124 H ................................................................................ 145
........................................................ 125 1. OO .......................................................................... 145
(monitor) ............................................................ 125 1.1. (Adverse Drug Reaction ADR) .................. 145
OI OOI .................................................................... 125 1.2. (Adverse Event) ............................ 145
1.3. ( ) .................................... 145
(induction chemotherapy Neoadjuvant) ........................ 125 1.4. .................. 145
(Adjuvant) .................. 125 1.5. [
1 ...................................................... 126 ()] ...................................................... 145
2 ...................................................... 126 1.6. .......................................................................... 146
1.7. .......................................................... 146
(Dose-Limiting Toxicity DLT) ........................................ 126 1.8. .......................................................... 146
1.9. ...................... 146
(Maximum Tolerated Dose MTD) .................................. 126 1.10. ...................................................... 146
(Disease free survival) .......... 126 1.11. (CRF) ...................... 146
(Overall Survival) .............................................. 126 1.12. / ................................................ 146
(Response Duration) .................. 126 1.13. / ...................... 146
1.14. ...................................................... 146
(Time to progression TTP) ............................................ 126 1.15. ( ) ...................... 146
............................................................ 126 1.16. .......................................................... 146
.................................... 126 1.17. .................................................................... 146
................................ 126 1.18. .................................................. 146
.......................................................... 126 1.19. ................................................ 146
........................ 126 1.20. (CRO) .......... 146
.................................................. 126 1.21. .......................................................... 147
.......................................... 126 1.22. .............................................. 147
( 1.23. .................................................... 147
) .......................................................................... 127 1.24. O (GCP) ........................................ 147
( ) .. 127 1.25.
/ (IDMC) (
............................................................................ 127 , ,
.... 127 ) ................................ 147
 OY XXIII

1.26. .............................................. 147 4.2. ................................................................ 153

1.27. 4.3. ........ 153
(AE-IEC, Independant Ethical Commitee) .................... 147 4.4. / .............................................. 153
1.28. .................................... 147 4.5. .................................. 154
1.29. .................................................................. 147 4.6. .................................................... 154
1.30. () .......................................................... 148 4.7.
1.31. (-IRB) ................ 148 .................................................................... 155
1.32. / .... 148 4.8.
1.33. .................................................. 148 ............................................................................ 155
1.34. .................................................................... 148 4.9. ............................................ 157
1.35. / ...................................................... 148 4.10. ...................................................... 158
1.36. 4.11. .......................................... 158
(Investigators Brochure) ................................................ 148 4.12. .......... 158
1.37. .................................. 148 4.13. (-) (-) .............. 159
1.38. .......................................................... 148 5. OTHPIKTH .................................................................. 159
1.39. ................................ 148 5.1. .................. 159
1.40. .................................................... 148 5.2. O (CRO) ........................ 159
1.41. ........................................................ 148 5.3. ............................................ 159
1.42. ( 5.4. .................................................. 159
) ................................................................ 148 5.5. ,
1.43. .................................... 148 .................................................. 159
1.44. ................................................................ 148 5.6. ................................................ 160
1.45. .................................. 149 5.7. ........ 161
1.46. (QA) .............................................. 149 5.8. ...... 161
1.47. (QC) .............................................. 149 5.9. O ...................................................... 161
1.48. ................................................................ 149 5.10. / .................. 161
1.49. ............................................................ 149 5.11. / ................ 161
1.50. (SAE) 5.12. ................ 162
(ADR) ........................................................ 149 5.13. , ,
1.51. .................................................... 149 ...................................... 162
1.52. .................................................... 149 5.14.
1.53. ................................................................ 149 .................................................................... 162
1.54. .......................................... 149 5.15. .................................................. 163
1.55. (SOP) ...................................... 149 5.16. .............................................. 163
1.56. ........................................................ 149 5.17. ................ 163
1.57. ................................................ 150 5.18. ...................................... 163
1.58. .................... 150 5.19. ........................................................................ 165
1.59. ...................................................... 150 5.20. .......................................................... 166
1.60. .......................................... 150 5.21. ........ 166
1.61. .................................................. 150 5.22. / .................... 166
1.62. ( ) ........................ 150 5.23. ................................................ 166
2. OI APXE TH OHIA ICH GCP ........................................ 150 6. PTOKOO TH KINIKH OKIMH KAI
3. OYO EO O YO / A TPOOOIHEI TOY PTOKOOY ................................ 166
OH OOOI ( / ) ................................ 151 6.1. ...................................................... 166
3.1. ...................................................................... 151 6.2. .................................................... 167
3.2. , ................................ 152 6.3. ........................................ 167
3.3. ...................................................................... 152 6.4. .................................................. 167
3.4. ............................................................................ 152 6.5. ...................... 167
4. EPEYNHTH ........................................................................ 153 6.6. ........................................ 167
4.1. ........................ 153 6.7. .................................. 168
XXIV OY

6.8. .................................................... 168

6.9. ........................................................................ 168 rastuzumab ........................................................................ 200
6.10. / (antisense)
........................................................................ 168 Angiozyme ............................ 202
6.11. ................ 168 P450 ,
, .................................................. 203
6.12. .................................................................. 168
.......................................................................... 204
6.13. ...... 168
6.14. O .............................. 168
6.15. .................................................................. 168
6.16. ............................................................ 168
7. ENHMEPTIKO YAIO IA TON EPEYNHTH .................. 168
E
7.1. ........................................................................ 168
7.2. .................................................................. 169 209
7.3. H ................................................................................ 209
.................................................................. 169 EOOA OOY .......................................... 209
7.4. 1 .................................................................. 172 E I DNA OI
7.5. 2 .................................................................. 172 (DNA SEQUENCING) .............................................................. 211
8. AAPAITHTA EPAA IA TH IEAH MIA KINIKH ( Sanger) .................................. 211
OKIMH ............................................................................ 172
8.1. ........................................................................ 172 (Southern Northern Blotting) ........................................ 213
8.2. .... 173 OOI O DNA OH DNA ...................... 214
8.3. OOI O DNA H DNA
.......................................................................... 176 OH (cDNA LIBRARY) ................................................ 216
8.4. .. 179 H OH AO ...................................... 217
H I OA
(PCR POLYMERASE CHAIN REACTION) ................................ 217
-
PCR ...................................... 218
181
MOOI DNA (DNA MICROARRAYS DNA CHIPS) .. 219
OHIA 2001/20/EK TOY EYPAKOY KOINOBOYIOY ........ 181 O OI O OY OO
.......................................................................... 193 (CANCER GENOME ANATOMY PROJECT) ................................ 221
Western Blotting .................................................. 221
FIS (fluorescent in situ hybridization) ................................ 222
195 (SKY) .................................. 223
(CGH) .................... 223
................................................................................ 195 .......................................................................... 223
OH H E .............................. 195
OH H E .......................... 196
.................................................. 197 (PROTEOMICS) -
........................................ 197 (GENOMICS) 227
...................................... 197
................................................................................ 227
.......................................................... 198
- (OMICS) .................................. 228
(antisense) ................................ 198
ONIMATIKH (GENOMICS) ................................................ 229
.................................................................... 198 (Conventional karyotyping) .. 229
OEOI APAONTE O OYO OH in situ (Fluorescence in situ
I .............................................................................. 199 hybridization FISH) .............................................................. 229
STI571:
.............................................................. 199 (Spectral karyotyping SKY) .................................................. 230
 OY XXV

-FISH ........................................................ 231

Centromeric multiplex-FISH (CM-FISH) ............................ 231 V O
Rx-FISH ............................................................................ 231
IIKH KAPKINOENEH 249
Fast-FISH .......................................................................... 231
-FICTION (Multicolor-FICTION) .............. 231 I ................................................................................ 249
.................................. 231 OI PAH RNA DNA OKOONN IN .............. 249
IPM-FISH .......................................................................... 231 RNA ................................................................ 249
-FISH (Micro-FISH) .................................................. 231 DNA ................................................................ 251
PRINS ................................................................................ 232 H KAPKINOENEH OYTAIAKO AINOMENO ............ 253

(Comparative Genomic Hybridization CGH) .......................... 232 in vitro ............................................................................ 253
(Nucleic Acid
Based Microarrays) in vivo ............................................................................ 253
(Gene Expression Arrays) ........................................................ 232
...................................................... 253
................................................................ 233 OI IOI AITIA HMIOYPIA KAPKINOY TON ANPO .... 254
MHXANIMOI PAH OKOONN IN TON ANPO ...... 255
O ................................................ 255
...................................................... 233
O .............................................. 256

Epstein-Barr virus ................................................................ 256
.................................... 233
Hepatitis B virus (HBV) .......................................................... 256
...................................................................... 233
Hepatitis C virus (HCV) .......................................................... 257
(PROTEOMICS) ................................................ 234
Human Papilloma virus (HPV) .............................................. 257
(expression proteomics) ............ 235
(functional proteomics) .......... 235 Human Herpesvirus 8 (HHV-8) .............................................. 257
.................................................................... 257
.......................................................... 235
.......................................................................... 258

(two-dimensional polyacrylamide gel electrophoresis
2D-PAGE) ,
(Mass Spectrometry MS) ...................................................... 235 261

H ................................................................................ 261
(Yeast two-hybrid system) ...................................................... 235
OH OE ............................................ 261

OA OI ............................................................ 264
(Protein-based Microarrays) .................................................. 236
OH OH O I
E
O OO O IO .............. 265
(Fluorescence resonance energy transfer FRET) ................ 237
IO: I O OHO ............................ 266

IO OH OO
(Laser Capture Microdissection LCMD) ................................ 237
O A ........................................................................ 267
(Tissue Microarrays) .......................... 237
KIO O OOAO .................................................... 267
RNA (RNA interference RNAi) .......................... 238
IO TOY OAO .................................................... 268
O OOO O
IO TOY EO EO .......................................... 269
OO .......................................................................... 238
KIO O HO OO ...................... 270
(wet genomics) .............................. 238
IO O EO .................................................. 270
.......................... 239
KIO O YO .................................................... 271
(Pharmacogenomics) .................... 239
IO O A ........................................................ 272
(Gene therapy) .................................... 239
IO O O .................................................... 272

KIO O EO .................................................... 272
- ...................................................................... 240
KIO O OY .......................................................... 273
A .................................................................... 241
KIO O OY O A ................................ 274
.......................................................................... 242
IO O HO H ................................ 274
XXVI OY

IO O OIO .............................................. 275 OOH Y O IO .......................... 305

KIO O .................................................... 275 OH A O IO ...................................... 306
IO O OA ...................................................... 276 DNA OOI (MICROARRAYS) IO ........ 306
IO O ...................................................... 276 I .............................................................................. 307
IO OOOO Y ...................................... 277 .......................................................................... 307
IO O OY ........................................................ 278
IO O AO .................................................... 278 311
IO O OOY ................................................ 279
................................................................................ 311
HODGKINS HODGKINS ........................ 279
O O OO .......................................... 311
I ............................................................................ 280
OOO O .................................................... 312
OH OH H
O IO .................................... 281 O O (GENETIC TESTING) .............................. 313
.......................................................................... 281 OOO O O O ................ 314
OOO O O O ...................... 318
O ........................................................ 322
V K OO O ................................ 323
Peutz-Jeghers ...................................................... 323
293 Gardner ................................................................ 323
H ................................................................................ 293 Li-Fraumeni .......................................................... 323
O-OOOI ............................................................ 294
(ultiple endocrine neoplasia 1) ................................ 324
- ................................ 294
2
- ............................ 294
(ultiple endocrine neoplasia MEN 2) ................................ 324
OOOI ........................................................................ 295
2 ............................................................ 324
.............................................................. 295
2 ............................................................ 324
............................................................ 295
O ............ 324
........................................ 295
.......................................................................... 325
.......................................... 295
.......................................... 296

............................................................ 296
........................................................ 296 V
................ 296
OOOO OI ...................................................................... 296 EEXO TOY KAPKINOY YNATOTHTE
DNA ................................................................ 296 POHTIKH APEMBAH 333
RNA ................................................................ 297 O .............................................................................. 333
O ................................................ 300 E A ................................................................ 335
OO-A OI ................................................ 300 .................................................................................... 336
Knudson ...................................................... 301 .............................................................. 336
(LOH) .............................................. 302 O EO ...................................................... 336
AI H IO ............................................ 339
- I .......................... 302 .......................................................................... 339
Wilms .................................................................... 302
O ............................................ 302
341
.................................................................. 302
Li-Fraumeni .......................................................... 303 E ................................................................................ 341
OA OI ........................................................ 303 O .......................................................................... 341
O ............................................................................ 303 OO ON O -O .. 342
O p53 .................................................................. 303 .... 342
p53 .................................................................. 304 - ........ 343
OE I OH OO ........ 304 OO ON O TOY O .......... 343
 OY XXVII

.... 343 OI H O O
.................. 343 O OOOO Y .................................................. 366
XOO TON O TOY O ................ 344 IOO .............................................................................. 366
.............................................................................. 344 .......................................................................... 367
.......................................................................... 345
.......................................................................... 346
(-4-hydroxyphenyl-retinamide 4-HPR) ...... 347 371
........................ 347 O OI .......................................... 371
() .............................................. 347 OOH OH O
OO TON O TOY O O OE OE E AO
O ................................................................................ 348 I ...................................................................... 373
........................................................ 348 OOH OH OOI ........................ 374
............................................................................ 348 OH I OOO ...... 375
O ...................................................................... 348 i. .......................................................................... 375
O ........................................................ 349 ii. .......................................................................... 375
a-difluro-methyl-ornithine (DFMO) ........................................ 349 iii. ................................................................ 377
O (NSAIDs) iv. .................................................................... 377
........ 349 v. ............................................................ 377
- 2 (COX-2) .......................... 350 vi. .................................. 377
OO TON O TOY O ............ 350 OH I O ................ 378
.............................. 350 ........................................ 379
H .............. 351 .......................................... 379
DHT .............................. 351 .................... 380
.............................................................. 351
............................ 380
GSTP-1 .................................. 352
I O .................................. 380
A OOE ........................................ 352
E A O OH
.......................................................................... 352 OH ........................................................................ 381
O BIRADS OA OOY
357 EO ................................................................................ 382
H ................................................................................ 357 OOO EO O
E E OOOI O .................................. 357 OI ........................................................................ 383
(Specific tumour antigens) ...... 358 O
...................................................................... 383
E OY OOY ...................... 359
A O (CELLULAR VACCINES) ........................ 359
.................................................................. 384
.............................................. 359
( ) ................ 384
.............................................. 360
OI O OO EO (SCREENING) .... 385
...................... 360
H O O OOI

OI .............................................................. 390
................................................................................ 361
.......................................................................... 390
A O (NON-CELLULAR VACCINES) .......... 362
.................................................... 362
(Purified Immunogens) .... 363
...................................... 363 (...) 393
........................................................................ 364 OOH I IO O
(gangliosides) .................................................... 365 (FECAL OCCULT BLOOD TEST F.O.B.T.) E E
.................................. 365 OH OOI EO OA .................. 393
OOO EO (Y OOOOO-
/ OONOO) ................................................ 395
(genetic vaccination / recombinant vaccines) ........................ 365 ...................................... 396
XXVIII OY

.................................................................... 397
........................................................ 410
........................................................ 398 O O O O O
H E O OOY .......................................... 398 O ................................................................................ 411
KOOOYO IO EO EO - .................................................................... 411
O EO .............................................................. 399
............................................ 399 ; .......... 412
O (FAP) .................... 399 OO N POPAMMATN
........................................................................ 399 O O O ...................................... 412
.............................................. 399 O O O
- O ................................................................................ 412
(Hereditary nonpolyposis colorectal cancer .............................. 412
HNPCC) .................................................................................. 400
........................................................................ 400 (screening) ............................................................................ 413
.............................................. 400
Amsterdam ...................................................... 402 ; ................................................................................ 413
Bethesda- ............................ 402 .................... 413
.......................................................................... 402 .................................................................... 414
.......................................................................... 414

PSA 405 419
O O EO O O OO
A .............................................................................. 405 O ................................................................................ 420
O O H
; ................................................................................ 405
O O TOY OO O O O O O
O O ...................................................................... 406 O O O O ........ 421
OO O O O test ; ........ 421
O ................................................................................ 406 test
...................................... 406 ; ...................................................................... 422
(TRUS) ...................................... 407
(PSA) ........................................ 407 .................................................................... 422
, PSA .......... 407 .................................................... 422
PSA; ................................ 408 OO ................................................................ 422
................................................ 422
PSA ........................................................ 408 OOO O
OO OO
PSA (1c) ........ 408 (Y BETHESDA 2001) .................................................. 422
PSA (PSA Density) .......................................... 408 ...................................................... 422
PSA (PSA Velocity) .................. 409 .............................................................. 422
( ) .......... 409 ........................................................ 422
PSA (f/t PSA) ................................ 409 ........................................................ 423
............................................................ 423
; ...................................... 410 .......................................................................... 423
 OY XXIX

V A (Methyl CCNU MeCCNU) .......................... 452

(Streptozocin) ........................................ 452
............................................................................ 452
H IAIKAIA ANATYH NEN
-D (D-actinomycin) ...................................... 453
ANTINEOAMATIKN APMAKN 431
(Mitomycin C) ................................................ 453
................................................................................ 431 .................................................................. 453
............................................................................ 431 (Daunorubicin) .................................... 454
................................................................................ 431 (Doxorubicin) .......................................... 454
.................................................................... 433 (Epirubicin) .................................................. 455
........................................ 433 I (Idarubicin) .................................................. 455
.................................... 433 (Mitoxantrone) .......................................... 455
Compare ............................................................ 434
.................................................. 435 (Pegylated liposomal doxorubicin) .................................... 456
.......................................................... 435 O O .............................................. 456
.................................................................. 435 G1 ............................................................................ 456
I .................................................................... 435 .................................................................................. 456
.................................................................. 436 L- (L-Asparaginase) .................................. 456
.................................................................. 436 S .............................................................................. 457
OO O OO IAOH O NCI ........ 436 .................................................................... 457
C-DNA MICROARRAYS (O) .............................. 437 ...................................................... 457
5- (5-FU, Fluorouracil) .......................... 457
O O O ALL ...................... 440 (Tegafur) ...................................................... 459
O O .......................................................... 459
OO O - (Cytarabine) ................................ 459
.............................................................................. 440
(Capecitabine) ............................................ 459
.................................................................... 442
(Gemcitabine) ................................................ 459
.......................................................................... 442
.......................................................... 460
(Thioguanine) ............................................ 460
6- (6-Mercaptopurine) ........................ 460
445 (Azathioprine) ............................................ 460
KO YO .............................................................. 445 .............................................................. 461
A O OY YO .......................................... 445 (Hydroxyurea) ............................................ 461
H A O OY ........................ 445 ...................................... 461
A O OY YO A .................... 447 - (Methotrexate) .................... 461
.................................................. 447 G2 ............................................................................ 462
(Nitrogen Mustard) ........ 447 .............................................................................. 462
(Cyclophosphamide) .......................... 448 (Bleomycin) .................................................. 462
(Ifosphamide) .............................................. 449 (Mithramycin) .............................................. 462
(Melphalan) (L-Phenylalanine Mustard, ............................................................ 463
L-PAM) .............................................................................. 449 ................................................................ 463
(Chlorambucil) ...................................... 450 (Etoposide VP 16) ........................................ 463
(Busulphan) .............................................. 450 (Teniposide VM 26) .................................... 464
(Thiotepa) .......................................................... 451 .............................................................................. 464
...................................................................... 451 Vinca Rosea .................................................. 464
(Carmustine BCNU) ................................ 451 (Vinblastine) ................................................ 464
(Lomustine CCNU) .................................... 452 (Vincristine) .................................................... 465
XXX OY

(Vindesine) ........................................................ 465 ...................................................................... 487

(Vinorelbine) .............................................. 466 , , ............................ 487
.................................................................................. 466 - .......................................................... 487
(Paclitaxel) .................................................... 466 ........................................................................ 488
(Docetaxel) .................................................... 467 ...................................................................... 488
........................................................ 467 ........................................ 488
(Cisplatin) ........................................................ 467 ............................................................................ 488
(Carboplatin) .......................................... 468 .................................................... 489
O (Oxaliplatin) ................................................ 469 ...................................................................... 489
................................ 469 .......................................................... 490
(Dacarbazine DTIC) .............................. 469 .......................................................................... 490
(Temodal) .................................................. 469 OO OO .............................................. 491
(Procarbazine) ........................................ 469 .............................................................................. 491
................ 471 .................................................... 492
OH OO OI ........................ 471 ...................................................... 493
.................................................................. 471 .............................................. 493
.................................................................. 471 .............................................. 494
.................................................................. 472 M ............................................ 495
........................................................ 473 .................................................. 495
.......................................................... 473 - .................................................... 496
.................................................... 474 .................................................................. 497
.......................................................................... 475 O ............................................ 497
................................................................ 497
477 .......................................................................... 498
OO ........................................................ 499
OOO O Raynaud .............................................................. 499
O ........................................................................ 477
................................ 500
.......................................................... 477
.......................................... 501
.................................................... 477
.............................. 501
.............................................................................. 477
E .............. 502
...................................................................... 479
.................................................................. 502
O ............................................................ 479
.......................................................................... 502
.................................................................. 479
OOO O OO
.......................................................................... 480
O .......................................................................... 503
.................................................................... 480
.................................... 504
........................................................................ 480
.............. 504
.......................................................................... 481
........................................................................ 505
........................................................................ 481 ...................................... 505
............................................................................ 481 ................................................................................ 505
........................................ 481 .................................................................. 506
O .................................... 482 ........................................................ 506
.......................................... 482 E ................................................ 506
.................................. 507
.................................................... 483 .......... 507
.......................................................................... 483 -
............................................ 485 .................................................. 508
L- .................................................................... 485 K .................................. 508
.................................................................................. 486
........................................................ 487 ( ) ........................................................ 509
 OY XXXI

........................................................................ 509 .................................. 528

............................................................................ 509 .................................................................. 529
.................................................................. 509 .................................................................... 529
.......................................................................... 510 .............................................. 530
...................................... 510 ............................................................ 530
5- ................................................................ 510 v v .................................................... 531
............................................................................ 510 .......................................................................... 531
.............................................................................. 510 .......................................................... 531
.......................................................................... 511 ...................................................................... 531
rastuzumab (Herceptin) ........................................................ 511 ........................................................................ 531
.......................................................................... 511 ........................................................ 531
OH OO .................................................... 514 .................................................................. 531
.............. 515 ........................................................ 531
............................................ 515 -
.................................................................. 516 (CINV) .................................................................... 532
............................................................................ 516 O ...................................................................... 533
C .......................................................................... 517 (delayed emesis) ........................................ 533
........................................................................ 517 (anticipated emesis) .......................... 533
.......................................................................... 517 ............................................................ 533
........................................................................ 518 .................................................................... 534
.................................................................... 518 .................................................................. 534
.................................................................. 518
.................................................... 534
........................................................................ 518
.................................................................. 535
- .......................................................... 519
............................................ 535
.......................................................................... 519
........................................................ 535
........................................................................ 519
O .............................................................. 535
.......................................................................... 519
( ) .................................... 535
OOH OO .................................................. 521
O .......................................................................... 536
.................................................... 522
.................................... 536
.......................................................................... 522

OO O O
.................................. 536
O OO .................................................................... 522
.............................. 537
.............................................................................. 522
........................................................................ 522
(GVHD) ................................................................ 537
.................................................................. 523
GVHD .................................... 537
.................................................................... 523
.......................................................................... 538
.......................................................................... 523
OOO ................................................................ 542
........................................................................ 523
........................................................................ 523 ...................................................... 544
5- ................................................................ 523 ............................................................................ 546
- .......................................................... 524 ............................................ 546
............................................................ 524 ...................................................... 546
............................................................................ 524 O ........................................ 547
.................................................................. 524 O ........................................................ 547
.......................................................................... 524
OO O O O Y .................... 525 ................................................................................ 548
............................................................................ 525 .......................................................................... 548
........................................................ 526 OO OI OA .......... 550
.................................................. 527 ................................................ 550
XXXII OY

................................................................................ 551 ................................................................................ 580
........ 552 .... 581
........................ 553 ................................ 584
v .................................................................. 553 O (O) .......................... 584
.................................................................... 553 dgkins () ............................ 585
.................................. 554 .......................................... 586
.......... 554 .......................................................... 587
.... 554 .................................... 588
.......................................................................... 555
............................................................................ 590
.............................. 591
557

................................................................................ 557 ............................................ 592
O O ........................................ 558 OO O O .... 592
............ 558 O O-
.............................. 559 O O ............................................ 594
........................ 559
...................................... 559 ........................................................ 594
...................... 560
OO O () ...... 560 (AA) ...................... 594

-gp .......................................................... 561
............................................................ 594

P-gp .................................................................... 562 I ........................................................ 595
.......................................................................... 596

MRP .................................................................... 563
........................................................................ 564
V H

LRP (Lung-Resistance Protein) .......................... 564
O O ................ 564
.................. 564
...................................... 565 603
........ 566 OOI O OO .................................... 603
.................................................... 566 O ............ 605
O O OO ...... 567 OE OOOI .............................................. 606
p53 ........................................................................................ 568
........................................................................ 568 .......................................... 609
.......................................................................... 568 MOPE OOO TON KAPKINO
TOY MATOY .......................................................................... 610
O ................................................ 610
-
O
575
(Selective estrogen receptor modulators SERMs) ............ 610
O .................................................................. 575 ........................................................................ 611
I I OOO I O- ................................ 612
OTHTA .............................................................................. 575 .......... 613
O .................................................... 577
O O I O ...... 579 .................................................................................. 614

.................................................................... 580 .............................. 615
 OY XXXIII

.................. 616
645
................................................................................ 618
................................................................................ 645
.................................. 618
...................... 645
.................................................. 619
.................................................................... 646
LH-RH ...................................... 620
........................................ 646
SERMs
.......................................................................... 620 E OI O INO
O OA ...................................................................... 646
- .......................... 620
O ............................................................................ 647
...................................................................... 620
.................................................................... 620 O ............................................................................ 647
.......................................................................... 621 LH-RH .................................................................... 647
SERMs .................................................. 621 ONOEPAEIA ME ANTIANPOONA TH EPAEIA
TOY KAPKINOY TOY POTATH .............................................. 648
........................................................................ 622
O .............................................................. 649
................ 623
.......................................................................... 649
................ 625
.......................................................................... 649
.................... 625
...................................................................... 650

................................................................ 625 150 mg .......................................................... 650
.................................................. 627 EO OOO OO .................. 650
...... 627 O OOO OO ...................... 651
...................................... 627 OO OOO ................................ 651
............ 628 O OOO ............ 652
OOO ............................ 652
.......................................... 628 OPOO .................. 653
O .......................................................................... 653
................................................................................ 630
O

X
...................................................... 630

............................................ 631
.......................................................... 631

.................................................................... 631 BIOOIA METAMOXEYH AIMOOIHTIKN
.................................................................... 632
KYTTAPN 659
............................................................ 633
................................................................................ 659

.............................................................. 633 OH OH ............................................................ 659
LH-RH .................................................................... 633 I O OO A .... 660
.................................................................. 635 .................................................... 660
.......................................................................... 635 ...... 660
................................ 660
(olerance) .......................................... 660

OH O YO O OO
641 A XOO OH OO
................................................................................ 641 OE .................................................................... 661
OH OONOEPAEIA ...................................... 641 .............................................................. 661
OOOI H OO .................... 641 ........................................ 662
O OOOI ...................................................................... 663
OI ................................................................ 642 () .................................... 663
.......................................................................... 642 O (OM) .................................. 663
XXXIV OY

O (O) .................................. 664

.............................................. 665 703
.......................................................... 665
I OY YO .............................................. 704
Hodgkins Hodgkin .......... 666
OI H O H I
.................................................................... 667 A YOOAO OO O ...... 705
O OO OO A ................ 667 .......................................................................... 706
E OO OO A ................ 669
A OOY O OO
A IO OE ...................................... 670 - -
(Conditioning) .............................. 670 709
E .......................... 670 OH O OO
A () ................................................................ 709
...................................................................... 671 O A OO (GVT) .......................................... 710
.................... 672 H O O-OOY O ...... 710
...................................................... 672 OOA H OOI ................ 710
.................................. 673 E E ................................................................ 711
.................................................................. 674 ............................................................................ 711
OO TOY MOXEYMATO KATA TOY ENITH (GVHD) ........ 674 ............................................................................ 711
OE O A O A Y .................................... 711
OA OOI E .... 712
100 A O .............................................. 677 .......................................................................... 713
OOOH A A O
OO A .................................................. 677
OO O O
O OO A .................. 680
E
O OE A O
BAIKE APXE EPITONAKH
OO A .................................................. 681
XHMEIOEPAEIA 719
I OOH A O
OO A .................................................. 681 ................................................................................ 719
O OE ............................................................ 682 OO O .............................. 719
OE OOE .................................................. 684 OO OO O
.......................................................................... 685 OO O .......................................... 720
O OOO OO
O .................................................................................... 720
............................................................................ 721
691 5- (5-FU) .................................................... 721
H ................................................................................ 691 O O O O
OOI O OI IO OO ............................................................................ 722
OY .................................................................................. 691 O O OO .................... 722
................................................................ 692 .......................................... 722
.......................................................................... 725
(Late Intensification) ............................................................ 692

B

(High-Dose Sequential) ........................................................ 692

(Multi-cycle high-dose chemotherapy) ................................ 692

OO ............................................................ 693
-
O
O O ................................................ 696 729
IOO .............................................................................. 698 ................................................................................ 729
.......................................................................... 699 MONOKNIKA ANTIMATA .............................. 731
 OY XXXV

YZEYMENA MONOKNIKA ANTIMATA .......................... 734 - ...................................................................... 764

A ........................................ 734 - ...................................................................... 764
.................................................................. 734 AO O- (TNF-) ................ 764
........................................................................ 735 I-2 .................................................................... 764
POOTIKE ............................................ 737 -2 (rIL-2) .... 764
.......................................................................... 738 ............................................ 765
........................................ 767
-2 .................................... 767
743 -2 ................................................ 767
................................................................................ 743 .......................................................................... 768
OO OO ............ 744
Trastuzumab (erceptin) ...................................................... 744
Cetuximab (IMC-C225) .......................................................... 745
N O
Edrecolomab (17-1A) ............................................................ 746 773
3F8 ........................................................................................ 746
.......................................................................... 774
CC49 ...................................................................................... 746
Anti-VEGF .............................................................................. 746
775
nti-Tenascin ........................................................................ 746
Theragyn (90 Y-Pemptumomab) .......................................... 747 H ................................................................................ 775
OO OO OI DHFR (DIHYDROFOLATE REDUCTASE
O .......................................................................... 747 INHIBITORS) .......................................................................... 776
AO OOI .................................................... 777
Rituximab .............................................................................. 747
5- (5-FU)
Alemtuzumab (Campath-1) ................................................ 748
........................................................ 777
Gemtuzumab ozogamicin (ylotarg) .................................. 748
- 5- (Prodrugs) ............ 778
BL22 ...................................................................................... 749
(Capecitabine, Xeloda) .................................. 778
CD45 ...................................................................................... 749
UFT ........................................................................................ 780
........................................................................ 749
S-1 .......................................................................................... 780
.......................................................................... 749
AO OOOI .......................................... 781
OI YIH ETA .............................. 781

B ANTIOIKA OAN TOXN

(MTA, PEMETREXED DISODIUM, ALIMTA) .............................. 782
OI GARFT (GLYCINAMIDE RIBONUCLEOTIDE
OI BIOOIKOI TPOOOIHTE FORMYLTRANSFERASE) AICARFT (AMINOIMADAZOLE
TH EPAEIA TOY KAPKINOY 755 CARBOXAMIDE RIBONUCLEOTIDE FORMYLTRANSFERASE) .... 784
E IOO .................................................... 784
H ................................................................................ 755
.......................................................................... 784
O ...................................................................... 755
- ...................................................................... 756
.......................................... 756 787
.............................................. 756 ................................................................................ 787
Hodgkins ...... 757 O .............................................................. 787
...................................................... 757 O .............................................................. 789
............................................................ 758 TXD 258 (RPR 11625A) .......................................................... 789
.............................................................. 759 SB-T-1213 IDN 5109 (SB-T-110131) ................................ 790
Kaposi AIDS .................................... 759 RPR 109881A ........................................................................ 791
.............................................................. 760 BMS 185660 .......................................................................... 791
.................................................................. 761 BMS 184476 BMS 188797 2-acyl
- ...................................... 763 .................................................................. 792
- .................................................. 763 .......................................................................... 792
XXXVI OY

795
................................................ 822
H ................................................................................ 795

OI ...................................................................... 796 - ........................................ 822
ZD 0473 ................................................................................ 796
R 3464 .............................................................................. 797 .................................................. 822
A OY A .............................................. 797 .......................................... 822
(JM216) .......................................................... 797 - .. 823
- ............ 823
........................................................................ 798
- .................. 824
: SPI 077 ............................................ 798
.................................................................... 824
A .................................................................... 798
.......................................................................... 825
.......................................................................... 799

- 833
803
................................................................................ 833
................................................................................ 803 OO O OOE O OY
O O ............................................................ 804 OY AO ........................................................ 833
OOO O O ........................ 804
O .............. 806 EGFR .............................................................. 834
........................................................ 806 Cetuximab .............................................................................. 834
O O O .................. 806 ............................................ 836
.............................. 808 EGFR .................. 836
.................. 810 ZD 1839 (Iressa) ...................................................................... 836
................................ 810 OSI-774 (Tarceva) .................................................................. 837
............................................ 811 CI-1033 .................................................................................. 838
.......................................... 811 I OO O OOE HER2 .......................... 839
.................................... 811 Trastuzumab (Herceptin) ...................................................... 839
O .................................................................... 839
OO O ................................................ 811 .................................................................. 839
O OY POAOYN THN AEIOENEH ................ 813 .................................................................. 840
(FGFs) .................... 813 trastuzumab .................................................. 840
O VEGF (VEGF / VEGFR) ...................... 814 trastuzumab .................................... 840
VEGF .................................................. 814 Trastuzumab
VEGF .................................................................... 814 ................................................................................ 841
VEGF-A ...................................... 815 trastuzumab ................................................ 841
VEGF ...................................................................... 816 trastuzumab ................................................ 841
A Tie ...................................... 816 Trastuzumab .................................................. 841
M .................... 817 Trastuzumab .............................................. 842
-OO O .................................... 818 (adjuvant) .............. 842
-1 (TSP-1) .................................................. 818 (neoadjuvant) .......... 842
...................................................................... 819 trastuzumab ........................ 843
.......................................................................... 819 (NSCLC) .......... 843
........................................................................ 819 ................................................................ 843
-O .......................................... 820 STI571 (IMATINIB MESYLATE, GLEEVEC) ................................ 843
.................................................... 844
............................................................................ 821 .................................................................... 844
- .............................................. 822 OI OE .......................................... 845
.......................................................................... 846
.......................................................................... 822 I OO O VEGF .......................................... 847
 OY XXXVII

SU 5416 ................................................................................ 847 M .............................................. 883

Bevacizumab (Avastin) .......................................................... 849 B .................................................... 883
OI O .......................... 850 O O O .................................... 884
............................................................ 850 .................................. 884
........................ 851 ........................................................ 884
.............................................................. 851 ................................................................ 885
.................................................................. 851 .......................................................... 885
.............................................................. 852 .................................................................... 885
OI ............................ 852 .................................................................. 886
Flavopiridol ............................................................................ 852 O O O ............ 886
UCN-01 .................................................................................. 853 O O O O OO .. 886
PKC412 .................................................................................. 854 O O OO .... 887
Antisense Oligonucleotides .................................................. 854 .......................................................................... 887
ISIS 5132 ................................................................................ 854
ISIS 3521 ................................................................................ 855 889
OI FARNESYL TRANSFERASE .......................... 855
O-O .............................................. 889
R115777 (Zarnestra) ............................................................ 857
OOO ................................................ 890
SCH66336 (Sarasar) .............................................................. 858 OO- O ................................................ 891
BMS-214662 .......................................................................... 859 O O ............................................ 891
L 778123 ................................................................................ 860 OO O
OI OO ............................................ 860 OOO ...................................................................... 891
PS-341 (Bortezomib) ............................................................ 860 .................................................................... 892
A .................................................................... 861 .......................................................................... 892
.......................................................................... 861

V Y
V
877 895
O O ........................ 877 OO IO ............................................................ 895
OO O .............................................. 877 O OY OO ........................................ 897
O O O ............................................................................ 897
(TERT) .................................................................................... 878 .................................................................. 897
, OO O .... 879 .............................................. 898
OOO O .............................. 880 .......................................................... 898
OO O OO O ............................................ 898
O O ...................................... 880
OO OO IO ........................ 899
O O
H ............................................ 899
O ............................ 880
O O (...) .......................... 900
O .......................................................... 881
.......................................................................... 900
O OO O ................ 881
( ...) .......................... 902
OO .................................................. 881
OO .............................................................................. 902
.......................................................................... 882
O ........................................................ 902
.................................................. 902
: 883 ................................................................................ 902
................................................................................ 883 ...................................................................... 902
O ........................................ 883 .......................................................................... 903
XXXVIII OY

................................................ 903 OOE E I ...... 913

................................................................................ 903 ...................................... 913
...................................................... 903 ...................................................... 914
.................................................... 904 .............................. 914
.......................................... 904 .............................................................. 915
................................................................ 915
(MST) ................ 904 E I ...................................................... 915
() .......................... 904 ............................................................ 915
.............................................................................. 904 ...................................................... 915
........................................................ 904 .................................................... 915
................................................................................ 905 .................................................... 915
...................... 905 ...................................................... 915
................................................................ 905 ........................................................................ 916
...................................................................... 905 .......................................... 916
.............................................. 905 .......................................................................... 917
.................................................................. 905
.............................................................. 906
...................................................................... 906 ,
...................................................................... 907 921
...................................................................... 907
OO OO
.................................................................. 907
O ........................................................................ 921
........................................................................ 907
(Signal trasduction) ........................ 924
() ............................ 907
OOO OO ...................................... 924
........................................................ 907 O OOO O
NMDA .................................. 907 OO .......................................................................... 925
................................................................ 908 A
...................................................................... 908 (Stem Cell Factor SCF) ........ 928
............................................................................ 908 ...................................... 929
OO O OO ...................... 908 .................................................................... 929
.......................................................................... 908 / -
.................................................................. 908 (GranUlocyte-Macrophage-Colony Stimulating
Factor GM-CSF) .................................................................. 929
...................................................................... 908
...................................... 929
.................................................................... 909
.................................................................... 930
................................................ 909


(GranUlocyte-Colony Stimulating Factor G-CSF) .............. 931
(Patient Controlled Analgesia PCA) .................................. 909
...................................... 931
........................................................ 909
.................................................................... 931
........................ 910
E (Erythropoietin EPO) .............................. 931
...................................................................... 910
...................................... 931
........................................................................ 911
.................................................................... 932
................................................................ 911
(Thrombopoietin TPO) ............................ 932
................................................................................ 911 ...................................... 932
.................................................... 911 .................................................................... 933
............................................................ 911 -11 (IL-11) ........................................................ 933
........................................ 912 ...................................... 933
O .......................................................... 912 .................................................................... 933
O .................................................. 912 O OO
O, H A, O .................... 912 O ........................................................................ 933
 OY XXXIX

O O OO ...................... 934 .................................. 956

G-CSF G-CSF ........................ 934 1. ...................................... 956
.................................................... 934 2. .................................................................... 956
.................................................. 935 3. ................................................ 956
................................................ 935 4. ................................................................ 956
.................................................... 935 ........................................................................ 957
O ...................... 935 OH OH ...................................................... 957
O ............................ 935 ........................................ 957
O ...................................................................... 936 O (O) .................................... 958
O (O) ................................ 936 .......................................................................... 958
.................................. 936
.................................... 936

O (O) ............................ 936
961
() .............................. 936
E ................................................................................ 961
.............................................................................. 937 OOO O ................................ 961
H P ............................ 966
O O O
.............................................................................. 937 O ............................................................ 966
........................................................................ 938 O O OOO O
O O ............................................................................ 967
...................................................................... 938 ........................................ 967
.................................... 938 ........ 968
G-CSF O ............................................................................ 969
(Pegylated methionyl G-CSF, peg-filgrastime) .................... 938
O OO
O O O ...... 938 O O .............................................. 969
A (rHuEpo) .... 938 ........................................................ 969

...................................................................... 970
................................................................ 939
................................................................ 970

............................................................................ 939 ........................................................................ 971
/ .. 939 .................................................................... 972
() .............................. 939 O O O
O O ............................................................ 972

...................................................................... 940 O ...................................................................... 972
...................................................................... 940 ........................................................................ 972
O O OOO .................... 941 ........................................................................ 973
-11 (L-11) ........................................................ 941 ........................................................................ 973
.................................................................... 941 .................................................................... 973
.......................................................................... 941 OO 5-3
OO .......................................................................... 974
O .......................................................................... 974
-
........................................................................ 975
955
............................ 975
H ................................................................................ 955 ........................................ 975
OI .............................................................................. 955 .............................................. 975
.................................. 955 O I 5-3 OO I
.................................................. 955 O .......................................................................... 976
I ................................................................................ 955 5-3 O
................................................................ 955 O .................................................................... 976
XL OY

O -1 ................................ 977 ........ 1000

O .................................................... 978 ................ 1000
O .......................................................................... 978 A ........................................................................ 1000
........................................................................ 978 () .................................................... 1001
O OO O I O O .................................................................... 1002
O TTO ............................................................ 978 .................................................................. 1002
H E .................................................. 979 .............................................. 1002
I OO ........................................ 981 ............................ 1002
.......................................................................... 981 OI O OOY ........................................ 1003
O O OY .......................................................... 1003
985 ...................................... 1004
................................................................................ 985 .................................... 1004
OO OO OOO O ........................................ 1005
...................................................................... 985 O O A .................................................. 1005
O ........................................................................ 987 .................................................................. 1005
.......................................................... 987 .................... 1005
...................................................................... 988 OE OOE ................................................ 1006
............................ 988 ........................................................................ 1006
...... 988
1011
.................. 988
OH OH .......................................................... 1011
O ...... 989
OOOOOI, STRESS E ................ 1012
.................................................. 990
AO O OIO O OO I
.......................................................................... 991
O STRESS .......................................................................... 1013
OOOI AO IO .......................... 1014
993 .............................................. 1014
H ................................................................................ 993 O ...... 1014
I Y OO OI ................................ 993 .......... 1015
OOI AO O .......................... 993 O ...................................................... 1016
OO OI OOY OY .............. 994 O ........................................................ 1017
OE O ...................................................... 994 O
.................................................................... 1018
.............................................................................. 995 O .......................... 1019
O .................................................... 1020
.................................................. 995 E OE O O OO
E OE O ........................................ 997 OO E H
Gram ........................................................ 997 I ............................................................................ 1022
Listeria monocytogenes ........................................................ 997 ........................ 1022
Nocardia asteroides .............................................................. 997 ...................................... 1023
Gram .................................................. 997 H .................. 1024
Aeromonas species .............................................................. 997 ................ 1024
........................................ 997 ...................................... 1024
OOOI I OY OY ...................................... 1025
YO .............................................................................. 998 O I H H .......................... 1027

................................................................................ 999 ................................ 1028
................................ 999 ,
............................................ 999 .................................... 1030
 OY XLI

E OI .... 1030 ANO O O :

................................................ 1030 O O ............................................ 1071
...................... 1031 O O O .......... 1077
............................ 1031 H OO OO O O ........ 1081
............ 1031 O O O O O .................... 1083
.............................................. 1031 O .... 1086
I OOOI .......................................... 1033 ................................ 1086
.................................................. 1086
O .............................................................. 1033
.................................................. 1087
O
................................................ 1087
.................................................................... 1034
.... 1088
O .................................. 1035
...................... 1088
O .................................................... 1035

,
........................................................................ 1090

O O: TO MEO
........................................................................ 1035
OO ...................................................................... 1093

........................................................................ 1097
.................................................................. 1039
H OE (BURN OUT)
I O
OI O OY ............................................ 1042 XVI

.................................... 1042

........................................................................ 1044
1107
.............................................................................. 1107
1053
OO ........................................................ 1107
H .............................................................................. 1053 .................................... 1107
OO OO OYO I OIO ........................................................ 1108
H .................................................................................... 1053 OO IO ...... 1108
OH EO OIO H .................................................................... 1108
YO OOOI .................................................. 1054
.................................................................. 1108
OO EO OO H .......................... 1054 OO O O O .......... 1110
OO OO H .................................... 1055 - .................................................................. 1111
...................................................... 1056 ................................................................................ 1111
............................ 1056 ...................................................... 1112
OO H I O .......... 1057 .......................................................... 1112
Y OH OO OO ...................................................... 1112
H OOE E E ................ 1057
/ .................................................................... 1112
IOO ............................................................................ 1058
.................................................................... 1113
........................................................................ 1059
............................................ 1113
O (Frail) .... 1113
O O
1063 .................................................................................. 1113
.............................................................................. 1063 O .......................................................... 1114
O O O O ........ 1064 ........................................................ 1114
: O O O .................................................................. 1114
O .......................................................................... 1066 .................................................................. 1115
AO O: OO O .................................................................. 1116
O O ........................................................ 1069 .................................................... 1116
XLII OY

.......................................................................... 1116 ...................................................... 1124

............................................ 1117 .......................................................... 1125
.............................................................. 1117 ...................................................................... 1125
O .................................................... 1117 ............................................................................ 1125
.............................................................. 1117 ...................................................... 1125
.................................................................. 1118 OOOI OO A Y .............. 1125
........................................................................ 1118 Hodgkin Hodgkins ............ 1125
...................................................................... 1125
1121 ................................................ 1125
EH .............................................................................. 1121 ...................................................... 1125
A OI .......................... 1121 .......................................................................... 1126
.................... 1121 ...................................................................... 1126
I OO A A Y .............. 1122 ...................................................... 1126
................................................................ 1122 AO I OO A Y .......... 1126
...................................................................... 1122 .............................................................. 1126
............................................................................ 1122 ........................................................ 1126
.............................................................................. 1122 ................................ 1126
( ) .................... 1123 ........................................................ 1126
( V) ...... 1123 ............................ 1126
.............................................. 1123 A OI ...................................... 1126
........................................................ 1123 A O O OY
K .......... 1124 O EO .......................................................................... 1127
................................................ 1124 I OH Y OOOY I
...................................................................... 1124 IO ........................................................................ 1128
............................................................................ 1124 ........................................................................ 1128

O ...................................................................................................................................................... i


B


. , . , . de Bree, . , . .......................... 5

.. , . ................................................................................ 55

: ,
. , . , . , . .................................................... 73

.. , . , . , . .............................. 91

. .................................................................................................................. 107
 H EIPOYPIKH OKOOIA THN AAH TOY AINA
. T, M. X, E. de Bree, . , .

.
1/3

O. O
- . -
. - , , -
, - , .

,
-

- . O -
,
, . -
. . -
20 - -
.
100% . -

.
- , , -
- . -
- ,
, -O, -
O -
, O - . , -
O. - -
O- , -
, -
- .
,
, - -
.
- , - -
, , -
. , -
, -
, .
-
. (, ) -

5
6 OY

, . -
. -
,
- . 18 19
- , ,
-
O . O 3.
O Morgagni, Le Dran Da Salva -
O.
, -
.
, -
. -
. O Perci-
. val Pott (17141788)
.-. . -
. 1829 Joseph Recamier (17741852) -
O O O . -
OOO Ephraim
- McDowell 1809 -
3.000 , 30 4.
- O -
Edwin Smith -
. , -
. -
1 (. 1).
O (460375 ..) ,
, - Crawford Long (18151878) William T.G. Mor-
- ton (18191868). O John Collins Warren5 1846
, . O
-
2. O (Surgical
- Observations on Tumors, 1838). O Joseph Lister (1827
. 18 1912)6 -
, -
1.500 , - .
, - ,
. - , X O
18 20
- .
-
. -
O-
. O Al-
bert Theodore Billroth
, , -
. William
Stewart Halsted -

1. - (. 2). -
(1600 ..). , -
. 7

3. O Halsted Theodor Kocher

2. O Halsted Bern .
1904
.

-
7-8 (. 3). (,
- , ,
, 1 2. )9.
- -
,
-
, - - -

1. O

1775 Percival Pott

1809 Ephraim McDowell
1829 Joseph Recamier
1846 John Collins Warren
1867 Joseph Lister
1873 Albert Theodore Billroth
1878 Richard von Volkman
1880 O Albert Theodore Billroth
1881 Albert Theodore Billroth
1890 William Stewart Halsted
1896 G. T. Beatson
1904 Hugh H. Young
1906 Ernest Wertheim
1908 W. Ernest Miles
1909 (Nobel Prize) Theodore Emil Kocher
1910 Harvey Cushing
1912 E. Martin
1913 O Franz Torek
1927 George Divis
1933 Evarts Graham
1935 Allen O. Whipple
1945 Charles B. Huggins
1957 Oliver Creech
1958 O NSABP Bernard Fisher

NSABP: National Adjuvant Breast and Bowel Project

8 OY

2. Nobel

1909 EMIL THEODOR KOCHER ,

1912 SIR FREDERICK GRANT BANTING
JOHN JAMES RICHARD MACLEOD
1923 ALEXIS CARREL -

1934 GEORGE HOYT WHIPPLE, GEORGE RICHARDS MINOT
WILLIAM PARRY MURPHY
1956 ANDR FRDRIC COURNAND, WERNER FORSSMANN
DICKINSON W. RICHARDS
1966 CHARLES BRENTON HUGGINS O
1990 JOSEPH E. MURRAY E. DONNALL THOMAS

. - , -
-
. -
,
- .
10-11. , -
X O-
Sir .
John Erichsen, B Medical Insti- .
tutions University College, 1873!!
Lancet: ...

1. Breasted JH. The Edwin Smith surgical papyrus. Chicago: MI:
University of Chicago Press, 1930.
2. Hill GJ II. Historic milestones in cancer surgery. Semin Oncol
1979; 6: 409-427.
3. Hayward OS. The history of oncology. I. Early oncology and
the literature of discovery. Surgery 1965; 58: 460.
4. Thorwald J. Science and the secrets of early medicine. New
York: Harcourt, Brace & World, 1962.
5. Moore FD. John Collins Warren and his act of conscience: a
brief narrative of the trial and triumph of a great surgeon. Ann
Surg 1999; 229: 187-96.
6. Cartwright FF. Background to medicine. Surgery in the period
between John Hunter and Joseph Lister. Teach In. 1972; 1:
435-41.
7. Modlin IM. Surgical triumvirate of Theodor Kocher, Harvey
Cushing and William Halsted. World J Surg 1998; 22: 103-13.
8. Wangensteen OH. Has medical history importance for sur-
geons? Surg Gynecol Obstet 1975; 140: 434.
9. Povoski SP. Novel applications of Endo GIA linear staplers
during pancreaticoduodenectomy and total pancreatectomy.
Am J Surg 2001; 82: 77-80.
10. Giuliano , Kirgan DM, Guenther JM, Morton DL. Lym-
phatic mapping and sentinel lymphadenectomy for breast can-
cer. Ann Surg 1994; 220: 391-398.
11. Tanabe KK, Curley SA, Dodd GD, Siperstein AE, Goldberg
SN. Radiofrequency ablation. Cancer 2004; 100: 641-650.
. 9

O OO O ,
OOO -
, . O -
-
-
. -
-

. -


.
, .

O
, -
-
,

, -
.
, -
, - . -
, -
, - , -
- ,
-
, ,
. .
- -
O, , (tu-
- mor).
. -
.
, -
OOO O O OO
. -
. -
, .
. ,
, - . -
, . -
-
-
. . -

, -
, - ,
, . -
- , , -
. - ,
-
, .. -
, . -
.. , -
, , , -
, - .., -
- . , -
, .. ,
, .. ,
. - .
10 OY

. - -
-
, - .
. () -
( ) , , -
(, - ,
) , - ,
.
, -
.
, - ,
. -
. -
OOO O O OOO -
,
. - en block
,
. , ,
- .
. , -
, -
, - -
-
.. - . -

. . -
.
-
, -
, - .
- , -
, -
. ,
. -
. - -
1 . , -
. - () -
, -
, 2 . () -
. - ,
- -.
5 .,
10 .
. - -
- , -
-
, -
. -
- .
, - , -
, - -
. 11

, - , , .
4 -
. 5 -
,
.
-


.



, -
, -

. -
,

. O
, , -

.
O -
-

E 4. -
, .
().
, - AMC A MA MC C
MAC AM M CM ,
MCA AD
CMA
*
(). O 1 N2
- 2 Option N2
3
, - 4sa Option
. 4sb
4d N1 Option
O - 5 Option
6 Option
- 7 N2
- 8a
8p
- 9
N3

. 10 Option N2
11
- 12 N3
, - 13
14a Option
. 14v N3
, 15 Option
16a2, b1 N3
, 16a1, b2 Option
1, 2, 3 17 Option
18 Option
.. - 19 Option N3 N2
(, , , ) - 20 N3 Option N2 N1
E 5. -
1, 2, 3 4. 1, 2, 3,
.
12 OY

1, 2 , , -
3 . ,
. R0
1, Residual,
D1. 1 -
2, D2 D3 -
D4. -
. -
-
. -
-
. - , -
15 .
. - , -
, . O -
. -
-
- ,
(stage migration Will Rogers effect)
. R0.
- . -
,
- -
. - . O -

- -
,
. - R0,
-
. ,
-
. - , -
,
, R1. -

, -
,
, -
(- R2.
). . -
-
OOO O O O
O , , ,
. - .. -
(curative intent) - ,
,
. -
. -
- . -
- ,
. - -
. 13

- -
- .
, , - O
, - -
-
. (, , -
. )
( , -
, -
- ) , -
. -
(, -
, . - ..). O
- , -
. - ,

, . -
(salvage treat- .
ment). ,
().
, - -
.
(. ).
OOO O O ON OO

- . -
. -
. -
cytoredu- ,
ction debulking. -
.
- . -
, ,
, . .

,
- -
. - .
-
() - . -
,
. - --
, , . -
..
- -
. -
(. - --
).
, -
. , -
- -
14 OY

-
, , .
, - -
-
:
. - 1.
. -
, ,
. 1.
, , -
O OOOO - OO H , , -
- ,
, , -
- , , ..
. 2. -
-
, 1. .
-
, - , -
- ,
, 1. - ..
3. -
, , -
, ,
- .
. 4.
20501. , ,
.
, 5.
, - -
, - .
. - ) -
- , , .
, )
.
. O
. -
,
- . O
. , - -
, , , - , .
-
, - .
-
. .
. - O :
, - 1. ,
2. ,
. 3. ,
- 4.
-- 5. .
. 15

-
-
. trocars .
-
- ,
, , - -
. ,
- ,
. , .
O -
, - . O
1015 . ,
. , , , -
, - .. -
- , , .., -
. , -
- -
, - -
. .
-
. .
- -
, ,
, - ,
. - -
- . O
-
- - .
() -
. (performance status) -
O . O -
- Karnofsky ECOG-WHO (. 3)2,3.
. - ,
. ,
, -
( seed . -
and soil) . O - -
, - .
, , , -
, .., , ,
. . .. -
- , -
, -
- , -
. - , ,
- ..
- .
-
.
- . -
- -
16 OY

3. (performance status)

Karnofsky scale2

100 ,
90 ,
80 ,
70 ,
60
50 ,
40 , ,
30 .
20
10
0
ECOG-WHO 3

0 O
1
2 50% ,
3 . 50%
4 .

. 5.
- .
-
, - , ,
, -
- , -
. .
, , -

,
. . O

-
- .
, ,
. , -
, -
. -
, . -
4. , -
- .
-
-
. -
, -
.

1. Edwards BK, Howe HL, Ries LAG, Thun MJ, Rosenberg HM, the nation on the status of cancer, 1973-1999, featuring impli-
Yancik R, Wingo PA, Jemal A, Feigal EG. Annual report to cations of age and aging on U.S. cancer burden. Cancer 2002;
. 17

94: 2766-2792. 1982; 5: 649-655.

2. Karnofsky DA, Abelmann WH, Craver LF, Burchenal. The use
of nitrogen mustards in the palliative treatment of cancer. Can-
cer 1948; 1: 634-656.
3. Oken MM, Creech RH, Tormey DC, Horton J, Davis TE,
McFadden ET, Carbone PP. Toxicity and response criteria of
the Eastern Cooperative Oncology Group. Am J Clin Oncol
4. Meyerowitz BE. Quality of life in breast cancer patients: the
contribution of data to the care of patients. Eur J Cancer 1993;
29A Suppl 1: S59-62.
5. Refaat Y, Gunnoe J, Hornicek FJ, Mankin HJ. Comparison of
quality of life after amputation or limb salvage. Clin Orthop
2002; 397: 298-305.

O OO O
O OO OOOO O -
- -
, , -
. ,
- -
-
, -
.
. - -
,
( )
,
. -
-
. -
/ -
O . -
- -
. ,
- -
.
-

(.. ). -
, -
-
, , , -
,
.
-
. -
- in
- situ (LCIS) -

1,2. - .
X O -
- BRCA 1
- BRCA 2, -
-
- 3,*.
-
.

* O (cumulative risk) 4085%

3.
18 OY

, , - (Familial Ade-
, nomatous Polyposis FAP).
- HNPCC
. ( 15% -
) - . O
-
- / , -
. .
- , , -
4 -
. - (mismatch repair genes, hMSH2,
1394, 6395 1.5006 - hMLH1, hPMS2 hMSH6), -
-
- . , ,
90% (
-
. - ).
, -
, - , -
- / ,
. ( -
- ).
. -
-
adenomatous polyposis coli (APC) -
BRCA 1

BRCA 2 -
100% . 25%
-
FAP -

. 50%

( )
*.
. -
, -
-
, -
100 -

100%
. O 551 (-
-
)7 170 ()8 -
11 2 - 40 .
- , -
- -
(2,3% 1% ).
.

- FAP (attenuated FAP).
/ - -

: - HNPCC.
(Hereditary Non- -
Polyposis Colorectal Cancer Syndrome HNPCC) (

* O (cumulative risk) 560%

3.
. 19

), () 2, -
. -
- -
, - (MTC) (
. - FMTC) -
- , , -
. - ( 2), ,
FAP -
- Marfan (MEN 2B)11. -

- MEN 2A / FMTC 46 .
. , MEN 2B,
, -

1 .
- -
-
Barrett - 24 .
(HGD),
9. * -
( . -
) , -
(occult) , -
. HGD - , -
Barrett ,
, - -
.
HGD .
,
16% HGD
7
. - ,
- ,
.
. O -
CDH1 -cadherin ( , , -
- ..) -
10. (.. , ..). -
18 ,
70% -
38 - / (.. ),
.
. O - .

612 .
. -
, -
- .
-

* An ounce of prevention is worth a pound of cure.

20 OY

-
, -
,
.

O. -

..., -
. -
-
/ . -

/ - (over / 6. .
under-treatment) .
], (rucut
- ), (incisional biopsy)
(excisional biopsy).
(. 6) -
,
, ,
, ..
, -
- . -
. . 12
- -


(, , ..), -
.
(, ,

, ..) -
-
(. ).
. -
.
* -
- -
. O .
- -
, -
, .
- (. 7)
. ** -
O - . -
, - .
-
[Fine Needle Aspiration Cytology (FNAC) - -

* , 100 , 2% , -
2 o 25%!!!
FNA , 8% ( ).
30%13!!
** : 6798%, 7590%, 115%14,15,16. % -

Trucut17.
. 21

.

. -

,
. O -
-
-

-
-
7. trucut .
. O

( ) -
. -
-
, -
-
(.. / ),
, -
.
,
:
1.

(..
rucut /
-
8. . ).
2. O
-
. O .
(Trucut FNA) - -
. -
, -
(US .
CT - ) (. 3. . -
8). H - .
.
- (tourniquet) -
( , - .
), - 4.
( ) -
. .
(incisional biopsy) - 5. -
. . -
- ,
set
. .
.
22 OY

6. , - -
- .
.

7. clips (
-
)
.
-

.

8. ,
/

. O
. -


.
(-
-
, ..).
. FNA
rucut . -
,
. -
9. .
- -
. ,
10. . O -
/ - -
/ FNA /
. Trucut .
11.O ,
. .
-
- ( -
.
12. ).
, , -

.
13. , - -
, ,
- ,
- .
-
.
, -
14. -
,
-
.
.
, -
15. -
FNA / Trucut.

, -

rucut (
(
). O
).
-
16. , -
- . - ,
- - (tattoo),
. -
O .
. 23

, - 4.
(
. ).
5. -
. , -
,
O () - .
O

O -

- / *.
, - O :
. - 1. O -
.
39% - 2. .
18. 3. .
, 4.
, (,
(. 9) , ..).
. -
O : :
1. - 1. O -
- -
. 90%
2. 20 20.
(FNA, Trucut) 2.
. ,
3. . , -

9. -
, . -
, , ,
.., ,
, , , , -
, , , , (
, , ) -
. -
,

,
.

* ,
19.
24 OY

, -
. ,
3. (clinical outcome).
- O
- -
. . -
4.
. O
,
.
5. O (
, .
, , - O / -
). :
6. O - 1.
, ( ).
. 2. ( -
7. ).
. 3. ( ,
8. - ), ,
, ..

21. O - ,
. O - ,
- ,
. .

,
, - (grade)
- (
,
- ). , -
. *
-
. (1,2) (. 10).
- 3,
() - -
. - ,
, - ( ),
.
. -
(Prognostic)
(Predictive) -
O
/ - .
, O (genomics, proteomics)

* , ,
, , , , . -
/ , / / .
. 25

10.
. -

.
,
(second tier lymph nodes)
. -



.
2

-
-
,
.


-
-
. ,
.

-
. O -

-

(head to head) /
. -
,

11. / (meta-analysis) -
. .
. (
) / -
-
(. 11) /
- (risk), (-
, ), (.. -
- ) (,
. ). O -
HER2 / neu,
p53, - .
22,23,24.
O ,
, -
. - .
HER2 , -
-
, -
26 OY

*. ( ). ..
60% 5
- 36% 5
25 - ,
: 40% [(60 - 36%)/60%].
(-
) -
, (baseli-
ne odds). .. 30% - -
5 , - 0 ( 1 ) -
. 1 ( )26.
(annual odds of ,
recurrence), -
. 01 . -

(absolute benefit), -
- -
- -
. .. 60% - . -
5 -
36% 5 , , , -
24% (60 - 36%).
(relative odds re- . -
duction), - ( -
( ) )
( , , )

4.

:
1988
1988

985.000 0,135 133.000 494.000 66.700

152.000 0,263 40.000 139.000 36.500
135.900 0,158 21.500 42.300 6.700
-O 147.000 0,045 6.600 61.500 2.750
O 68.900 0,128 8.800 20.000 2.550
27.300 0,37 10.100 5.800 2.150
99.000 0,053 5.250 28.000 1.500
27.000 0,04 1.100 24.500 1.000
26.900 0,06 1.600 18.100 1.100
39.100 0,038 1.500 18.000 700
14.000 0,04 550 10.900 450
. 70.700 0,015 1.050 23.100 350

Wright D and Delaney T. Treatment of metastatic cancer. In: DeVita V, Hellman S, Rosenberg S, eds. Cancer. Principles
and Practice of Oncology. 1989; Chapter 62: 2245-2332.

* , ,
. (
). , 2
3 6 3 .
. 27

- .
. , -
-
,
(. . O -
4)27. . -
- -
-
(, , - 28. -
..). -
- (1,2) . -
. -
/ -
. -
. -
/
85 . -

. .

(.. ). ,
4 : (cTNM),
(sTNM), (pTNM) -
(aTNM). - .
,
* -
-
**.
, - -
. . O
: (),
, - .
() - -
(). (in vitro)
(re-treat- -
ment TNM / rTNM), - -
in vivo. -
-
- . O -
.
. , -
, , -
, - . -
. -
- . -

* , ,
.
** ,
.
28 OY

-
. ,
, -
- . -
. - -

/ - , -
, ,
.
.
. O
-
- . O
-
- .
- Wilms 75% -
-
1920 1940. 40% -
- .
, ,
(R0). ,
-
, 70% . -
,

12. - .

, -
, - -
en block - 12. -
,
,
. 5 ,
- 29. -
50% 80% -
- .
. -
Halsted /
- -
, 30% - -
- -
. (R1) (R2) ,
,
. .
, - ,

(debulking),

. - , -
.
( ) -
. 29

40 22,7 33,9 (50% -

38 ) (. 12).
()

36

34
-
32
-
30
. O -
28
*
26
-
24
(, , ) -
22
( -
20
0 20 40 60 80 100 ) -
(%) **.
,
12. -
-
. Bristow R, et al. JCO 2002; 20: 1248-1259. , -
.
, , - . O -
. , -
- -
(non-cancer directed surgery).

(.. ) - -
.

, , /
-
.
first order ki-
- netics.

.
. -
-
- -
12. , -
. -30 . zero
81 6.885 order kinetics, -
19891998 -
10% .
5,5 -
. 25% / -
> 75% -

* O . 80% 2 -
. O -
(.. ).
** : ) , , )
, ) , )
, ) , ,
) .
30 OY

. -



,
, -
.

13. .

-
, -
.
-

. -
, -

. -

.

14.
- .
30% .
- O
,
. - . :
- 1. -

. - . -
-
, .
, 2. -
- (radiofrequency
per se. - ablation) (. 13),
- argon (ultra-cold liquid argon gas-
, cryoablation) (. 14) -
- .
(therapeutic intent). -
- .
. - 3.

,
. ,

, : , (. ).
,
,
-
. -
. 31

, 5. -
-
, .
O : O +

1. . -
78% 8% 1%
. 69% 21% 2,7%
50% 29% 10,4%
, - O 5% 3,5%
-
. O
70%
. 6. -
2. . - O Organization
Mondiale de Gastro Enterologie (OMGE), 1986
. -
- (%)
10.320
. O - 3.507 34
O 2.895 28,1
O 1.005 9,7
- 423 4,1
O 413 4
. O 302 2,9
3. . , - 295 2,9
, , , 253 2,5
. 159 1,5
151 1,5
4. .
146 1,4
) : , , 647 6,3
, , ,
, , ,
, - , -
.
) : - . O
, , - ( , )
.
) - -
: , , , - .
. O
) : i. : , ,
-
, / . ii. : -

, .
-
- , . O
-
. - -
- (, / )
-
. -
(. 5). O ,
Top 10 ,
(. 6)31. -
O -
- ,
32
- , .
, , ,
1. , , , . 132(8): 815-8; discussion 819-21.
- 16. White R, Halperin T, Olson J, Soo M, Bentley R, Seigler H.
Impact of core-needle breast biopsy on the surgical manage-
. . 1998; 70: 553-563. ment of mammographic abnormalities. Ann Surg 2001 Jun;
2. , , . 233(6): 769-77.
. - 17. Shah V, Raju U, Chitale D, Deshpande V, Gregory N, Strand
1997; 2: 77-86.
3. Taucher S, Gnant M, Jakes . Preventive mastectomy in pa-
tients at breast cancer risk due to genetic alterations in the
BRCA1 and BRCA2 gene. Langenbecks Arch Surg 2003; 388:
3-8.
4. Meijers-Heijboer H, van Geel B, van Putten W, et al. Breast
cancer after prophylactic bilateral mastectomy in women with
BRCA1 or BRCA2 mutation. N Eng J Med 2001; 345: 159-164.
5. Hartmann L, Schaid D, Woods J, et al. Efficacy of bilateral
prophylactic mastectomy in women with family history of breast
cancer. N Eng J Med 1999; 340: 77-84.
6. Pennisi V, Capozzi A. Subcutaneous mastectomy data: a final
statistical analysis of 1500 patients. Aesthetic Plast Surg 1989;
13: 15-21.
7. Rebbeck T, Lynch H, Neuhausen S, et al. For the Prevention
and observation of surgical end points study group. Prophyla-
ctic orthorectomy in carriers of BRCA1 or BRCA2 mutations.
N Eng J Med 2002; 346: 1616-1622.
8. Kauf N, Satagopan J, Robson M, et al. Risk reducing salpingo-
ophorectomy in women with a BRCA1 or BRCA2 mutation.
N Eng J Med 2002; 346: 1609-1615.
9. Heitmiller R. Prophylactic esophagectomy in Barrett esopha-
gus with high grade dysplasia. Langenbecks Arch Surg 2003;
388: 83-87.
10. Schwartz A. Preventive gastrectomy in patients with gastric
cancer risk due to genetic alterations of the E-cadherin gene
defect. Langenbecks Arch Surg 2003; 388: 27-32.
11. Frilling A, Weber F, Tecklenborg C, Broelsch C. Prophylactic
thyroidectomy in multiple endocrine neoplasia: the impact of
molecular mechanisms of RET proto-oncogene. Langenbecks
Arch Surg 2003; 388: 17-26.
12. Rosenberg S. Principles of Surgical Oncology. In: Devita V,
Hellman S, Rosenberg S, eds. Cancer. Principles and Practice
of Oncology. 1989; Chapter 14: 236-246.
13. Ljung B, Drejet A, Chiampi N, et al. Diagnostic accuracy of
fine needle aspiration biopsy is determined by physician train-
ing in sampling technique. Cancer 2001 Aug 25; 93(4): 263-8.
14. Jackman R, Nowels K, Rodriguez-Soto J, Marzoni F, Finkel-
stein S, Shepard M. Stereotactic, Automated, Large-Core
Needle Biopsy of Nonpalpable Breast Lesions: False-Negative
and Histologic Underestimation Rates after Long-term Fol-
low-up. Radiology 1999; 210: 799-805.
15. Acheson M, Patton R, Howisey R, Lane R, Morgan A. Histo-
logic correlation of image-guided core biopsy with excisional
biopsy of nonpalpable breast lesions. Arch Surg. 1997 Aug;
OY
V. False-negative core needle biopsies of the breast: An analy-
sis of clinical, radiologic, and pathologic findings in 27 conse-
cutive cases of missed breast cancer. Cancer 2003; 97: 1824-31.
18. Zarbo R, Schmidt W, Bachner P, et al. Indications and imme-
diate patient outcomes of pathology intraoperative consulta-
tions. College of American Pathologists/Centers for Disease
Control and Prevention Outcomes Working Group Study. Arch
Pathol Lab Med 1996 Jan; 120(1): 19-25.
19. Weiss S, Willis J, Goldblum J, Greenfield L. Frozen section
consultation. Utilization patterns and knowledge base of sur-
gical faculty at a university hospital. Am J Clin Pathol 1995
Sep; 104(3): 294-8.
20. Novis D, Zarbo R. Interinstitutional comparison of frozen se-
ction turnaround time. A College of American Pathologists Q-
Probes study of 32,868 frozen sections in 700 hospitals. Arch
Pathol Lab Med 1997 Jun; 121(6): 559-67.
21. Gephardt G, Sarbo R. Interinstitutional comparison of frozen
section consultations. A college of American Pathologists Q-
Probes study of 90,538 cases in 461 institutions. Arch Pathol
Lab Med 1996 Sep; 120(9): 804-9.
22. Camp-Sorrell D. Antiangiogenesis: the fifth cancer treatment
modality? Review. Oncol Nurs Forum 2003; 30(6): 934-44.
23. Menard S, Pupa SM, Campiglio M, Tagliabue E. Biologic and
therapeutic role of HER2 in cancer. Review. Oncogene 2003
Sep 29; 22(42): 6570-8.
24. Fridman JS, Lowe SW. Control of apoptosis by p53. Review.
Oncogene 2003 Dec 8; 22(56): 9030-40.
25. Adjuvant Therapy for Breast Cancer, NIH Consensus Deve-
lopment Conference Statement, Nov 1-2, 2000.
26. , .
. . 1997; 69: 502-512.
27. Wright D, Delaney T. Treatment of metastatic cancer. In: De-
vita V, Hellman S, Rosenberg S, eds. Cancer. Principles and
Practice of Oncology. 1989; Chapter 62: 2245-2332.
28. Singletary E, et al. Revision of the American Joint Committee
on Cancer Staging System for Breast Cancer. J CLin Oncol
2002; 20: 3628-3636.
29. Dripps RD, Eckenhoff JE, Vandam LD. Introduction to Ane-
sthesia. Philadelphia: WB Saunders, 1977.
30. Bristow R, Tomacruz R, Armstrong D, Trimble E, Montz F.
Surgical effect of maximal cytoreductive surgery for advanced
ovarian carcinoma during the platinum era: A meta-analysis.
JCO 2002; 20: 1248-1259.
31. DeDombal FT. Diagnosis of acute abdominal pain. Churchill
Livingston, 1986.
. 33

O O -
O , -
O
- -
. - .
, - O O OO-O-
-
-
O
-

. .
3040% ,
.
. (. 7).
- O -
. - -
en block
- . O -
-
, - .
-
. (infusion)
( -
) (per-
- fusion) -

1.
.
O -
- , -
1920. - ( ) (-
-
, 7
DNA, -
- O ()
. -
(Intra-arterial infusion)
-
. - /
5060%
,

-
(solation Perfusion)
. - / /
- (Isolated Limb Perfusion ILP)
, ,
O
.

- (CHPPC)
( -
) ( ). -
( (Radiofrequency ablation RF)
(Cryotherapy)
-

). -
34 OY

-) -
.
. in
vitro,
1950 ,
Klopp2, -
.
. -
1960 - Eckman5.
-
:
, Krementz3
CL
- Advantage = 1 +
(solated Limb Perfu- QA (1 EX)
sion ILP) -
. CL: , QA:
O , Ex: .
- ,
- ( CL)
. ( QA), -
- , - -
(first (. 8).
passage effect), -
,
. 8. -
Collins4 1981 -
-
A O
(steep-dose response), A

-
. in vitro
-
O
1 10 g/ml (. 15).

-
First passage effect
. O -
-


100


75


R%

50


25
Ivalon, Gelfoam, Lipiodol, ,
,
0
0,01 0,1 1 10 100 C
DSM-Spherex
15. -
(steep-dose response). H (Haemofiltration)
1 10 g/ml.
. 35

O -

.
, -
6: .
, -
, . :
-
, , , ,
.
- .
,
. -
(FUDR), 5-FU, -
-

-
(9499%) -

,
-
5-FU, , MMC 9.
-
-
.
-
O -
-


, -
.
7.

-
. (
,
) / -
1033% 50%, -
,
.
.
Pape8 et al,
,
-
, -
-
(. 16).
, -
-,

7 ,
-
FUDR 5-FU (41%
.
14% , -
-
16 13)9.
/ -
-
.
-
()
- .
. O 40 .
-
( ), . -
.
- .
1 mm - O / -
-
. -
- ,
:
.
36 OY

16.
.
( ).

17. block . -
stop-flow, -
, ( ).

, -
, ,
, - 10.
, ,
, - .
- .
7 (. 17). -

- , -
(. 8). . -
O -
. 37

, - -
( )
. - -
, Aigner 1990 11.
- stop-flow
. -
O - , -
-
.
2550% pH.
6 12 . ,
- (L-PAM), (DXR) -
- (MMC). -
20 , , SF micro-emboliza-
. tion,
-
- .
, -
, -
. .
-

,
(Isolation Perfusion)
(perfusion)
/ / stop-flow perfusion isolated perfusion.

- ,
- 20.

- -
. -
(. 18).
. -

18.
(Stop-flow/
Isolated perfusion). -

,

( ).
-
.
-



20.
-

-
.

38 OY

19. -
(stop-flow) ( ).

20.
(stop-flow) ( ).

, , (Isolated Limb Perfusion ILP)

, , , .., -
- -
. 14.
12,13: ( 30 -
- )
. -
(,
) (. 21).
. 10% -
(in-transit)
46 -
. - .
083%, -
(> 50% ) ,
- ,
. . ILP -
(, - 50% -
) , 6080% ,
(. 19, 20). .
. 39

21. in-transit . O , -
ILP .
( ).

F (tumor necrosis factor)

-
- -

100%. -
-
-
.
O TNF, - -

. -

8090% .
-
. -

- 22. -
(Continuous Hy-
, -
perthermic Peritoneal Perfusion Chemotherapy CHPPC)
17 ( ).
-
. - -
, :
15, 16, -
,
(. 22).
40 OY

23. CHPPC -
. , -
. , -
( ).

O 23 mm. -
-
. (. 23).
O -
, ,
- (-)
(. 24).

24. . (
) , -
,
( ).
. 41

(Radiofrequency ablation
RF) -
, ,
(100500 kHz), - ,
/ - . O 46 .
-
. - -
- 35 cm,
, - 3680%20. -
96%
, -
. -
. -
,
, -
, -
,
. -
, heat-shock
.
18. O
6 O O
56 cm, - O
(adjuvant) -
15 cm (. 25). , , -
- -
, - ,
, , , , -
. - ,
, . -
- -
- ,
, , , , -
. . -
, , -
. -
- (IL-2 INF-),
19. - .

25. . -
. ( ).
42 OY

, ,
- ,
.
(- -
-) (- .
-) -
. , -
(mul- . -
tidisciplinary approach) - -
, ,
.., - . O -
-
. .
-
, -
. . ,
. - -
50% -
, -
,
-
-
.

,
75% -

21.

-
. -
. O
- -
, - , .
. - ,
. O , -
, -
. . -
-
- ,
. -
- -
, ,
, - . O
.

-
. - .
, - , -
-
. -
, , -

. - .
-
. 43
1. Pollock R, Morton D. Principles of Surgical Oncology. In:
Holland, Frei, eds. Cancer Medicine. 5th ed. 2000: 448-458.
2. Klopp CT, Alford TC, Bateman J, et al. Fractionated intra-ar-
terial cancer chemotherapy with bis-amine hydrochloride: A
preliminary report. Ann Surg 1950; 132: 811-832.
3. Krementz ET. End results in the treatment of sarcoma by per-
fusion with chemotherapeutic agents. Cancer Chemother Rep
1960 Dec; 10: 83-7.
4. Collins JM, Dedrick RL. Pharmacocinetics of anticancer drugs.
In: Chabner . Pharmacologic principles of cancer treatment.
Philadelphia: WB Saunders, 1982: 77-99.
5. Eckman WW, Patlak CS, Fenstermacher JD. A critical evalua-
tion of the principles governing the advantages of intra-arterial
infusions. J Pharmacokinet Biopharm 1974 Jan; 2(3): 257-85.
6. Aigner KR. Intra-arterial infusion: overview and novel approa-
ches. Semin Surg Oncol 1998 Apr-May; 14(3): 248-53.
7. Aigner KR. Regional chemotherapy-Editorial review article.
Reg Cancer Treat 1994; 2: 55-66.
8. Pape H, Geismar D, Schmid G. Capillar density in preirradiat-
ed breast cancer to predict chemotherapeutic response. Reg
Cancer Treat 1993; Suppl I: 40.
9. Dizon D, Kemeny N. Intrahepatic arterial infusion of chemo-
therapy: Clinical results. Sem Oncol 2002; 29(2): 126-135.
10. Sullivan K. Hepatic artery chemoembolization. Sem Oncol
2002; 29(2): 145-151.
11. Pilati P, Mocellin S, Miotto D, Rossi CR, Codello L, et al.
Stop-flow technique for loco-regional delivery of antiblastic
agents: literature review and personal experience. EJSO 2002;
28: 544-553.
12. Guadagni S, Aigner KR, Palumbo G, Cantore M, Fiorentini
G, Pozone T, et al. Pharmacokinetics of mitomycin C in pelvic
stopflow infusion and hypoxic pelvic perfusion with and with-
O OO IO O OOO- ,
O H
, - ,
. O
-
. , , -
. -
-
-
. .
- -
- 30 -
-
. .
, - .
,
. :
out hemofiltration: a pilot study of patients with recurrent un-
resectable rectal cancer. J Clin Pharmacol 1998 Oct; 38(10):
936-44.
13. Guadagni S, Russo F, Abate G, Pozone T, Capannolo B, Mar-
sili L, et al. Stop-flow in mediastinum and thorax for resistant
lymphoma. Hepatogastroenterology 2000 Mar-Apr; 47(32): 378-
82.
14. Lejeune FJ, Kroon BB, Di Filippo F, Hoekstra HJ, Santinami
, Lienard D, Eggermont AM. Isolated limb perfusion: the
European experience. Surg Oncol Clin N Am 2001; 10(4):
821-32.
15. Sugarbaker PH. Management of peritoneal-surface malignan-
cy: the surgeons role. Langenbecks Arch Surg 1999 Dec; 384
(6): 576-87.
16. de Bree E, Romanos J, Michalakis J, Relakis K, Georgoulias
V, Melissas J, Tsiftsis D. Intraoperative hyperthermic intrape-
ritoneal chemotherapy with docetaxel as second-line treatment
for peritoneal carcinomatosis of gynaecological origin. Anti-
cancer Res 2003 May-Jun; 23(3C): 3019-27.
17. Tsiftsis D, de Bree E, Romanos J, Petrou A, Sanidas E, Asko-
xylakis J, et al. Peritoneal expansion by artificially produced as-
cites during perfusion chemotherapy. Arch Surg 1999 May;
134(5): 545-9.
18. Parikh A, Curley S, Fornage B, Ellis L. Radiofrequency abla-
tion of hepatic metastases. Sem Oncol 2002; 29(2): 168-182.
19. Sotsky T, Ravikumar T. Cryotherapy in the treatment of liver
metastases from colorectal cancer. Sem Oncol 2002; 29(2):
183-191.
20. Giovannini M. Percutaneous alcohol ablation for liver meta-
stasis. Sem Oncol 2002; 29(2): 192-195.
21. Antman , Eilber FR, Shiu MH. Soft tissue sarcomas: cur-
rent trends in diagnosis and management. Curr Prob Cancer
1989; 13: 339-367.
44 OY

1. . OI OO
2.
. , -
3. . -
4. O . ,
.
5. - -
. , -
6. . -
7. . -

-
-
7 -

100.000 1.
.
71,4 10.000
-
:
20%
1. (ASA III-V

ASA I/II, : 10,65).
3,4.
2. (-
: 4,44). H O
3. ( - -
, : 3,82). .
4. (> 80 < 60 ,
: 3,29) . -
5. O - -
(12 > 3, - -
: 2,94). . 32.223
Dripps et al5
O H

. -
-
(American Society ASA I
of Anesthesiologists ASA) - , 1 16.000 -
, . -
ASA I ASA V (. 9), (.
2. 10).

9.
(ASA)

ASA I , , .

ASA II

ASA III ,
ASA IV (performance status)
ASA V 24
, ,
, , .. .
ASA V

. 45

10. Dripps et al

ASA I 16.192 0 < 0,006

ASA II 12.154 7 0,058
ASA III 4.070 11 0,27
ASA IV 720 17 2,4
ASA V 87 4 4,6
33.223 39 0,12

ASA I - -
-
. -
.
-
.
, - -
-
6. ,
485.850 - , -
1986 ,
55% 6%. -
ASA 1 185.000 - 55% 2%9,10.
7. -
1976 1988, Eichorn8 - , -
1 200.000 , 0,3%. -
ASA I II. - -
, -
- : -
(, -
. - ..) ; -
-
ASA I II, - , -
.
0,001% 0,01%.
E OE
, -

. -

E OE :
Goldman et al9 1 :
, - (.. -
).
- 2 : -
. - (.. ).
- 3 :
(.. -
. O - ).
4 : .
, , - -
46 OY

, - , :
, , 1. .
, 2. .
, . - 3. - -
- .
4. -
- .
, - 5. -
- .
. 6.
- 7. 14.
40%
1/5 , O H
11. - -
:
1. .
2. - 17.000 Palm-
. berg Hirsjarvi15.
3. . 70 0,25%,
4. 70 9,2%.
. 36%
5. .
6. . 8% . O -
7.
8. . 75% ,
,
- . O Hosking et al16
-
20 - 800 90 .
10. ,
O , ASA
, - -
- .
. , - O -
. -
- ,
- , -
11. .
- 17,18.
(maximum voluntary ventilation) - 80 9 7 -
. 5 -
, - 90 40% 30% ,
12. 95 23% 17% -
, - 17.
, - -
13. .
-
O
50% O OOOO H
14. O , -
. -
. 47

- : ,
. - ,
- .
,

- . -
. ,
.
- .
. - , -
, , -
- . , -
. -

,
- 22.
. - -
-
, - . -
19. , -
- ,
- . ,
,
,
. -
- , .
, .
-
- . O -
. - . -
- O-
-
. -
20,21. -
-
22. -
- .

1. Cohen MM, Duncan PG, Tate RB. Does anaesthesia contribu-
te to operative mortality? JAMA 1988; 260: 2859-2863.
2. Cullen DJ, Apolone G, Greenfield S, Guadagnoli E, Cleary P.
ASA Physical Status and age predict morbidity after three sur-
gical procedures. Ann Surg 1994; 220: 3-9.
3. Feuer DJ, Broadley KE, Shepherd JH, Barton DP. Systematic
review of surgery in malignant bowel obstruction in advanced
gynecological and gastrointestinal cancer. The Systematic Re-
view Steering Committee. Gynecol Oncol 1999; 75: 313-22.
4. Huguier M, Baumel H, Manderscheid JC, Houry S, Fabre JM.
Surgical palliation for unresected cancer of the exocrine pan-
creas. Eur J Surg Oncol 1993; 19: 342-347.
5. Drips RD, Lamont A, Eckenhoff JE. The role of anaesthesia in
surgical mortality. JAMA 1961; 178: 261-266.
6. Eichhorn JH. Documenting improved anaesthesia outcome. J
Clin Anesth 1991; 3: 351-353.
7. Buck N, Devlin HB, Lunn JN. Report on the confidential en-
quiry into operative deaths. London: Nuffield Provincial Ho-
spital Trust, The Kings Fund Publishing House, 1987.
8. Eichhorn JH. Prevention of intraoperative anaesthesia acci-
dents and related severe injury through safety monitoring. A-
naesthesiology 1989; 70: 572-577.
9. Goldman L, Caldera DL, Nussbaum SR, Southwick FS, Krog-
stad D, Murray B, Burke DS, OMalley TA, Goroll AH, Caplan
48 OY

CH, Nolan J, Carabello B, Slater EE. Multifactorial index of
cardiac risk in noncardiac surgical procedures. Engl J Med
1977; 297: 845-850.
10. Rao TL, Jacobs KH, El-Etr AA. Reinfarction following anae-
sthesia in patients with myocardial infarction. Anaesthesiology
1983; 59: 499-505.
11. Seymour DG, Pringle R. Post-operative complications in the
elderly surgical patient. Gerontology 1983; 29: 262-270.
12. Ergina PL, Gold SL, Meakins JL. Perioperative care of the
elderly patient. World J Surg 1993; 17: 192-198.
13. Hodgkin JE. Preoperative assessment of respiratory function.
Respir Care 1984; 29: 496.
14. Houston MC, Ratcliff DG, Hays JT, Gluck FW. Preoperative
medical consultation and evaluation of surgical risk. South Med
J 1987; 80: 1385-1397.
15. Palmberg S, Hirsjarvi E. Mortality in geriatric surgery. With
special reference to the type of surgery, anaesthesia, compli-
cating diseases, and prophylaxis of thrombosis. Gerontology
1979; 25: 103-112.
16. Hosking MP, Warner MA, Lobdell EM, Offord KP, Melton
LJ. Outcomes of surgery in patients 90 years of age and older.
JAMA 1989; 261: 1909-1915.
17. Manton KG, Vaupel JW. Survival after the age of 80 in the U-
nites States, Sweden, France, England, and Japan. N Eng J Med
1995; 333: 1232-1235.
18. Lubitz J, Cai L, Kramarow E, Lentzner H. Health, life expe-
ctancy, and health care spending among the elderly. N Engl J
Med 2003; 349: 1048-1055.
19. de Bree E, Witkamp AJ, Zoetmulder FAN. Intraperitoneal
chemotherapy for colorectal cancer. J Surg Oncol 2002; 79: 46-
61.
20. Strander H, Turesson I, Cavallin-Stahl E. A systematic over-
view of radiation therapy effects in soft tissue sarcomas. Acta
Oncol 2003; 42: 516-531.
21. Ooi BS, Tjandra JJ, Green MD. Morbidities of adjuvant che-
motherapy and radiotherapy for resectable rectal cancer: an
overview. Dis Colon Rectum 1999; 42: 403-418.
22. Sutherland DE, Weitz IC, Liebman HA. Thromboembolic
complications of cancer: epidemiology, pathogenesis, diagno-
sis, and treatment. Am J Hematol 2003; 72: 43-52.

O OO OOOO -
O O -
O O; .
1980 - Birkmeyer et al4
- 19921995 -
- Whipple -
5
... O 4%, 2
, Wennberg1-3, - 16%.
: ... -
) 2,1%. 3 -

37%, 25%.
... , ,
) O ,
, -
.
O . O

,
, -
. -
- .
. X O - -
, -
, . -
- -
. - , .
, -
,
. 49

- , -
- ,
-
. O

(outcomes research)5.
: - , 36
(effectiveness re- . -
search)
(quality assessment).
Hermanek
evidence- & Hermanek11, 2000
based medicine. -
. .

.
12 -
, -
- , -
: . 13. -
-
Fielding 19806 multidisciplinary approach.
19887 McArdle 19918. -

, - . -
, ,
. O -
, , -
, -
700% - , -
. 1997 Holm et al9 , -
- .
, , -
, -
.
, .

, , UICC 1995 -
-
.
, -
,
, :
. 1.
- -
-
- . -
, Heald. 1999
Havenga10 ,

, - -
50 OY

. , :
2. , 1.
-
, .
, - 2.
, -
, ,
. .
3. - 3. O -
. - .
- 4. O
-
.
, 5.

. .
- 6.
,
- .
X O. 7. , , -
-
.
- -
. O (- Bell et al14
) - , -
- 21 16 -
. , - -
,
. 7 . -
2 419 -
, 28% -
. -
. 6 3
- . -
-
, - ,
;
,
, -
. , -
-
- .
. -
- , -
,
-
. ,
30 17% 23% -
- 46% 76%.
, ,
. 51

-
-
- . -

. ,
-
, - .

1. Wennberg JE, Gittelson A. Variations in medical care among
small areas. Sci Am 1982; 246: 120-34.
2. Wennberg JE, Freeman JL, Culp WJ. Are hospital services
rationed in New Haven or overutilized in Boston? Lancet 1982;
23: 1185-9.
3. Wennberg JE, Freeman JL, Shelton RM, Bubolz TA. Hospital
use and mortality among medicare beneficiaries in Boston and
New Haven. N Engl J Med 1989; 321: 1168-73.
4. Birkmeyer JD, Warshaw AL, Finlayson SR, Grove MR, To-
steson AN. Relationship between hospital volume and late
survival after pancreaticoduodenectomy. Surgery 1999; 126:
178-83.
5. Porter GA, Skeibber JM. Outcomes research in Surgical On-
cology. Ann Surg Oncol 2000; 7: 367-375.
6. Fielding LP, Stewart-Brown S, Blesovsky L, Kearney G. Ana-
stomotic integrity after operations for large bowel cancer: A
multicentre study. BMJ 1980; 281: 411-4.
7. Fielding LP. Surgeon-related variability in the outcome of
cancer surgery. J Clin Gastroenterol 1988; 10: 130-2.
8. McArdle CS, Hole D. Impact of variability among surgeons on
postoperative morbidity and mortality and ultimate survival.
BMJ 1991; 302: 1501-5.
9. Holm T, Johansson H, Cedermark B, Ekelund G, Rutqvist
LE. Influence of hospital and surgeon related factors on
outcome after treatment of rectal cancer with or without preo-
perative radiotherapy. Br J Surg 1997; 84: 657-663.
10. Havenga K, Enker WE, Norstein J, Mariya Y, Heald RJ, Van
Houwelingen HC, Van de Velde CJH. Improved survival and
local control after total mesorectal excision or D3 lymphade-
nectomy in the treatment of primary rectal cancer: An interna-
tional analysis of 1411 patients. Eur J Surg Oncol 1999; 25:
368-374.
11. Hermanek P. Hermanek PJ. Role of Surgeon as a Variable in
the treatment of Rectal Cancer. Seminars of Surg Oncol 2000;
19: 329-335.
12. Sainsbury R, Haward B, Rider L, Johnston C, Round C. In-
fluence of clinician workload and patterns of treatment on sur-
vival from breast cancer. Lancet 1955; 345: 1265-70.
13. Sainsbury R, Rider L, Smith A, MacAdam A. Does it matter
where you live? Treatment variation for breast cancer in
Yorkshire. Br J Cancer 1995; 71: 1275-1278.
14. Bell CMJ, Ma M, Campbell S, Basnett I, Pollock A, Taylor I.
Methodological issues in the use of guidelines and audit to im-
prove clinical effectiveness in breast cancer in one United
Kingdom health region. Eur J Surg Oncol 2000; 26: 130-136.

O OOO ) O
O
- .

- O
. . -
, . -
O
, , -
. O
,

) . .
) - O
- ,
.
) , .
52 OY

, ,

.
-
, - , -
... ,
,

- , -
. , , -
- , -
, - , ,
, -
- ,
.
- .
O- ,
. -
5,
- 6, -
, , ,


, - -
, .. .
, -
-
(- ,

), - -
.
1-3. - -

, - , ,
2,1
16% 3 2537%. , .
- , -
, ,
, - .
..4.
,

, - .
, -
O-
, ,
-

. .
-
. 53

O , ,
. .
-

1. Wennberg JE, Gittelson A. Variations in medical care among
small areas. Sci Am 1982; 246: 120-34.
2. Wennberg JE, Freeman JL, Culp WJ. Are hospital services ra-
tioned in New Haven or overutilized in Boston? Lancet 1982;
23: 1185-9.
3. Wennberg JE, Freeman JL, Shelton RM, Bubolz TA. Hospital
use and mortality among medicare beneficiaries in Boston and
New Haven. N Engl J Med 1989; 321: 1168-73.
4. Holm T, Johansson H, Cedermark B, Ekelund G, Rutqvis LE.
Influence of hospital and surgeon related factors on outcome
after treatment of rectal cancer with or without preoperative
radiotherapy. Br J Surg 1997, 84: 657-663.
5. Havenga K, Enker WE, Norstein J, Moriya Y, Heald RJ, van
Houwelingen HC, van de Velde CJH. Improved survival and
local control after total mesorectal excision or D3 lymphadene-
ctomy in the treatment of primary rectal cancer: an internatio-
nal analysis of 1411 patients. Eu J Surg Oncol 1999; 25: 368-
374.
6. Sainsbury R, Haward B, Rider L, Johnston C, Round C. In-
fluence of clinician workload and patterns of treatment on sur-
vival from breast cancer. Lancet 1995; 345: 1265-1270.

OO O -
O OOOO
O ,
- , , -
, , , -
. O- , , -
- -
- , -
, -
,
, , ,
multidiscipli-
, , -
nary care multimodality treatment.
, .


, ,
-
-
,

-
,
- , -
.
- .
-
, , - 1. O -
- . -
. -
- . -
, - .
, , - . -
-
- . -
-
. O - .
, , . .
, , - , -
, , . -
54 OY

. - -
- 1995
. Calman-Hine. British Breast
. , - Group
- .
.
, (Breast Cancer Guidelines), -
, -
2. - (The Improving Outcomes Guidance). 1997
- 10.000.000

. - -
. - 2000
National Cancer Plan,
. - .
- , -
.
-
, - -
. - 4. -
. -

, - :
-
,
-
()
3.
,
, .
,
.
National , , ,
Cancer Institute -
American Cancer Society

. O.

1. Lee CZ, et al. Comprehensive breast centers: Priorities and
pitfalls. Breast J 1999; vol 5: 319-324.
2. Haward R, Amir Z, Borrill C, Dawson J, Scully J, West W,
Sainsbury E. Breast cancer teams: the impact of constitution
new cancer workload, and methods of operation on their effe-
ctiveness. Br J Cancer 2003; 89: 15-22.
3. Chang JH, Vines E, Bertsch H, Fraker DL, Czerniecki BJ,
Rosato EF, Lawton T, Conant EF, Orel SG, Schuchter L, Fox
KR, Zieber N, Glick JH, Solin LJ. he Impact of A Multidisci-
plinary Breast Cancer Center on Recommendations for Patient
Management. Cancer 2001; 91: 1231-716.
4. Fukuhi SG, Offutt LA, Sacks J, Mann BD. Teaching a multidi-
sciplinary approach to cancer treatment during surgical clerk-
ship via an interactive board game. Am J Surg 2000; 179: 337-
340.

. . , .

O - -
O O 4560 Gy -
4.
) . , -
() -
-
20
-
.
-
200.000 -
, .. -

5 5 Gy5.
. 2/3 -
) (). O -
-
- -
() -
6:
/ . - . O -
, / - , -
, 40% 1-3. .
: -
) . -
. - .
: Hodgkin,
, Hodgins , , -
6570 Gy . - , .
1,82 Gy ( . O -
, fractionation)
(hyperfractionation) . -
, , - - ,
. -
. -, -
) . -
- (1+1 = 2) (1+1 > 2). O
( 1520%) / - -
. : .
, , -,
- , , (--)
- ...
-- --
, - ,
, -
( -
) . -
/ -
( ). O -

55
56 OY

( Nigro)
1. -

..
) . -
. / -
:

, -
O
, -
, -
, ,
..,
. -
. -
-

-
(. 1).

Hodgkin -
: 10 3 Gy, 5 4 Gy,
2 8,5 Gy, 1 10 Gy .. ( ,
. hypofractionation). -


-

, 9.

O O I
-
-
-
. -
, -
-
. - :
-, - . -
, .
, -
7,8, , :

/
=
. / .

- .
. -
, , -
- -
, -
, - . -
. (. 1).
- -
. - :
, ) .
, - ) .
- ,
. 57

-60

1 .

( ).

-60

-59 . -

.
0,5
-60

(1)

(2)
1,17 1,33 eV. -

5,26 ,

,
D , 3,5 . -
1. - : N = N0 e-t ,
(1) - , -
. (2) - t
. = N0/2, t = T= 1n2/. O -
( . .
, University Studio Press, 2000, . 17, . 1.1). .

)
, 4
, 25 MV ( ).
.. -
) . - (325 MeV). -
- -
- , -
, -
. , -
-
OO O (. 2). -
H OO I -
- (multileaf colli-
. O mators),
: -
(. 3). -
) (3D-conformal ra-
diation therapy)
, 40400 KV (). ,
Intensity Modulated Radiation Therapy (IMRT).
.

) (-60, -
-137)

, 0,66 MV (),
1,33 MV (). ,
, 30
, -
-
. -
, -
-
. E 2. O .
58 OY

3. O (multileaf collimator E 5.
MLC). . . -
, 60C, -
. - .
- -
, - .
. (set-up
margin ICRU).

, -
..). -
-

-
(. 5).
-
,
.
-
(virtual simulation) -
(CT-si-
4. O () mulator), -
(,
) . O -
-
. .
-
O . .
, -
. O
- -
. - .
( -, -
..) - (.. , ,
(. 4). - , ). -
-
, - -
, . (, , ..). -

- -
( , - . -
. 59

-137, -192, 6,10.

-98 .. - -
(High Dose Rate HDR) - . -
-192. HDR . -

( 810 23 ,
) . O -
().
,
(. ). :

OI OA
H2O e-(.) + OH + H + H2 + H2O2
- O O -
, - , -
(.. - 100 ngstrom. RH (..
), , - DNA) ,
, - :
. - RH + OH R + H2O,

R, -
, ,
-
(
-
) .
.
. -
-
-131,

, -89 -
HO2, H2O2.

O HO2 ,
..

OO O
H2O2.
To O2 :
O OOI
R + O2 RO2
-
RO2+ RH (DNA) RO2H + R
-
. H RO2
1 Gray (Gy) ROOH,
1 Joule 1 kg, () .

1 Gy = 1 Joule / kg -
Gy cGy (rad) (1 Gy = 100 -
cGy). . 3 -
,
(--
cGy, 5.0007.000. ) -
150300 cGy, 57 - .
-
.
, :
A OOI Y (h)
- RH RH+
- RH+ R + H+
-
Compton - -
60 OY

.
DNA 5 RNA, 700 D/3 D/3 D/3
, 7.000 1.200.000
. 85% - D

15%
.

Y OOE A

10:
) .
) -
.
O

. O -
(interphase death) 6. -
, 3 x D/3 (=D)
.
-
( ) - 1 x D ( . . -
. , University Studio Press, 2000, . 98, . 5.9).
)
(sublethal damage). - -
.
, .
- , -
- (). -
. - -
- (hyperfractio-
(, shoulder). O nated).
- ) .
, -
, - , -
. - ,
(-
) , . -
, - (lethal damage)
( - -
) , , -
. .
(. 6). 50 ,
- 56 (25=32, 26=64).
, RNA
, - DNA,
, - RNA
- ,
. . -
(isoeffective doses). -
- .

. - , -
- .
. 61

- ..., . O -
, , -
.
- (cell cycle time Tc). [.:
( ) - -
. H - (clonogens).
Bergonie-Tribondeau. -
-
- ].
.
O OO BERGONIE-TRIBONDEAU
-
. O -
1906 ,

, -
(volume doubling time Td) , ,
, , , -
1 2 10
11.
20 ...
-

Bergonie-Tri-
bondeau: , . -
- 150 m
. - ,
-
(. 7). -
. -
(radiosensitive), - -
(radiocurable). - (tumor angiogenesis
. factor TAF).
-
, - . -
. 300 m,
.
O 2,53 -
O , -
O (. -
. -
, ).

<70
7.
. -
.
().
12
70
2,53 -
-
, . -
.



62 OY

4R OO- ,
.
-
. -
-
. -
.
4. (Repopulation). O -
4R . 4R -
- . -
10:
1. (Repair). -
. - , -
- -
- 13.
. - -
( (accelerated
, . ) radiation therapy).

. -
2. (Reoxygenation). - ,
- . -
. R -
- (, Radiosensitivity).
,
-
. -
, - -
,
. - . -
- ,
( , , . O
-, - ..), ( -
12. , ),
3. (Redistri- .
bution). ( , ,
) - -
. . -
(..
(> 5 Gy). ) ,
(), G2 .
G1/S, S. ()
To - TD5/5 (Tolerance Dose), 5
-
. M 5%
- . TD50/5
, - 5
G2. - 50%
- .
. O
- 2. O : )
. 63

2.

- / TD5/5 TD50/5
2001.000 cGy
210
12
610
1.0002.000 cGy
612
(stem) O 1520
2.0003.000 cGy
: . 2328
: , 2030
3.0004.000 cGy
: 3540
2535
4.0005.000 cGy
, 4350
5.0006.000 cGy
5055
5060
6.0007.000 cGy
6070
O 6575
O 6575

, ) 200 cGy10% , -
5 , ) 68 - . -
) . -

OO ( ) / -
OO .
-
: , . -
- , -
. O ,
, , , Hodgkin ..
- O
(. ). .
O. - . 2
2 -
. ( , .
, , , ..) - , .. ,
, , .. O
. - ,
, , - , -
. - / ,
, ( ..
). .
-
. -.
O -
2 . ,
64 OY

3. RTOG (Radiation Therapy Oncology Group)

Grade
0 1 2 3 4
, , , ,

..

O <1h, ,
- ( 1 ) , , ,

. -
4. -


.
(, -
, )
( ,
, -
)
. (, , )
O -
, , - ,
-
( )
()
. , , : ()
(, , , -
, ), -
(, ), -
( ), (- .
), (), - (
(, ),
, , , ), -
( ). -
- . O --
, - ,
( - ,
, , ) .. .
-
-
( ) - actuarial.
. -
14.
H A OO-
:
O . . ..
3 .
. . -
( ) - -
. . .. FEV1
5 . -
. 65

. -
. - . -
(. 3). - , .. -
- -
.. -
4. -
,
O O (repopulation).
(DOSE FRACTIONATION) -
YO (HYPERFRACTIONATION) , , -
,

CHART (Continous Hyperfractionated Accelerated Ra-
-
diation Therapy)16.
1,82 Gy 5 .
. (continuous), -
-
12 .

, -
() 180200 cGy.
. -
110130 cGy, 10
(hyperfractionated), 3 -
15% ,
(8 .., 2 .., 8 ..) 1,41,5 Gy
. . O 6 , -
.
6 , , (accelerated),
- 50,4 Gy 12 . O
. (: , -
- ) ,
, - 12 -
- .
. - -
, ..,
ORTC ( 57 -
(European Organization of Radiation Therapy and Che- ). -
motherapy)15. 356 -
( - 17-19.
) 12, 01, 0,
1980 1987. - OO (HYPOFRACTIONATION)
35 2 Gy = 70 Gy
7 , - 2,5
80,5 Gy 70 7 Gy. --
(2 1,15 ). 5- ,
- , -
59% 40% (p = 0,02), - , .. 10 3 Gy, 5 4 Gy, 1
(74% 42%) 8 Gy ..
(Karnofsky 90100). ,
,
OO O .
(ACCELERATED FRACTIONATION) Christie Hospital Manchester . -
- ,
- ,
23 . O .
, ,
. -
66 OY

, ..
3,33 Gy ,
5 , -
50 Gy. O
16 3,13 Gy
70 Gy 35 -
.

. -
-

( 8. .
/), (box-technique). O
(fractionation sensitivity)20-22.
( 100%), -
- .
% .
- 70 Gy,
IMRT. 90% () 63 Gy.

O
O
, -
, -

TV
,

CTV
.
GTV
, -
. O
International Commis-
sion on Radiation Units and Measurements (ICRU) PT V

, ICRU50 1993 ICRU

62 199923,24. (Volumes) -
E 9. O ,
. -
ICRU (. ).
,
( -
..) (. 8).
)
(Volumes) (. 9):
.
,
i.
-
:
( -
), - Gross Tumor Volume (GTV)
(Radiation Treatment Planning RTP). M - ,
-
,
. , , -
- , , ..
( -
). , .. .
GTV -
% , -
(.. 90% , 30% - .
. 67

Clinical Target Volume (CTV) iii. :

GTV Treated Volume (TV)
() . GTV - E
, CTV , ,
. O CTV (prescribed)
- .
,
, Irradiated Volume (IV)
, E
- .
.. O -
- - (1D, Dimensional) -
. - , ..
CTV, .. - .
(CTVI) (CTVII).
(CTVI) 50 Gy, (2D), ..
(CTVII) 60 , -
Gy ... . ,
(3D),
ii. (3D-con-
: formal radiation therapy 3D-CRT). -
Planning Target Volume (PTV) -
O , - ..
, , ,
(clonogens) (maximum), (minimum),
CTV. (mean), (median) (mo-
CTV dal) . O CRU
. (reference point), -
CTV ,
, - (. 8).
. -
.. - O O
, - / -
( - (3D-
), ( CRT). -
), ( ..). -
Internal Margin (IM). -
- (contouring) ,
(set-up) - . -
- -
. Set-up Margin 3D-CRT.
(SM). PTV o- O
: PTV = CTV + IM + SM. -
( , -
Organs At Risk (OAR) ..). -
- -
- .
/ , .. -
, .. . O
,
68 OY

.
CT-topogram
, -
. , -
210 mm -
. O -
(Treatment Planning Sy-
stem TPS) /
(virtual simulation). O -
-
CTV (. ICRU-50 62)
.
TPSs
() ..

DRR (Digitally Reconstructed Radio-
graph). DRR
10. DRR -
(. 10).
. - DRR , TPSs,
/ por-
tal imaging portal film, -
, - . -
.

11. (virtual simulation)

. .
, DRR,
( OO 2.0).
. 69

1,0

0,9
PTV CTV
0,8

0,7

0,6

0,5

0,4

0,3
0,2

0,1

0,0
0 10 20 30 40 50 60

12. (cumulative) (DVH) o.

. 70% CTV 50 Gy,
10% 20 Gy, 8% 10 Gy ...

-
( , -
) Beams Eye View
(BEV) (. 11). A

-
. , -
TPS
-

. -
,
/ (wedge filters) E 13. O blocks
- .
.. -
(trial and error). -
(Multileaf Collimator MLC),
, blocks,

- (Dose Volume Histogram DVH). / -
DVH (. 3).
( ) - -
. -
. , .
(differential) DVH (cumulative) DVH. ( ) -
(. 12). (portal i-
maging), . -
block, ,
blocks, - (portal film). O -
blocks ,
-
(. 13). - . ,
70 OY

2.
. (set-up)
.
3. T
- (dose escalation trials),
57 . -
- .
12
, , O OO-
. - (IMRT)
(, , - E Intensity Modulated Radiation
) . Therapy (IMRT). -
. -
O
O O ,
. -
3D-CRT , , - IMRT -
, , - .
-1,2. , -
: .
1. - - -
- (. , MLC)

. -

E 14. RT .. ,
, . -
.. . . O -
45 Gy, 60-70 Gy.
. 71
25.
, - -
. - . , 1 Joule
1 m2 1 sec,
. O 1 watt/m2 (1 watt = 1 joule/sec). H
-
. - = 0 e-, 0
, -
IMRT .
(. 14).
[: - .]
1. Leibel SA, Phillips TL, eds. Textbook of Radiation Oncology.
Philadelphia: WB Saunders Co, 1999.
2. Perez CA, Brady LW, eds. Principles and Practice of Radia-
tion Oncology. 2nd ed. Philadelphia: JB Lippincott Co, 2000.
3. Casciato DA, Lowitz BB. Manual of Clinical Oncology. 3rd
ed. A Little Brown Spiral Manual, 1995.
4. Fletcher GH. Basic clinical parameters. In: Fletcher GH, ed.
Textbook of Radiotherapy. Philadelphia, PA: Lea & Febinger,
1980; 180-219.
5. Swedish Rectal Cancer Trial. Improved survival with pre-ope-
rative radiotherapy in resectable rectal cancer. New Eng J
Med 1997; 336: 980-987.
6. A. . tion to standard fractionation therapy for head and neck squa-
. - mous cell carcinomas: first report of RTOG 9003. Int Jour Ra-
: University Studio Prress, 2000.
7. Jeremic B, Shibamoto Y, Milicic B, et al. Hyperfractionated
radiation therapy with or without concurrent low-dose daily
cisplatin in locally advanced squamous cell carcinoma of the
head and neck: a prospective randomized trial. J Clin Oncol
2000; 18: 1458-1464.
8. Fountzilas G, Ciuleanou E, Theofanopoulou M, et al. A ran-
domised study of concomitant radiotherapy with cisplatin or
carboplatin versus radiotherapy alone in patients with locally
advanced non-nasopharyngeal head and neck cancer. A Helle-
nic Cooperative Oncology Group (HECOG) phase III study.
(Abstract) J Clin Oncol 1991; 22 Suppl. 1: 2003.
9. Plataniotis GA, Kouvaris JR, Dardoufas C, Kouloulias V,
heofanopoulou MA, Vlahos L. A short radiotherapy course
for locally advanced non-small cell lung cancer (NSCLC). Ef-
fective palliation and patients convenience. Lung Cancer 2002;
35: 203-207.
10. Nias EJ. Radiobiology for the Radiologist. 5th ed. Philadel-
phia: Lippincott Williams & Wilkins, 2000.
11. Steel GG, ed. Basic Clinical Radiobiology. 3rd ed. Arnold Pu-
blishers, 2002.
12. Van den Bogaert W, van der Schueren E, Horiot JC, et al. The
EORTC randomised trial on three fractions per day and miso-
nidazol in advanced head and neck cancer: prognostic factors.
Radiother Oncol 1995; 35: 100-106.
13. Withers HR, Taylor JMG, Maciejewski B. The hazard of acce-
lerated tumor clonogen repopulation during radiotherapy.
Acta Oncol 1988; 27: 131-146.
-
14. Bentzen SM. Quantitative Clinical Radiobiology. Acta Oncol
1993; 32: 259-275.
15. Horiot JC, Le Fur R, et al. Hyperfractionation versus conven-
tional fractionation in oropharyngeal carcinoma: final analysis
of a randomized trial of the EORTC cooperative group of ra-
diotherapy. Radiother Oncol 1992; 25: 231-241.
16. Dische S, Saunders M, Barrett A, et al. A randomized multi-
center trial of CHART vs conventional radiotherapy in head
and neck cancer. Radiother Oncol 1997; 44: 123-126.
17. Fu KK, Pajak TF, Trotti A, et al. A Radiation Therapy Onco-
logy Group (RTOG) phase III randomised study to compare
hyperfractionation and two variants of accelerated fractiona-
diat Oncol Biol Phys 2000; 48: 7-16.
18. Ang KK. Accelerated fractionation: what is the price for
speeding? Radiother Oncol 1997; 44: 97-99.
19. Horiot JC, Bontemps P, van den Bogaert W, et al. Accelerated
fractionation (AF) compared to conventional fractionation
(CF) improves locoregional control in the radiotherapy of ad-
vanced head and neck cancers: results of the EORTC 22851
randomized trial. Radiother Oncol 1997; 44: 111-121.
20. Yeoh EEK, Fraser RJ, Mc Gowan RE, et al. Evidence for effi-
cacy without increased toxicity of hypofractionated radiothera-
py for prostate carcinoma: early results of a phase III rando-
mized trial. I. J Radiation Oncol Biol Phys 2003; 55: 4.
21. Fowler JF, Ritter MA, Chappel RJ, Brenner DJ. What hypo-
fractionated protocols should be tested for prostate cancer?
Int J Radiation Oncol Biol Phys 2003; 56 (4): 1093-1104.
22. Brenner DJ. Hypofractionation for prostate cancer radiothe-
rapy what are the issues? (Editorial). Int J Radiation Oncol
Biol Phys 2003; 57: 912-914.
23. International Commission on Radiation Units and Measure-
ments ICRU Report 50. Prescribing, recording and reporting
photon beam therapy. Bethesda, MD: ICRU, 1993.
24. International Commission on Radiation Units and Measure-
ments ICRU Report 62. (Supplement to ICRU Report 50)
Prescribing, recording and reporting photon beam therapy.
Bethesda, MD: ICRU, 1999.
25. Chao KS, Low DA, Perez CA, Purdy JA. Intensity-modulated
radiation therapy in head and neck cancers: The Mallinckrodt
experience. Int J Cancer 2000; 90: 92-103.
 : ,

. , . , . , .

OI OH
OOI . O
.

-
/ . :
, :
.
. =+
, , .. O :
oo , .. 12 C.
. 6
,

, -
(.. ). -
-
OH O OO ( Antoine Henri
, Bequerel, 1896, ). -

(
(). - ) -
. O ,
, -
, -
,
-
, -
():
. -
-

( , ). .
O , ,
-
(K, L, M, N ..). .
m = 9 10-30 kg -
q = -1,6 10-19 Coulomb. O
- -
, : .
(p) (n). - -


1.800
(42He), , 42,
. -
(, )
( )
:
.
- (, ) ( 4, 2) + 42
- -
. O ( ).

73
74 OY

-- e+, -
. , +, -
, - , -
() (4), , .
(2) . +- -
- -19: 19 10 Ne 199F + +.
-226: 226 88 Ra 222 86Rn + 4 2. (Electron Capture EC)
- +- -
- (EC)
- (- L- ) .
. -
:
, . - p + e n + v
-
. . -
:
n p + e + v 1,
+-:

1, - (, ) + e ( 1, ) + v
-
:
(, ) ( + 1, ) + e + v -
.
- -
, - , -
. -
- , ..
- -, L-. -
. (
. -
-
160
( -). 150
- - 140
-60: 6027 Co 60 28 Ni + 130
-131: 131 131 Xe + . 120
54 54
110 -
+- 100
-
- 90
80
. 70
: 60
50
pn+e+v 40

30 =
20 + EC-
1, -
10
-
: 0 10 20 30 40 50 60 70 80 90 100

(, ) (Z 1, A) + e+ + v
1.
4 -
, . .
. 75

) . -
. - ,
-125:
125 + EC 125 52Te + 28 keV - (I, isomeric transition). O -
53
m (metastable). -
O
-
4 -
Cs-137.
-
1. (Internal Conversion IC)

OOI
( ) -
-
-
(- -) ,
,
. -

,
( )
-
, . -
, (conversion electrons) ,
. -,
- ( ).
. OO A
(, , -
), - O -
. dN dt, -
:
10-15s - dN / dt =

1. -

* - - (MeV)
3H 0,02 12,32
14C 0,2 5730 .
32P 1,7 14,28 d ,
51Cr EC 0,32 27,7 d
57Co EC 0,122 + 0,136 270 d
59Fe 1,6 45,1 d
1,099 + 1,292
60Co 1,5 5,27 .
1,173 + 1,332
81Rb + 1,1 4,58 h
0,446
99mTc 0,141 6,0 h
123 EC 0,159 13,2 h
125 EC 0,035 60,14 d ,
131 0,8 8,02 d ,
0,364
137Cs 1,2 30,17 .
0,662
192Ir 0,7 74,02 d
0,317 + 0,468 + ...
198Au 1,4 2,69 d ,
0,412
201T1 EC 0,167 + 0,135 3,05 d
76 OY

O .
. - , , , -
,
: , -
dN / N = dt .
Rntgen
: . Rntgen -
N(t) = N(t0) e-(t-t0) :
- ) Rntgen-Bremsstrahlung .
- ) Rntgen.
t, N(t), -
Rntgen-remsstrahlung
N (t0) ()
t0. - Rntgen-Bremsstrahlung -
-
, . ( Coulomb) . -
, - -
- Bremsstrahlung (
). Rntgen-Brems-
. = 1n2/.
strahlung , ,

, -
, = 1/. O 1
.

- Rntgen
.

.
-
dN / dt -
() -
(
. )
Bequerel
(Bq): 1 Bq = 1 s. -
e-
Bq:
N
1 Kilobequerel (kBq) = 103 Bq M
1 Megabequerel (MBq) = 106 Bq L

1 Gigabequerel (GBq) = 109 Bq
e- +Zqe
Bq -
Curie (Ci): 1 Ci = 3,7 1010
Bq (= 37 GBq). A e-

OOI RNTGEN
Rntgen Wilchelm N
M
Conrad Rntgen 8 1895
Wuerzburg ,
, -
. -
(
). , - B
-
2. Rntgen.
keV Rntgen- . -
GeV. . ()
.
. 77

. (-
. , ) dV -
- , dm
( ) dV, dm = dV, :
K = dEk /dm
.
,
-
KERMA , KERMA .. KER-

MA SI Joule
.
Gray (Gy): 1 Gy = 1 J/kg.

KERMA
.
KERMA KERMA
Rntgen. -
:
-
, K = dK/dt = dEk /dm dt
, - KERMA SI Watt
, (W/kg = Gy/s). -
Gy/min, Gy/h
(cGy/min, cGy/h).
.
Rntgen D
(. 2). ( )

A OA E

D :

, , D = dE/dm,
. dE -
J dV,
dm
J :
dV, dm = dV, . -
J = dQ / dma , SI ,
dQ KERMA, Gray (Gy). -
( ) ,
dV , dma - KERMA, rad (Radiation Absorbed Dose): 1 rad
dV. = 0,01 Gy.
SI Coulomb
(C/kg). D
( )
Rntgen (R): 1 R = 2,58 104 C/kg. D

:
- D = dD/dt = dE/dm dt
:
J = dJ/dt = dQ/dma dt SI , KERMA, Gray/sec.
Gy/min, Gy/h
SI
(cGy/min, cGy/h).
Amper (A/kg). -
Rntgen per second (R/s) Rnt-
E I
gen per minute (R/min) Rntgen per hour (R/h).
H I OH
KERMA (Kinetic Energy Released in Material) O
KERMA () -
dEk . ,
78 OY

2,0

1,5

1,0

0,5
4 MV
6 MV
10 MV
192
0,0 Ir
0 1 2 3 4 5
(cm)

3. -192 .

OO I H ()
, 1 . - ,
,
. O
(Planning Target Volume TV). -226 1.620 ,
TV -222 84 .
- -
. -
, (. -192 ( = 74 )
3). -137 ( = 30 ) -
PTV , -125 ( = 60 )
( - (. 2).
).

1896 .. Becquerel -
1. - - -

1903. . ,
-226 Pierre
Marie Curie2,3 1898. - PTV. -
-
, 2.
.

E NOBOIA

16 (-226, -
I-125 (0,30,6 mCi) 60 d 28 keV
-222, -60, -137, -198, -
Pd-l03 17 d 2025 keV
-182, -192, -125, -103, - Au-198 2,7 d 412 keV
90, -106, -241, -145, -
169, -252, -75) - Ir-192 74,2 d 320 keV
, I-125 (520 mCi) 60 d 28 keV
. O - Co-60 5,3 y 1,171,33 MeV
Ra-226 1.620 y 0,182,2 MeV
-
Cs-137 30 y 662 keV
.
. 79

, - -226
- -,
. - , -226
- -226
0,18 2,2 MeV. .
-137 0,66 MeV
-192 0,37 MeV. - (afterloading) . -
-137 -192
-226 - (),
.

O . -226
Becquerel - 1.000 Rntgen
(SI) . -
. 7.000 Rnt-
Curie gen -
3,7 1010 (1 Curie = 3,7 . -
1010 Becquerel). - -
, - .
- 1980 -
. , -
-192, (Rntgen, rad, Gy). O
(.. mg
3,5 mm 0,6 mm ) / (mgE/h), 1 mg -
. 1 mCi. O
.
OOI 2 4 cm 0,2
- 0,3 mm. O -
- -
- -. -- .
.
0,5 2 ,
mm. . -
-
-106 . -
-106 -106 , -
-106. -
39,4 keV 2,07 3,63 MeV. . -
- , , ,
-106, (pre-
-. - loaded radium techniques), -
-106 (applicator), -
100 Gy . .

-90 -60
-90 -90, -60 -60, -
- 2,28 MeV. 5.272 . -, -
-90 , , (1,17 MeV 1,33 MeV), -
- -
, ,
. . -
80 OY

, - -
, . (conformal) .
-192
-137 -
O -137 . -
30 . -137 -- -192
0,66 MeV, .
-226. -226
-137 - ,
, - , -
. - ,
-137 - .
.
-192 O O
. O
. O
-125 -
-125 60 - . O
- 35 keV. - .
(seeds) - -

. - :
. ) ,
) ,
-103 ) (, , ),
-103 17 -
.
2025 keV. - ICRU-Report 38 19857 -
-125. - ,
- [Low-Dose-Rate (LDR), Medium-Dose-Rate (MDR)
, High-Dose-Rate (HDR), ]:
.
-103 LDR: 0,42 Gy/h
-125 - MDR: 212 Gy/h
, HDR: 12 Gy/h.
, -
. -
-
. . -
(fractionated), -
-192 , -
- . -
-192. LDR MDR ,
74 -192 - 37 28 .
- 320 keV. - -
(. ,
afterloading): LDR- HDR- (isoeffective do-
- se), , -
, . O .
-
-
. 81

. -
(. )
- .
(Man- -
chester System, Paris System, Offenbach System) -
. , ,
.

. (Intraoperative radio-
(.. LQ-model) therapy IORT)5,9,10,
(isoeffective dose), 4.
.
, -
. . -

LDR- HDR- (.
. 4). -
LDR-. ,
, .
PDR- (Pulse Dose Rate),
-
24 - (ovoids). O
1 Gy . (
- ) ovoids
, - .

. . :
- Manchester ICRU.
LDR- HDR- - Manchester (
Orton8. )
LDR- . 2 cm -
HDR- . 2 cm () -
LDR 0,85 Gy/h - . 3 cm
78 . HDR 4 . Manchester
6 7,5 Gy. -
HDR -
-
.
LDR- HDR- -
.

EOO I
-
() -
() .
,
,
.
2.
4. O
1 cm ( , superficial contact therapy) - .
82 OY

PTV.
3.
(HDR)
-
-
.
Manchester
(HDR)
ICRU PTV

.
B

-
11 ,
.
- . -
, - -
stents. ,
. -
. .
PTV - -
. O -
. O -
-
-182 - , -
-192. . O
- , -
. ,
.
, -
-192. - .
(dwell positions) - O
(stepping source system). 1970
- 1980 LDR, Sele-
(dwell time ctron LDR Curietron. -
position). 137 , pellets. O
, (HDR) -
- -60,
. - -192 (. 3).
-
-
, , -
(seeds) -
. -
(Seed Selectron) -

.
, -
PTV. I O O
OO


(prescription) , -
. (optimization)
1904, - (registration)
1970
. . -
6 -
. 83

- ,
- PTV.
(organs at risk) -
, PTV. . O
-
: .
1. . -
2. . -
3. .
4. . -
- .
-
(DR). To -192 (CT,
- MR, US).
.
H H O
-
, -
-
(Treatment Planning System).
II. -
15,17,31,32,49. -
O .
. - 0,5 cm
-
- 21,24,52,54. HDR- PDR--

DVHs (Dose Volu- -

me Histograms). O -
- .
FLABs -
. III. -
FLABs
-
16,17,31: (FLAB:
.
. O ,
- ,
- , 5-6).

5. FLAB (). 6. FLAB .

84 OY

O -
O
- , -
PTV15. - LDR-.
-
(Catheter Oriented Sy-
1 cm 0,5 cm . stems) -
, - (LDR-).
- Manchester System42,46 -
. PTV. O -
/ -
15,23,27,28,30,32,50. , PTV
- +/ 10%
- . Quimby System48 ,
. Manchester System, -
- ,
Manchester System, . -
ICRU-3830, - ,
- -
26,37,41,49,50. . Paris System18
-

PTV.
- ,
: .
1. --
22,30,31,37,50 -
(Projectional Recostruction Method PRM). .
Paris System LDR-
, -
, -
(X-ray catheters). .
2. - (Manchester System Quimby Sy-
(.. - stem), Paris System -
clips - , -
). - .
3. -
-. , -
4. :
, - 1.
. .
5. 2. -
, - PTV.
() 3. -
(%) .
6. -
( film -
). --
1970 1980 (- .
LDR-) 4.
, - .
. 5.
. 85

(fractionated) .
:
. 1. .
2. .
- 3. .
, - -
, . - -
( ).
-
40,41,47,53. ,
25,29,33- (CT-guided implan-
36,40,41,45,47,53,55,49 tation).

,

.
-
. -
, , -
(. 7). templa-
- tes (. 8, 9), -
, . -

(CT-, MR- US-guided brachytherapy).
-
-
: -
,
.
-
. -
,

V.
0,52,0 cm -
.

.
() -

-
( plexiglas,
-
template). -
-

2 -
.
7.
. -
. O . E:
. : -
- .
86 OY

-
CT template
, template
-

.
CT templates22-24
.

-
. -
Template-Technique

-
-
.
. -
, -



CT PTV.
8.
template. template. templates -

9. , . )
. ) , PTV (organs
at risk) CT. ) () .
) ().
. 87
10. . :
. : , .
- ,
. -
-
, -
- (. 10).
. -
1. Becquerel H. Emission de radiations nouvelles par luranium
metallique. Paris: Comptes rendus Acad. des Sciences, 1896;
122: 420.
2. Busch M, Sauerwein W. Klinischmethodische Grundlagen der
Brachytherapie. In: Scherer E, Sack H, Hrsg. Strahlenthera-
pie: Radiologische Onkologie. 4te Auflage. Springer Verlag,
1996: 81-108.
3. Curie P, Curie M, BBmont G. Sur une substance nouvelle ra-
dioactive, con tenuc dans la pechblende. Paris: Comptes ren-
dus Acad. des Sciences, 1898; 127: 1215.
4. Fritz P, Hensley FW, Bems C, et al. First experience with su-
prafractionated skin irradiations using large afterloading molds.
Int J Radiat Oncol Biol Phys 1996; 36(1): 147-157.
5. Harrison LB, Minsky BD, Enker WE, et al. High dose rate in-
traoperative radiation therapy (HDRIORT) as part of the ma-
nagement strategy for locally advanced primary and recurrent
rectal cancer. Int J Radiat Oncol Biol Phys 1998; 42(2): 325.
6. Henschke UK, Hilaris BS, Mahan GD. Afterloading in inter-
stitial and intracavitary radiation therapy. Am J Roentgenol
1963; 90: 386-395.
7. International Comission on Radiation Units & Measurements.
ICRU Report 38, Dose and volume specification for reporting
intracavitary therapy in gynaecology. Bethesda: ICRU, 1985.
8. Orton CG. High dose rate versus low dose rate brachytherapy
to gynaecological cancer. Semin Radiat Oncol 1993; 3: 232-239.
9. Strassmann G, Walter S, Kolotas C, et al. Reconstruction and
navigation system for intraoperative brachytherapy using the
flab technique tot colorectal tumor bed irradiation. Int J Ra-
diat Oncol Biol Phys 2000; 47: 1323-1329.
.
-
10. Tonus C, Kolotas C, Appel P, et al. Colorectales Carcinom -
Behandlungsalter- native durch intraoperative Radiotherapie
mittels Afterloading-flab- Technik? Chirurg 1999; 70: 43-48.
11. Waksman R, King SB, Crocker IR, et al (Hrsg). Vascular Bra-
chytherapy. Nucletron B. Veenendaal, 1996.
12. Anderson LL. A natural volume-dose histogram for brachy-
therapy. Med Phys 1986; 13: 898-903.
13. Anderson LL. Dose specification and quantification of im-
plant quality. In: Williamson IE, Thomadsen BR, Nath R, eds.
Brachytherapy Physics. Madison: American Medical Physics,
1995: 343-360.
14. Ash D, Flynn A, Battermann I, et al. ESTRO/EAU/EORTC
recommendations on permanent seed implantation for loca-
lized prostate cancer. Radiother Oncol 2000; 57: 315-321.
15. Baltas D, Kolotas C, Geramani K, et al. A Conformal Index
(COIN) to Evaluate Implant Quality and Dose Specification
in Brachytherapy. Int I Radiat Oncol Biol Phys 1998; 40(2):
515-524.
16. Baltas D, Kneschaurek P, Krieger H. Leitlinien in der Radio-
onkologie P3 und DGMP Bericht Nr. 14: Dosisspezifikation in
der HDR Brachytherapie, 1999.
17. DIN 6827-3: Protokollierung bei der medizinischen Anwen-
dung ionisierender Strahlen, Brachytherapie mit umschlosse-
nen Strahlungsquellen, Entwurf 1999.
18. Dutreix A, Marinello G. The Paris System. In: Pierquin B,
Wilson IF, Chassagne D, eds. Modern Brachytherapy. New
York: Masson Publishing, 1987: 25-42.
19. Edmundson GK. Geometry based optimization for stepping
source implants. In: Martinez AA, Orton CG, Mould R, eds.
88
Brachytherapy HDR and LDR. Columbia, 1993.
20. Edmundson GK. Volume optimization: an American view-
point. In: Mould RF, Battermann II, Martinez AA, Speiser
BL, eds. Brachytherapy from radium to optimisation. Veenen-
daal: Nucletron International B. V, 1994: 314-318.
21. Fritz P, Hensley FW, Berns C, et al. First experience with su-
prafractionated skin irradiations using large afterloading molds.
Int I Radiat Oncol Biol Phys 1996; 36(1): 147-157.
22. Giannouli S, Baltas D, Milickovic N, et al. Autoactivation of
source dwell positions for HDR brachytherapy treatment plan-
ning. Med Phys 2000; 27(11): 2517-2520.
23. Grigsby P, Georgiou A, Williamson I, et al. Anatomy variation
of gynecologic brachytherapy prescription points. Int I Radiat
Oncol Biol Phys 1993; 27: 725-729.
24. Harrison LB, Minsky BD, Enker WE, et al. High dose rate in-
traoperative radiation therapy (HDR-IORT) as part of the
management strategy for locally advanced primary and recur-
rent rectal cancer. Int I Radiat Oncol Biol Phys 1998; 42(2):
325.
25. Hebbinghaus D, Kovacs G, Kohr P, et al. The Kiel conformal
HDR/PDR interstitial brachytherapy planning system incor-
porating cross-sectional digital imaging. Endocur/Hyperther
Oncol 1996; 12: 81-86.
26. Herbolsheimer M, Baier K, Gall P, et al. Ferngesteuerte in-
trauterine Nachlade- Packmethode beim Endometriurnkarzi-
nom. Rontgenberichte 1988; 17: 226.
27. Henschke UK, Hilaris BS, Mahan GD. Afterloading in inter-
stitial and intracavitary radiation therapy. Am I Roentgenol
1963; 90: 386-395.
28. Hilaris BS, Nori D. Brachytherapy oncology: concepts and tech-
niques. In: McKenna RJ, Murphy GP, eds. Fundamentals of
surgical oncology. New York: Macmillan, 1986: 335-344.
29. Hilaris B, Tenner M, Moorthy C, et al. Three-dimensional bra-
chytherapy treatment planning at New York Medical College.
In: Mould RF, Battermann II, Martinez AA, Speiser BL, eds.
Brachytherapy from radium to optimization. Veenendaal: Nu-
cletron International B.V., 1994: 307-313.
30. International Commission on Radiation Units and Measure-
ments, ICRU Report 38, Dose and volume specification for re-
porting intracavitary therapy in gynaecology. Bethesda: ICRU,
1985.
31. International Commission on Radiation Units and Measure-
ments, ICRU Report 58: Dose and Volume Specification for
Reporting Interstitial Therapy. Bethesda: ICRU, 1997.
32. Joslin CAP, Flynn A. Dose specifications and associated pro-
blems, Brachytherapy 1984, Proceedings of the 3rd internatio-
nal Selectron users meeting, Mould (editor), Nucletron Leer-
sum, 1985: 218-226.
33. Kolotas C, Birn B, Baltas D, et al. CT guided template techni-
que intcrstitial brachytherapy. In: Zamboglou N, ed. New de-
velopments in interstitial remote controlled brachytherapy.
Mnchen: W. Zuckschwerdt Verlag, 1997: 143-152.
34. Kolotas C, Birn G, Ballas D, et al. CT guided interstitial high
dose rate brachytherapy for recurrent malignant gliomas. Br J
Radiol 1999; 72: 805-808.
35. Kolotas C, Baltas D, Zamboglou N. CT based interstitial HDR
OY
Brachytherapy. Strahlenther Onkol 1999; 175: 419-27.
36. Kovacs G. Conformal treatment planning using Magnetic Re-
sonance Imaging tot interstitial implants. In: Zamboglou N,
ed. New developments in interstitial remote controlled brachy-
therapy. Mnchen: W. Zuckschwerdt Verlag, 1997: 52-59.
37. Kubo H. Use of oblique simulation films for estimating the
maximum dose to the bladder and rectum in obese brachythe-
rapy patients. Med Phys 1995; 22: 441-442.
38. Lahanas M, Baltas D, Zamboglou N. Anatomy-based three-di-
mensional dose optimization in brachytherapy using multi-ob-
jective genetic algorithms. Med Phys 1999; 26: 1904-1918.
39. Lahanas M, Baltas D, Zamboglou N. A hybrid evolutionary al-
gorithm for multi-objective anatomy-based dose optimization
in high-dose-rate brachytherapy. Phys Med Bio 2003; 148: 399-
415.
40. Levendag P, Peiffert D, Jansen P, et al. Rotterdam approach
to future prospects for improvements in HDR brachytherapy
of the tonsil. In: Zamboglou N, ed. New developments in inter-
stitial remote controlled brachytherapy. Mnchen: W. Zucksch-
werdt Verlag, 1997: 128-134.
41. Ling C, Schell M, Working K, et al. CT-assisted assessment of
bladder and rectum dose in gynecological implants. Int J Ra-
diat Oncol Biol Phys 1987; 13: 1577-1582.
42. Meredith WJ, ed. Radium dosage the Manchester system. 2nd
ed. Edinbourgh: Livingstone, 1967.
43. Milickovic N, Lahanas M, Papagiannopoulou M, et al. Multi-
objective anatomy-based optimization for HDR-brachytherapy
with constraints free deterministic algorithms. Phys Med Bio
2002; 147: 2263-2380.
44. Nag S, Cano E, Demanes DJ, et al. The American Brachythe-
rapy Society Recommendations for High-Dose-Rate Brachy-
therapy for Head-And-Neck Carcinoma. Int J Rad Oncol Biol
Phys 2001; 50(5): 1190-1198.
45. Narayana MS, Roberson PL, Winfield RJ, et al. Impact of ul-
trasound and computed tomography prostate volume registra-
tion on evaluation of permanent prostatc implants. Int J Ra-
diat Oncol Biol Phys 1997; 39: 341-346.
46. Paterson R. The Treatment of Malignant Disease by Radium
and X-rays. London: Edward Arnold, 1948.
47. Pfandner K, Atzinger A, Breit A. MR treatment planning in
Brachytherapy. In: Mould RF, Muller RP, eds. Brachytherapy
in Gennany. Veenendaal: Nucletron International B.V., 1993:
215-226.
48. Quinlby EH. The grouping of radium tubes in packs and pla-
ques to produce the desired distribution of radiation. Am J
Roentgenol 1932; 27: 18.
49. Rotte K. Das ferngesteuerte Nachladeverfahren (remote con-
trolled afterloading) fr die intrakavitare Kontakttherapie (Bra-
chytherapie) gynakologischer Karzinome. Radiologe 1983; 23:
20-23.
50. Stitt J. Dose specification for inoperable endometrial carcino-
ma: the Madison system. Activity Journal, Supplement 2, 1993;
32-34.
51. Strassmann G, Kolotas C, Heyd R, et al. Navigation system for
interstitial brachytherapy. Radiother Oncol 2000; 56: 49-57.
52. Strassmann G, Walter S, Kolotas C, et al. Reconstruction and
. 89
navigation system for intraoperative brachytherapy using the
flab technique for colorectal tumor bed irradiation. Int J Ra-
diat Oncol Biol Phys 2000; 47: 1323-1329.
53. Ten Haken R, Diaz R, McShan D, et al. From manual to 3D
computerized treatment planning for 125I stereotactic brain
implants. Int J Radial Oncol Biol Phys 1988; 15: 467-480.
54. Tonus C, Kolotas C, Appel P, et al. Colorectales Carcinom -
Behandlungsalternative durch intraoperative Radiotherapie
mittels Afterloading-flab- Technik. Chirurg 1999; 70: 43-48.
55. Tsalpatouros A, Baltas D, Kolotas C, et al. CT based software
for 3D localisation and reconstruction in stepping source bra-
chytherapy. IEEE, Transactions on infonnation technology in
biomedicine, 1997; Vol. 1, No. 4: 229-242.
56. Van der Laarse R, Prins TPE. Introduction to HDR brachy-
therapy Optimisation. In: Mould RE, Battennan J, Martinez
Aa, Speiser BL, eds. Brachytherapy from Radium to Optimi-
zation. Veenendadl: Nucletron International, 1994: 331-351.
57. Van der Laarse R, Prins TPE. Comparing the stepping source
dosimetry system and the Paris system using volume-dose hi-
stograms of breast implants. In: Mould RE, Battennan J, Mar-
tinez Aa, Speiser BL, eds. Brachytherapy from Radium to Op-
timization. Veenendaal: Nucletron International, 1994: 352-372.
58. Vickram B, Shivaji D, Beitler JJ, et al. The relationship bet-
ween dose homogeneity hot spots and complications follow-
ing high-dose rate brachytherapy. Int J Radiat Oncol Biol Phys
1999; 43: 983-987.
59. Willins J, Wallner K. CT-based dosimetry for transperineal -
125 prostate brachytherapy. Int J Radiat Oncol Biol Phys 1997;
39: 347-353.



. . , . , . , .

-
- (Major Histocompatibility Complex MHC). -
() .
. -- CD3
, - TCR -
, - ,
, IFN-. MHC.
-, , - MHC -
-, CD3+ / TCR+ -.
- -O
-
-
. -
, -
- -
. -
-
,
1 ( 1 ), -
MHC.
-
[CR / CD3] [C-] -
. O -

-
,
(Natural Killer cells ), - .
, - CD2
1 CD43. - -
. MHC ,
- IL-2, -
-- -. MHC
, - IL-2 -
- -.
, - ,
, --
, - (Helper cells
. T), - (Suppressor
cells TS) - (Cyto-
O - toxic cells TC)1-3. -
O O OO O
CD4 , TC -
O CD8 . CD4+ -
. H - - MHC -
, CD8+ TC -
[CD3 / TCR] ( Cell Receptor TCR) - MHC
-. . Y ,
CD4+ -

91
92 OY

, MHC . CD3 . O TCR /

10% -
6,7.
CD45. [CR/CD3] -
(splicing) 8 ( ),
CD45 mRNA. , - , -
, -
CD45. . O CD3 -
-- - -
, - v . ,
(200245 KD, CD45RA , -,
+ ). - -Fcy . -
-, in vitro - [TCR/CD3] -
, -
CD45RA+ CD45RO+4. , CD3 . O -
CD4+CD45RO+ MHC,
, , , - ,
, -
CD4+CD45RA+ TCR /+.
. , CD4+CD45RO+ - /+ - -
in vitro , .
in vivo. - TCR /+ -
CD4+CD45RO+ - /+ - -
- , MHC
CD4+CD45RA+ -
(naive), . - MHC.
CD45RA+ CD45RO+ - /+ - -
CD8+ - - MHC. -
. CD8+CD45RO+ /+ -
- /+ - -
, /+ - -
in vivo, CD8+ MHC.
CD45RA+ ,
. OO -O
- -
O OO -O TCR
( CELL RECEPTOR TCR) MHC -
- TCR ( II.
/ / ) , - CD3 -
- . -
(CD3)5. -
TCR - [CR / CD3] -
, 49 -. -
42 KD, - -
8090 KD. 90% (cell-adhesion)
TCR / -
CD4+ CD8+ , [TCR / CD3]
- (110%) [-C] (co-activation). CD2
CD4 - -
CD8 , - .
/ TCR, CD2 LF-3
. 93

- ii) --
8. ,
CD11 / CD18 (LFA-1) ICAM-1 ICAM-2 CD4 CD8 TCR
MHC11.
-9. -
, -
-- OOO O
, CD28 710. O - - -

IL- . O ,
2 - - - -
7 - -
, , ,
- 7-1 7-210. - -
IL-2,
CD28 7 - .
. - -
CD4 . - -
CD8, -
. -, , -
CD4 CD8 - , , -
MHC , - , . -
[CD3/TCR] - - [C-
. ] -
CD4 CD8 , -
-, -
. - --
i) - . CD8+ -
CD4 CD8 - -
MHC -CD4 -CD8, - , -
-, (. 1). CD4+ -

FasL
IL-2
GM-CSF
CD4+
+ CD8+
+ IFN-
TNF-
TCR/CD4
TNF- IL-18 CD40 ligand (L)
IL-2 IL-12 CD40
GM-CSF TNF-
IFN- IL-1 IL-12 MHC II
MHC I
TCR/CD8

CD40
CD80
""

1. CD4+ CD8+ -
. CD4+ (Dendritic Cells DCs), ,
, CD8 -
.
94 OY

LFA-3
MHC 7-1 (CD80)
B7-2 (CD86) ICAM-1

IFN-
GM-CSF
IL-4
TNF-
CD4 IL-1
IL-6
TNF-
IL-12
IL-15

-
1 2
LFA-1 CD2
lck
TCR p56 CD28

2. .
(CR-MHC / , CD28-B7-1 B7-2, LFA-1-
ICAM-1, CD2-LFA-3) .

1 (1) - .
, . -
CD4+ - 2 (2) - , -
--
, (.. -
- , ),
12,13. - (prim-
, , - ing phase).
-
- , -
, - , -
- (. 2). .
. ,
OKTONA
O OO -
O .
(Natural iller cells IL-2, IL-12, IL-15, IL-18, IL-18
cells) , - -- F-14-16.
, -
. - - , 3 , , -
, -
(severe combined im- . -
munodeficient SCID) - (.. IL-
RAG-1 RAG-2 (RAG-1 12, L-15 IL-18),
RAG-2 knock out mice). - (.. - IL-2),
- . -
oo (mmunoglobulin Ig)
- ( Cell Receptor TCR), 5 : ) -
- - , .. CD2, CD18, CD54
. 95

CD40, ) , .. IL-1, TNF- Histocompatibility Complex MHC), -

IL-2, ) , .. IFN-, L-1, TNF-, , ,
IL-2, ) - TNF (.. FasL) (
) 17-19. 150.000 ). -
,
- ,
. . -
,
OO -
, , -
I OO
, - (.. -
K
) (. 3).

OO O O
(ligands) -.
OO O
, ,
, O Killer Inhibitory Recep-
, tors (KIR) -
. KIR -
, HLA , HLA-C
. O , - (p58 KIR), HLA-B (p70), 1, HLA- (p140)
, HLA-G (p49 / KIR2DL4)20,21. -
, - HLA-E
. MHC. -
O , , - CD94 / NKG2A -
(Major C. -

CD94/NKG-2C

CD94/NKG-2
'

IFN-, TNF- CD94/NKG-2

NKG/2D
?

?
? KIR2,3GL

KIR2DL4 /?

KIR2,3DS

NCR
p46, p30, p44

+ IFN-R
TNF CD2
: FasL CD69
IL-15R CD44
IL-18R CD54
IL-12R CD226

3. . -
: ) , , IFN-, TNF-
FasL, CD69, ) -
.
96 OY

vv , -
KIR , (antibody dependent cell-mediated cytotoxicity ADCC)
KIR ,
. Fc
KIR, MHC - 23.
, - FcyRIII, -
v , IgG1 IgG3
, . -
-24. O
OO O O --
I OO O ,
O , KIR, - -
(granzymes). ADCC -
,
(adaptors) , . ADCC
,
22. O -
: -
, Fc .
- --
CD3 FceR (p46, p44, OO
p30, CD16) - OO O O
OO
D (NKG2D). O -
-
,

stress ( .. -
) - , -
. -,
--
OO o -
FC OO O
.
-, - ,
MHC . - , , -
-
- . -
, - -
. - , , TRP-1,
TRP-2 gp100, -
. , -
, ,
, - 25,
- 27.

, -
.
. - - (Tumor In-
- filtrating Lymphocytes TIL) -
, IL-2
() . , -
- -
- - .
. 97

MHC ex vivo - 111 - -

- -, - .
- - IL-
- (CTL), 2
Melan-A / MART-1 *0201, - 31,32.
28.
TIL
gp100 - IL-2 35% 40%.
- , -
16, -
. - .
-
99 gp75/TRP-1 , IL -
gp75+ B16F10 - . -
. O - TIL -
- .

. TIL TNF-
, TIL
MAGE -ESO-1, , -
, , - -
29,30.
, TIL. , ,
, - cDNA TNF-, -
. TNF -
35.
-
, - TNF
, - , -
, , 400 g/kg. -
.
- 8 g/kg -
. .
TIL , TNF--
TIL IL-2 TIL
TNF, --
-, - , . -
(). - , TNF, -
-
ooo - , -
. o-- .
-, -
TNF TIL -
-. O - - TNF -
, , . O -
. LTR Moloney34,
-, -- , -
- (TIL, Tumor-nfiltrating Lymphocy- ,
tes), in vitro - - CMV.
-
. - TNF TIL.
98 OY

TNF, , -
17kDa o- , ,
26kDa, - -
17kDa. HLA .
cDNA o TNF, ,
- IFN-, - HLA- ,
TNF. - , -
TNF , ,
.
26kDa. - -
TNF , - -
TNF TIL , Fv (ScFv, Single-chain Fv domain),
- -
cDNA o TNF. ( VL), -
( V). -
. Fv -
YFC -
- - - Sp6 (Sp-y),
MOv18 (-), -
- 38kDa ,
-
TIL . 35,36.
- -
(mAb), - - - -
, .
, - -. -

, - O-3, - --
. -
-. - -
- -
) , -
- . ,
, ) - --
,
) -
(Human Arti-Mouse Antibody response , -
).
- , V
, - .
-
, O O
-
, -
- TCR -
Fc -
(YFC). , . (immunodomi-
nant) ,
, , in
, , - vitro
, ,
. 99

, - , -
/ - -
, 39,40
(Antigen Presenting Cells C)37,38. - (. 4).
-

MHC , v, -
- -
. -
, - v -
gp100, - , .. ,
IL-2, .
42%. - ,
,
, . , -
- v
v .
vv. -

vvvv
, ,
vv-
. , - vv , -
- .
v , -
v, - .
v . - ,

CD

154
C- ( CD
MH 4 0L
)
DCs
CD83 bi
CD80 bi
CD86 bi
MHC bi
PB

C
M

-4
F IL

G M-CS

4. (Dendritic Cells DCs). (Peripheral Blood

Mononuclear Cells PBMCs) , , in vitro -
GM-CSF IL-4 5-7 . T DCs CD40L, -
.
100 OY

, , -
DNA41. -- ( -
RNA , - -
, . ADCC)
- -
CD4+ CD8+ -
, , .
MHC -
, - -
. , , , -
, , -
,
. -
, / - .
, / -
D, -
. , -

OO I
(Human Anti-
Mouse Antibody ),
Kohler Milstein (1975)42

, . -
-
. -
-

NK

5. . -
.
, -
.
. 101

-
. -
, , - -
- ( ).
- O
. ( 12 )46.
-
-

O -
. , -
- -
20 . -

,
,
- .
43,44. ,
- -
- 17-1 (anti-Ep-CAM -
) -
, - ( ), -
45. ( C
Dukes), -
- 30%
(. 5). 27%

- .
-
- ,
- . -
-. - , ,
, , 300 mCi/m2 -
- CC49 (-TAG-72 )
- 131,
- .

, , -
- (56 cGy).
. 131- 1 (-CD20 , , -
) ,
75%, dg- 2, 15 , -
kins ( , .
) ,
131
33 (-33 ),
(76% 50% ). -
( 100%) -
. 23
- , -
, -
102 OY

LTR L VH VL S neo LTR

-
SV40

VH VL (ScFv): ,
: 15
: 59
: TCR- - Fc()RIII
L, LTR:
neo: GH18

6. ScFv . -
, - ,
.

47,48. 2530%
-
, - , -
- 49.
. , , rhuMabHER2 -
46 .
- -
F (ScF), MFE-23, - ( 50% -
(CEA) ) 12% ,
. 37% -
ScF, - . rhuMabHER2
, - -
-
(. 6). - p185HER2 (ECDHER2), -
, rhuMabHER2
ScF, . -
-
,
, -
. . -

-
,
- -
. ,
, -
-
. -
-HER2. ,
rhuMabHER2, - rhuMabHER2 , -
p185HER2 -
( HER2/neu), -
. p185HER2 - p185
HER2 (23,50).
(EGFR), Ley
. 103

, -
I
- TIL
. (..
( Ley TNF-) .
) ,
-
. (naked) DNA - (mini-
genes), DNA
-

-
, 41.


-
DNA -
G250, -
(.. ), , -
. O
,
G225, 131,
. DNA
) -
0,1% - (CEA), ..
/g (ID/g), , ) PSA
0,001 , ) MC-1 -
0,01% (ID/g). - ) Melan-A / MART-1 -
(HACA) 2 16 - 53-55.
. G250 - -
, 131, -
, ,
.
.
G250 CEA - IL-2
- IL-2,
, IL-6, IL-7 IL-12, -
.
51-52. -
ADCC 56.
IL-2 in i IL-2 -
. - OO
ADCC -

, -

(GD2, GD3) 17-1,

-
. , in itr in i ,
.

, CD3 -
(-), CD16 ( ) - ,
, . -
-
O ,
- -
- .
104
1. Rmagnani S. The Th1/Th2 paradigm. Immunl Tday 1997;
18: 263.
2. Drf , Kuchr K, Cllins . Suppressr cells: sme
answers but mre questins. Immunl Tday 1992; 13: 241.
3. Barry , Bleackley RC. Cyttxic lymphcytes: all rads lead
t deat. Nat Rev Immunl 2000; 2: 401.
4. Trwbridge IS, Thmas . CD45: an emerging rle as a pr-
tein tyrsine phsphatase required fr lymphcyte activatin
and develpment. nnu Rev Immunl 1994; 12: 85.
5. Allisn JP, Lanier . The structure, functin and serlgy f
the cell antigen receptr cmplex. nn Rev Immunl 1987;
5: 585.
6. Garcia KC, Degan , Stanfield RL, Brunmark , Jacksn
MR, Petersn , Teytn L, Wilsn . n alphabeta -cell
receptr structure at 2.5 and its rientatin in the TCR-
MHC cmplex. Science 1996; 274: 176.
7. Garbczi O, Ghsh , Utz U, Fan QR, Biddisn WE, Wiley
DC. Structure f the cmplex between human -cell receptr,
viral peptide and HLA-A2. Nature 1996; 384: 134.
8. Bierer , Burakff SJ. -lymphcyte activatin: the bilgy
and functin f CD2 and CD4. Immunl Rev 1989; 111: 267.
9. Springer . Adhesin receptrs f the immune system. Natu-
re 1990; 346: 425.
10. Linsley PS, Ledbetter JA. The rle f the CD28 receptr
during cell respnses t antigen. nnu Rev Immunl 1993;
11: 191.
11. Parnes JR. Mlecular bilgy and functin f CD4 and CD8.
Adv Immunl 1989; 44: 265.
12. Paganelli R, Scala , Aiuti F, Firilli . B-cell help by Tc2
cells. Immunl Tday 1998; 19: 142.
13. Ma J, Chen , Mandelin J, Cepnis , Miller , Hukkanen
, Ma GF, Knttinen U. Regulatin f macrphage activa-
tin. Cell l Life Sci 2003; 60: 2334.
14. Fehniger , Caligiuri . Interleukin 15: bilgy and rele-
vance t human disease. Bld 2001; 97: 14.
15. Fehninger , Shah , Turner MJ, anDeusen JB, Whit-
man SP, Cper , Suzuki , Wechser , Gdsaid F, Cal-
giuri . Differential cytkine and chemkine gene expres-
sin by human cells fllwing activatin with l-18 or l-15
in cmbinatin with l-12: implicatins fr the innate immune
respnse. J Immunl 1999; 162: 4511.
16. Dunne J, Lynch, S, OFarrelly C, Tdryk S, Hegarty JE, Fei-
ghery C, Dherty DG. Selectie expansin and partial activa-
tin f human cells and receptr-psitive cells by l-
2 and l-15. J Immunl 2001; 167: 3129.
17. Lee RK, Spielman J, Zha OU, Olsen KJ, Pdack ER. Perf-
rin, Fas Ligand, and tumr necrsis factr are the majr cyt-
txic mlecules used by Lymphkine-activated killer cells. J
Immunl 1996; 157: 1919.
18. Timnen , Gahmberg CG, Patarry . Participatin f
CD11a- c/CD18, CD2 and RGD-binding receptrs in endge-
nus and interleukin-2- stimulated activity f CD3-nega-
tive large granular lymphcytes. Int J Cancer 1990; 46: 1035.
19. Wang , anky F, i SL, Patarry , Klein . Functinal
OY
characteristics f the intercellular adhesin mlecule-1 (CD54)
expressed n cyttxic human bld lymphcytes. Cellimmu-
nl 1990; 131: 366.
20. Wilsn MJ, Trkar , Trwsdale J. Genmic rganizatin f
a human killer cell inhibitry receptr gene. Tissue Antigens
1997; 49: 574.
21. ales-Gmez , Reyburn , Erskins RA, Lpez-Btet ,
Strminger JL. Kinetics and peptide dependency f the bind-
ing f the inhibitry receptr CD94/NKG2-A and the acti-
vating receptr CD94/NKG2-C t HLA-E. O 1999; 18:
4250.
22. Blassni R, Cantni C, Falc . The human leukcyte antigen
(HLA)-C- specific activatry or inhibitry natural killer
cell receptrs display highly hmlgus extracellular dmains
but differ in their transmembrane and intracytplasmic pr-
tins. J xp Med 1996; 183: 645.
23. Carsn WE, Parihar R, Lindemann MJ, Persneni , Dierk-
sheide J, Merpl NJ, Baselga J, Calgiuri . Interleukin-2
enhances the natural killer cell respnse t Herceptin-cated
Her2/neu-psitive breast cancer cells. Eur J Immunl 2001;
31: 3016.
24. Rbertsn MJ, Ritz J. Bilgy and clinical relevance f human
natural killer cells. Bld 1990; 76: 2421.
25. Parkhurst MR, DePan C, Riley JP, Rsenberg SA, Shu S.
Hybrids f dendritic cells and tumr cells generated by electr-
fusin simultaneusly present immundminant epitpes frm
multiple human tumr-assciated antigens in the cntext f
MHC class I and class II mlecules. J Immunl 2003; 170:
5317.
26. Negriu G, Dwek RA, Petrescu SM. The inhibitin f early N-
glycan prcessing targets TRP-2 t degradatin in 16 mela-
nma cells. J il Chem 2003; 278: 27035.
27. Mandelcrn-Mnsn RL, Shear , Yau , Sambhara S, Bar-
ber , Spaner D, DeBenedette . Cyttxic lymphcyte
reactivity t gp100, MelanA/MART-1, and tyrsinase, in HLA-
A2-psitive vitilig patients. J Invest Dermatl 2003; 121: 550.
28. Garbe C, Leiter U, Ellwanger U, Blaheta HJ, Meier F, Rass-
ner G, Schittek . Diagnstic value and prgnstic significance
f prtein S-100beta, melanma-inhibitry activity, and tyrsi-
nase/MART-1 reverse transcriptin-plymerase chain rea-
ctin in the fllw-up f high-risk melanma patients. Cancer
2003; 97: 1737.
29. Reynlds SR, Zeleniuch-Jacqutte , Shapir RL, Rses DF,
Harris , Jhnstn D, Bystryn JC. accine-induced CD8+
-cell respnses t MAGE-3 crrelate with clinical utcme in
patients with melanma. Clin Cancer Res 2003; 9: 657.
30. Yakirevich , Sab , Lavie O, Mazareb S, Spagnli GC, Res-
nick . Expressin f the MAGE-A4 and NY-ESO-1 can-
cer-testis antigens in serius varian neplasms. Clin Cancer
Res 2003; 9: 6453.
31. Ridlfi L, Ridlfi R, Riccbn , De Pala F, Petrini , Ste-
fanelli , Flamini , Raaili , erdecchia GM, Trevisan G,
Amadri D. Adjuvant immuntherapy with tumr infiltrating
lymphcytes and interleukin-2 in patients with resected stage
. 105
III and IV melanma. J Immunl 2003; 26: 156.
32. Figlin RA, Thmpsn JA, Bukwski RM, gelzang NJ, N-
vick AC, Lange , Steinberg GD, Belldegrun AS. Multicenter,
randmized, phase III trial f CD8(+) tumr-infiltrating lym-
phcytes in cmbinatin with recmbinant interleukin-2 in me-
tastatic renal cell carcinma. J Clin Oncl 1999; 17: 2521.
33. Hwu , Yannelli J, Kriegler , Andersn WF, Perez C,
Chiang U, Schwarz S, Cwherd R, Delgad C, Mule J. Fun-
ctinal and mlecular characterizatin f tumr-infiltrating
lymphcytes transduced with tumr necrsis factr-alpha cDNA
fr the gene therapy f cancer in humans. J Immunl 1993;
150: 4104.
34. Treisman J, Hwu , Yannelli JR, Shafer GE, Cwherd R, Sa-
mid D, Rsenberg SA. Upregulatin f tumr necrsis factr-
alpha prductin by retrvirally transduced human tumr-in-
filtrating lymphcytes using trans-retinic acid. Cell Immunl
1994; 156: 448.
35. Gritzapis O, Mamalaki , Kretsvali , Papamatheakis J,
Belimezi , Perez SA, Baxevanis CN, Papamichail . Redi-
recting muse hybridma against breast and varian carci-
nmas: in viv activity against HER-2/neu expressing cancer
cells. r J Cancer 2003; 88: 1292.
36. Mritz D, Wels W, Mattern J, Grwer . Cyttxic lymph-
cytes with a grafted recgnitin specificity fr ERBB2-expres-
sing tumr cells. Prc Natl Acad Sci 1994; 91: 4318.
37. Wang RF, Rsenberg SA. Human tumr antigens fr cancer
vaccine develpment. Immunl Rev 1999; 170: 85.
38. Slingluff CL Jr, Petrni GR, Yamshchikv G, Barnd DL,
Eastham S, Galavtti , Pattersn JW, Deacn O, Hibbitts
S, Teates D, Neese U, Grsh WW, Chianese-Bullck ,
Wdsn , Wiernasz CJ, Merrill , Gibsn J, Rss , En-
gelhard v. Clinical and immunlgic results f a randmized
phase II trial f vaccinatin using fur melanma peptides
either administered in granulcyte- macrphage clny-stimu-
lating factr in adjuvant or pulsed n dendritic cells. J Clin
Oncl 2003; 21: 4016.
39. Hernand JJ, Park TW, Kuhn WC. Dendritic cell-based vac-
cines in breast and gynaeclgic cancer. Anticancer Res 2003;
23: 4293.
40. Cranmer LD, Trevr , Hersh . Clinical applicatins f
dendritic cell vaccinatin in the treatment f cancer. Cancer
Immunllmmunther 2003, v 26.
41. rnor R, Ben-Yedidia . Old and new vaccine appraches. Int
Immunpharmacl 2003; 3: 1195.
42. Khler G, Milstein C. Cntinuus cultures f fused cells secre-
ting antibdy f predefined specificity. Nature 1975; 256: 495.
43. Glennie MJ, Jhnsn PW. Clinical trials f antibdy therapy.
Immunl Tday 2000; 21: 403.
44. Abken , Hmbach , Reinhldu, Ferrne S. Can cmbined
-cell and antibdy based immuntherapy utsmart tumr
cells? Immunl Tday 1998; 19: 2.
45. Sung , Queen C. Humanized antibdies fr therapy. Nature
1991; 351: 501.
46. Frer , Lbugli AF. Histry f antibdy therapy fr nn-
Hdgkins lymphma. Semin Oncl 2003; 30: 1.
47. Smith CL, Dulphy , Sali , Cerundl V. Immuntherapy
f clrectal cancer. r Med ull 2002; 64: 181.
48. Welt S, Divgi CR, Kemeny , Finn RD, Sctt , Graham
Germain JS, Richards EC, Larsn SM, Oettgen HF. Phase III
study f idine 131-labeled mnclnal antibdy 33 in pa-
tients with advanced cln cancer. J Clin Oncl 1994; 12: 1561.
49. Schultz , Weber BL. Recent advances in breast cancer bil-
gy. Curr Opin Oncl 1999; 11: 429.
50. Kub , Mrisaki , Kurki , Tasaki , Yamanaka , Ma-
tsumt , Nakamura , Onishi , Baba , Katan . Cm-
binatin f adptive immuntherapy with Herceptin fr pa-
tients with HER2-expressing breast cancer. Anticancer Res
2003; 23: 4443.
51. Mulders PF, De Mulder . The rle f adjuvant immun-
therapy in renal cell carcinma. Curr Opin Oncol 2002, Rep 3:
44.
52. Bruwers , Dorr U, Lang O, Berman OC, Oyen WJ,
Steffens MG, Osterwijk , Mergenthaler HG, Bihl , Cr-
stens FH. 131 I-cG250 mnclnal antibdy immunscintigra-
phy versus [18 F]FDG-PET imaging in patients with metastatic
renal cell carcinma: a cmparative study. Nucl Med Cmmun
2002; 23: 229.
53. Mincheff , Altankva I, Zubak S, Tchakarv S, Btev C,
Petrv S, Krusteva , Kurteva G, Kurte , Dimitrv , Ilieva
, Gergiev G, Lissitchkv , Chernzemski L, Meryman .
n viv transfectin and/r crss-priming f dendritic cells fl-
lwing D and adenviral immunizatins fr immunthe-
rapy f cancerchanges in peripheral mnnuclear subsets
and intracellular l-4 and IFN-gamma lymphkine prfile. Crit
Rev Oncl Hematl 2001; 39: 125.
54. Jhnen , Kulbe , Pecher G. Lng-term tumr grwth sup-
pressin in mice immunized with naked D f the human
tumr antigen mucin (MUC1). Cancer Immunllmmunther
2001; 50: 356.
55. Mincheff , Tchakarv S, Zubak S, Lukinv D, Btev C,
Altankva 1, Gergiev G, Petrv S, Meryman . Naked D
and adenviral immunizatins fr immuntherapy f prstate
cancer: a phase III clinical trial. ur Urol 2000; 38: 208.
56. Ettinghansen SE, Rsenberg SA. Immuntherapy and gene
therapy f cancer. Adv Surgery 1995; 28: 223.

. T

I . -
- (cell
- cycle kinetics),
(tissue growth
/ . - kinetics) . -

- .
.
O O O
-
O O O YO
:
1. , -
- . O
, -
1. -
2. (. 1).
- G1
(gap1 = ) G0.
- ,
. M , -
(proliferati- ( -
ve index) -

2,3.
3. O G0

4.

- G2 (m =1h)
(TG2 = 6h st
,
3h 184h)
DNA=4N

DNA=2N

-
G1
, - (TG1 = 23h
- 3h 180h)
-
5.
S (Ts = 17h
10 130h) A
D N
- 1. -
, - ()
- .

107
108 OY

) D = 2 10%. S0, DNA 2 4. -

G1 - S
12 24 .
DNA. - ,
G1 23 . - DNA
D, G0 ( - G2 (gap2= ). -
). G0 G2 6 .
(. 2). G0 G2.
, G2 -
-
, (- 1 . -
), - 24
. G1 - 6.
S 17 . O -
DNA 2 4, , -
-
, ,

DNA

ATM?
;
ATM
Chk 1,2

p53 ATM 14, 3, 3

Bax

cdc25
p21
?
Nbs 1

/cdk /cdk

RB E2F1

2. .
DNA .
, .
G1, DNA p53.
, gadd45, mdm2, p21, G Bax,
p21WAF1/CIP1 . S,
DNA DNA ATM nbs110.
G2 M, DNA chk1 chk2
cdc25. cdc25
14-3-3 /cdk1 MTF (maturation promot-
ing factor). O , , .
. 109

. Li-Fraumeni8.
, , - DNA p53 ,
DNA, -
DNA S (CKI) p21WAF1/CIP1. -
p21WAF1/CIP1
. - / cdk (cyclin dependent kinases),
: G1
1. , GM-CSF S
( - RB (. 2)9.
) . G1 S p53
2. .
3. -
. DNA. p53
4. , -
- .
. S
5. , , -
O -

S DNA -
,
. (mutat-
.
ed in ataxia-telangiectasia)
6. O- , p53 -
S. -
. -

-
-

, p53,
5.
DNA ,
DNA10.
(cell cycle checkpoints) G2 S
- H G2
-
-
7. - G2
, - . -
, - DNA chk1,
, - cdc25 (. 2)9.
. - cdc25
/ cdk1 MTF (matura-
. - tion promoting factor), -
, , - . cdc25
, - -
, 14-3-3. -
DNA - ,
- .
.

G1 S
- p53 -
G1 , -
DNA. -
p53 . -
, -
110 OY

-

(. 3).
-
-
. -
-

-
S (, , -
DNA)
,
.
3. .
O OOO OE
, ( MAD1, MAD2, MAD3, (-PULSE LABELED MITOSES)
BUB1, BUB2, BUB3) 11, -
- S -
. -
p53 - 3H-Th. -
12, -
p53 - , -
. -
- . -
-
- -
(3H-Th)13. - 14. -
o -
,
DNA. , , -
, 4. -
. O S
3-Th - 3-Th,
, - .
- 3-Th
- G2

A
4.
100
-
. -
S G2 S ( )
75 ,
B M

S ( ) -
G1
. -
50 3H-h -
TG2 TS -
TC ,
G2.
25 -

S


0
.
. 111

(G2).
S ( ) -

-
-
S (s). -
- (LASER)

-
(c). PLM
S, G2
, G1 -

, 3 -
.
(c) - 5. .
1
2 ,
2 3 15. - -
PLM DNA -
- .
. , , (
c (O) )
2,5 -
2 9. , .
, O - , -
, - Laser
,
. -
PLM
, (-
, ). 6 -
, - DNA DNA.
G0/G1 4 DNA.
DNA -
S
, G0 / G1 G2 / M. -
- S -
. DNA -

OI OH (TLI). -
S S S + G2 / S -
-
DNA . .
DNA S 0,05 ( ..
- )
(. 5). , , S 0,15 (-
- )
- S 0,3 (
, Burkitt) 16.
DNA . - DNA ()
, , - G0 / G1, -
, Laser. DNA DNA -
17.
112 OY

3200 3200
G0/G1
2800 2800
G0/G1
2400 2400

2000 2000

1600 1600

G0/G1
1200 1200

800 800

G2/

G2/
400 G2/M
400
S
0 0
0 40 80 120 160 200 240 280 0 32 64 96 128 160 192 224 256
DNA DNA

6. DNA ( DNA)
() ( DNA) ().

O OO
1. (TL)
O A A (Growth Fraction GF)
, TLI
-
, Burkitt 0,29
0,09
. -
M 0,110,24
& 0,050,11
G0 - 0,08
, - 0,05
. - 0,05
0,03
- 0,02
- 0,02
3-Th. -
(LI, Thymidine
Labeling Index). O TLI - S
DNA DNA 3-Th. -
3-Th ( - , -
:
). O TLI : GF = TLI c /s ,
c s -
TLI =
S
O L - PLM. O TLI
( 1% 8%), 3-
, Th ( 1) -
Burkitt, ,
30%, -
, 16%. 18.

(CELL LOSS)
,
(. 1). O , EO H
, O -
, - :
. 113

-
,
,
,
:
= K ,

, -
(simple exponential growth pattern) (.
8). , -
7. (-
-
), ( - , -
) ( ). ,

1. . (. 8).
2. (-
) AA O OO A GOMPERTZ
3. . O
- . -
-
- , -
/ . -
, . - L1210
- (. 8)19,20.
-
/ .
7, - , -
( - Gompertz 182521. -
) Gompertz
( ), - -
(- (. 8). Gompertz -
) -
(high cell turnover rate).
, -
. ( ). -

Log N

Log N

8. . . . Gompertz.
114 OY

1014
1012
1012 1 KG

10
10
1010

10 G
109
1G
1,3 x 108
108 130 MG

9.
(30 )
106 -
106 -
.
104

(27 )
102

1
10 20 30 40 50

, - . Gom-
, - pertz , -
. ,
Gompertz, . 0,109 , -
( - 1 10 , 0,120
109 ), 2 - 10 102, 0,131
. Gompertz - 102 103 (. 2).
- O
, , Gompertz
. - , -
( ) -
, - ) , -
1012 ( 1 kg
), (. 9). -
, , ) -
108 (1/10 - , )
) 1010 ( ) - ) -

2. ( 10)
( ) - , ..

I TTOO A
()
EO O OOY AO (LOG
0 1 ILL)
0,109 10

0,229 102
0,360 103 Skipper et al. ,
0,506 104 L1210,
(0,553) (2 104) -
0,670 105

0,858 106
1,078 107 -
1,343 108 , -
1,674 109 22. -
2,120 1010 ,
2,801 1011
4,306 1012
(, -
, ..)
. 115

1012

1011
3
1010

109

108

107

106 1

105

104

103

102

101

100 1 2 3 4 5

10. .
, ,
. 99,9% (3 ) , -
. -
, : .

, , -
- L1210 ,
, .
Skipper et al -
. - L1210 -
-
( ) . ( 106 -
, , )
. -
. , , -

1010 .
(. 8),
99,9%
-
,
.
1 -
Skipper

10, L1210
1010 107 (Log ill= 3). - , -
- 1,
-
- .
-
,
- -
5 (. 10). ,
116 OY

. -
, -
-
. ,
.
-
OI -
. , -
) -
, -
,

)
-

.
.
O OEO GOLDIE COLDMAN
-
-

Lu-
,
ria Delbruck25.
. ,
Escherichia coli
.
-
, -
,
, , -
-
(), -
. , 1979, Goldie

Coldman ,
,

.
,

.
-
,
.
-
-
, o, ,
-
26.

:
. -
- 0 = 1
(sanctuary) - e (N 1)
. -
() - 0
- () -
. ,
. -
- . ,
Goldie Coldman
-

- ,
. ,
- = 10-6 ( -
23,24. 106 ) -
- -
, , - 105 -
- 0,905. -
, - -
. 117

107 - -
0,000045. -
. -
90%, 105 , - -
, ,
107 . (.. -
Goldie Coldman ),
(. -
8). -
o -
, . Goldie Coldman
, - ,
- Hodgkin,
27. - 28-31.
, -
- . -

. - , -

Goldie Coldman
, - (
- Goldie Coldman).
,
. O , -
- .
, - Goldie Coldman ,
o ,
-
,
. .
Goldie -
Coldman - , .

- O OO O
(non-cross-resistant drugs), - (DOSE INTENSITY)
( -
)
. , -
- -
. -
, Hodgkin ( 20%),
-
. - , -
, , -
, -
. - .
-
-
Goldie Coldman, --
.
. 3,
118 OY

3. O Ridgway.
L-PAM

(RDI)
L-PAM (%) (%)

0,38 0,82 0,60 100 60

0,75 0,18 0,47 100 44
0,25 0,55 0,44 100 0
0,50 0,12 0,31 10 0
0,17 0,36 0,27 0 0

RDI: Relative Dose Intensity, L-PAM:

, (1-log)
Skipper, - . -
( ) -
Ridgway32. -
L-PAM .

, ,

( -
). - .
20%
50%. - . -
. -
Hryniuk33,
10 -

4. : , -

OOO OO O (RDI)
:
, 80 mg/m2/ ()
(DI): 560 mg/m2/
: , 100 mg/m2/ ( 1-14, 28 )
(DI): 350 mg/m2/
RDI: 350/560=0,62
OOO OO O (RDI)
*:
, 2 mg/kg/ (), DI: 560 mg/m2/
M, 0,7 mg/kg/, DI: 28 mg/m2/
5-, 12 mg/kg/, DI: 480 mg/m2/
:
, 100 mg/m2/ ( 1-14, 28 ), DI: 350 mg/m2/, RDI: 350/560=0,62
M, 40 mg/m2 1 8, DI: 20 mg/m2/, RDI: 20/28=0,71
5-, 600 mg/m2 1 8, DI: 300 mg/m2/, RDI: 300/480=0,62
28
(RDI) = (0,62 + 0,71 + 0,62) / 3= 0,65

* , 5-.
mg/kg mg/m2, 40,34
. 119

. - .
(Dose intensity DI)
-
, -
- -
(mg/m2 /week) , .
. -
(Relative dose intensity RDI) -
-
, -
-
-
(standard),
-

, . -

,

-

-
(standard).
4 34,35. , -
- . -
- -
, -
, . -
- . -
, - -
-
CMF (, - .
5-) -
. -
- , -
DNA -
- -
- -
- .

1. Bethlefsen IA, ed. Cell Cycle Effects of Drugs. Oxford: Perga-
mon Press, 1986.
2. Meyer JS, Province . Proliferative Index of breast carcinoma
by thymidine labeling. Prognostic power independent of stage,
estrogen and progesterone receptors. Breast Cancer Res Treat
1988; 12: 191-204.
3. Tubiana , Courdi . Cell proliferation kinetics in human so-
lid tumors: relation to probability of metastatic dissemination
and long term survival. Radiother Oncol 1989; 15: 1-18.
4. Tubiana , Koscielny S. Natural history of human breast can-
cer: recent data and clinical implications. Breast Cancer Res
Treat 1991; 18: 125-140.
5. Hunter , Pines J. Cyclins and cancer. Cell 66: 1071-1091.
6. Norton L. The Norton-Simon hypothesis. In: Perry MC, ed.
The Chemotherapy Souree Book. Baltimore: WilIiams & Wil-
kins, 1992: 36-66.
7. Elledge SJ. Cell cycle checkpoints: preventing an identity cri-
sis. Science 1996; 246: 603.
8. Hollstein M, Sidransky D, Vogelstein B, Harris CC. P53 muta-
tion in human cancers. Science 1991; 253: 49.
9. Lim D-S, Kim S-T, Xu B, et al. ATM phosphorylates p95/nbs1
in an S-phase pathway. Nature 2000; 404: 613.
10. Canman CE, Lim D-S, Cimprich KA, et al. Activation of the
ATM kinase by ionizing radiation and phosphoryliation of p53.
Science 1998; 281: 1677.
11. Hartwell LH, Kastan MB. Cell cycle control and cancer. Scien-
ce 1994; 266: 1861.
12. Cross SM, Sanchez CA, Morgan CA, et al. A p53-dependent
mouse spindle checkpoint. Science 1995; 267: 1353.
13. Cleaver JE. Thymidine metabolism and cell L kinetics. Am-
sterdam: North Holland Publishing Co, 1967.
14. Quastler , Sherman FG. Cell population kinetics in the inte-
120
stinal epithelium of the mouse. xp Cell Res 1959; 17: 420-
438.
15. Tannock I. Cell kinetics and cancer chemotherapy: critical
Review. Cancer Treat Rep 1978; 62: 1117-1133.
16. Shacney SE, Levine M, Fisher R, et al. The biology of the tu-
mor growth in the non-Hodgkins lymphomas: a dual parame-
ter flow cytometry of 220 cases. J Clin Invest 1984; 73: 1201.
17. Zackon IL, Goolsby CL. clinicians guide to flow cytometry.
Contemporary Oncology 1994; 4 (5): 14-36.
18. Cooper M, Cooper R. Principles of Medical Oncology. In:
Holleb , Fink DJ, Murphy GP, eds. American Cancer Socie-
ty Textbook of Clinical Oncology. American Cancer Society
1993; 47-68.
19. Yankee RA, DeVita VT, Perry S. The cell cycle of leukemia
L1210 cells in vivo. Cancer Res 1967; 27: 2381-2385.
20. Skipper , Schabel FM, Mellet LB, et al. Implications of bio-
chemical, cytokinetic, pharmacologic, and toxicologic relation-
ships in the design of optimal therapeutic schedules. Cancer
Chemother Rep 1970; 54: 431-450.
21. Laird . Dynamics of growth in tumors and normal orga-
nisms. Natl Cancer Inst Monogr 1969; 30: 15-28.
22. Skipper , Schabel FM Jr, Wilkox WS. xperimental evalua-
tion of potential anticancer agents. . On the criteria and
kinetics associated with curability of experimental leukemia.
Cancer Chemother Rep 1964; 35: 1-111.
23. Bleyer WA, Poplack DG. Prophylaxis and treatment of leu-
kemia of the central nervous system and other sanctuaries. Se-
min Oncol 1985; 12: 131-148.
24. Russo , Schiliro G. The enigma of testicular leukemia: a cri-
tical review. Med Pediatr Oncol 1986; 14: 300-3060.
25. Luria SE, Delbmck . Mutations of bacteria from virus sensi-
tivity to virus resistance. Genetics 1943; 28: 491-511.
26. Goldie JH, Coldman AJ. mathematic model for relating the
drug sensitivity of tumors t their spontaneous mutation rate.
OY
Cancer Treat Rep 1979; 63: 1727-1733.
27. Goldie JH. Scientific basis for adjuvant and rimary (neoadju-
vant) chemotherapy. Semin Oncol 1987; 14: 1-7.
28. Bonadonna G, Valagusja , Santoro . Alternating non-cross-
resistant combination chemotherapy O in stage Hodgkins
disease. n Intern Med 1986; 104: 738-746.
29. Longo DL, Duffey PL, DeVita V, et al. Treatment of advan-
ced-stage Hodgkins disease: Alternating non-cross-resistant
O. J, CABS is not superir to O. J Clin Oncol 1991;
9: 1409-1420.
30. Feld R, Evans WK, Coy , et al. Canadian multicenter rando-
mized trial comparing sequential and alternating administra-
tion of two non-cross-resistant chemotherapy combinations in
patients with limited small cell carcinoma of the lung. J Clin
Oncol 1987; 5: 1401-1409.
31. Aisner J, Korsuln , Perlojr , et al. randomized compari-
sn of CAF, v , and v alternating with CMFVP for
advanced breast cancer, a CALBG study. Proc Am Soc Clin
Oncol 1988; 7: 27.
32. Skipper H. Data and analysis having to do with the influence
of dose intensity and duration of treatment (single drugs and
combinations) on lethal toxicity and therapeutic response of
experimental neoplasms. Birmingham, AL: Southern Research
Institute, Booklets 13, 1986, and 2-13, 1987.
33. Hryniuk WM. The importance of dose intensity in the outco-
me of chemotherapy. In: Hellman S, DeVita VT, Rosenberg S,
eds. Important advances in Oncology. Philadelphia: JB Lippin-
cott, 1988: 121-141.
34. Hryniuk WM. Average relative dose intensity and the impact
on design of clinical trials. Semin Oncol 1987; 14:65.
35. Tannock IF, et al. randomized trial of two dose levels of cy-
clophosphamide, methotrexate and fluorouracil chemotherapy
for patients with metastatic breast cancer. J Clin Oncol 1988;
6: 1377-1387.

B
O

. . , . , . ...................................................... 123

ICH GCP E ........ 145

.... 181

H O
A.E. P, N.K. K ................................................................................ 195

.. , . , .

: ) -
-
) M
-
- ( -
. ),


O EO AO , .. -
, - .
(), -
. -
, .
. -
A
O
, .
. .
I H OH; M I
H E
. - ( ) .
- -
, , - , (MTD) -
. , (DLT) . -
-
. (). O -
O .
, -
. O - -
.
, . -
M
-
. , -
.
. -
O O IO- -
OOOI (3080). ,
O : ,
.

123
124 OY

M I H E

- O -
. O - .
, , :
. -
-

-

.



:
O

( - .
) (
) , -

.
.
(CRF)
OH H H
(GOOD CLINICAL PRACTICE GCP) -
, - .
, , -
- .
- , -
. -
-
, - . -
. -
.
GCP : :
-
O ICH (International Conference of Har- ( -
monisation) , )
886, - (, -
. , , , , , , -
)
GCP : (

)

-
-
-
-
-
.
. 125

, - .
O :
: - -
, -
, .. -
, ..
O

O -
, ,

. CRF

.
O
GCP (Good Clinical -
Practice) .

O - OI OOI
-
, -
.
- :
O ,
, -
- -


-
, O ().
-

, (Induction chemotherapy Neoadjuvant)
E -
O - - , -
. in vivo -
.
- -
, / -
, , .
. ,
,
(monitor)
.
-
(Adjuvant)
, - E -
, -
(standard operating procedures) - ,
, GCP . O .

, -
126 OY

C Dukes,
. (Time to progression TTP)
1 -
(CR),

(PR) (SD)

/
( ) . O




( ).
, -
6 .
2
-
1 - , :
, . ( -
): ,
20 10 mm
(Dose-Limiting Toxicity DLT) : ,
20 10 mm
, - ( ): -
( - ,
grade 4 grade >3 10 10 mm
) - CT / MRI: , -
> 50% . 20 10 mm.

(Maximum Tolerated Dose MTD)
- , :
, , , ,
( CT scans MRI: -
) >50% - , >10 mm.
.
.

(Disease free survival) -
,
O
(-
).

(Overall Survival) O
O - ,
. . -
-
(Response Duration)
-
, -
(CR) - -
(PR) - .
(,
) (
) -
. -
. 127

3 . ()
, .

(
6 -, -
)
,
- - (CR):
. - , ,
3 4
. .
(PR):
( 50% , 4
) .
(CR): (SD-NC): -
- 6 -
, 4 . , -
, . 50% -
(PR): - 25%.
, - (PD):
50% - 25%
- .
. , -
/ -
50%

.
: -
, - -
, . ,
(SD-NC): - , .
, :
- ,
- 6
6 - .
, 50%, : -
25%. - -
, - 4 -
.
6 -
, < 50% < 25% .
. . -
(PD):

25% -
. - -
, - .
O ,
. - 6 (2 -
. ) .
9
.
: - O -
25% -
- :
128 OY

PD O O PD
O PD O PD
SD-NC O PD O PD SD-NC
PR O PD O PD PR
CR PD O PD PR
CR CR CR CR
O O PD PD

O -
, :

PD O O PD
O PD O PD
SD-NC O PD O PD SD-NC
PR O PD O PD PR
CR O PD O PD PR
CR CR CR CR
O O PD PD

O
, :

PD O O PD
O PD O PD
SD-NC O PD O PD SD-NC
PR O PD O PD PR
CR O PD O PD PR
CR CR CR CR
O O PD PD

/ CTG.
O . -
() , -
, , ,
, ,
, , - , , -
. . -
-
- , ,
. , - .. -
NCIC- .
. 129

-
.
. ,
. , -
.
-
30 - /
-
. O - -
( . -
30 ), -
, - .
.

1.

OO O
0 1 2 3 4

WBC (109 /L) 4,0 3,03,9 2,02,9 1,01,9 < 1,0

O (109 /L) 2,0 1,51,9 1,01,4 0,50,9 < 0,5
PLT (109 /L) E..O. ( 150,0) 75,0149,9 50,074,9 25,049,9 < 25,0
Hgb (g/dL) E..O. ( 13,0) 10,012,9 8,09,9 6,57,9 < 6,5
Hgb (g/dL) E..O. ( 12,0) 10,011,9 8,09,9 6,57,9 < 6,5
Hgb (mmol/L) 8,07 6,218,06 4,966,20 4,034,95 < 4,03
Hgb (mmol/L) 7,45 6,217,44 4,966,20 4,034,95 < 4,03
() M E

..O.:

OO O
0 1 2 3 4

K A, , Y - X X
, ,



EF/CHF K A A CHF
- - CHF
> 20% 20%

K M A O
a ST - -

K A , . E,
. - -
ECG
M E
()
130 OY

OO O
K 0 1 2 3 4

K , , X Y
-

> 20 mmHg (D) > 20 mmHg (D)
> 150/100 mmHg, 150/100 mmHg,


A - A A A
(- , - > 48
- , -
48
)

/ E M
/ ( ) ( / -
/ /
) -

O 1+ 2+ - 3+ 4+,

- K N

M
()

OO O
0 1 2 3 4

E..O. 0,990,75 N 0,740,50 N 0,490,25 N > 0,24 N

E..O. 1,011,25 N 1,261,50 N 1,512,00 N > 2,00 N
E..O. 1,011,66 N 1,672,33 N 2,343,00 N > 3,00 N
() M E

..O.: , :
. 131

OO O
0 1 2 3 4

K , E E

K A, - -
- - -

K E

K A E

( )
RT
A, Y
,

( )
RT
K N

( )
K N, 2

( )
- K T , E
> 2

K
N
E - M -

M E
()
- K , ,
-
/


K (
)
132 OY

OO O
0 1 2 3 4

/ M - A

N

K <1/ M >1/ ,

, A,
,
6
Cushing
E M E

K ( - M ( (
, - , - )
) )

OO O
O 0 1 2 3 4

/ -
- - -

-


O
()

OO O
0 1 2 3 4

K 37,138C 38,140C > 40C (104F)

(98,7100,4F) (100,5104F) 24 24 -

K -

/ M A

N

M


()
. 133

OO O
0 1 2 3 4

K -
,

K 1 24 25 24 610 24 > 10 24
-

K A 23 - A 46 - A 79 / > 10
/ / - / ,
-
-

K A - A E
, -

N, < 96 N, > 96
/ A A - M - -
, -
-


- , - A A

N
M

()

OO O
A 0 1 2 3 4

() K , ,12 - , 34 - , >4 -



K , K, O, -
- > 38C , -
< 38C (100,4F) (100,4F), -

O GVHD K V
M
()

K , A p.o. A V E
() .. - , ..

( )
A p.o. IV - E
- , ..

134 OY

OO O
0 1 2 3 4

E..O. > 1< 1,5 1,53,0 > 3,0 N

(SGOT, SGPT) E..O. 1 > 12,5 N 2,65,0 N 5,120,0 N > 20,0 N
E..O. 1 > 12,5 N 2,65,0 N 5,120,0 N > 20,0 N
5
() K H

() M E

..O.: , :

OO O
0 1 2 3 4

K O - -

pO2 /pCO2 K PO2 > 70 pCO2 50, PO2 > 60 pCO2 60, PO2 > 50 pCO2 70, PO2 50
pO2 > 85 0 01 02 pCO2 > 70
pCO2 40
- >90% M 7690% M 5175% M 2650% M 25%
CO

A , A
( -
)
K -

A - , A M


M E
()

OO O
B 0 1 2 3 4

K A , - E , E , A
, , -


/ K A , - E , A
O , , -
-

K ( )
K - - N
( ) -


. 135

OO O
0 1 2 3 4

131135 126130 12111250 120

(mEq/L mmol/1) > 135 CNS,
3,13,5 2,63,0 2,12,5 2,0
(mEq/L mmol/1) > 3,5 ,
(mg/dL) < 116 116160 161250 251500 > 500
(mmol/dL) < 6,4 6,48,8 8,913,8 13,927,8 > 27,8
(mmol/L) > 3,6 3,13,6 2,33,0 1,72,2 < 1,7
..O. < 1,5 N 1,52,0 N 2,15,0 N > 5,0 N
(mg/dL) < 10,6 10,611,5 11,612,5 12,613,5 > 13,5
(mmol/L) < 2,64 2,642,87 2,883,12 3,133,37 > 3,37
(mg/L) > 8,4 8,47,8 7,77,0 6,96,1 6,0
(mmol/L) > 2,10 2,101,95 1,941,75 1,741,52 1,51
(mEq/L) > 1,4 1,41,2 1,10,9 0,80,6 0,5
(mmol/L) > 0,58 0,580,49 0,480,37 0,360,25 0,24
() M

..O: , N:

OO O
0 1 2 3 4

- , - , -
, - ,
, , -

/ A , A , A , K


- K A, - O
-


E E , ,
- -
- > 10

/ / K , A K > 50%
-

/ , A A A
-


M
() M
136 OY

OO O
0 1 2 3 4

K Y , - A -


- E - , , K
/ ,

E A



M E
()

OO O
0 1 2 3 4

M , -
(-
)
/ PNS A A
-

M - A

K A, - B A -
-
,

K T


E
,

M E
()

OO O
0 1 2 3 4

(- M A M
)
( )
K - (O 24, )


( )
. 137

OO O
0 1 2 3 4

K M , E

/ K


, .


A
M
()

OO O
0 1 2 3 4

K

< 5,0% 5,09,9% 10,019,9% 20,0%
< 5,0% 5,09,9% 10,019,9% 20,0%
E T
,
M O


N
-

- N

N
K , A A
(
)
M
()
138 OY

OO O
N / - 0 1 2 3 4

M , .. A, K
K E - M
.

K Y >100cc - X -
(TUR
)

- K A A > 2 M -
/ - 2 - < , -

K , - -
(
-
)
- K N

O M E
()
E..O. (> N) > 1 < 1,5 N > 1,53,0 N 3,16,0 N > 6,0 N
K 1 + 23 + 4+ N -
<0,3 g% 0,31,0 g% >1,0 g%
< 3 g/l 310 g/l >10 g/l
A M , + A -

A
M E

K M , K ,
- ,

,
-

GU K N
GU M E
()
. 139

2.

ECOG KARNOFSKI

0: O 100: ,
90:
1: , 80: , -

70: ,

2: , 60: ,
. 50:
50%

3: . 40: ,
50% 30: ,
O OO O
4: . . 20: .
O OO O
10:
0:

3.
T Cockcroft Gault (Clcr)

(SrCr) mg/dL (SrCr) mol/L

CLcr (mL/min) (140 )* ()* Clcr (mL/min) (0,85) (140 )* ()*

(72) (SrCr) (0,81) (SrCr)

CLcr (mL/min) (0,85) (140 )* ()* Clcr (mL/min) (0,85) (140 )* ()*
(72) (SrCr) (0,81) (SrCr)

*
** (> 30% ),
Clcr.

4. Devine

= 50 + (2,3 5 )
50 + (0,906 152,4 )
= 45,5 + (2,3 5 )
45,5 + (0,906 152,4 )
:
, = 90 , = 68
= 50 + (2,3) (6860) = 68,4

> 30% . -
(. 68,4 ) .
140 OY

5.

(%)
13
, , 8
10
28
34
4

6.
DUBOIS (BSA) (sqM)

BSAsqM = ( )0,725 ( )0,725 0,0077184

7.

OO

() ()
()

0 DCIS Paget (Tis) O () (N0) isN0M0

< 2 cm (T1) O () (N0) T1N0M0
> 2 cm < 5 cm (T2) O (+) (N1) T0 T1N1M0
T2N1 N2M0
> 5 cm (3) O (+) T0 T1N2M0
(N2) T2N2M0
T3N0-2M0
O : - T4NOOIOM0
/ TOOION3M0
(N3)
-
peau d oranze (T4)
V O O TOOIONOOIOM1

M:

T0 T1 T2 T3 T4 M1
N0 0 I IIA IIB IV
N1 IIA IIA IIB IV
N2 IV
N3 IV
M1 IV IV IV IV IV
. 141

Tx: , - 1:
1. ()
Tis: in situ 2.
T1: 3 cm 3.
4.

T2: : 2:
> 3 cm 1.
2.
3. - -
4. (
, )
5.
> 2 cm
6. - ( )
T3: :
7. -

8. -

9.
< 2 cm ,
10.

(O 2 8 2b, 2a)

3:
- 1.
2.
T4: : 3. - -
4. (
)
5.
6. - ( )
7. -
8. -
9.
10.
( )
11.
( 11 3, 3b)
0: M0:
1:

0 1 2 3 1
1 V
T2 IB IIB IIIA IIIB IV
T3 IIB IIIA IIIA IIIB IV
T4 IIIB IIIB IIIB IIIB IV
M1 IV IV IV IV
142 OY

Dukes

Tx: O Dukes A 100

T2N0M0
is: in situ ( ) Dukes B T3N0M0
T4N0M0
1: Dukes C OOION1M0 OOION2M0
2: Dukes C2 TOOION3M0
3: Dukes D TOOIONOOIOM1
Astler-Coller
(MAC)
O o MAC A 100

MAC B1 200
O MAC B2 300
4: 400

O

MAC B3 400
O (, , , , ) MAC C1 210 220

0: MAC C2 310
320
410
420
1: 13 MAC C3 410
2: 4 420
3:
MAC D TOOIONOOIOM1
0:
1:

* MAC: modified Astler-Coller

: :
a: ,
b: , Ia:
c: a b b:
c: a b -

. 143

: - b: a, -
/ - (< 2 cm)
c: (> 2 cm)
a: O , /
, -
.. IV: (
)

is 1 2 3 4

In situ < 2 cm 24 cm > 4 cm

In situ - -

In situ

In situ 02 cm 24 cm 46 cm -

, ,
/

In situ - -
- - ,
,

/

0:
1: , , < 3 cm
2: 2a 3,16,0 cm
2b:
3: 3a > 6,0 cm
3b:
3c:

0:
1:

1 2 3 4 1
0 IV IV
1 IV IV
2 IV IV IV IV IV
3 IV IV IV IV IV
1 IV IV IV IV IV
144 OY

:
:
: 3 cm
: /
IV:

Clark:

O 100%
85%

65%

IV 50%
V 15%

Breslow ( American Joint Committee on Cancer):

Ia: 0,75 mm
Ib: 0,751,5 mm
IIa: 1,54,0 mm
IIb: > 4,0 mm
III: 5
IV:

2: > 3 cm
1: /
2: , ,
3: ( )
4: , , 3: , , -
/

0:
1: < 3 cm 0:
1:

1 2 3 4 1
0 IV
1 IV
2 IV IV
3 IV IV IV IV IV
1 IV IV IV IV IV

1. Spilker B. Guide to clinical trials. Raven Press: 1991. What is a clinical trial?
2. Spriet A, Dypin-Spriet Th. Good practice of clinical drug trials. 4. National Cancer Institute. Understanding Clinical Trials.
Karger: 1992. 5. ICH Harmonised Tipartite Guideline. Guideline for Good Cli-
3. The University of Texas MD Anderson Cancer Center, 2000. nical Practice. 1996.
 CH GCP

H
O -
, , .. .
, -
. - , -
-
, - -
,
- -
- (. O ICH -
. : O
O (International Conferen- ).
ce of Harmonisation Good Clinical Practice ICH GCP)
1.2. (Adverse Event)
-
, -
A,
, -
. , -
- .
O
, ..A., (
, , ), -
O (WHO). - -
() ,
() (.
. O ICH
- : O -
, ).
1.3. ( )
.
. .
1. OO
1.4.
1.1. (Adverse Drug Reaction ADR) O
-
, .
, -
1.5. [
- ()]
, . - -
,

145
146 OY

, , , -
O - / . O -
. .

1.6. 1.13. /
/ -
, , -
,
- , -
,
, - (. O ICH
(SOP), O ).
.
1.14.
1.7. -
- (.. ) -
.
.
1.8.
1.15. ( )
. , -
O
1.9.
.

. 1.16.
, -
1.10.
, -
.
-
. , , 1.17.
, - , -
, , , - , -
, - ,
-
. -
.
1.11. (CRF)
.
, , -
, 1.18.
,
-
. .
1.12. / 1.19.
O -
, - ,
/ .
/ -
- 1.20. (CRO)
/ , - (, -
, - )
. 147

,
-
. ,
.
1.21.
, , - 1.26.
, - ,
, -
. O (.. - , -
, , - , -
) -
, - ,
-
, - .
-
. 1.27.
(AE-IEC, Independant Ethical Commitee)
1.22. ( -
(- , , )
, , , - /
, , - / , -
), ,
,
, - -
,
. / -
, , ,
1.23. , -
, -
, - .
(. , , , -
. 8. -
). -
, -
1.24. O (GCP) O
, , - , O.
, , ,
, 1.28.

- / -
, ,
.
.
1.25. ,
(IDMC) ( -
, - .
, -
) 1.29.
-
, ,
- ,
148 OY

- ,
, / .
(CRO) -
, 1.36.
. (Investigators Brochure)
-
1.30. () , -
O (.
, 7. E ).
.
1.37.
1.31. (-IRB) -
, - ,
- -
, .
-
- 1.38.
,
-
, -
, , (SOP), O
. -
.
1.32. /
1.39.
- -
/
. , ,
.
1.33.
1.40.
, - -
, - ,
.
, ( -
) - 1.41.
O
- .

. 1.42. ( -
)
1.34. / -
- (A).
.
, - 1.43.
- (B. 1.52. ).
(. -
1.56. ). 1.44.
, -
1.35. / , ,
/ - . -
. 149

- 1.51.
,
, -
. O ICH GCP ,
. , -
-
1.45.
. -
( -
- ).
.
1.52.
1.46. (QA)
,
(.. , -
, - , , , -
, ,
() - ,
O (GCP) - ,
. -
1.47. (QC) , -
, ,
O -
, ,
-
,
, -
, -
-
).
.
1.48. 1.53.

, ,
, -
, . / .

1.49. 1.54.
O . O
ICH GCP , -
-
(. 1.29. E- . O -
). (..
). -
1.50. (SAE) - - -
(ADR) .
O , -
1.55. (SOP)
-
-
- .

- 1.56.
/ O
/ .
(. O ICH
: O - / -
). (..
150 OY

, , ) (. 1.62. ( )
1.34. ).
.
1.57.
2. OI APXE TH OHIA ICH GCP
- 2.1. O -
.
-
1.58.
O (GCP)
- .
, 2.2. , -
,
, -
/
. .
,
1.59. .
- 2.3. , -
. -
-
1.60. .
2.4. O -

(.. , -
.
- 2.5. O

) (. O ICH - .
: O - 2.6.
.) , -
/
1.61. / -
- ( / ).
2.7.


-
-
,
-
-
.
,
2.8.
. -
, , - , -
, ,
, - .
, 2.9.
. -
, , .
, , - 2.10. -
, , ,
, , , , -
. , -
. 151

. /
2.11. , - / /
- /
, .
, 3.1.3. /
- -
. , -
2.12. - / -
, - .
O 3.1.4. /
(GMP). -
-
.
2.13. .
- 3.1.5. / -
. -
4.8.10,
3. OYO EO O YO /
A OH OOOI ,
( / ) / .
3.1. 3.1.6.

3.1.1. / -

, - (. 4.8.12, 4.8.14), /
. /
- -
. -
3.1.2. / .
: /- / - 3.1.7.
, -
- -
, - (. 4.8.15), /
, - /
(.. ),
,
, - (..
, - ).
, 3.1.8. /
/ ,

-
/ , - . H -
. -
/ -
.
- 3.1.9. /
, , - -
, ,
:
/ , -

152 OY

- )
. .
. 3.3.2. O ,
.
3.2. , 3.3.3.
3.2.1. / .
, 3.3.4. O ,
.
3.3.5. H , -
, -
. / /
:
. . / /.
. 3.3.6. O
. , / -
. /
/ . .
/ , - 3.3.7. O
-
, , - ,
/ -
. , -

/ .
3.2.2. / (.. -
, - , ) (.
4.5.2).
, 3.3.8. O
O (GCP) - / :
. . ,
3.2.3. / -
(. 3.3.7, 4.5.2, 4.5.4).
, -
. -
,
/ -
.
(. 4.10.2).
3.2.4. , -
. -
/
.
/
.
.

3.2.5. O -
.
,
3.3.9. / -
/ -
/ ,
/ / . :
3.2.6. / . /
, .
. . / .
3.3.
. / -
.
/ ,
, 3.4.
: / -
3.3.1. O ( - (.. , -
. 153

, / 4.2.2. O -
, , - ,
) - -
3 - .
, 4.2.3. O -
. -
O , -
/ , -
.
. 4.2.4. O

4. EPEYNHTH , -
4.1. -
.
4.1.1. O
, - 4.3. -
,
. 4.3.1. ( , -
),
, -
- ( ) -
- .
/ - 4.3.2. -
- / -
, / / .
4.1.2. O -
, -
, - , -
, . O -
/ -
- , -
. ,
4.1.3. O .
O - 4.3.3. -

. ( -
4.1.4. O / -
- ).
. 4.3.4. -
4.1.5. O ,
, , -
- , -
. , -
-
4.2. .
4.2.1. O -
(.. ) 4.4. /
- 4.4.1. /
-
/ /
. , -
154 OY

, - . / /
, - .
(.. ) . , -
.
. . .
4.4.2. O /
/ - 4.6.
4.6.1. /
/ . - - /-
- / .
, / - 4.6.2. / , /
/ - /
-
.

4.4.3. /
-
/
, -
.
.
4.5. 4.6.3. O / / -
4.5.1. O / - -
- / ,
, -
,
/ / . O -
/ -
- -
, .
. , , / -
4.5.2. O - , ( )

- -
/ . O
/ ,
- -
-
- -
-
.
(.. ,
4.6.4. -
).
, (.
4.5.3. O
5.13.2 5.14.3)

- .
. 4.6.5. O -
4.5.4. O - -
, .
- 4.6.6. O
, / /
/ . - -
, - , -
, / - , -
: .
. 155

4.7.
-
O - , ,
( ) -
.
. , 4.8.5. O
- -
-
(.. , - (
) - )
. , -
-
4.8. / /
.
4.8.1. O 4.8.6.
, -
-
, -
O -
, -
. - ,
/ .
4.8.7. -
- -
. ,
4.8.2.

, -
.

. O -
- .
4.8.8. -
/ /
. - -
-
, ,
- -
. .
- 4.8.9. -
. ,
4.8.3. O -
-
.
.
4.8.4. -
, - -

, -
,
, ,
156 OY

. O (monitor), , /
,
,
-
. / ,
- ,
- -

-
- -
.
. . -
4.8.10. -
/
- , -
- . ,
- -
: .
. . . -
. O . , -
. O
. -
. O - .
, . (-) (-) -
. -
. . , ,
. .
. O ,
(
) . .
. . - . O /
- -
, .
. . -
. O .
. O
. .
. / - 4.8.11. -
-
. -
. ( -
) -
. -
. ( ) - .
. , -
. -
-

, -
, .
. 4.8.12. ( -
. 157

) - /
- / , -
,
(.. ), -
- . -
,
, -
, , - -
- ,
(. 4.8.10).
.
4.8.13. (.. 4.9.
- 4.9.1. O -
) - , , -
- -
- -
(CRF) .
, 4.9.2. -
4.8.14. (CRF), -
4.8.14. ,
-
, .
: 4.9.3. O -
. O -
(CRF) -
-

.
, ( )
. O -
-
.
(..
. -
). -
.
-
. .
(. 5.18.4, ). O
. / / -
-
. -
- . O
,
- -
, - (CRF),
. - -
, , -
, - . O
. -
4.8.15. , .
, 4.9.4. O / -
, -
, .
(. . 8)
- . O
, /
- -
/ .
158 OY

4.9.5. - , -
2 -

ICH - / .
- 4.11.2. / -
ICH 2
-
. - , -
, -
, -
.
. - 4.11.3.
-
/ - /
(. 5.5.12). (.. -
4.9.6.
).
-
/ . 4.12. -
4.9.7. O / , ,
(monitor), -
-
, /
, / -

, -
.

4.10. -
4.10.1. O - , -
/ . :
, 4.12.1. -
/ . ,
4.10.2. O , -
, / , -
(. 3.3.8) , , /
,
- /
/ - -
. .
4.11. 4.12.2.
4.11.1. - (. 5.21), -
, ,
, /
(..
) - / -
. O - .
- 4.12.3. / -
. O - / (. 3.1.2
- 3.3.9), -
, -
, /
, -
/ . -
- .
. 159

4.13. (-) (-)

, - , .
, . O - 5.2.4. ,
/ / O, -
- , -
. -
-
5. OTHPIKTH .
5.1. 5.3.
5.1.1. O - O -
- , -
- -
, - . -
, , (-)
() .
, O
. 5.4.
5.1.2. O 5.4.1. O -
, (.. ,
(. 1.21) ), ,
,
/ , -
(CRF) -

.
5.1.3. O .
, - 5.4.2. :
(.
. . 6), O ICH -
5.1.4. O - -
/ / ICH ,
.
, -
. 5.5. , -

5.2. O (CRO) 5.5.1. O -
5.2.1. ,
,
- , ,
, -
.
. O 5.5.2. O -
,
. , -
5.2.2. O -
, -
-
, . , -
5.2.3. O - .
-
160 OY

. .
5.5.3. 5.5.8.
/ - (..
- ,
, : ), -
. - 2 -
-

, , - .
5.5.9.
(.. ). , -
. - / -
. .
. - 5.5.10. O -
, -
, , -
- .
- 5.5.11.
(.. - 2 -
).
. - ICH
- -
. ICH
. 2
-
(. 4.1.5 4.9.3). . -
. , -
.
. ,
(.. .
5.5.12. O -
). / -
5.5.4. - -
, - ,
(. 4.9.5).
.
5.5.5. O 5.6.
- 5.6.1. O
(. 1.58), - / .
- , -
. ,
5.5.6. O (. 4.1, 4.2),
- . -
(. 8. - / -
- -
). ,
5.5.7. O / .
5.6.2. -
/
/ -
- / , -
. 161

- 5.9. O
, / -
. -
5.6.3. O / .
/ :
5.10. /
. O
, -
, ( , -
/ -
)
/.
, /
.
(
.
), . -
. ,
/ -
(. 4.1.4).
. .
-
/ (. . 8), - 5.11. /
/ - 5.11.1. O
(. 4.9.4, / :
4.9.5 5.5.12). . / -
O / - / .
- . / -
, -
. O
.
5.7. - . / /
, ,
, -
, -
. -
, -
5.8. -
-
-
5.8.1.
/ .
,
5.11.2. / /
-
-
/ ( -
, -
) , -
, -
/ . /
5.8.2. , -
/ -
, -
- / -
, /.
. 5.11.3. O
5.8.3. - /
, - /
- -
. / .
162 OY

5.12. 5.13.5. -
5.12.1. -
-
- , -
/ (.. ,
, - , ),
, - ,
, -
. ,
5.12.2. O - -
, -
.
(. 7.
5.14.
).

5.13. , , - 5.14.1. O -
/
5.13.1. O .
( 5.14.2. O -
- / ,
, ) -
, (.. / /
).
O (GMP) 5.14.3. O -
, , -
, , /
.
- -
. . O
5.13.2. O - -
- , , , ,
, (.. - -
), , - ( -
,
, . O -
-
[.. (monitors), - ).
, , ] 5.14.4. O :
. . -
5.13.3. - (-).
, . -
, , , -
-
. (. 8. -
5.13.4. ).
- .
,
, - (.. -
, -
- ).
. .
. 163

- / , /
. AE ( ) .
5.14.5. O : 5.17.2.
. -
O-
. ICH
. - : O -
, .
, - 5.17.3. O -
, -
. - , -
, .
-
, 5.18.
- 5.18.1. . O
, :
.
. .
. ,
5.15.

5.15.1. O - .
- . -
/ / ,
O -
/ , - .
, / - 5.18.2. [
- (monitors)]
. . O -
5.15.2. O .
. O -
- /
, , , -
/ - . -
.
. . O -
5.16. , ,
5.16.1. O -
-
. , -
5.16.2. O , O -
/ - .
5.18.3. . O -
-
, . O -
/ - -
/ . . -
, ,
5.17. , , , -
5.17.1. O , -
, . -
, , .
164 OY

.
- .
, - -
- , -
, ,

O . .
- .
- .
. . -
5.18.4. . O , - , ,
,
-
,
, - /
: -
. .
. . -
. - .
(. 4.1, 4.2, 5.6) - . -
- .
, , - .
, , -
, .
- . -
. , ,
. : -
i. , , -
- , .
. .
ii. - -
, (CRF)
, - ,
. . O
iii. - :
, , - i. -
- -
. (CRF)
iv. , - .
- ii. /
. -
v. -
iii. , -
- -
- o
. (CRF).
. iv. CRF -
- , -
, .
. .
- v.
. 165

- .
CRF. . O
.
CRF, - -
. O - .
-
, - 5.19.
, ( ) -
- ,
- :
5.19.1. O . O -
CRF . - , -
.
. - ,
-
O - , -
, , / , - , O -
,
O ICH .
: O- 5.19.2. H
. . O ,
. - /
(. 8. , .
). . O
. , -
, , O - ,
.
.
, - 5.19.3. O
. . O -
5.18.5. . O / -

- -
, ,
- .
. . -
5.18.6. -
. O -
- ()
, ,
. ,
. O - -
, , .
, . O
. .
. O .
,
, - . O
/ ,
, , -
/ - ,
166 OY

O 5.23.1. -
. -
. , -
- , ,
. / / .
5.23.2.
5.20.
, -
5.20.1. , -
, O . -
/ , -
/ -
- .
, 5.23.3.
. -
5.20.2. / - .
/ 5.23.4.
/ , ,
,
/ . - -
/ CRFs.
, 5.23.5. -
. .
5.21. -
6. PTOKOO TH KINIKH OKIMH KAI

TPOOOIHEI TOY PTOKOOY
, -
- -
/ - -
. / .

-
/ , ,
. , -
, -
5.22. / .
, -
6.1.

- 6.1.1. O , -
, - .
.
- .
6.1.2.
O ICH - ( ).
. (: 6.1.3. -
O ICH -
-
.
). 6.1.4. , ,
--
5.23. , ( --
, , ).
: 6.1.5. -
. 167

, - 6.4.3. ,
/ ,
. :
6.1.6. , , i.
( - ii. .
), 6.4.4. ,
() -
( - . -
). , -
6.1.7. O .
/ / - 6.4.5. -
.
, -
6.2. -
6.2.1. - (follow-up), .
(-). 6.4.6. -
6.2.2. ,
, - .
, - 6.4.7.
. ,
6.2.3. , -
, , . .
6.2.4. , 6.4.8.
, -
. .
6.2.5. 6.4.9. -
, O -
. (CRF) (.. -
6.2.6. . )
6.2.7. .

. 6.5.
6.5.1. .
6.3. 6.5.2. .
6.5.3. (..
.
) :
6.4. i.
/ .
- ii. O -
.
: .
6.4.1. iii. -
( ), .
. iv. T
6.4.2. / - -
(.. , - / .
, -
) - 6.6.
, - 6.6.1. , -
. ,
168 OY

, , / - ).
, - 6.9.7. -
(..
/ , -
/ - , ,
. ).
6.6.2. / -
( - 6.10. /
) / .
6.6.3. - O -
.
/ ,
6.7. , / -
6.7.1. . , -
6.7.2. , - , -
- / .
.
6.11.
6.8. 6.12.
6.8.1. .
6.8.2. , - .
.
6.8.3. , - 6.13.
-
. 6.14. O
6.8.4. O
, -
-
.
.
6.15.
6.9.
, -
6.9.1.
.
,
- 6.16.
.
(:
6.9.2. O -
/ , -
, . -


O ICH -
-
).
.
,
7. ENHMEPTIKO YAIO IA
( ) TON EPEYNHTH
.
6.9.3. . 7.1.
6.9.4. .
6.9.5. ,
. ,
6.9.6. - . O
(-
-

/ , -
. 169

, , -
/ , -
.
, -
/ -
. O - .
, , - -
, -
, .
-,
- .
-
.
- , -
, - , -
- , -
- -
. .
-
7.2.
-
. :
7.2.1. .
. ,
(.. ,
- -
, ,
- )
. , - . -
, - -
-
, . -
, 7.4. 1.
- 7.2.2. . O -
.
, , / -
(.. ), -
-
. - / .
-
, - 7.3.
, -
. , -
, -
. , :
O - 7.3.1. . -
, - 7.5. 2.
, , 7.3.2. . ( -
/ / , - 2 )
- , ,
. , , , -
170 OY

, ,
, -
-
.
7.3.3. .
, -
( - :
, ) - 1.
, , - .
2.
(.. .
), - 3. .
4. .
, - 5. .
. , 6. .
-
/ , ,
. .
7.3.4. ,
. - , -
- -
( /
,
)

, -
. , -
.


(.. -
, -
).
, -
-
, -

, .
. ,
.
/ mg/kg.
. . . -
7.3.5. . . -
- ,
, , - , -
. -
. -

, - (.. ,
- ),
(..
.
O , - ).
, , .
/ : . -

-
, .. milligram / kilogram . -
(mg/kg)
. 171

- -
).
. .
-
. , , -
. . -
- (
, - , ) -
, ,
: ( / ). H -
.
-
,
(.. -
)

(). . -
7.3.6. . . -
(

(-) , ).
, / -
, , - -
, , - .
.
, -
. ,

-
, - .
-
, ,
. .
. - . . -
.
-

, . -
, :
( -
, , , (.. , ,
, ). -
)
(- -
, , / ), - / -
-
(, / .
) 7.3.7.
(.. .
)
(.. - -
172 OY

- 4. , -
, -
. - 5.
- 5.1.
5.2. -
-
. 5.3.
, 6.
6.1. -
.
6.2.
. 6.3.
7.
O
:


, -

, -


.
. - ( ).
, ,
, , 8. AAPAITHTA EPAA IA TH IEAH
. MIA KINIKH OKIMH
8.1.

,
, - ,
- -
. .
7.4. 1
, -
O
- (GCP) -
(). .
: -
: . -
: -
O: , ( ) / -
( -
): , -
: .
:
:
: -
:
.
7.5. 2

.
(). ,
() : 1.
()
1. (8.2), 2.
2. (8.3), 3. -
3. (8.4).
. 173

)
/ .
-
. - -
- -
. .
O -
8.2.
/ -
. -
,
( / , .

:
/

8.2.1.
-


8.2.2.
( )
,
(CRF)
8.2.3.

-
(-
-
)
O -

( -
), -

-
( -
)
8.2.4. O
/

8.2.5. ( -
)


174 OY

8.2.6.
,
..:
/ -

/ - (
)
(CRO)

(CRO)
/
( )
8.2.7. / -
/ - /
: / -
- .

CRF ( )


O -


( )

( )
O
/ -

8.2.8. - (
/ / )
O
8.2.9. / - ( (
/ ) )
( )



8.2.10. /

/

8.2.11. -
/ -
/ -
/
/ -

. 175

8.2.12. / / - (
/ - )


-
/

(
)
8.2.13.
-


8.2.14. O

- , ,
(
-
)
8.2.15.
,
-

. -

, -

8.2.16. , -
-
-

8.2.17. (
-
- )
,


8.2.18. O - - (

)
8.2.19. -
( -
8.2.20)
8.2.20.


( -
8.2.19)
176 OY

8.3. - ,
,
.
-

:
/

8.3.1.

,

8.3.2. O :
/

(CRF)


O
-



( )
8.3.3. / -
/ / -
: /
- / .

:


O



( -
)
O
/


(. 3.1.4)
8.3.4. / / - - (
)
, -
:
-

. 177

8.3.5.
-
(. 8.2.10)
8.3.6. -
/
- -
/ / - (. 8.2.11)
/ -

8.3.7. / (
/ - )
/ (. 8.2.12)



/
( )
8.3.8. -

(. 8.2.15)
8.3.9.
-
(. 8.2.16)
8.3.10. /


8.3.11. -

: ,
,
, -


8.3.12. -
O


. ,
(. 8.2.3)
8.3.13.
(Source documents) -

.

,

178 OY

8.3.14. -
, - () ()


8.3.15. ,
- () ()
(CRF) CRF, -

8.3.16. -



4.11
8.3.17. - / (
/ ( ( ) )
) /
/ - -
5.17 4.11.1
-
4.11.2
5.16.2
8.3.18. -
-
5.16.2
8.3.19. (
/ / 4.10 )
5.17.3
8.3.20. (
)

8.3.21. /



.
/

8.3.22. -

8.3.23. - N -


8.3.24.


/ CRFs
. 179

8.3.25. -
/ , -
( )

8.4. , 8.2
8.3, -
.

:
/

8.4.1.

.


,
,


8.4.2. (
- )
-

8.4.3. O - -
- ,


follow-up. O
-


8.4.4. ( - -
)
8.4.5. -


-


8.4.6. ,
-

180 OY

8.4.7. -
/ /

( ) (. 4.13)
8.4.8. (
(. 5.22) )


OHIA 2001/20/EK TOY EYPAKOY -

KOINOBOYIOY -
O 2001/20/ , -
, 4 2001, -
, , -
- -
.
. (3) -
[ . L 121 01/05/2001, -
. 0034-0044] . -

: .
O EYPAKO KOINOBOYIO KAI TO YMBOY- , -
IO TH EYPAKH ENH, :
, . -
95, 1, - -
O 2, - , -
251 -
3, : ,
(1) 65/65/EOK , . -
26 1965, ,
, - , -
4, -
. -
-
, ,

. 75/317/O -
, 20 1975, - . ,
, -
,
- . ,
5,
. , -
(2) O . O -
-
, -
.
, , -
, 1996. -
- .

181
182 OY

(4) O
, .. -
, .., .
- (8) -
. -
, - , -
-

. .
(9) , ,
, - -
, , -
.
(5) .

, -
, / .
. (10) O ,
(6)
, - , , -
, -
. - . O -

-
, ,
. -
(7) -

(OK) . 2309/93 , 22 - . -
1993,
-
-
- -
6, - -
- .
, , (11)
, -
, , -
O -
(
O), - .
-
. .
(12) O
- .
(13) -
. .
(14) -
. - -
,
. 183

. OYA OHIA:

1.
- 1. -
, , -
,
65/65/EOK,
- 1
75/319/EOK 91/356/EOK, 65/65/EOK,
, .
.
. 2. -
- -
- , -
- , ,
-
. -


91/356/EOK.
,
(15)
,
, -
.

3. O
, -

-
, , -
. 21 2,
(16) O
, , . -
- .
- 4. ,
, - , -
- ,
. .
(17)
95/46/EOK - 2. O
, 24 O 1995, ) :
-
- , /

7. / -
(18) -
- / ,
, ,
(- ,
), - / -
. .
(19) - -
-
1999/468/EOK , 28 - ,
1999, ) :
-
8. , , -
184 OY

. , -
,
/ ) : , -
) : , -
, - , , -
, , -
. -
,
, ,
, , . -
, -
-
. - -
-
- ) : ,
, -
) : -
(>ISO_1>pla- , -
cebo) >ISO_7> -
,
, -
, - ,
( ) ,
- -
- ,
-
) : ,
) : , , - , , , , -
, -
/ ,
) : - , -
- -
, / -
- -
. O - ,
-
. - ) :
,
- ,

) : - ) : -
- ,
,
) -
: ,
) : , ,
, , , - , -
. O ,
, -

) : ) :
. 185

- , -
( , - , ,
. -
, - ,
, - ,
,
). ,
) , -
3. ,
1. , -
- ,
, - ) -
-
- .
. , 3. -
, -
, -
- , ,
. .
2. , - 4. O
: .
) -
- 4.
, - ,
. - , :
, - )
/ . -


, , -
,
, ) -
) , , -
- , ,
, - ,
- ) , -

, , -

- , ,
, ,
, )
) ,
- ) -
,
, - -
-
95/46/, -
) , -
- .
,
186 OY

, -
, ,
) - ,
O, ) ,
) , ,
, , -
,
,
, - ,
- ) -
,
) -

, , -
-
, ,
) )
. ,
) -
5. - -

.
,
- 6.
. - 1.
,
, .
, - 2.
, , :
) - .
3. , -
- :
, )
, ,
) - )
, ,
, - 3 2 ), -
, ,
) , ,
) ,
, )
,
) ,
, , ) ,
, ) -
) ,
, ,
) -
-

. 187

3, .
)

, , ,
)
, .
) -
- 8.
,
, , -
) . -
4. ,
- ,
-
-
9
.
3 ), ) ) -
.
9.

, , 1. ,
O. -
5. 60 .
O ,
, - -
, -
. -
6. - . O

, , .
. 2. -
5 - ,
.
7. 60
5 , .
- 3. -
-
- , , ,
. - -
30 . 2, -
90 .
90 , - , -
,
.
. - 4.
- 2 -
.
60 .
7. -
60 , -
, - . -
,
, ,
188 OY

. -
O , -
, ,
- ) -
6,
30 . 10 ) -
90 ,
90 ) .
-
10.
. -
:
. )
5. , 6, - .
-
-
65/65/ -
OK - -
(EOK) . 2309/93, , ,
- -
, -
(-) (-) (-)
-
6 9.
. -
6. - 3 6 -
- 7, -
, , - 35
,
.
. - ,
- .
-
.
7.
, , 90/219/EOK ,
, 23 1990, -
- . ,
9 90/220/EOK - -
, 23 1990, -
, -
10.
8. - ) )
: ,
) - -
2,
- , -
- , ,
, - ,
, - -
. 189

. O 9 -
-
, -
- ,
.
) 90 - ,
,
, / ,
, - .
. -
, ,
15 - , O -
. -
, -
11. .
2.
1. , -
-
,
-
, -
,
, O-

: -
) . -
2 9, ,
) , .
3 9,
) 13.
) 10,
) ,
1. ,
)
-
)
.
.
, ,
2. ,
,
O ,
-

21, -
-
2.

2.
.
3. , , - 1

23
, - 75/319/EOK ,
O, 20 1975, -
,
. 11
-
. 3 -
.
12. 3.
1. -
- 21 75/319/EOK,
2
190 OY

, , 319/EOK.
25 ), )
, , : ),
) ,
, -
-
.
91/356/EOK , 13 4.
1991, -

- -
12,
- -
9
2 , , 5
) .
, 5. ,
,
- , -
, -
91/356/EOK , -
21 75/319/EOK,
,


23 24 , -

-
9 2 -
.
,
)
14.

,
-
, -
- , ,
, O-
, - O -
, ,
19 75/319/EOK.
O
-
9 2 - :
. -
O
- ,
, -
65/65/EOK
-
- 75/319/EOK
13 . O - -
21 - -
2 - -
19 75/ .
. 191

15. -

-
1.
21 2.
,
, 16.
, : 1. O
, ,
, -
-
/ - . -
. , . -
O , ,
,
O, - .
- 2. /
. O -
O,
(EOK) . , ,
2309/93 . - , -
.
. 3. -
2. - ,
. - -
, - .
. - 4. O -
,

, O-
. -
.
-
3. , O-
, .
, (EOK)
. 2309/93 , -
17. -
,

, -
, 1.
- ) O
.
4. - ,
, , , -

, ,
, -
/ , 7
/ -
. - , -
, . -
5. O 8 .
, ) -
, - -
, , -
192 OY

- 20. --
, 15 -
- O
.
) - 21 -
2.

. 21.
) O 1.
.
2. ( ),
, 2 75/318/EOK.
, 2. -
, 5 7
- 1999/ 468/, -
, 8 .
. 5 -
3. 6 1999/468/,
.
) , -
3. .
-
, , 22.
1. ,
, - 1 2003, ,
11 1, ,
, , -
O . .
) O - -
- 1 2004.
O. O ,
, -
18. O -
, O, - . O -
, - .
, - 2. -
-
, .
23.
.
-
19. -
.
-
. 24.
.
. , 4 2001.
O
, , ,
- >ISO_1>N. Fontaine
. >ISO_7>
O
. >ISO_1>B. Rosengren
. 193

1. >ISO_7>EE>ISO_1>C 306 >ISO_7> 8.10.1997, . 9 6. >ISO_1>L 214 >ISO_7> 24.8.1993, . 1

>ISO_1>C 161 >ISO_7> 8.6.1999, . 5. () . 649/98
2. >SO_1>C 95 >ISO_7> 30.3.1998, . 1. ( >ISO_1>L 88 >ISO_7> 24.3.1998, .
3. 17 7).
1998 ( >ISO_1>C 379 >ISO_7> 7.12.1998, . 27), 7. >ISO_1>L 281 >ISO_7> 23.11.1995, . 31.
20 2000 ( 8. >ISO_1>L 184 >ISO_7> 17.7.1999, . 23.
>ISO_1>C 300 >ISO_7> 20.10.2000, . 32) - 9. >ISO_1>L 117 >ISO_7> 8.5.1990, . 1
12 2000 98/81/ (
( ). - >ISO_1>L 330>ISO_7> 5.12.1998, . 13).
26 2001. 10. >ISO_1>L 117 >ISO_7> 8.5.1990, . 15
4. 22 9.2.1965, . 1/65 - 97/35/
93/39/O ( >ISO_1>L 214 ( >ISO_1>L 169 >ISO_7> 27.6.1997, .
>ISO_7> 24.8.1993, . 22). 72).
5. >ISO_1>L 147 >ISO_7 9.6.1975, . 1 11. >ISO_1>L 147 >ISO_7> 9.6.1975, . 13
1999/83/ 93/39/
( >ISO_1>L 243 >ISO_7> 15.9.1999, . ( >ISO_1>L 214 >ISO_7> 24.8.1993, . 22).
9). 12. >ISO_1>L 193 >ISO_7> 17.7.1991, . 30.

. . , . .

, -
- ,
- , , -
-
. ,
,
. .
-
OH H E

Louis Pasteur, -
.
, - . O
- -
.
- ,
. O -
. - -
, -
, -
.
, -
,
, - ,

, . -
O -
.
- -
, -
. , .
-
in 1.
vitro, - ,
- . -
, - -
, . , - . -

- , , , -
( - ,
). - -
-

195
196 OY

K RAS
Bcr-Abl
Grb2 SOS
MYC
Raf-1

JAKs CRKL PI3 /Akt K

MEK MAP
BCL-2
CBL (p120CBL) ERK

STATs
A

K


M

A K

E 1. BCR-ABL. -
, ABL . -
, .

, in vi- , ,
tro, , , ,
, , -
, , - ,
. : .

OH H E
, -
- .
. -
(signal
- transduction).
, - , -
, -
- , -
. , -
- . -

, - ,
, .
. -
, -
, - .
O
,
, . - . O


, . ,
. 197

, , ,
-
, - -
.
.
- . -
- . ,
, , ,
, -
- , -
. - .
, -
, , -
, -
, . O - ,
.
-
- .
. -
, -
,
- . -
, -
:
,
, , -
In vitro ,
In vivo .

. , -
, :
OH OOY OO 1.
, - .
- 2.
- .
. 3. -
, -
,
, .
. -
, - O Y AO
, -
. O . O

- , ,
. - (antisen-
- se) .
.
-
, - --
, - ,
198 OY

,
, ( , -
) . O ,
(signal transduction .
inhibitors STI) .
in vitro -
- -
, -
1,2,3. . -
-
. in vivo
O - , -
.
. -
(mAb) (bioavailabili-
ty, -
, ), -
. - (pharmacokinetic,
. -
() , , -
- ), (pharmaco-
dynamic, -
(Natural Killers cells , -
NK), - ) . -
- -
4,5,6. .
, -
(antisense) , -
- ,
- , , , ,
mRNA. - , , -
- .
DNA RNA, -
- E OE
-7,8,9. O
-
. -
,
in vitro .
.
-
, , -
,
, - -
. -
. O -
, -
, - . , 3%
. H... .
, - O :
, .
. 199

(1530) -
, -
- () -
. O (gastrointestinal stromal
tumors GIST), -
(.. ), - .
, ,
,
. O - .
-
, , - (Ph),
-
. , BCR-ABL.
. ,
100 . - bcr-abl, -
9 2210. O -
, , - (protein tyrosine kinase PTK) -
, - (Pi)
(ATP) , -
. - . -
-
, -
. , , -
. -
- -
. .
. BCR-ABL -
100 1.000 . - . -
, BCR-ABL,
,
95% , -
(. 1). imatinib
. (Glivec)
IV. - . Glivec ATP. -
ATP
- ( BCR-ABL), -
.
I, II III .
, -
. BCR-
ABL,
OEOI APAONTE O OYO . -
OH I 3.000
- -
- BCR-ABL
. . -

STI571: ENA EIIKO ANATOEA TH MH Y- ,
IOOIKH METAH HMATO (Glivec)
- BCR-ABL
Glivec STI571 (.
200 OY

-H
PAP
H H N
N N N N

N O CH3SO3H

E (3-)

E 2. STI571. O ATP
(PAP). ATP
ATP. (3-) -
. -
Ser/Thr Tyr.

2). - OOA I
, - O IO RASTUZUMAB
, - -
. O > -
300 mg 31
. Herceptin. Herceptin (Trastuzumab) -
- (recombinant DNA-derived humanized) -
O - ,
... (FDA) - (Kd = 5
. nM) -
1.100 2 (HER2) .
Glivec - (INF-) - HER2 IgG1 kappa
(cytosine arabinoside Ara-C), (human framework regions)
. O - 4D5.
HER2 c-erbB2 -
INF-.
Glivec 185-kDa,
, - .
c-kit, -
R2
90% 11. O . -
40 HER2 -
Glivec, -
400 600 mg 12. .
69% - -
53% , .
- 2530% -
. 147 HER2.
400600 mg 24 . Herceptin -
HER2
38% (400 mg 33% 600 mg 43%). . -
Glivec ,
2002 GISTs.
. 201

. HER2 Herceptin 2 mg/kg. -

. (ORR, -
),
Herceptin . , 14%, 2%
(1975) in vitro 12% .
. - -
HER2 - . -
(1985). . Herceptin
HER2 -
2530% - .
(1987) - -
Genentech - Herceptin -
HER2.
Herceptin HER2
(ADCC). In vitro - .
Herceptin ADCC - Herceptin -
HER2 - 25,1 -
, 20,3 -
HER2. n vitro , 24%. -
Herceptin -
-
-
HER2.
29% 45%, Her-

ceptin ( 55%). O
. -
4,5 -
10 500 mg
7,2 Herceptin
-
. -
. Herceptin
Herceptin 8,3
, ,
5,8, .
(469 ),
Herceptin
(open-label single agent)
(222 ). , 14% 222
, ,
HER2. O -
50% .
2+ 3+ ( 0 3+) - -
. , Herceptin -
, -

, HER2 -
. - .
, - 10.000 800
Herceptin ..., .
-
. Herceptin Herceptin
(open-label, single-arm) HER2 , -
HER2 - .
Herceptin ,
- HER2
. O - FDA
4 mg/kg, - 199813.
202 OY

OA (ANTISENSE) OOOO-
I I O IO ANGIOZY- -
ME .
RNA -
. . O VEGF
- .
-
. - ,
mRNA - -
. - -
mRNA .
mRNA - ( VEGF Va-
- scular Permeability Factor), VEGF -
. - (fibrin) -
siRNA (small .
interfering RNA), VEGF -
mRNA, -
. - , -

. .
, - -
-
. -
O [Ribozyme Pharmaceuticals, Inc. (RPI) . -
Chiron Corporation] -
ngiozyme -
. O .
Angiozyme -
. .
VEGF, -
mRNA -,
- .

-
siRNA. -
. -
siRNA -
-
.

siRNA
, -

- , 14,15.
. -
- , . 28
siRNA
ngiozyme
, . 29 . n-
Angiozyme - giozyme
, - . 25%
, Angiozyme 6
. . -
. -
-
- . O -
. O VEGF (Vascular Endothelial Growth Factor)
. 203

..., . -
Angiozyme -
75 . 56%
Angiozyme - (Estrogen Receptor positive
. ER+) 50% ER--
45 (R). ER+
. 80%.
45 12 .
VEGFR-1 -
,
43 ngiozyme. -
, - .
Angiozyme, [4,4-(1H-1,2,4--)
Angiozyme - ], , -
IV - . -
16. . -

OI P450 A 450 -
OO, OO, A (. 3).
O
-
. - . -
-
, . In vitro -
. 200
, , in vivo 10.000
. , 1030 -
70% - -
- , fadrozole17 , -
, ,

E 3. NC CN
450
- DNA
mRNAs
.

proMMOs/MMPs
204 OY

,
. -
/ -
, - -
, - . O -
, - -
, . 8 40 (20%)
, 2,5 mg -
. - . -
, - ,
10.500 - .
, - O 0,5 mg, 2,5 mg
. .
n vitro , , 60%
1/5 -
- .
. in vitro -
- , - -
- , 2,5
, mg Tamoxifen 20 mg 907
. - ( IIIB) -

, - . -

18.
- 9,4 6,0 Tamoxifen.

. Tamoxifen -
, - (30% 20%),
0,1 mg 5 mg 6 (49% 38%) -
/ 181 - (9,1 5,7).

1. Klohs WD, Fry DW, Kraker AJ. Inhibitors of tyrosine kinase.
Curr Opin Oncol 1997; 9(6): 562-568.
2. Levitt ML, Koty PP. Tyrosine kinase inhibitors in preclinical
development. Invest New Drugs 1999; 17(3): 213-226.
3. Roussidis AE, Karamanos NK. Inhibition of receptor tyrosine
kinase-based signal transduction as specific target for cancer
treatment. In Vivo 2002; 16: 459-470.
4. Fan Z, Mendelsohn J. Therapeutic application of anti-growth
factor receptor antibodies. Curr Opin Oncol 1998; 10(1): 67-
73.
5. Farah RA, Clinchy B, Herrera L, Vitetta ES. The develop-
ment of monoclonal antibodies for the therapy of cancer. Crit
Rev Eukaryot Gene Expr 1998; 8(3-4): 321-356.
6. Hudson PJ, Souriau C. Recombinant antibodies for cancer
diagnosis and therapy. Expert Opin Biol Ther 2001; 1(5): 845-
855.
7. Gewirtz AM, Sokol DL, Ratajczak MZ. Nucleic acid thera-
peutics: state of the art and future prospects. Blood 1998; 92
(3): 712-736.
8. James HA, Gibson I. The therapeutic potential of ribozymes.
Blood 1998; 91(2): 371-382.
9. Dobra K, Andang M, Syrokou A, Karamanos NK, Hjerpe A.
Differentiation of mesothelioma cells is infuenced by the ex-
pression of proteoglycans. Exp Cell Res 2000; 258(1): 12-22.
10. Rowly DA. A new consistent chromosomal abnormality in
chronic myelogenous leukemia identified by quinacrine fluo-
rescence and Giesma staining. Nature 1973; 243: 290-293.
11. Joensuu H, Dimitrijivic S. Tyrosine kinase inhibitor imatinib
(STI571) as an anticancer agent for solid tumours. Ann Med
2001; 33(7): 451-455.
12. van Oosterom AT, Judson I, Verweij J, Stroobants S, Donato
di Paola E, Dimitrijevic S, Martens M, Webb A, Sciot R, Van
Glabbeke M, Silberman S, Nielsen OS. Safety and efficacy of
imatinib (STI571) in metastatic gastrointestinal stromal tu-
mours: a phase I study. Lancet 2001; 358: 1421-1423.
13. Harries M, Smith I. The development and clinical use of tras-
tuzumab (Herceptin). Endocr Relat Cancer 2002; 9(2):75-85.
14. Sandberg JA, Parker VP, Blanchard KS, Sweedler D, Powell
. 205
JA, Kachensky A, Bellon L, Usman N, Rossing T, Borden E,
Blatt LM. Pharmacokinetics and tolerability of an antiangio-
genic ribozyme (ANGIOZYME) in healthy volunteers. J Clin
Pharmacol 2000a; 40(12 Pt 2): 1462-1469.
15. Sandberg JA, Sproul CD, Blanchard KS, Bellon L, Sweedler
D, Powell JA, Caputo FA, Kornbrust DJ, Parker VP, Parry TJ,
Blatt LM. Acute toxicology and pharmacokinetic assessment
of a ribozyme (ANGIOZYME) targeting vascular endothelial
growth factor receptor mRNA in the cynomolgus monkey. An-
tisense Nucleic Acid Drug Dev 2000b; 10(3): 153-162.
16. Weng DE, Usman N. Angiozyme: a novel angiogenesis inhibi-
tor. Curr Oncol Rep 2001; 3(2): 141-6.
17. Miller WR, Anderson TJ, Dixon JM. Anti-tumor effects of le-
trozole. Cancer Invest 2002; 20 Suppl 2: 15-21.
18. Mitropoulou TN, Tzanakakis GN, Kletsas D, Kalofonos HP,
Karamanos NK. Letrozole as a potent inhibitor of cell prolife-
ration and expression of metalloproteinases (MMP-2 and MMP-
9) by human epithelial breast cancer cells. Int J Cancer 2003;
104: 155-160.
clinical trials:
http://www.centerwatch.com/
II
E


. ............................................................................................................ 209

(Proteomics) (Genomics)
S. Murray, . ................................................................................................ 227


.

H
Hpa I
-
5' G T T A A C 3

. O
3' C A A T T C 5'

.
CUT
-
Eco RI

, - 5' G A A T T C 3'
1.
3' C T T A A C 5'

CUT
-
. -
Hind III

, - 5' A A G C T T 3'
(HUGO) ,
- 3' T T C G A A 5'
. CUT

-
- 5' C T G C A G 3'
.
3' G A C G T C 5'
EOOA OOY
CUT Rst I
, -
, , 1. O
DNA . -
. O
- .
DNA, 4 8 . O DNA
, , - .
(
). , (.
- 2).
.
(
DNA )
(. 1). O (. 2). DNA
. (ligation)
DNA - DNA.

209
210 OY

TAAT DNA (restriction map) (. 3). -

3'
5' -
ATAT -
3'
5'
3' + 5' . -
T T AA AATT DNA ,
3'
5' -
T T AA . O
3'
5' DNA ,

-
AATT .
5' 3'
3'
T T AA
5' O
TAAT
. , -
3'
5'
ATAT , -
+ 3'
5' -
T T AA . -
3'
5' ,
. O
2.
DNA . DNA DNA -
-
, . RFLP (restriction fragment length polymorphism). -
DNA , -
co R1,
-
. (. 4).
O RFLP
- ,
DNA -
(restriction sites). -
Southern (Southern lot), DNA (-
(restriction fragments). - )
, - DNA
, - (. 5).

DNA 10 kb
:
.

.




A B
2kb 2 kb 3kb
3kb 8 kb 7kb
5kb 2kb 5kb 3kb
10kb
= 10 kb = 10 kb = 10 kb

3. . ,
, .
. 211

,
DNA +

, +

RFLP ( )
DNA

,

4. DNA (RFLP).
. DNA, , 3 , -
DNA. DNA DNA -
Southern Blotting. . , -
, . O
DNA RFLP. . O DNA, -
.

Southern Blotting
DNA
3m ( 3)

3p ( 3)

3m

RFLP DNA

3p

3m

3p
DNA



DNA
RFLP

5. RFLP Southern Blotting.

3 .

E I DNA OI -
(DNA SEQUENCING)
DNA - .
: . ,
in vitro DNA H EOO (EOO SANGER)
- , DNA -
- in vitro -
DNA. DNA ,
212 OY

NH2 , -
N
DNA .
N
(ddNTPs) (.
6) 3O,
N N
. -
DNA,
5' O
H2O3P O CH2 .
H H 1' 7 -
H H dNTPs
H H
ddATP,
E 6. 5- - . DNA DNA

(dATP, dCTP, dGTP, dTTP) C (ddATP)
A GTC G A
TA T G TC
TA T C G A T
A A T TC A
T
GT C C A T
G C
G
-
DNA
DNA
DNA
5' GCTACCTGCATGGA
3' CGATGGACGTACCTCTGAAGCG 5'
DNA

5' GCATATGTCAGTCCAG 3'

DNA
CGTATACAGTCAGGTC

3' CGTATACAGTCAGGTC 5' DNA

5' GCAT 3' + DNA
+ dATP
dTTP
dCTP
dGTP

+ ddATP + ddTTP + ddCTP + ddGTP

GCAT A GCAT AT GCAT ATGTC GCAT ATG

GCAT ATGTCA GCAT ATGT GCAT ATGTCAGTC GCAT ATGTCAG
GCAT ATGTCAGTCCA GCAT ATGTCAGT GCAT ATGTCAGTCC GCAT ATGTCAGTCCAG

3'
G
A
C
C
T
G
A
C
T
G
T
A 5'
A T C G

7. O DNA Sanger.
. 213

DNA . - ern Blotting),

DNA - (
, - -
DNA. ).
RNA DNA (Blotting)
, - .
. -
( ) - -
DNA. - DNA
- . O DNA, -
ddNTPs, RNA DNA -
. - , .
- DNA -
- -
. - ,
DNA -
5 3, DNA . Southern -
. DNA
DNA .
E OY O OE -
(SOUTHERN NORTHERN BLOTTING) .
Southern Blotting -
DNA RNA - -
Southern (Southern Blotting) . -
Northern (Northern Blotting) (. 8). (PCR), -
RNA (Northern Blotting) - , -
DNA
(South- . -

DNA RNA

RNA

8. Southern / Northern Blotting.

214 OY

t(9,22) ( Philadelphia, Bcr/Abl - DNA.

), - , in vitro
(CML). DNA
Southern Blotting
t(8;14), t(2;8), t(8;22) - DNA -
(ALL) - , -
t(8;21) [AML1/ETO], t(15;17) [PML/RARA] inv
16 [MYH11/CBFb] 1012 DNA -
(AML) (1st MIC Cooperative Study Group, 1986). - ,
- . DNA -
Hodgkins ( (cloned).
), Burkitt , -
t(8;14), t(2;8), t(8;22) MYC;IGH/IGK/IGL - DNA, -
Ewing t(11;22) FL11/EWS2. - DNA -
- .
HER2/neu/erbB2 DNA
HPG-1 -
. -
3.
DNA, -
Southern Blotting
, -
. ,
, -
N-myc
-. -
4.
20 30 -
N-myc
, -
. H N-myc ( 3 300
1.000 -
) .
Southern Blot 4. -
-
OOI O DNA OH DNA
, DNA
DNA DNA () . DNA
, - -
, - . -
, , - (
. - )
DNA , . -
- DNA -

DNA

DNA DNA

DNA









DNA

DNA
DNA

9. DNA.
. 215

BomHI
HindIII

EcoRI
DNA -

SmoI
KpnI
SocI
Sphl

XboI
Pstl
SilI
(. 9).
DNA -
. -
, - Polylinker
-
DNA (. 10). locZ'

. loc
AmpR
-
.
, - ori
pUC 18
2,69 kb



11.
DNA ,
.


. -
-
DNA, -
-
: ) -
DNA (ori), ) -
, ) -
DNA, -
(polylinker)
DNA
(. 11).
-
DNA, -

.
-
.

.

DNA
-
.
DNA




. -
DNA DNA
(genomic DNA library). -
DNA ,
, -
,
10. DNA -
DNA. RNA.
216 OY

OOI O DNA H (dT), -

DNA OH (cDNA LIBRARY) (A) mRNA .
DNA
RNA RNA-DNA . -
. O - RNA,
DNA DNA . 3 -
, - cDNA
DNA (cDNA) mRNA - , -
cDNA DNA
. O cDNA DNA - cDNA. ,
S1 , ,
. DNA,
cDNA mRNA. -
: RNA (
mRNA) -
DNA (comple- . DNA, -
mentary DNA cDNA) mRNA - -
. , -
(reverse transcriptase), .
RNA -
DNA . T DNA DNA (
- ) DNA -
DNA DNA , (screening of the DNA libraries). -
(. 12). : )
12 - DNA , -
- ( ) -
, )
.
5' mRNA 3' H cDNA

. O England et
al5,
5' 3'



DNA 3' 5'

5' 3' -


, cDNA -
3'

5' RNA,
3' RNA , -


3'
cDNA 5' .
H DNA

-

DNA

3' , BASE (breast cancer and
salivary gland expression). SE -
5'
S1
, -
. ,
5' 3'

3'

5' .
cDNA mRNA
O Xu et al6 -
12. cDNA mRNA. ,
. 217

cDNA DNA
. - 3' 5'

P503S P504S. , P510S, -

-
. Northern Blotting 5' 3'
real-time PCR
DNA
/
.
3' 5'

H OH AO
3'
, DNA 3'
-
, 5' 3'
DNA .
() DNA -
13. PCR -
, ()
. DNA .
, 20 kb,
-
DNA (. 13).
, PCR -
: ) DNA (denatu-
.
ration), ) DNA -

(annealing) )
DNA, DNA (li-
(extension) (. 14). PCR
gase). DNA,
-
, in vitro -
. DNA -
-
95C. -


-. -
DNA-
DNA , 5060C. -
. 72C, -
,
H I OA
, aq , -
(PCR POLYMERASE CHAIN REACTION)
dNTPs. ,
DNA ,
, - in vitro DNA. -
(PCR).
PCR DNA , -
- . 20
. - 30 -
, - DNA.
. DNA
- .
- DNA in
DNA , vitro ( ) ,
3 - in vivo -
3 . - .
- PCR, ,
() DNA DNA
218 OY

DNA
DNA DNA
DNA ...
DNA
DNA ...

...

...

...

DNA ...

(2 DNA ) ...

...
(4 DNA )

(8 DNA )

14. DNA PCR.

. RNA - ,
K-ras -
DNA (RT-PCR re- , -
verse transcription PCR). PCR 10. O -
Southern K-ras DNA
(- 14 -
, ..). 11,
12.
PCR A O IO -
PCR - . -
. - APC -
, -
, 13,14. -
- -ras p53
15,16. O
. -

7. DNA -
PCR.
,

. 50%
DNA, -
DNA (-
hMLH1 hMSH2). -
DNA8.
H APC PCR17.

. - 95% -
(PCR) - -
- - (HPV).
(Ras, p53, Rb ..) , - PCR 26 .
9.
7590% DNA
- . -
12 K-ras. PCR , -
. 219

, 5264%, -
, 4%. -
. - PSA (RT-PCR) -
PCR-SSCP -
c-Ha-ras DNA , -
. 44% . -
. ,
p53 24.
PCR-SSCP. 17% - RT-PCR -
. H - -
p53 .
10.000 . O
. -
p53 -, -
, - 20 ( -
), -
18.
PCR 25.

RT-PCR (reverse transciption polymerase chain reaction)

mRNA. - .
mRNAs mRNA (CEA)
mRNAs
19. H RT-PCR 26 27.
-, O -
, . O - . -
Ewing -
20. -
H RT-PCR -
, - 2.
- , , -
21.
, -
9
, - 28. -
22. - -
MAGE
-
- -
, 7.

23. MOOI DNA (DNA MICROARRAYS
RT-PCR - DNA CHIPS)
PSA.
, -
mRNA PSA. RNA29. -
, - DNA30 -
, 31.
- -
. -
220 OY

. O - minisequencing , -
DNA - DNA -
, -
. T DNA - 5 . O -
, -
DNA -
DNA. (- . -
2025 nt) , -
chip -
DNA - O 3 -
dot blot . . -
- ddNTPs
.
- .
DNA -
DNA , ,
- ,
. O - 33. H -
DNA -
. - -
DNA - ,
- .
- O Golub et al34
32. -
-- .

CGH
RPS6KB1 MUL APPBP2

RPS6KB1 MUL APPBP2

cDNA

15. cDNA CGH -

MCF7 . . H
17, CGH, 17q23. . -
MCF7 CGH () cDNA (). -
DNA -
, . .
cDNA , () -
() , MUL, RPS6KB1 APPBP2, 17q23 in situ -
. . Y RPS6KB1 MCF7 , FISH44,45.
. 221

- , -
35,36, -
- 37, - .
38, 39,40 , -
41. . -
, CGAP -
- -
. 47.
- CGAP Genetic Annotation Initiative (GAI) -
-

42,43. - . GAI -
- -
, - DNA -
, - . -
. 48,49.

WESTERN BLOTTING
-
, Western Blotting -
- ,
, -
. H
in vivo in vitro.
,
,
, -
, -
(spectral karyotyping) -

(comparative genomic hybridi-
.
sation) 30, -
O
,
SDS (SDS-
. O
PAGE),
Monni et al44,45 Barlund et al46
.
- (blotting)
CGH .
-
(. 15). -
.

- . -
,
. . -
, C ELISA, - .
Western Blotting -
. Western Blot -
.
. -
O OI O OY
OO (CANCER GENOME ANATOMY
PROJECT) . -

Cancer Genome Anatomy Project. O Can- -
cer Genome Anatomy Project (CGAP) - 50.
222 OY

Western Blotting -
ALG-2 54-63, 64-66 -
. - 67.
ALG-2 - FISH -
. - . ,
Western Blot HER2/neu erbB-2 -
. 185 Kd. 25-30%
-
ALG-2 .
- FISH
. . FISH -
ALG- , -
2 , Southern Blot
51. ,
lumican - .
, , H FISH -
. -
. H Western Blott- 8
ing 7, -
mRNA - 68.
(CaSki, ME-180
HeLa). - Bcr/Abl
lumican - . -
-
69.
52.

FIS (FLUORESCENT IN SITU HYBRIDIZATION)

O in situ (FISH) -

. DNA
(probes)
. O -
DNA -
A. . -
.
(. 16): alpha satellites ( ),
-
, , -
-
, (chromoso-
me paints), -
53. -
- . .
-
-
16.
. - FISH. . X ,
, . . Alpha
. satellites ( ),
. .
FISH - , -
, , - . . , -
. - .
. 223

OOH OY (SKY) H ONIIMATIKH OOI (CGH)

H (Spectral Karyotyping (Compara-
SKY) tive Genomic Hybridisation CGH) -
(Comparative Genomic Hybidization CGH) -
, - 74. DNA
. ( -
SKY ) , DNA
- ( -
, - ) . DNs
.
- .
. - DNA DNA -
- , DNA -
SW480
SW620 70 - , .
71. - ,
72. , DNA
-
SKY FISH

. .
.
-
-
15 73. . H CGH
CGH , -
1q, 8q, 20q, 7, 11q13, 20 Mb. -
17q, 9q 16p, 8p, 11q14 18q. .
SKY - CGH
. O - . -
, FAP75,
. 76,
77
8, 1, 17, 16 20. 78.
SKY CGH -
Burkitt, -
CGH, 1q 7q -
- Burkitt79.
.
80
.
81,
82
83.

1. Balmain A. Cancer genetics: from Boveri and Mendel to mi-
croarrays. Nat Rev Cancer 2001; 1(1): 77-82.
2. West DC, Grier HE, Swallow MM, Demetri GD, Granowetter
L, Sklar J. Detection of circulating tumor cells in patients with
Ewings sarcoma and peripheral primitive neuroectodermal tu-
mor. J Clin Oncol 1997; L5(2): 583-8.
3. Herness EA, Naz RK. A novel human prostate-specific gene-1
(HPG-1): molecular cloning, sequencing and its potential in-
volvement in prostate carcinogenesis. Cancer Res 2003; 63(2):
329-36.
224
4. Combret V, Audoynaud C, Iacono I, Favrot MC, Schell M,
Bergeron C, Puisieux A. Circulating MYCN DNA as a tumor-
specific marker in neuroblastoma patients. Cancer Res 2002;
62(13): 3646-8.
5. Egland KA, Vincent JJ, Strausberg R, Lee B, Pastan I. Disco-
very of the breast cancer gene BASE using a molecular appro-
ach to enrich for genes encoding membrane and secreted pro-
teins. Proc Natl Acad Sci USA 2003; 100(3): 1099-104.
6. Xu J, Stolk JA, Zhang X, Silva SJ, Houghton RL, Matsumura
M, Vedvick TS, Leslie KB, Badaro R, Reed SO. Identification
of differentially expressed genes in human prostate cancer us-
ing subtraction and microarray. Cancer Res 2000; 60(6): 677-
82.
7. Bustin SA, Dorudi S. Molecular assessment of tumour stage
and disease recurrence using PCR-based assays. Mol Med To-
day 1998; 4(9): 389-96.
8. Leon SA, Shapino B, Sklaroff DM, Yaros MJ. Free DNA in
the serum of cancer patients and the effect of therapy. Cancer
Res 1997; 37(3): 646-50.
9. Birrer MJ, Brown PH. Application of molecular genetics to
the early diagnosis and screening of lung cancer. Cancer Res
1992; 52: 2658-2664.
10. Ando N, Nakao A, Nomoto S, Takeda S, Kaneko T, Kurokawa
T, Nonami T, Takagi H. Detection of mutant K-ras in dissected
paraaortic lymph nodes of patients with pancreatic adenocar-
cinoma. Pancreas 1997; 15(4): 374-8.
11. Mulcahy HE, Lyautey J, Lederrey C, qiChen X, Anker P, Bal-
linger A, Fathing MJ, Strain M. A prospective study of K-ras
mutations in the plasma of pancreatic cancer patients. Clin
Cancer Res 1998; 4(2): 271-5.
12. Nomoto S, Nakao A, Kasai Y, Harada A, Nonami T, Takagi
H. Detection of ras gene mutations in perioperative peripheral
blood with pancreatic adenocarcinoma. Jpn J Cancer Res 1996;
87(8): 793-7.
13. Leppert M, Dobbs M, Scambler P, OConnell P, Nakamura F,
Stanffer D, et al. The gene for familial polyposis coli maps to
the long arm of the chromosome 5. Science 1987; 238: 1411-13.
14. Konishi M, Kikuchi-Yanoshita R, Tanaka K, Muraoka M, On-
da A, Okumura Y, et al. Molecular nature of colon tumors in
hereditary nonpolyposis, colon cancer, familial polyposis and
sporadic colon cancer. Gastroenterology 1996; 111: 307-17.
15. Vogelstein B, Fearon Er, Hamilton Sr, Kern Se, Preisinger Ac,
Leppert M, et al. Genetic alterations during colorectal-tumor
development. N Engl J Med 1988; 319: 525-32.
16. Bos JL. Ras oncogenes in human cancer: a review. Cancer Res
1989; 49: 4682-89.
17. , . cov Dev 2001; 4: 116-23.
. . . . 2000; (17)6: 556-575. 32. Pinkel D, Segraves R, Sudar D, Clark S, Poole I, Kowbel D,
18. Sjdransky D, van Eschenbach A, Tsai YC, et al. Identification
of p53 gene mutations in bladder cancer and urine samples.
Science 1991; 252-706.
19. Tokunaga E, Ishida M, Kimura Y, Maehara Y. Correlation
with bone metastasis and high expression of CK 19 mRNA
measured by quantitative RT-PCR in the bone marrow of
breast cancer patients. Breast J 2003; 9(5): 440-2.
20. Miyachi K, Sasaki K, Onodera S, Taguchi T, Nagamachi M,
Kaneko H, Sunagawa M. Correlation between surviving mRNA
OY
expression and lymph node metastasis in gastric cancer. Ga-
stric Cancer 2003; 6(4): 217-224.
21. Smith B, Selby P, Southgate J, Pittman K, Bradley C, Blair
GE. Detection of melanoma cells in peripheral blood by means
of reverse transcriptase and polymerase chain reaction. Lancet
1999; 338 (8777): 1227-9.
22. Buzaid AC, Balch CM. Polymerase chain reaction for dete-
ction of melanoma in peripheral blood: too early to assess cli-
nical value. J Natl Cancer Inst 1996; 88(9): 569-70.
23. Glaser R, Rass K, Seiter S, Hauschild A, Christophers E, Til-
gen W. Detection of circulating melanoma cells by specific am-
plification of tyrosinase complementary DNA is not a reliable
tumor marker in melanoma patients: a clinical two-center stu-
dy. J Clin Oncol 1997; 18(8): 2818-25.
24. Verhagen PC, Tilanus MG, de Weger RA, van Moorselaar RJ,
van den Tweel JG, Boon TA. Prognostic factors in localised
prostate cancer with emphasis on the application of molecular
techniques. Eur Urol 2002; 41(4): 363-71.
25. Denis MG, Lipart C, Leborgne J, LeHur P A, Galmiche JP,
Denis M, Ruud E, Truchaud A, Lustenberger P. Detection of
disseminated tumor cells in peripheral blood of colorectal can-
cer patients. Int J Cancer 1997; 74(5): 540-4.
26. Mori M, Mimori K, Ueo H, Tsuji K, Shiraishi T, Barnard GF,
Sugimachi K, Akiyoshi T. Clinical significance of molecular
detection of carcinoma cells in lymph nodes and peripheral
blood by reverse transcription-polymerase chain reaction in
patients with gastrointestinal or breast carcinomas. J Clin On-
col 1998; 16(1): 128-32.
27. Castaldo G, Tomaiuolo R, Sanduzzi A, Bocchino ML, Ponti-
ciello A, Barra E, Vitale D, Bariffi F, Sacchetti L, Salvatore F.
Lung cancer metastatic cells detected in blood by reverse
transcriptase-polymerase chain reaction and dot-blot analysis.
J Clin Oncol 1997; 15(ll): 3388-93.
28. Rubnitz JE, Crist WM. Molecular genetics of childhood can-
cer. Implications for pathogenesis, diagnosis and treatment.
Pediatrics 1997; 100(1): 101-8.
29. Lipshutz RJ, Fodor SP, Gingeras TR, Lockhart DJ. High den-
sity synthetic oligonucleotide arrays. Nat Genet 1999; 21: 20-4.
30. Pinkel D, Segraves R, Sudar D, Clark S, Poole I, Kowbel D,
Collins C, Kuo WL, Chen C, Zhai Y, Dairkee SH, Ljung BM,
Gray JW, Albertson DG. Pollack JR, Perou CM, Alizadeh
AA, Eisen MB, Pergamethscmkov A, Williams CF, et al. Ge-
nome-wide analysis of DNA copy-number changes using cDNA
microarrays. Nat Genet 1999; 23: 41-6.
31. Haab BB. Advances in protein microarray technology for pro-
tein expression and interaction profiling. Curr Opin Drug Dis-
Collins C, Kuo WL, Chen C, Zhai Y, Dairkee SH, Ljung BM,
Gray JW, Albertson DG. High resolution analysis of DNA co-
py number variation using comparative genomic hybridization
to microarrays. Nat Genet 1998; 20(2): 207-11.
33. Macgregor PK, Squire JA. Application of microarrays to the a-
nalysis of gene expression in Cancer. Clinical Chemistry 2002;
48(8): 1170-77.
34. Golub TR, Slomm DK, Tamayo P, Huard C, Gaasenbeek M,
Mesirov J, et al. Molecular classification of cancer: class disco-
. 225
very and class prediction by gene expression monitoring. Scien-
ce 1999; 286: 531-7.
35. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS,
Rees CA, et al. Molecular portraits of human breast tumors.
Nature 2000; 406: 147-51.
36. Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen
H, et al. Gene expression patterns of breast carcinomas distin-
guish tumor subclasses with clinical implications. Proc Natl
Acad Sci USA 2001; 98: 10869-74.
37. Alizadeh AA, Eisen MB, Davis RE, Ma C, Lossos IS, Rosen-
wald A, et al. Distinct types of diffuse large B-cell lymphoma
identified by gene expression profiling. Nature 2000; 403: 503-
11.
38. Bittner M, Meltzer P, Chen Y, Jiang Y, Seftor E, Hendrix M,
et al. Molecular classification of cutaneous malignant melano-
ma by gene expression profiling. Nature 2000; 406: 536-40.
39. Garber ME, Troyanskaya OG, Schluens K, Petersen S, Thae-
sle TZ, Pacyna-Gengelbach M, et al. Diversity of gene expres-
sion in adenocarcinoma of the lung. Proc Natl Acad Sci USA
2001; 98: 13784-9.
40. Bhattacharjee A, Richards WG, Staunton J, Li C, Monti S, Va-
sa P, et al. Classification of human lung carcinomas by mRNA
expression profiling reveals distinct adenocarcinoma subclas-
ses. Proc Nat Acad Sci USA 2001; 9: 13790-5.
41. Dhanasekaran SM, Barrette TR, Ghosh D, Shah R, Varam-
bally S, Kurachi K, et al. Delineation of prognostic biomarkers
in prostate cancer. Nature 2001; 4: 12822-6.
42. Kudoh K, Ramanna M, Ravatn R, Elkahloun AG, Bittner ML,
Meltzer PS, et al. Monitoring the expression profiles of doxo-
rubicin-induced and doxorubicin resistant cancer cells by cDNA
microarray. Cancer Res 2000; 60: 4161-6.
43. Scherf U, Ross DT, Waltham M, Smith LH, Lee JK, Tanabe
L, et al. A gene expression database for the molecular pharma-
cology of cancer. Nat Genet 2000; 24236-44.
44. Monni O, Barlund M, Mousses S, Kononen J, Sauter G, Heis-
kanen Met, et al. Comprehensive copy number and gene ex-
pression profiling of the 17q23 amplicon in human breast can-
cer. Proc Natl Acad Sci USA 2001; 9: 5711-6.
45. Monni O, Hyman L, Mousses S, Barlund M, Kallioniemi A,
Kallioniemi OP. From chromosomal alterations to target ge-
nes for therapy: integrating cytogenetic and functional geno-
mic views of the breast cancer genome. Semin Cancer Biol
2001; 11: 395-401.
46. Barlund M, Forozan F, Kononen J, Bubendorf L, Chen Y,
Bittner ML, et al. Detecting activation of ribosomal protein S6
Kinase by complementary DNA and tissue micro array analy-
sis. Natl Cancer Inst 2000; 92: 1252-9.
47. Hess JL. The Cancer Genome Anatomy Project: power tools
for cancer biologists. Cancer Invest 2003; 21(2): 325-6.
48. Clifford R, Edmonson M, Hu Y, Nguyen C, Scherpbier T,
Buetow KH. Expression-based genetic/physical maps of single-
nucleotide polymorphisms identified by the cancer genome a-
natomy project. Genome Res 2000; 10(8): 1259-65.
49. Riggins GJ, Strausberg RL. Genome and genetic resources
from the Cancer Genome Anatomy Project. Hum Mol Genet
2001; 10(7): 663-7.
50. Balaz P, Friess H, Kondo Y, Zhu Z, Zimmermann A, Buchler
MW. Human macrophage metalloelastase worsens the pro-
gnosis of pancreatic Cancer. Ann Surg 2002; 235(4): 519-21.
51. La Cour JM, Mollerup J, Winding P, Tarabykina S, Sehested
M, Bercntold MW. Up-regulation of ALG-2 in hepatomas and
lung cancer tissue. Am J Pathol 2003; 163(1): 81-9.
52. Naito Z, Ishiwata T, Kurban G, Teduka K, Kawamoto Y, Ka-
wahara K, Sugisaki Y. Expression and accumulation of lumi-
can protein in uterine cervical cancer cells at the periphery of
cancer nests. Int J Oncol 2002; 20(5): 943-8.
53. Ried T, Schrock E, Ning Y, Wienberg J. Chromosome paint-
ing: a usefull art. Hum Mol Genet 1998; 7(10): 1619-26.
54. Conn CM, Harper JC, Winston RM, Delhanty ID. Infertile
couples with Robertsonian translocations: preimplantation ge-
netic analysis of embryos reveals chaotic cleavage divisions.
Hum Genet 1998; 102(1): 111-23.
55. Fung J, Munne S, Garcia J, Kim UJ, Weier HU. Molecular
cloning of translocation breakpoints in a case of constitutional
translocation t(11;22)(q23;q11) and preparation of probes for
preimplantation genetic diagnosis. Reprod Fertil Dev 1999;
11(1): 17-23.
56. Munne S, Scott R, Sable D, Cohen J. First pregnancies after
preconception diagnosis of translocations of maternal origin.
Fertil Steril 1998a; 69(4): 675-81.
57. Munne S, Marquez C, Magli C, Morton P, Morrison I. Scor-
ing, criteria for preimplantation genetic diagnosis of numerical
abnormalities for chromosomes X, Y, 13, 16, 18 and 21. Mol
Hum Reprod 1998b; 4(9): 863-10.
58. Munne S, Bahce M, Schimmel T, Sadowy S, Cohen J. Case re-
port: chromatid exchange and predivision of chromatids as
other sources of abnormal oocytes detected by preimplanta-
tion genetic diagnosis of translocations. Prenat Diagn 1998;
18(13): 1450-8.
59. Munne S, Escudero T, Sandalinas M, Sable D, Cohen J. Ga-
mete segregation in female carriers of Robertsonian transloca-
tions Cytogenet. Cell Net 2000; 90(3-4): 303-8.
60. Pierce KE, Fitzgerald LM, Seibel MM, Zilberstein M. Preim-
plantation genetic diagnosis of chromosome balance in em-
bryos from a patient with a balanced reciprocal translocation.
Mol Hum Reprod 1998; 4(2): 167-72.
61. Weier HU, Munne S, Fung J. Patient-specific probes for pre-
implantation genetic diagnosis of structural and numerical a-
berrations in interphase cells. J Assist Reprod Genet 1999;
16(4): 182-91.
62. Van Assche E, Staessen C, Vegetti W, Bonduelle M, Vander-
vorst M, Van Steirteghem A, Liebaers I. Preimplantation ge-
netic diagnosis and sperm analysis by fluorescence in-situ hy-
bridization for the most common reciprocal translocation
t(11;22). Mol Hum Reprod 1999; 5(7): 682-90.
63. Willadsen S, Levron J, Munne S, Schimmel T, Marquez C.
Scott R, Conen J. Rapid visualization of metaphase chromoso-
mes in single human blastomeres after fusion with in-vitro ma-
tured bovine eggs. Hum Reprod 1999; 14(2): 470-5.
64. Cassel MJ, Munne S, Fung J, Weier HU. Carrier-specific
breakpoint scanning DNA probes: an approach to preimplan-
tation genetic diagnosis in interphase cells. Hum Reprod 1997;
12(9): 2019-27.
65. Escudero T, Lee M, Stevens J, Sandalinas M, Munne S. Preim-
226
plantation genetic diagnosis of pencentric inversions. Prenat
Diagn 2001; 21(9): 760-6.
66. Iwarsson E, Ahrlund-Richter L, Inzunza J, Rosenlund B, Frid-
strom M, Hillensjo T, Sjoblom P, Nordenskjold M, Blennow E.
Preimplantation genetic diagnosis of a large pencentric inver-
sion of chromosome 5. Mol Hum Reprod 1998a; 4(7): 719-23.
67. Iwarsson E, Ahrlund-Richter L, Inzunza J, Fridstrom M, Ro-
senlund B, Hillensjo T, Sjoblom P, Nordenskjold M, Blennow
E. Preimplantation genetic diagnosis of DiGeorge syndrome.
Mol Hum Reprod 1998b; 4(9): 871-5.
68. Bishop JM. The molecular genetics of cancer. Science 1987;
235: 308-311.
69. Donis-Keller H. Human gene mapping techniques: A labora-
tory manual. New York: Stockton Press, 1991.
70. Menzel T, Melcher R, Koehler S, Dusel G, Backhaus K, Ott
G, Breithaupt W, Al-Taie O, Schauber J, Gostner A, Schep-
pach W, Luhrs H. Establishment of a colonic adenoma cell li-
ne (GEKI-2): spectral karyotype analysis and functional chara-
cterization. Int J Colorectal Dis 2004; 19(1): 12-7.
71. Augustus M, Bruderlein S, Gebhart E. Cytogenetic and cell cy-
cle Studies in metastatic cells from ovarian carcinomas. Anti-
cancer Res 1986; 6(2): 283-9.
72. Lu XV, Harris CP, Cooley L, Margolin J, Steuber PC, Sheldon
M, Rao PH, Lau CC . The utility of spectral karyotyping in the
cytogenetic analysis of newly diagnosed pediatric acute lym-
phoblastic leukemia. Leukemia 2002; 16(11): 2222-7.
73. Kytola S, Rummukainen J, Nordgren A, Karhu R, Farnebo F,
Isola J, Larsson C. Chromosomal alterations in 15 breast can-
cer cell lines by comparative genomic hybridization and spe-
ctral karyotyping. Genes Chromosomes Cancer 2000; 28(3):
308-17.
74. Weiss MM, Kuipers EJ, Meuwissen SG, van Diest PJ, Meije
GA. Comparative genomic hybridisation as a supportive tool
in diagnostic pathology. J Clin Pathol 2003; 56(7): 522-7.
75. Tarafa G, Prat E, Risques P, Gonzalez S, Camps J, Grau M,
Guino E, Moreno V, Esteller M, Herman JG, Genna JR, Miro
R, Peinado MA, Capella G. Common genetic evolutionary
pathways in familiar adenomatous Polyposis tumors. Cancer
OY
Res 2003; 63(18): 5731-7.
76. Weber-Man gal S, Sinn HP, Popp S, Klaes R, Emig R, Bentz
M, Mansmann U, Bastert G, Bartram CP, Jauch A. Breast
cancer in young women (up to 35 years): Genomic aberrations
detected by comparative genomic hybridization. Int J Cancer
2003; 107(4): 583-92.
77. Johnen G, Krismann M, Jaworska M, Mueller KM. CGH find-
ings in neuroendocrine tumors of the lung. Pathologe 2003;
24(4): 303-7.
78. Veltman IM, Veltman IA, Arkesteijn G, Janssen IM, Vissers
LE, de Jong PJ, van Kessel AG, Schoenmakers EF. Chromo-
somal breakpoint mapping b7y array CGH using flow-sorted
chromosomes. Biotechniques 2003; 35(5): 1066-70.
79. Garcia JL, Hernandez JM, Gutierrez NC, Flores T, Gonzalez
D, Calasanz MJ, Martinez-Climent IA, Pins MA, Lopez-Capi-
tan C, Gonzalez MB, Odero MD, San Miguel IF. Abnonnali-
ties on lq and 7q are associated with poor outcome in sporadic
Burkitts lymphoma. A cytogenetic and comparative genomic
hybridization study. Leukemia 2003; 17(10): 2016-24.
80. Matteucci C, La Starza R, Crescenzi B, Romoli S, Santoro A,
Magrin S, Lauria F, Coco FL, Martelli MF, Mecucci C. Diffe-
rent mechanisms lead to a karyotypically identical t(20;21) in
myelodysplastic syndrome and in acute myelocytic leukemia.
Cancer Genet Cytogenet 2003; 140(1): 13-7.
81. Wolter H, Trijic D, Gottfried HW, Mattfeldt T. Chromosomal
changes in incidental prostatic carcinomas detected by compa-
rative genomic hybridization. Eur Urol 2002; 41(3): 328-34.
82. Lillington DM, Kingston JE, Coen PO, Price E, Hungerford J,
Domizio P, Young BD, Onadim Z. Comparative genomic hy-
bridization of 49 primary retinoblastoma tumors identifies
chromosomal regions associated with histopathology, progres-
sion and patient outcome. Genes Chromosomes Cancer 2003;
36(2): 121-8.
83. Rigola MA, Casadevall C, Bemus M, Caballn MR, Ruster C,
Gelabert Gozcue J, Mir R. Analysis of kidney tumors by com-
parative genomic hybridization and conventional cytogenetics.
Cancer Genet Cytogenet 2002; 137(1): 49-53.
 (PROTEOMICS)
(GENOMICS)
S. Murray, .

, -
O - , -
- .
DNA, -
- ,
. - (high-
throughput technologies)
, - (Human
, - Genome Project):
1. (Genomics): -
. - .
2. (Proteomics): -
, - -
Bcr-Abl , -
- -
- .
ST571 (Gleevec). , 90% 3. (Transcriptomics):
- RNA -
, , , -
.. , (genome) (proteome).
,
- -
, . ,
, - (functional geno-
, mics), ,
.
. -
(profiles) -
, - , -
, DNA - (single nucleotide polymorphisms
(DNA microarrays), - SNPs), R1 DNA,
DNA (sequencing by
hybridization), - , CpG -
cDNA (expression profiling), - (promoters). -
(comparative genomic hybridization),
- X,
- (MRI),
(tandem mass-spectroscopy) - (structural and combinatorial chemistry),
. - -
-
, .
, -

227
228 OY

, DNA
1. -

- - -
,
-
, -
-
( O). O - CHO




.
http://www.healthtech.com
-
( -
), - , -
, -
. O
: - -. --
(comparative genomic hybridisation), -
(genome chromosome , DNA, RNA -
painting), , -
(Serial Analysis of Gene Expression SAGE) DNA .
(microarrays) (Tran- O
scriptosome), -
(2D-protein electrophoresis) - . -
(Proteome). - ,
, -
, -
- micro na-
. - no, -
(transcriptosome), -
RNA (messenger RNA), -
(proteome), . -
, , -
.
30.00060.000 , 80.000250.000
- (OMICS)
OMICs - (splice variants) 500.000 2 -
- . -
- -
(global networking). --
, , Drosophilia1. -
, , - : -
, -
- (. 1). - ,
- (splice variants) - -
, , 98% -
(computational analysis), - -
(wet-chemistry), 2. -
(high- -
throughput technology). .
. 229

- -
-
. (Karyotyping) -
. - - -
, - , 21, -
. , , , -
ONIMATIKH (GENOMICS)
, .. -
.

-
DNA -
-
- (proto-oncoge-
, -
nes), - (tumour
.
suppressor genes). -
, , -
, - ,
. -
(loss of heterozygosity LOH) ( ),
(chromosomal loci) -
- - , de
. LOH novo -
(unbalanced structural rearrangements).
- -
- , -
. - - (PCR, sequencing,
- Southern Blotting ..).
, , -
. - in situ
, DNA, (Fluorescence in situ hybridization FISH)
. O in situ --
- -
- , -
20013,4. -
, -
- . -
DNA- (probes)
5-7. - ,
, , -
- (bacterial artificial chro-
(screening) , mosomes BACs),
- (yeast artificial chromosomes YACs) -
. (plasmid artificial chromosomes
( PACs), 10 > 100
) , - Kb. O (pro-
-
bes) , -
.
(breakpoints) -
, -

, -
-
.

(. 1). FISH
(Conventional karyotyping) -
O - , ,
- (interphase nuclei).
230 OY

1. A. (G-banding). B. (Metaphase spread, G-banding). . FISH.

(probe) ,
(over-amplification).

(spectral microscopy)10.
FISH - SKY -
-
, - (probes) .
(: , 23 -
) . O
, - (probes) -
. - -
, PCR (degenerate oligonucleotide-
primed PCR),
CGH ( - haptens. -
), , , -
, 24 -
8.
.
-
24 -
-
. -
-
-
,
, Leica-M-
FISH (multiplex-FISH M-FISH),
FISH software, -
, . O
9. M- SKY, -
FISH - ,
DNA, (software technology)
, -
2 .
, .
- SKY
- -
(PCR) Southern lot. ,
DAPI (4,6-diamidino-2-phenyl-in-
dole) G-banded (Giemsa banding) ,
(Spectral karyotyping SKY)
SKY . -
FISH, - SKY,
, - -
. 231

2.000 kbp, -FICTION

, (Multicolor-FICTION)
. - -
SKY PCR -
FISH, , (fluorescence im-
- munophenotyping and interphase cytogenetics as a tool
-
for the investigation of neoplasms FICTION). -
(breakpoints).
FISH
, -
ay-Grunwald-Giemsa (MGG) -
-
( )
. -
.
:
Hodgkin,
-FISH 1% (
SKY, FISH)17.


48 -
11.

Centromeric multiplex-FISH (CM-FISH)12 , -
- PCR (DOP-PCR: de-
(subtelo- generate oligonucleotide primed probes). -
meric) , - -
. O -
. (-
) ,
, - 18.
.
IPM-FISH
Rx-FISH
,
-
M-FISH, -
, -
(IRS-PCR), -
, gibbon,
R- -
-
(combinatorial labeling).
. -
,
-
.
- - 13. -
FISH, (single-step) -
- 19.
(chromosome bar coding)14. -FISH (Micro-FISH)
Fast-FISH (micro-
dissection) (FISH-MD)
DNA, SKY-MD micro-
- FISH -
(denaturing agents) - -
. - . -
(microdissection)
- (PCR)
FISH -
15. -
fast-FISH (LTFF)16. 20,21.
232 OY

PRINS -
, Northern
DNA,
, (differential display),
DNA (in
situ), Taq - .
. - -
FISH, - -
, ,
. -
- 28. O (high-
3 21, - throughput technology)
FISH22,23.
: Combinatorial multi- , -
fluor FISH11, multicolor high resolution banding of chro-
mosomes (mBAND)24 Fibre-FISH, - .
.
- ,
25. 50.000 250.000 -
mRNA. 1994
DNA, Affymetrix,
(Comparative Genomic Hybridization CGH) 16.000 (probes) -
H . -
, - 1,5
. -
. , - (specific hybridization)
-
, - -
-
10 - ,
. , 29. O -
-
CGH, - .
(microarrays technology). - -
- DNA, -
BACs , - cDNA -
0,5
. -
26,27. DNA (complementary) mRNA
(transcripts). O cDNA
(libraries) mRNA,
(Nucleic Acid Based Microarrays) -
-
(Gene Expression Arrays) . O DNA

- (high-density microarrays 70.000 )
(HGMP) - cDNA Gene-Chips. -
(Expressed Sequence Tags EST), -
- DNA, EST (
, - 1.000.000 EST
. 6090% )
. 233

, . (Gene- -
Chips) in situ -
- . -
- -
30,31. -
(Transci- , -
ptosome) cDNA -
, -
- -
, -

, . -
- .
.
-
-


O :
,
-

, -
- RNA
, --
, -
. . -
- -
-
, - ,
.
11q23.
,
,
, -
-
. O
.

- ,
-
,
- -
(tailored treatment).

, - . -

5 , - -
-
. (DNA probes)
- ( -
, , ,
, , ..). O
234 OY

RNA
2. . . -
.
2060 -

. -
2a 2b . . -
cDN.
EST,
Cy5 Cy3 PCR -
.
-

. , -
Cy3 Cy5,
Cy5
-
Cy3 +Cy5 . spot , -
(test).
Cy3 -
, .

(20-60-mer) , spot , -

.
EST
PCR

- , -
() -
( -
, microspotting ..). - DNA (molecular wi-
- res).
.
, cDNA ( ) -
-
. (-)
O cDNA .

. - (PROTEOMICS)
- O -
1994 Macqarie
. (test) (1040 , -
g RNA ) (proteome)33,34. O
- , -
, ,
, - -
- / -
(.. Cy3 Cy5, . / DNA / RNA / ,
2). - . -
(-
- -
SNPs: single nucleotide polymorphisms), - ,
, , -
. - ... -
20 60 . -
- .
-
( ) - ,
( , . 2)32. -
. 235

, - (SAGE)35. -
-
36-39. -
. O ,
, , -
- .
. -
- -
. (two-dimensional polyacrylamide gel
- electrophoresis 2D-PAGE)
: 1. - (Mass Spectrometry MS)
, 2. 2D-PAGE -
3. - pH (-
- - ) -
. . 500 2.000
: - gel.
; gel -
- (MS)
; (. 3). O
- -
, , , NCBI, SWISSPROT,
; HGMP, OWL ..
20 ,
. -
(expression proteomics) 10%


(M).
, .
,
-
, :
,
(High Performance
,
Liquid Chromatography), Matrix Associated Laser De-
-
sorption / Ionisation (MALDI) -
.
. Surface-nhanced
(functional proteomics) Laser Desorption / Ionisation (SELDI)
- -
DNA RNA - (< 20 kDa). O
. , -
- 40. -
-
, - ( femtomolar),
- . -

.
.


(transcriptosome) - (Yeast two-hybrid system)
(proteome). -
- (-) -
RNA (messenger RNA), - -
- (yeast transcription factor,
236 OY

SDS PAGE
3 45 67 9 11 pH
A:

A

B: B
B
IEF

1 200 kDa

1 2 5 6
90 kDa
50 kDa
2
32 kDa

3 21 kDa

()
15 kDa

3. .
, , 2D--
( ) .

Gal4) , - . -
-
Gal441,42. -- , -
-
Gal4 -
. .
O -
( 10.000
- )
. -

. -
(Protein-based Microarrays) -
- , (screening) -
, - (recombinant) ,
- -
. , -
, - -
43,44. O
( -- (zymograms, western blots, 2D- -
), - ) ,
- , ,
, , - -
.
. 237

(protein chip techno-

logy) . LCMD
. 2D- 50.000 -
. LCMD SELDI
, , -
- .
, -
45. (Proteome chips) - (Tissue Microarrays)
-
, (screening)
. -
(protein libraries) , -
(affinity), .. . -
(antibody libraries)46,47.
in situ -
(plated solid phase libraries) -
- . -
DNA. (core biopsies, 0,62,0 mm -
- ) blocks
,
(cross-reactivity), (redun- block . 600 -
dancy). block
DNA, RNA . -
, -
in situ (DNA
(capture molecules) - RNA)28. O -
, , -
.. , -
50.
E O
(Fluorescence resonance energy transfer FRET) -
( )
-
(fluorophores) p53 -
51,52. O -
. -
- cDNA
(control fluorophore) , ,
, - . -
-
48,49. -
. ,
-
(Laser Capture Microdissection LCMD) ,
- ,
, ,
,
. LCMD ,
35 m - 53-55. -
. LCMD -
2D- - , (amplification)
238 OY

17 locations) / (deletions),
, translocation t(9;22)
- (CML) t(X;18)(p11;q11) (sy-
, - novial sarcoma). X
4.700 - , -
, 135
- -
61. (amplification) HER
56. 2/neu 62. -
-
3, 7 17 p16 -
, . O - 9p21 -
(core) -
, - 63.
CGH -
- , -
. -
. -
RNA (RNA interference RNAi) , -
RNA - , -
- - 64.
, - -
RNA (RNA interference)57,58. A -
,
, -
(high-throughput).
RNA. , - CGH SKY,
(switch off) , -
.
- (consortium based data), -
( Phenomics)59. , -
-
. ri-
-
bozymes RNA


-
, -
.
in vivo.
PCR, Southern lotting,
Id4 BRCA 1 -
-

, LOH, MSI ..
ribozyme, -
(global)
60.
(Transciptosome),
mRNA, cDNA -
O OOO
O OO SAGE35,65, -

ONIIMATIKH (WET GENOMICS) , -
O 66. O
, -
.
, 67. O -
(trans-
. 239

68,69. -
- -
, .
RNA (RNA protection assays), Southern
Northern lotting Real-time PCR. (Compa-
rative Genomics),
ONIIMATIKH BAIMENH E YOOITE
- .
, (screening) ,
- , -
, - 71,
. - 72. -
- .
, -
1% OONIIMATIKH
70. (PHARMACOGENOMICS)
, -
,
- .

. ,
-
.
- (pharmacogenomics)
- 73,74. -
(net- ,
work). - .
(Cancer Genome Anatomy Project CGAP) , -
.
(sequencing) 75. -
cDNA. ,
-
, - (screening) ,
- SNP.
(xpressed Sequence Tags database dbEST).
- OH I (GENE THERAPY)
-
. - ,
, - .
,
, - ,
, ,
. .
, -
-
, . O -
, -
. ex vivo -
SNP, ( - in vivo 76,77.
), dbEST
/ -
240 OY

, - -
78. .
-
E OE H RNA . -
O OO - cDNA -
- -
-

, - , -
, (Open Reading Frames ORFs) -
, .
--
-
- . O
. RNAi , knock-
O - - out -
- ,
RNA , -
(rate constants) 85,86.
-DNA
. Chip-chip (chromatin
immunoprecipitation array), DNA
- . T -
, -
- -
. - (yeast-two-hybrid technique)87,88. -
, -
, - 64,89.
, , , DNA
. , -
O - ,
, - .
,
. - -
(Biomolecular Inter-
action Network Database BIND), - -
(Database of Interact- .
ing Proteins DIP), - (protein localization profil-
(Molecular Interactions Database MINT) ing) -
-
(General Repository for Interaction Data- (green fluorescent protein tagged proteins). O
sets GRID), 79-82. O (protein identification) -
,
- -
83,84. -
- ,
, , -
90-92. O -
-
.
- 93,94.
. 241

- A
- (high-
throughput technology) -
-
, -
- . O
95,96. -
-
,
-
, , ..
mRNAs -
. - -
, .
mRNAs
-
, -
,
. - ,
( -
single-hit multiple-hit ).
.
- .
-
(transcripts), - -
. O - -
- / .
, - ,
(splice variation), , RNA ,
(non-linerality) , cDNA -
(amplification steps), ,
, , - .
. -
- ,
. (laser capture techniques) -
- .
- -
/ RNA / DNA. O ,
- - :
- )
, .
) -
- .
, - )
. - .
) .
. - ) -
- - .
-, - ) -
. .
242
) -
. -
) .
-
.
) , , - -
. ,
. ,
- - -
- -
- O -
O. O , , -
, .
,
1. Claverie JM. What if there are only 30000 human genes?
Science 2001; 291: 1255-1527.
2. Sorek R, Amitai M. Piecing together the significance of splic-
ing. Nature Biotechnol 1996; 19: 196.
3. International Human Genome Sequencing Consortium. Initial
sequencing and analysis of the human genome. Nature 2001;
409: 860-921.
4. Ventner JC, Adams MD, Myers EW, et al. The sequence of
the human genome. Science 2001; 291: 1304-1351.
5. Brent R. Genomic biology. Cell 2000; 100: 169-183.
6. Jiminez-Sanchez G, Childs B, Valle D. Human disease genes.
Nature 2001; 409: 853-855.
7. Baltimore D. Our genome unveiled. Nature 2001; 409: 814-
815.
8. Weiss MM, Hermsen MA, Meijer GA, et al. Comparative ge-
nomic hybridization. Mol Pathol 1999; 52: 243-251.
9. Speicher MR, Gwys Ballard S, Ward DC. Karyotyping human
chromosomes by combinatorial multi-flour FISH. Nat Genet
1996; 12: 368-375.
10. Schrock E, du Manoir S, Veldman T, et al. Multicolor spectral
karyotyping of human chromosomes. Science 1996; 273: 494-
497.
11. Joyce CA, Ross FM, Dennis NR, Wyre ND, Barber JC. Multi-
paint FISH: a rapid and reliable way to define cryptic and
complex abnormalities. Clin Genet 1999; 56: 192-199.
12. Henegariu O, Bray-Ward P, Artan S, et al. Small marker chro-
mosome identification in metaphase and interphase using cen-
tromeric multiplex fish (CM-FISH). Lab Invest 2001; 81: 475-
481.
13. Teixeira MR, Micci F, Dietrich CU, Heim S. Detailed geno-
me-wide screening for inter- and intrachromsomal abnorma-
lities by sequential G-banding and RxFISH color banding of
the same metaphase cells. Cancer Gent Cytogenet 2000; 119:
94-101.
14. Muller S, Wienberg J. Bar-coding primate chromosomes:
molecular cytogenetic screening for the ancestral hominoid
karyotype. Hum Gent 2001; 109: 85-94.
OY
15. Durm M, Schussler L, Munch H, et al. Fast-painting of human
metaphase spreads using a chromosome-specific, repeat-de-
pleted DNA library probe. Biotechniques 1998; 24: 820-825.
16. Durm M, Haar FM, Hausmann M, Ludwig H, Cremer C.
Non-enzymatic, low temperature fluorescence in situ hybridi-
zation of human chromosomes with a repetitive alpha-satellite
probe. Z Naturforsch 1997; 52: 82-88.
17. Soenen V, Fenaux P, Flactif M, et al. Combined immunophe-
notyping and in situ hybridization (FICTION): a rapid method
to study cell lineage involvement in myelodysplastic syndro-
mes. Br J Haematol 1995; 90: 701-706.
18. Carter NP. Cytogenetic analysis by chromosome painting. Cy-
tometry 1994; 18: 2-10.
19. Aurich-Costa J, Vannier A, Gregoire E, Nowak F, Cherif D.
IPM-FISH, a new M-FISH approach using ISR-PCR painting
probes: application to the analysis of seven human prostate
cell lines. Genes Chromosomes Cancer 2001; 30: 143-160.
20. Weimer J, Koehler MR, Wiedemann U, et al. Highly compre-
hensive karyotype analysis by a combination of spectral karyo-
typing (SKY), microdissection, and reverse painting (SKY-MD).
Chromosome Res 2001; 9: 395-402.
21. Meltzer PS, Guan XY, Burgess A, Trent JM. Rapid genera-
tion of region specific probes by chromosome microdissection
and their application. Nat Genet 1992; 1: 24-28.
22. Hou JW, Wang TR. Primed in situ (PRINS) labeling for rapid
detection of numeric and structural chromosome anomalies. J
Formos Med Assoc 1997; 96: 46-50.
23. Hindkjaer J, Koch J, Terkelsen C, et al. Fast, sensitive multi-
color detection of nucleic acids in situ by PRimed IN Situ la-
beling (PRINS). Cytogenet Cell Genet 1994; 66: 152-154.
24. Michalova K, Zemanova Z, Brezinova J. Multicolor fluore-
scence in situ hybridization (-FISH). Cas Lek Cesk 2001; 140:
99-103.
25. Florijn RJ, Bonden LA, Vrolijk H, et al. High-resolution DNA
Fiber-FISH for genomic DNA mapping and color bar-coding
of large genes. Hum Mol Genet 1995; 4: 831-836.
26. Solinas-Toldo S, Lampel S, Stilgenbauer S, et al. Matrix-based
comparative genomic hybridization: biochips to screen for ge-
. 243
nomic imbalances. Genes Chromosomes Cancer 1997; 20: 399-
407.
27. Pinkel D, Segraves R, Sudar D, et al. High resolution analysis
of DNA copy number variation using comparative genomic hy-
bridization to microarrays. Nat Genet 1988; 20: 207-211.
28. Murray S. The Technology of Microarrays and Applications in
Oncology. Forum Clin Oncol 2002; 1: 44-48.
29. Ramaswamy S, Golub TR. DNA microarrays in clinical onco-
logy. J Clin Oncol 2002; 20: 1932-1941.
30. Ramsay G. DNA chips: state-of-the art. Nat Biotechnol 1998;
16: 427-431.
31. Granjeaud S, et al. Expression profiling: DNA arrays in many
guises. Bioessays 1999; 21: 781-790.
32. Freeman WM, et al. Fundamentals of DNA hybridization ar-
rays for gene expression analysis. Biotechniques 2000; 29: 1042-
1055.
33. Wilkins MR, Sanchez JC, Gooley AA, et al. Progress with pro-
teome projects. Why all proteins expressed by a genome should
be identified and how to do it. Biotechnol Genet Eng Rev
1996; 13: 19-50.
34. Wilkins MR, Sanchez JC, Williams KL, Hochstrasser DF. Cur-
rent challenges and future applications for protein maps and
post-translational vector maps in proteome projects. Electro-
phoresis 1996; 17; 830-838.
35. Velculescu VE, Zhang L, Vogelstein B, Kinzler KW. Serial a-
nalysis of gene expression. Science 1995; 270: 484-487.
36. Lockhart DJ, Winzelar EA. Genomics, gene expression and
DNA arrays. Nature 2000; 405: 827-836.
37. Debouck C, Goodfellow PN. DNA microarrays in drug disco-
very and development. Nature Genet 1999; 21: 48-51.
38. Stratowa C, Wilgenbus KK. Gene expression profiling in drug
discovery. Curr Opin Mol Ther 1999; 1: 671-679.
39. Clarke PA, te Poele R, Wooster R, Workman P. Gene expres-
sion microarray analysis in cancer biology, pharmacology and
drug development: progress and potential. Biochem Pharma-
col 2001; 62: 1311-1336.
40. Merchant M, Weinberger SR. Recent advancements in surface-
enhancement laser desorption/ionization-time of flight-mass
spectrometry. Electrophoresis 2000; 21: 1164-1167.
41. Fields S, Song O. A novel genetic system to detect protein-pro-
tein interactions. Nature 1989; 340: 245-246.
42. Coates PJ, Hall PA. The yeast two hybrid system for identify-
ing protein-protein interactions. J Path 2003; 199: 4-7.
43. Haab BB. Advances in protein microarray technology for pro-
tein expression and interaction profiling. Curr Opin Drug Dis-
cov Devel 2001; 4: 116-123.
44. Schweitzer B, Kingsmore SF. Measuring proteins on microar-
rays. Curr Opin Biotechnol 2002; 13: 14-19.
45. Zhu H, Bilgin M, Bangham R, et al. Global analysis of protein
activities using proteome chips. Science 2001; 293: 2101-2105.
46. Schweitzer B. Multiplexed protein profiling on microarrays by
rolling-circle amplification. Nat Biotechnology 2002; 20: 359-
365.
47. Haab BB, Dunham MJ, Brown PO. Protein microarrays for
highly parallel detection and quantitation of specific proteins
and antibodies in complex solutions. Genome Biol 2001; 2: 1-13.
48. Schmidt JA, Sitte HH. Fluorescence resonance energy transfer
in the study of cancer pathways. Curr Opin Oncol 2003; 15: 55-
64.
49. Lewis F, et al. Unlocking the archive-gene expression in paraf-
fin-embedded tissue. J Pathol 2001; 195: 66-71.
50. Camp RL, Chung GG, Rimm DL. Automated subcellular lo-
calization and quantification of protein expression in tissue mi-
croarrays. Nature Medicine 2002; 11: 1323-1327.
51. Kononen J, Bubendorf L, Kallioniemi A, et al. Tissue microar-
rays for high-throughput molecular profiling of tumor speci-
mens. Nat Med 1998; 4: 844-847.
52. Kallioniemi OP, Wagner U, Kononen J, Sauter G. Tissue mi-
croarray technology for high-throughput molecular profiling of
cancer. Hum Mol Genet 2001; 10: 657-662.
53. Bubendorf L, Kononen J, Koivisto P, et al. Survey of gene am-
plifications during prostate cancer progression by high-through-
out fluorescence in situ hybridization on tissue microarrays.
Cancer Res 1999; 59: 803-806.
54. Bubendorf L, Kolmer M, Kononen J, et al. Hormone therapy
failure in human prostate cancer: analysis by complementary
DNA and tissue microarrays. J Natl Cancer Inst 1999; 91:
1758-1764.
55. Bowen C, Bubendorf L, Voeller HJ, et al. Loss of NKX3.1 ex-
pression in human prostate cancers correlates with tumor pro-
gression. Cancer Res 2000; 60: 6111-6115.
56. Schraml P, Kononen J, Bubendorf L, et al. Tissue microarrays
for gene amplification surveys in many different tumor types.
Clin Cancer Res 1999; 1966-1975.
57. Montgomery MK, Xu SQ, Fire A. Rna as a target of double-
stranded rna-mediated genetic interference in caenorhabditis
elegens. PNAS 1998; 95: 15502-15507.
58. Fire A. Rna-triggered gene silencing. Trends Genet 1999; 15:
358-363.
59. Li QX, Robbins JM, Welch PJ, et al. A novel functional geno-
mics approach identifies mtert as a suppressor of fibroblast
transformation. NAR 2000; 28: 2605-2612.
60. Beger C, Pierce LN, Kruger M, et al. Identification of id4 as a
regulator of brca1 expression by using a ribozyme-based inver-
se genomics approach. PNAS 2001; 98: 130-135.
61. Mitelman F, Mertens F, Johansson B. A breakpoint map of re-
current chromosomal rearrangements in human neoplasia. Nat
Genet 1997; 417-472.
62. Funkhouser WK, Kaiser-Rogers K. Review: significance of,
and optimal screening for, HER-2 gene amplification and pro-
tein overexpression in breast carcinoma. Ann Clin Lab Sci 2001;
31: 349-358.
63. Halling KC, King W, Sokolova IA, et al. A comparison of cyto-
logy and fluorescence in situ hybridization for the detection of
urothelial carcinoma. J Urol 2000; 164: 1768-1775.
64. van de Vijver MJ, He YD, vant Veer LJ, et al. A gene-expres-
sion signature as a predictor of survival in breast cancer. NEJM
2002; 347: 1999-2009.
65. Polyak K, Riggins GJ. Gene discovery using the serial analysis
of gene expression technique: implications for cancer research.
J Clin Oncol 2001; 19: 2948-2958.
66. Scherf U, Ross DT, Waltham M, et al. A gene expression data-
base for the molecular pharmacology of cancer. Nature Genet
244
2000; 24: 227-235.
67. Clarke PA, te Poele R, Wooster R, Workman P. Gene expres-
sion microarray analysis in cancer biology, pharmacology, and
drug development: progress and potential. Biochem Pharma-
col 2001; 62: 1311-1336.
68. Perou CM, Serlie T, Eisen MB, et al. Molecular portraits of
human breast tumours. Nature 2000; 406: 747-752.
69. Golub TR, Slonim DK, Tamayo P, et al. Molecular classifica-
tion of cancer: class discovery and class prediction by gene ex-
pression monitoring. Science 1999; 286: 531-537.
70. Fearon ER. Human cancer syndromes: clues to the origin and
nature of cancer. Science 1997; 278: 1043-1050.
71. Loots GG, Locksley RM, Blankespoor CM, et al. Identifica-
tion of a coordinate regulator of interleukins 4, 13, and 5 by
cross-species sequence comparisons. Science 2000; 288: 136-140.
72. Onyango P, Miller W, Lehoczky J, et al. Sequence and compa-
rative analysis of the mouse 1-megabase region orthologous to
the human 11p15 imprinted domain. Genome Res 2000; 10:
1697-1710.
73. Slonim DK. Transcriptional profiling in cancer: the path to cli-
nical pharmacogenomics. Pharmacogenomics 2001; 2: 123-136.
74. Smaglik P. Pharmacogenetics initiative galvanizes public and
private sectors. Nature 2001; 410: 393-394.
75. Jain KK. Applications of biochip and microarray systems in
pharmacogenomics. Pharmacogenomics 2000; 1: 289-307.
76. Anklesaria P. Gene therapy: a molecular approach to cancer
treatment. Curr Opin Mol Ther 2000; 4: 426-432.
77. Kuroiwa Y, Tomizuka K, Shinohara T, et al. Manipulation of
human minichromosomes to carry greater than megabase-sized
chromosome inserts. Nat Biotechnol 2000; 10: 1086-1090.
78. Somia N, Verma IM. Gene therapy: trials and tribulations. Nat
Rev Genet 2001; 2: 91-99.
79. Bader GD, et al. BIND the Biomolecular Interaction Net-
work Database. NAR 2001; 29: 242-245.
80. Xenarios I, et al. DIP, the Database of Interacting Proteins: a
research tool for studying cellular networks of protein intera-
ctions. NAR 2002; 30: 303-305.
81. Zanzoni A, et al. MINT: A Molecular Interaction database.
FEBS Lett 2002; 513: 135-140.
82. Breitkreutz BJ, et al. The GRID: the general repository for in-
teraction databases. Genome Biol 2002; 3: 13.
83. Mewes HW, et al. MIPS: a database for genomes and protein
sequences. NAR 2002; 30: 31-34.
84. Dwight SS, et al. Saccharomyces Genome Database (SGD) pro-
vides secondary gene annotation using Gene Ontology (GO).
NAR 2002; 30: 69-72.
85. Nolan PM, et al. A systematic, genome-wide, phenotype-driven
mutagenesis programme for gene function studies in the mou-
se. Nat Genet 2000; 25: 440-443.
86. Wu RZ, et al. Cell-biological applications of transfected-cell
microarrays. Trends Cell Biol 2002; 12: 485-488.
87. Robyr D, et al. Microarray deacetylation maps determine ge-
nome-wide functions for yeast histone deacetylases. Cell 2002;
109: 437-446.
88. van Leeuwen F, et al. Dot1p modulates silencing in yeast by
methylation of the nucleosome core. Cell 109; 745-756.
OY
89. Reynolds T. For proteomics research, a new race has begun.
JNCI 2002; 94: 552-554.
90. Ficarro SB, et al. Phosphproteome analysis by mass spectro-
metry and its application to Saccharomyces cerevisiae. Nat
Biotechnol 2002; 20: 301-305.
91. Wells L, et al. Mapping sites of O-GlcNAc modification using
affinity tags for serine and threonine post-translational modifi-
cations. Mol Cell Proteomics 2002; 1: 791-804.
92. Mann M, et al. Analysis of protein phosphorylation using mass
spectrometry: deciphering the phosphoproteome. Trends Bio-
technol 2002; 20: 261-268.
93. Li J, Zhang Z, Rosenzweig J, Wang YY, Chan DW. Proteo-
mics and bioinformatics approaches for identification of serum
biomarkers to detect breast cancer. Clin Chem 2002; 48: 1296-
1304.
94. Petricoin III PF, Ardekani AM, Hitt BA, et al. Use of proteo-
mic patterns in serum to identify ovarian cancer. Lancet 2002;
359: 572-577.
95. Jeong H, et al. Lethality and centrality in protein network. Na-
ture 2001; 411: 41-42.
96. Wagner A. The yeast protein interaction network evolves rapi-
dly and contains few redundant duplicate genes. Mol Biol Evol
2001; 18: 1283-1292.
-
a. Bayani J, Squire JA. Advances in the detection of chromoso-
mal aberrations using spectral karyotyping. Clin Genet 2001;
59: 65-73.
b. Bayani J, Squire JA. Applications of SKY in cancer cytogene-
tics. Cancer Invest 2002; 20: 373-386.
c. Going JJ, Gusterson BA. Molecular pathology and future de-
velopments. Eur J Cancer 1999; 35: 1895-1904.
d. Kelly L, Clark J, Gilliland DG. Comprehensive genotypic ana-
lysis of leukemia: clinical and therapeutic implications. Curr
Opin Oncol 2002; 14: 10-18.
e. Lee C, et al. Multicolor fluorescence in situ hybridization in
clinical cytogenetic diagnostics. Curr Opin Pediatr 2001; 13:
550-555.
f. Patel AS, et al. Cytogenetics and cancer. Curr Opin Oncol
2000; 12: 62-67.
g. Debouck C, Goodfellow PN. DNA microarrays in drug disco-
very and development. Nat Genet 1999; 21 (1 Suppl): 48-50.
h. Hacia JG. Resequencing and mutational analysis using oligo-
nucleotide microarrays. Nat Genet 1999; 21 (1 Suppl): 42-7.
i. Cole KA, Krizman DB, Emmert-Buck MR. The genetics of
cancera 3D model. Nat Genet 1999; 21 (1 Suppl): 38-41.
j. Brown PO, Botstein D. Exploring the new world of the geno-
me with DNA microarrays. Nat Genet 1999; 21 (1 Suppl): 33-
37.
k. Bowtell DD. Options availablefrom start to finishfor ob-
taining expression data by microarray. Nat Genet 1999; 21 (1
Suppl): 25-32.
l. Lipshutz RJ, Fodor SP, Gingeras TR, Lockhart DJ. High den-
sity synthetic oligonucleotide arrays. Nat Genet 1999; 21 (1
Suppl): 20-24.
. 245
m. Cheung VG, Morley M, Aguilar F, Massimi A, Kucherlapati
R, Childs G. Making and reading microarrays. Nat Genet
1999; 21(1 Suppl): 15-19.
n. Duggan DJ, Bittner M, Chen Y, Meltzer P, Trent JM. Expres-
sion profiling using cDNA microarrays. Nat Genet 1999; 21 (1
Suppl): 10-14.
o. Southern E, Mir K, Shchepinov M. Molecular interactions on
microarrays. Nat Genet 1999; 21 (1 Suppl): 5-9.
p. Array of hope. Nat Genet 1999; 21 (1 Suppl): 3-4.
q. Taylor SW, Fahy E, Ghosh SS. Global organellar proteomics.
TRENDS in Biotechnol 2001; 21: 82-88.
r. Huynen MA, Snel B, von Mering C, Bork P. Function predi-
ction and protein networks. Current Opinion in Cell Biology
2003; 15: 191-198.
s. Drewes G, Bouwmeester T. Global approaches to protein-pro-
tein interactions. Current Opinion in Cell Biology 2003; 15:
199-205.
t. Zhu H, Bilgin M, Snyder M. Proteomics. Ann Rev Biochem
2003; 72: 783-812.
u. Fenyo D, Beavis RC. Informatice and data management in
proteomics. Trends in Biotechnol 2002; 20: S35-S38.
v. Strausberg RL, Greenhut SF, Grouse LH, et al. In silico analy-
sis of cancer through the Cancer Genome Anatomy Project.
TRENDS in Cell Biology 2001; 11: S66-S71.
w. Rosell R, Monzo M, OBrate A, Taron M. Translational onco-
genomics: toward rational therapeutic decision-making. Curr
Opin Oncol 2002; 14: 171-179.
V
O
I
.. ...................................................................................................... 249

,
. , E. .................................................................................. 261

. .

I -
O - (. 1) -
-
.
. - DNA RNA
-
, -
.
.
,
-
OI PAH RNA DNA
- OKOONN IN

- -
.
O -
: , .
-
-

-
.
,
, Per-
.
ton Rous 1911, Rous Sar-
-
coma Virus (RSV)1,
,
1. -

-

20 2.
1. . -
, RNA OKOONOI IOI
. O -
2. .


- 3. -
. 60 70 Duesberg Vogt -
3. . O - , RSV (Rous
- Sarcoma Virus),
.
4.
, ALV (Avian Leuki-
. - mia Virus),
- .
. in vitro RSV4
5. . - -
-
.
-
-

249
250 OY

, -
Src5,6. -
12.
7,8 - -
- ,
Src.
- .
-
,
9. --
-
- . O -
, , -
.
- -
- .
-
- , -
,
(. 2)10. - [.. avian leukosis virus, mouse mammary tumor virus
(MMTV)]. -
30
- -
11. -
(upstream) - .
- -
- -

2.

O I

Abl Abelson murine leukimia virus Ab-MLV

Fes ST feline sarcoma virus ST-FeSV
Fps Fujinami sarcoma virus FuSV
Src Rous sarcoma virus RSV
ErbB Avian erythroblastosis virus AEV-ES4
Fms McDonough feline sarcoma virus SM-FeSV
Kit Hardy-Zuckerman-4 feline sarcoma virus HZ4-FeSV
Mil Avian myelocytoma virus MH2 /
Mos Moloney murine sarcoma virus Mo-MSV /
Raf Murine sarcoma virus 3611 MSV3611 /
Sis Simian sarcoma virus SSV
H-ras Harvey murine sarcoma virus Ha-MSV GDP/GTP binding
K-ras Kirsten murine sarcoma virus Ki-MSV GDP/GTP binding
ErbA Avian erythroblastosis virus AEV-ES4
Ets Avian myeloblastosis virus E26 AMV-E26
Fos FBJ osteosarcoma virus FBJ-MSV (AP1 component)
Jun Avian sarcoma virus 17 ASV-17 (AP1 component)
Myb Avian myeloblastosis virus AMV
Myc MC29 myelocytoma virus MC29
Rel Reticuloendotheliosis virus REV-T (NF-kB family)
Crk CT10 avian sarcoma virus CT10
IV. 251

3. , -

O I

Lck Moloney murine leukimia virus Mo-MLV

c-erbB Rous-associated virus 1 RAV-1
c-fms Friend murine leukimia virus Fr-MLV
Pim 1 Moloney murine leukimia virus Mo-MLV /
Egf 3 / Int 2 Mouse mammary tumor virus MMTV
Wint 1 / Int 1 Mouse mammary tumor virus MMTV
Wint 3 / Int 4 Mouse mammary tumor virus MMTV
c-Ki-ras Friend murine leukimia virus Fr-MLV GDP/GTP binding
Ets 1 Moloney murine leukimia virus Mo-MLV
c-fos Rous-associated virus 1 RAV-1 (AP1 component)
c-myb Rous-associated virus 1 RAV-1
c-myb Moloney murine leukimia virus Mo-MLV
c-myc Rous-associated virus 1 RAV-1
c-myc Moloney murine leukimia virus Mo-MLV
Fis 1 / Cyclin D1 Friend murine leukimia virus Fr-MLV G1
Vin 1 / Cyclin D2 Moloney murine leukimia virus Mo-MLV G1

, -
- . -
13. -
, .. c-myc
70 - (. 3) avian-
, , leukosis virus N-myc -
in vivo, , Wood-
- chuck hepatitis virus14,15.
- O TV (Mouse Mammary Tumor Virus)
. , -
-- . -

.
, (Int 2) fibroblast growth fa-
ctor gene Wnt-116. O
-
,
- MMTV .
. O -
DNA OKOONOI IOI
, DNA (poly-
, - omaviruses, papilloma viruses, adenoviruses) -

.
, 17,18,19.
- -
, . , -
,
, . -
- -
252 OY

DNA - p53, ,
- -
(tumor suppressor genes). - SV40
DNA 6.
- p53
-. O ( -
p53),
, - - - -
S - 26. -
- -
DNA. -
1 -
Simian Virus 40 (SV40) T-ag (large T-antigen), 27. pRb (
) , ,
DNA, -- SV40
S20,21,22. O - T-ag, p53, -
-
DNA 22,28.
4. - -
- -
- SV40. O
.
- -
- p53 pRb - DNA -
-. p53
DNA -23,24. - - -
DNA ,
, - -
p53 pRb, - -
, - ( -
)
25. , DNA

4. A

SV40 - P53, PRb

t- PP2A
HPV E6 P53 via E6AP, DLG, MAGI 1, MUPP 1
E7 PRb
Adeno E1A PRb
E1B-55K P53
Adeno9 E4ORF1 DLg, MAGI-1, MUPP 1
BPV E5 PDGF- receptor
EBV LMP1 TRAFs
HBV HBx(?) P53, DDB1
Polyoma T- PRb
T- c-Src, PI3-K, PLC-, Shc
t- PP2A

Adeno: , BV: , PDGF: , PI3-K: , Poly-

oma: , PLC-: , PP2A:
IV. 253

stress29.
in vitro
, MDM2, ARF
30,31. - SV40 polyoma. -
p53, -
- ,
-
DNA. pRb - T-ag
E2F T-ag. -
G1 , pRb - , -
, - (.. myc ras, E1A
2F 1) -
.
DNA.

T-ag pRb-
in vivo
E2F -
2F, -
.
-
DNA . -
- SV40. , -
6 HPV (Human Pa- . -
pilloma Virus) p53 - avian erythroblastosis,
- V-erbA V-erbB
, E1B-55K . O - in vivo -
, , ,
(pRb) - , V-erbB.
. - -

pRb, p107 p130, - -
- , ,
-
. , -
. -
p53 pRb, -
SV40T-ag. .
-
H KAPKINOENEH OYTAIAKO -
AINOMENO
DNA
- .
- -
- -
, - ,
32,33,34. H - 36. -
- ,
35. - -
, - . -
- . -
in vitro 1-19
in vivo.
254 OY

Bcl-2, , , - 6.

p5337,14, 6 HPV 1. O
T-ag SV40. .
2. O
-.
OI IOI AITIA HMIOYPIA KAPKINOY 3.
TON ANPO .
4. O

.
5. O -
38,39 ,
.
(. 5). 6. -
-
- .
. O 7.
.
. HBV HCV 8. O -
.
- 9. O
(HCC)40,41, o EBV Burkitt lymfo-
ma, nasopharyngeal carcinoma (NPC), Hodgkins di- .
sease 42, 10. -
.
HPV -
11. O
43, HTLV .
T-cell leukemia - 12. -
44, HHV-8 (KSHV) Kaposi45 .
SV40 -
, 46. -
15% ( -
, ).
. O , - -
6,
- . O -
. -
, , . O
5. -
-
, ,


epadnaviridae HBV 47. O -
Herpesviridae
Gammaherpesviruses EBV HHV-8 (KSHV)
Papovaviridae
,
Papillomaviruses HPV (high risk types) HPV (other types) 48. -
Polyomaviruses SV40, BKV, JCV HHV-8 (KSHV),
Adenoviridae
Poxviridae , -
Molluseipoxvirus MCV
Leporipoxvirus
, -
Retroviridae 49.
Simple O -
Complex
Flaviviridae HTLV-1 . -
HCV HIV
-
IV. 255

: )
- - -
, ,
( EBV -), ) -
- , , -
(HSV -
, HPV ), ) - -
54.
- (.. HIV Influenza Virus).
- -
- -
. , . -
HPV 50% - -
, -
,
50. ,
- .
.
HPV -
-
. O - . O
,
-
. O HBV .
,
,
51. HBV - -
90% .

MHXANIMOI PAH OKOONN IN
. TON ANPO
O
HCC . -
O HCV : )
85% ) . O
- -
, - , .
O -
. ,
HCV in vitro.
-
, 3%
52.
O EBV ,
- ,
. .

1, O
- - O DNA
- . O
V53.
256 OY

, S3
- 33 p5358. O
DNA. O Papilloma HTLV-1 -
Polyoma - ATL
- - 59.
. ,
- p53 pRb - , -
. , -
HPV, ,
6 7, O.

5. - EPSTEIN-BARR VIRUS
O Epstein-Barr herpesvirus, -
platelet-derived growth factor Gammaherpes viridae. O EBVs
, DNA 172 Kb
55. 100 -
EBV. O .
(LMP1), - -
,
, -- EBV Burkitt lymphoma -
BL
. EBV . -
(EBNAs) -
. 1
BL -
56. . -
DNA EBV, -
O ,
O , --
-
, - . -
- -
. V Hodgkins, -
HBV - 53.
,
, - HEPATITIS B VIRUS (HBV)
, - O B (HBV) DNA -
. - . -
Hepadnaviridae
, - DNA 32 Kb. -
. HBV
. - -
, -
HPV EBV, - .
- -
- 60.
- -
- -
57. ,
HCV, HBV
, - .
IV. 257

HEPATITIS C VIRUS (HCV) .

O C (HCV) RNA -
- , -
Flaviviridae. 95 Kb HPV -
. HPV . -
HCV -
6 -
50 . HCV -
80% - . -
, 30% - HPV -
HCC. - , -
HCV - -
, - DNA .
, - DNA 6 7
, 2 -
, ,
Flavivirus, 6 7 62.
. O -
HUMAN HERPES VIRUS 8 (HHV-8)
HCV -
61. O HHV-8 -
, -
HUMAN PAPILLOMA VIRUS (HPV) Kaposi63 -
O , - KSHV (Kaposis Sarcoma-associated herpesvi-
DNA - rus). O HHV-8 -2-,
8 Kb. 120 - 140,5 Kb -
HPV EBV. O -
, HPV 16 HPV 18 - .

,
. -
- -
-
. . -
,
. ,
HPV
64.
- -
-
. 99% - -
DNA - .
HPV, - ,
- O,
.
-
Hill HPV - . O -
, - , ,
, - -
, - .
258
1. Rous P. Transmission of a malignant new growth by means of
a cell-filtrate. A Am Med Assoc 1911; 56: 198.
2. Vogt PK. Historical introduction to the general properties of
retroviruses. In: Coffin JM, Hughcs S, Varmus HE, eds. Retro-
viruses. New York: Gold Spring Harbor, 1997: 1-25.
3. Fields BD, Knipe DM, et al. Virology. 2nd ed. New York: Ro-
wen Press, 1990.
4. Temin HM, Rubin H. Characteristics of an assay for Rous sar-
coma virus and Rous sarcoma cells in tissue culture. Virology
1958; 6: 669-688.
5. Lai MMC, Deusberg PH, et al. Avian tumor virus RNA: a
comparison of three sarcoma viruses and their transformation
defective derivatives by oligonucleotide finger printing and
DNA RNA hybridization. PNAS 1973; 70: 2266-2270.
6. Lane DP, Crawford LV. T antigen is bound to a host protein
in SV-40 transformed cells. Nature 1979; 278: 261-263.
7. Baltimore D. RNA dependent DNA polymerase in virions of
RNA tumor viruses. Nature 1970; 226: 1209-1211.
8. Temin HM, Rubin H. Characteristics of an assay for Rous sar-
coma virus and Rous sarcoma cells in tissue culture. Virology
1958; 6: 669-688.
9. Stehelin D, Varmus HE, et al. DNA related to the transform-
ing gene(s) of avian sarcoma viruses is present in normal avian
DNA. Nature 1976; 260: 170-173.
10. Hsu JL, Glaser SL. Epstein-Barr virus associated malignancies
epidemiologic patterns and etiologic implications. Crit Rev
Oncol Hematol 2000; 34 (1): 27-53.
11. Rosenberg N, Jolicoeur P. Retroviral pathogenesis. In: Hughcs
S, Vatmus HE, eds. Retroviruses. New York: Gold Spring
Harbor Laboratory Press, 1997: 475-585.
12. Telesnitsky A, Goff SP. Reverse transcriptase and the genera-
tion of retroviral DNA. In: Coffin JM, et al, eds. Retroviruses.
New York: Gold Spring Harbor Laboratory Press, 1997: 121-
160.
13. Krung HJ, et al. Retroviral mutagenesis of cellular oncogenes,
a review with insights into the mechanisms of insertional acti-
vation. Curr Top Microbiol Immunol 1991; 171: 1-25.
14. Finzer P, et al. The role of human papillomavirus oncoproteins
E6 and E7 in apoptosis. Cancer Lett. 2002; 15:188 (1-2), 15-24.
15. Fourel G, et al. Frequent activation of N-myc genes by hepad-
navirus insertion in Woodchuck liver tumor. Nature 1990; 347:
294-298.
16. Luther SA, Acha-Orbea H. Mouse mammary tumor virus,
immunological interplays between virus and host. Adv Immu-
nol 1997; 65: 139-243.
17. Cole CN. Polymavirinae: the viruses and their replication. In:
Fields BD, et al. Virology. 3rd ed. Philadelphia PA: Lippin-
cott-Raven, 1996; Vol. 2: 1997-2025.
18. Howely RM. Papillomavirine: the viruses and their replication.
In: Fields BD, et al. Virology. 3rd ed. Philadelphia PA: Lippin-
cott-Raven, 1996; Vol. 2: 2045-2076.
19. Shenk T. Adenoviridae: the viruses and their replication. In:
Fields BD, et al. Virology. 3rd ed. Philadelphia PA: Lippin-
cott-Raven, 1996; Vol. 2: 2111-2148.
OY
20. Pipas JM. Common and unique features of T antigens encod-
ed by the poluomavirus group. J Virol 1992; 66: 3979-3985.
21. Butel JS, Lednicky JA. Cell and molecular biology of simian
virus 40, implications for human in infection and disease. J
Natl Cancer Inst 1999; 91:119-134.
22. Neil JO, et al. p53 and tumor viruses catching the guardian off-
guard. Trends Microbiol 1997; 5: 115-120.
23. Nevins JR, Vogt PK. Cell transformation by viruses. In: Fields
BD, et al. Virology. 3rd ed. Philadelphia PA: Lippincott-Ra-
ven, 1996; Vol. 1: 301-343.
24. Ishido S, Hotta H. Complex formation of the non-structional
protein 3 of hepatitis C virus with the p53 tumor suppressor.
FEBS Let. 1998; 438: 258-262.
25. Anton M, et al. The role of tumor suppressors and viral onco-
proteins in cervical carcinogenesis. Geska Gunekol Jul. 2000;
65 (4): 275-278.
26. Finlay CA, Hinds PW, Levine AJ. The p53 proto-oncogene act
as a suppressor of transformation. Cell 1989; 17: 43-52.
27. Whyte P, et al. Association between an oncogene and an anti-
oncogene: the adenovirus EIA protein bind to the retinobla-
stoma gene product. Nature 1988; 334: 124-129.
28. Cheng Yue. Human DNA oncogenic viruses and their trans-
forming protein interactions with cell cycle control proteins.
Chinese Medical Journal 1999; 112 (4): 291-296.
29. Lane DP. Cancer p53 guardian of the genome. Nature 1992;
358: 15-16.
30. Freedman DA, Levine AJ. Regulation of the p53 protein by
the mdm2 oncoprotein. Cancer Res 1999; 59: 1-7.
31. Amudson SA, et al. Roles for p53 in growth arrest and apopto-
sis putting on the brakes after genotoxic stress. Oncogene 1998;
17: 3287-3299.
32. Bishop JM. Molecular themes in oncogenesis. Cell 1991; 64:
235-248.
33. Weinberg RA. Oncogenes, antioncogenes and the molecular
basis of multistep carcinogenesis. Cancer Res 1989; 49: 3713-
3721.
34. Howely PM, Munger K. Human papillomaviruses and squa-
mous cell carcinomas. In: Microbes and malignacy. Oxford: Ox-
ford University Press, 1999: 157-179.
35. Zur Hawgen H. Viruses in human cancers. Science 1991; 254:
1167-1173.
36. Teodoro IG, Branton PE. Regulation of apoptosis by viral ge-
ne products. J Virol 1997; 71: 1739-1746.
37. Gottlieb TM, Oren M. p53 and apoptosis. Semin Cancer Biol
1998; 8: 359-368.
38. Parkin DM, et al. The global health burden of infection asso-
ciated cancer. Cancer Surv 1999; 33: 5-33.
39. Wong M, et al. New associations of human papillomavirus, Si-
mian Virus 40 and Epstein-Barr virus with human cancer. J
Nat Canc Inst 2002; 18 94 (24): 1832-1836.
40. Chung RT, Liang TJ. Hepatitis C virus and hepatocellular car-
cinoma. In: Microbes and Malignacy. Oxford: Oxford Univer-
sity Press, 1999; 267-288.
41. Robinson WS. Hepatitis B virus and hepatocellular carcinoma.
IV.
In: Microbes and Malignacy. Oxford: Oxford University Press,
1999; 232-266.
42. Raab-Iraub N. Epstein-Barr virus, lymphoproliferative disease
and nasopharyngaeal carcinoma. In: Microbes and Malignacy.
Oxford: Oxford University Press, 1999; 180-206.
43. Munger K, Howley RM. Human papillomavirus immortaliza-
tion and transformation functions. Virus Res 2002; 36 (5 Suppl
1): 574-83.
44. Mortreux F, et al. Molecular ad cellular aspects of HTLV-1 as-
sociated leukomogenesis in vivo. Leukemia 2003; 17 (1): 26-38.
45. Boshoff C. Kaposiss sarcoma associated herpesvirus. Cancer
surv 1999; 33: 157-190.
46. Carbone M, et al. Simian virus 40, poliovaccines and human
tumors, a review of recent developments. Oncogene 1997; 15:
1877-1888.
47. Relman DA. Chronic host-parasite interactions. In: Microbes
and Malignacy. Oxford: Oxford University Press, 1999: 19-34.
48. Smith GL. Virus strategies for evation of the host response to
infection. Trends Microbiol 1994; 2: 81-88.
49. Schultz TF. Kaposis sarcoma associated herpevirus 8. J Gen
Virol 1998; 79: 1573-1591.
50. Konya J, Dillner J. Immunity to oncogenic human papilloma-
viruses. Adv Canc Res 2001; 82: 205-38.
51. Wild CP, Hall AJ. Hepatitis B virus and liver cancer. Cancer
Surv 1999; 33: 35-54.
52. Dominguez-Malagon H, Gaytan-Graham S. Hepatocellular car-
cinoma: an update.Ultrastruct Pathol 2001; 25 (6): 497-516.
53. Hunter T. Cooperation between oncogenes. Cell 1991; 64:
249-270.
259
54. Cohen SM. Infection, cell proliferation and malignancy. In:
Microbes and Malignacy. Oxford: Oxford University Press,
1999: 89-106.
55. DiMaio D, et al. Virocrine transformation: the intersection
between viral transforming proteins and cellular signal trans-
duction pathways. Annu Rev microbiol 1998; 52: 397-421.
56. Wilson JB, et al. Expression of EBV nuclear antigen 1 induces
B cell neoplasia in transgenic mice. EMBO J 1996; 15: 3117-
3126.
57. Murakami S. Hepatitis B virus X protein: a multifunctional vi-
ral regulator. J Gastroenterol 2001; 36 (10): 651-60.
58. Ishiji T. Molecular mechanism of carcinogenesis by HPV-16. J
Dermatol 2000; 27 (2): 73-86.
59. Philpott SM, Buehring GC. Defective DNA repair in cells with
human T-cell leukemia viruses. Role of tax-gene. J Natl Can-
cer Inst 1999; 91: 933-942.
60. Ryu WS. Molecular aspects of hepatitis B viral infection and
the viral carcinogenesis. J Biochem Mol Biol 1999; 31: 36 (1):
138-143.
61. El-Serag HB. Hepatocellular carcinoma and hepatitis C in the
United States. Virus Res 2002; 89 (2): 213-228.
62. Jmrech S, et al. Mechanisms of oncogene perturbation. In:
Oncogenes and Tumor suppressors. Oxford: Oxford University
Press, 1997: 3-32.
63. Herrero R, Monoz N. Human papillomavirus and cancer. Can-
cer Surv 1999; 33: 191-211.
64. Peto J. Cancer epidemiology in the last century and the next
decade. Nature May 2001; 17 (411): 390-395.
 ,

. , .

H OH OE
O -
.
- -
(- . -
o) - -
. -
- .
, -
-
- ,
. ,
-
, - ,
- ,
1. C
4,5. O
-


. ,
, .
-

-

(, -

, ), ,
-
. , - 6.
, . - , -
-
, -
, , ,
- , , -
2. O - 7,8.
- , , -
. ,
, ,
, , -
,
, . -
, - . -
, - , , -
,
.

261
262 OY

, - )10.
,
- , -
- -
.
, . 1 -
O
, - . ,
. - ,
, . .
( -

), , -
,
, (-
11.
, , ) -
2
( , -

-
). . -
, , - -
, ..9.
-
.
- 3
, -
(), , ,
( 4
), (-
- .

1.

()

O











O

: , : , : , : , : -
, :
: Lagiou P, Trichopoulou A, Trichopoulos D. Nutritional epidemiology of cancer: accomplishments and prospects. Proceedings of the
Nutrition Society 2002; 61: 217-222 ()
IV. 263

2.

: , : , : , : , : -
, :
: Lagiou P, Trichopoulou A, Trichopoulos D. Nutritional epidemiology of cancer: accomplishments and prospects. Proceedings of the
Nutrition Society 2002; 61: 217-222 ()

3. -

/ C E

O



(-)


(-)

: , : , : , : , : -
, :
: Lagiou P, Trichopoulou A, Trichopoulos D. Nutritional epidemiology of cancer: accomplishments and prospects. Proceedings of the
Nutrition Society 2002; 61: 217-222 ()

4. -

-
O






,

: , : , : , : , : -
, :
: Lagiou P, Trichopoulou A, Trichopoulos D. Nutritional epidemiology of cancer: accomplishments and prospects. Proceedings of the Nu-
trition Society 2002; 61: 217-222 ()
264 OY

OA OI (, )
- (, -). -
, - ,
. , -
O 1015% .
2545%. -
9 kcal
.
.
0,6 g -

.
(). O -
4 kcal -
-
. 20 , 9
,
,
-
, -
. -
. .
, , , , - O (, D, E, K) -
, , , - ,
. 11 ,
, , , - -
, , , , - . O (B, C), , -
, , . O
9 - , -
, -
. .
O , O
50% 5 6.
. -
4 kcal . - ,
(.. ), -
. . -
- ,
(, , ), -

5.

1. ( ) , , , ,
2. ( -) ,
3. 1 () , , , , ,
4. 2 () , , , ,
5. 3 ( ) , , , ,
6. 6 () , , ,
7. 12 () , , , , ,
8. , , , ,
9. C ( ) , , , ,
10. D , , ,
11. , , ,
, ,
12. , , , , , ,
, , ,

: World Health Organisation, 1998 ( )

IV. 265

6.

1. , , , ,
2. , , , ,
3. , , ,
4. , , ,
5. (), ,
6. , , ,
7. ,
8. ,
9. , , ,
10. , , ,

: World Health Organisation, 1998 ( )

-
. O - ,
, -
- (..
. O -
, ).
. O - -
,
(.. , ) (.. -
). . ,
,
. -
- ,
(, - .
), C, -
(-, , ), ,
, - -
, - 12.
( -
, , )9. . H -
-
OH OH O , -
I O OO- .
O IO -
- : ,
,
. 13.
, -
. , -
, ,
(.. ), - , -
- , ,
(.. HBV) - ,
(.. - . -
). - -
266 OY

7. -

(%)

/ 33
/ / / 31
>3
5
/ / <9
/ 6
/ 5
5

: Adami O, Day NE, Trichopoulos D, Willett WC. Primary and secondary prevention in the reduction of cancer morbidity and mortality.
European Journal of Cancer 2001; 37: S118-S127 ()

, , .
( ) - ,
PSA ( ),
- .
14. ...
7 -
- 20% 16.
, -
-
. - 17.
, -
-
(.. ), - . -
,
- /
. .

IO: I O OHO 1/10 . -
- -
- , -
. 18.
-
18%
15. H - (, , )
-
- -

- .
. ,
. - 10.000.000 19.
, -
- ..., ,
, , 1950 1996,
, ,
IV. 267

400 kg,
20. , o 33.
- .
, , (ADH3,
CYP2E1), -
, .
21.
, -
IO OH OO 34.
O A -
390.000 ,
- , -
, , -
, -
21. - -
35.
, -
, - -
, - ,
.
,
/ , - (-
- ), --
22,23. -28,36.
,
KIO O OOAO
5070%24. - O
, , . , . -
C , -, , - 37. --
25. M -
1 , ,
mol/L - 84% -
, - 38. -
, -
, . -
C, - , -
,
26-28. E , ,
, , , , -
29. 39,40. -
- , -
-
/ , - , , -
- -
30,31. - 41. To
-
, - , , -
32. 50100 -
100 kg 42,43. -
-
, . -
268 OY

, -
, , , .. -
... - ,
44,45. H - , , -
- ,
46,47. - , o , -
, 56.
- - ,
. 80% -
69 , ,

-- 54.
- ( ) - -
--, - ,
- - -
(), .
--, -
- ,
48,49. -
,
IO TOY OAO
O , - , -
(resveratrol)57,58.
4 , - 59.
-
. -
800.000900.000 - -
37. - 1,5 2,560.
, ..., -
, 50. O -
- (BMI). O -
, -
,
- 61,62.
51. -
- -
50% , - -
, . -
, C ,
-
, - 63. -
52,53. A - -
- ,
-
, 70% - -
- 64.
54. O -
- Helicobacter pylori
, -
55. . 71% -
, -
IV. 269

,
. pylori65. - -
2,9% 1.246 . pylori
7,8 - , -
, -
280 - 76-78. O
66. - -
-
. pylori. - .
. pylori
, - -
,
, - 79,80.
- -
- , -
. pylori 67, - -
68. -
,
IO TOY EO EO -
O () - 81,82.
- -
...69. -
, - ,
. , -
..., , -
70. O - .
- -
- , , -
.
To , - , ,
-
, 2,783. -
71,72. .
, 15
, 20% , -
, - - 84. -
73. -
- 85.
- -
, , - ,
74,75. E - ,
- DNA ( -
- ), -
, - DNA86,87.
, -
,
-
. - 86,88. -
,
-
, , - . -
270 OY

(Body Mass Index BMI) 99. -

, , -
- -
. 22,4, 2,4 -
86,89. 100.
... -
, 101.
, -
- ,
. (Thorotrast),
- , -
- ,
90. ,
-
KIO O HO
OO 102,
103.
O -
. O - H
,
, - , -
, 70. 80% , -
- (TCE)
37.
- 104,105.
- A -
()91. - , ,
- 106,107.
,
(HBsAg)92. O - IO O EO
- 200.000 -
. - 70. -
, -
1 - ( ) - (
100.000 ) -
1 - , 108 ( -
, - ).
1 - - To
- -
93,94. ,
M 20%
- 109,110. To
,
- ,
1 , , -
111,112.
95- , -
97.
To 1988 o O , ,
(IARC) - 113,114.
- ,
98. ,
IV. 271

. - -
O- , -
(IARC) . O -
11,2 ,
: - 23,2 , 50
38 -
, - .
- , -
. - 124. H -
115. E-

, ,
116,117. - 125. T
-
-
- -
, -
118. 126,127.
H - -
, ,
- 3 128. 5
119,120. -
- , -
- 20 -
, , 129,130.
- -
121,122. ,
- 1980131. -
, - ,
- -
( ) -
80% , -
, - 2025%132-134.
. - -
-
6% ,
123. -
. ,
KIO O YO -
O - , -
,
, -
, - , 135.
. -
, 136.
37. O - Y
-

, - 137.

. O ,
272 OY

, -
, ,
, - , (-
. - ), , , , -
, , ,
(.. - 148. O
) -
, ,
, - -
138. - 149. E -
, -
-
, , --
- , -
139. , -
- -
, , -
> 100 rad150,151.

. A IO O A
- 140.000 -
- 1990,
, 5/6 37. -
140,141. , -
, , . ,
. 70.

O
, -
,
-
152. H -
3080%140. ,
,
- -
-
, ,
-
-
140.
142.
, , -

153.
,
, , C, IO O O
-
O -
143-145. ,
- . -
, ,
..., , , , -
-
154.
146,147.
O KIO O EO
- -
. O - 155. O
510% -
, .
IV. 273

...
70. , -
. - , -
, -
. , ..., -
. , - 170.
156.
37% - KIO O OY
, , O -
, - 795.000 -
157. , , 1990
, - 172. O
- . ,
, - 70. M -
, -
, 158-160. -
,
161.
, -
-
162. 12 173,174.
- -
.
- 175.
, -
- :
,
- (.. ),
163-164.
, -
, -
165-167. H - 176.
- -
120 36 -
, - ,
, (relative risk = 1,5) -
168. - , -
- -
177,
169. 178. -
, - -
, - ,
170,171. -
, - . ,
, , -
179.
, - -
, , -
, , 5

. - 2180. -
274 OY

- 192.
, , -,
C. - - ,
,
, C, -
- , 193,194. -
-, -
181,182. -
- , -
, -
- , -
, 195.
, ,
. (isoflavones) - (DDT) -
, (PCBs).
-
183. -- -
DDT PCBs .
,
184. -
.
,
-. KIO O OY O A
-
O
40% -
, -
185.
196. -
O -
,
-

, - -
.
186. O () -

-
- -
, , -
-
187,188. - 197.

IO O HO H
189. -
- O
, , -
. O
, , , ,
, . ,
. - . , . , 37.
- -
, -
. 30, 198.
-
,
190,191. .
- 4 - uman Papilloma Virus
- (HPV)
IV. 275

199. - .
-
HPV() 200. - , -
- .
, - -
201. , - -
. , -
, - -
- -
- 207.
37,140. , -
, -
-, C , ,
- -
37,203. 208. -
-
IO O OIO 209. -
O 4% , -
- , -
, 203. O -
. - ,
70. - 210,211.
-
, , KIO O
- O -
204. -
70.
. - -
, - -
, - , -
- , -
. - , -
-
, - 14%
205. 212,213.

- -
, ,
, -
206.
214-216.
, , -
, -
, -
, 217. -
, - , -
. -
- . -
. -
- , -
, , -
276 OY

, 228.
218,219. -
-
IO O OA ,
O
- 229,
230. O -
, 70. -
, .. ...,
. , - , -
220. -
-
231,232.
221. - , ,
, -
, - , -
, -
. , -
, -
: 233,234.
, , -
, - -
-
DNA. - : ,

,
, -
235,236. ,
222-224.
H -
, .
,
- , -
, , , -
, 237.

225,226. ..., IO O
4 - O , -
,
. , -
, .
, ,
. -
227. 1525
O -
. O
, - -
, 3050%, -
. , - , -
, - , 30
- , -
70. . -
IV. 277

, 50. T , -
- 248. -
238. -
, , - , -
(, , -
, )
249. , pH ,
239. -
, -
IO OOOO Y
O DNA 250. pH -
. . -
70. - ,
.
. -

, . - ,
251.
192040, , -

-
240. . -
-
, -
. 252. -
- -
241-243. 253,254.
O H ,
, -
20 , - ,
20% -
5 . 255. -
-
20 -
241. -
O 256.

, -
, - . O -
- , ,
, , 48%
, - -
244. - 257. O , --
, - , , - 4--

245,246. -
(..
- , )258-260.
247. , - , -
, , -
, , - ,
278 OY

261. -
, -
- , , -
, 271,272.
,
. - , ...,
,
262. -
- 273.
- -
-
. O -
- 274.
, -
263,264. - -
, - 275,276. O
. ,
. E -
- .
-
110 g/l, . -
- , -
265,266. , -
.
IO O OY
2000 189.000 - 277.
, ,
2% . O - IO O AO
- O
. . , , . - . .
, . , . 70.
70. M -
M , -
, - -
- 278.
. (cured) -
-
- , -
- -, -
267,268.
-
279-283.

, - , -
- , -
, , , -
269. 284,285.
, -, -
- - ,
-
270. /
IV. 279

286.
H -
- 296,297. , -
- -
, , -
, , - , ,
287,288. E -
- , -
-
- 298.
290,291. -
- ,
291. 299,300.
H (> 20 ) -
, , -
, 292. ,
, -
IO O OOY 301,302.
O , , -
, . - -
-
1,7/100.000 / 4,7 , -
293. H - 303.
-
(screening)
- . O -
. , -
,
,
- ,
(TSH), - 1 Sv (Sievert). -
294. , - 4 Sv, -

. O -
50%, -
- -
295. , -
O - 20 304.
,
. , ,
-,
, -
- 305.
( ). , -
, - HODGKINS HODGKINS
Hodgkin (D)
Thomas Hodgkin (17981866). -
. , 8% . -
Hodgkin
, - ,
, - , -
280 OY

, ..., , O- -
..70. , 315-318.
- -
. Hodgkins (NHL), , ,
, -
, .
2,5% O -
306. , -
23 / 100.000 / 14 / 100.000 , -
...70. -
NHL 319,320. -
, 34% , - , -
307. , ,
O - -
-
Hodgkin, - -
- ,
NHL308-310. - 321,322.
- -
HD NHL
. . -
- - Gray (1 Gy =
- 100 rad),
- Sievert (1 Sv = 100 rems).
HD , -
6 - (linear energy
, transfer = LET), -
311. -, 1 Gy 1 Sv. -
- LET, .. -
, -
. , -
- ,
- 1 Sv.
HD. -
- ,
HD (LET = 1 Sv),
NHL312. . LET,
-, -
I , 323,324.
- -
, 1/3 - ,
, 313. ,
- 12 rad,
, - 325.
, , -
- -
70. - ,
326.
314. H
, - -
, , ,
IV. 281

8. 2000, -
2020

, 2000 , 2020 , 2020

25 100 60
15 100 30
/ 10 30 1020
/ 0 0 0
/ 10 20 10
0 15 5
/ 5 30 15
0 0 0
5 20 10
30 60 45
20 50 30
5 15 10
0 15 5

, -
-
. . 8
-
- -
327,328. 2000,
,
OH OH H .
O IO

O -
- 13%, -
. , - 6% (2000, -
, - ). O , 20
, - ,
. - 30% -
4% -
- 329.

1. Trichopoulos D, Petridou E. Epidemiologic Studies and Can-
cer Etiology in Humans. Med Exerc Nutr Health 1994; 3: 206-
225.
2. World Cancer Research Fund & American Institute for Can-
cer Research. Food, Nutrition and the Prevention of Cancer:
A Global Perspective. Washington, DC: American Institute
for Cancer Research, 1997.
3. World Cancer Research Fund & American Institute for Can-
cer Research. Food, Nutrition and the Prevention of Cancer:
A Global Perspective. Washington, DC: American Institute
for Cancer Research, 1997.
4. International Agency for Research on Cancer, 1994.
5. nternational Agency for Research on Cancer, 1987. Colditz
G, DeJong W, Hunter, Trichopoulos D, Willett W, eds. Har-
vard Report on Cancer Prevention, Volume 1: Causes of Hu-
man Cancer. Cancer Causes and Control 1996; 7, Suppl. 1: 1-
59.
6. Lagiou P, Trichopoulou A, Trichopoulos D. Nutritional epide-
miology of cancer: accomplishments and prosprects. Proceed-
ings of the Nutrition Society 2002; 61: 217-222.
7. Katsougiannni K, Skalkidis , Petridou E, et al. Diet and Pe-
ripheral Arterial Occlusive Disease: The role of Poly-, Mono-,
and Saturated Fatty Acids. Am J Epid 1991; 133: 24-31.
8. Petridou E, Trichopoulos D. Epidemiology and etiology of hu-
man neoplasms. Archives of Hellenic Medicine 1996; 13: 252-
273.
9. A, . . : -
, , .
282
& . 2 . : , 2000: 399- 28. World Cancer Research Fund in association with American
426.
10. Willet WC, Trichopoulos D. Nutrition and cancer: a summary
of the evidence. Cancer Causes and Control 1996; 7: 178-180.
11. Lagiou P, Trichopoulou A, Trichopoulos D. Nutritional epide-
miology of cancer: accomplisments and prospects. Proceedings
of the Nutrition Society 2002; 61: 217-222.
12. Adami HO, Day NE, Trichopoulos D, Willett WC. Primary
and secondary prevention in the reduction of cancer morbidity
and mortality. European Journal of Cancer 2001; 37: S118-
S127.
13. Harvard Center for Cancer Prevention. Harvard report on can-
cer prevention, Volume 2: Prevention of human cancer. Pre-
vention of tobacco use. Cancer Causes and Control 1997; 8
(Suppl. 1): S5-S12. Trichopoulos D, Petridou E, Lipworth L, et
al. Epidemiology of Cancer. In: DeVita VT Jr, Hellman S, Ro-
senberg SA, et al, eds. Cancer: Principles and Practice of On-
cology. 5th ed. Philadelphia: Lippincott-Raven, 1997: 231-257.
14. Trichopoulou A, Lagiou P, Kuper H, Trichopoulos D. Cancer
and Mediterranean dietary traditions. Cancer Epidemiol Bio-
markers Prev 2000; 9: 869-873.
15. Parkin DM, Bray F, Ferlay J, et al. Estimating the world can-
cer burden: GLOBOCAN 2000. Int J Cancer 2001; 94: 153-6.
16. Hankey BF, Feuer EJ, Clegg LX, et al. Cancer surveillance se-
ries: interpreting trends in prostate cancer- part I: evidence of
the effects of screening in recent prostate cancer evidence,
mortality and survival rates. J Natl Cancer Inst 1999; 91: 1017-
24.
17. Burton EC, Troxclair DA, Newman WP. Autopsy diagnoses of
malignant neoplasms. JAMA 1998; 280: 1245-48.
18. Murray CJL, Lopez AD, eds. The Global Burden of Disease.
Cambridge, MA: Harvard University Press, 1996a.
19. Greenlee RT, Murray T, Bolden S, Wingo PA. Cancer stati-
stics, 2000. CA Cancer J Clin 2000; 50: 7-33.
20. Bailar JC 3rd, Gornik HL. Cancer undefeated. N Engl J Med
1997; 336: 1569-74.
21. Ferlay J, Bray F, Pisani P, et al. GLOBOCAN 2000: Cancer
Incidence, Mortality and Precalence Worldwide. International
Agency for Research on Cancer, 2001.
22. Muscat JE, Richie JP Jr, Thomson S, et al. Gender differences
in smoking and risk for oral cancer. Cancer Res 1996; 56:
5192-7.
23. Blot WJ, Mc Laughlin JK, Winn DM, et al. Smoking and drin-
king in relation to oral and pharyngeal cancer. Cancer Res
1988; 48: 3282-7.
24. De Stefani E, Deneo-Pelegrini H, Mendilaharsu M, et al. Diet
and risk of cancer of the upper aeredigestive tract-I. Foods.
Oral Oncol 1999; 35: 17-21.
25. La Vecchia C, Tavani A, Franceschi S, et al. Epidemiology and
prevention of oral cancer. Oral Oncol 1997; 33: 302-12.
26. Nagao T, Ikeda N, Warnakulasuriya S, et al. Serum antioxi-
dant micronutritients and the risk of oral leukoplakia among
Japanese. Oral Oncol 2000; 36: 466-70.
27. Sawant SS, Kandrkar SV. Role of Vitamins C and E as chemo-
preventive agents in the hamster cheek pouch treated with oral
carcinogen- DMBA. Oral Dis 2000; 6: 241-7.
OY
Institute for Cancer Research. Food, Nutrition and the Pre-
vention of Cancer: A Global Perspective. Washington, DC: A-
merican Institute for Cancer Research, 1997: 96-106.
29. Soler M, Bosetti C, Franceschi S, et al. Fiber intake and the
risk of oral, pharyngeal and esophageal cancer. Int J Cancer
2001; 91: 283-7.
30. Franceschi S, Favero A, Conti E, et al. Food groups oils and
butter, and Cancer of the oral cavity and pharynx. Br J Cancer
1999a; 80: 614-20. Francsceschi S, Levi F, Conti E, et al. Ener-
gy intake and dietary pattern in cancer of the oral cavity and
pharynx. Cancer Causes Control 1999b; 10: 439-44.
31. Petridou E, Zavras A, Lefatzis D, et al. The Role of Diet and
Specific Micronutritients in the Etiology of Oral Carcinoma.
Cancer 2002; 94: 2981-88.
32. Horn-Ross PL, Morrow M, Ljung BM. Diet and the risk of sa-
livary gland cancer. Am J Jepidemiol 1997; 146: 171-6.
33. Franco EL, Kowalski LP, Oliveira BV, Curado MP, et al. Risk
factors for oral cancer in Brazil: a case-control study. Int J
Cancer 1989; 43: 992-1000.
34. Dong YJ, Peng TK, Yin SJ. Expression and activities of alco-
hol dehydrogenase in human mouth. Alcohol 1996; 13: 257-62.
35. Wight A, Ogden GR. Possible mechanisms by which alcohol
may influence the development of oral cancer a review. Oral
Oncol 1998; 34: 441-7.
36. Yu MC. Diet and nasopharyngeal carcinoma. FEMS Micro-
biol Immunol 1990; 2: 235-42.
37. Parkin M, Pizani P, Ferlay J. Estimates of the worldwide inci-
dence of 25 major cancers in 1990. Int J Cancer 1999; 80: 827-
41.
38. , . -
. : , ,
. & . 2 .
: , 2000: 137.
39. Launoy G, Milan CH, Faivre J, et al. Alcohol, tobacco and oe-
sophageal cancer: effects of the duration of consumption mean
intake and current and former consumption. Br J J Cancer
1997; 75: 1389-96.
40. Lagergren J, Bergstrm R, Lindgren, et al. The role of tobac-
co, snuff and alcohol use in the aetiology of cancer of the oeso-
phagus and gastric cardia. Int J Cancer 2000a; 85: 340-6.
41. Castellsque X, Munoz N, De Stefani E, et al. Independent and
joint effects of tobacco in men and women. Int J Cancer 1999;
82: 657-64.
42. Brown LM, Hoover RN, Greenberg RS, et al. Are racial deffe-
rences in squamous cell esophageal cancer explained by alco-
hol and tobacco use? J Natl Cancer Inst 1994; 86: 1340-5.
43. Zambon P, Talamini R, La Vecchia C, et al. Smoking, type of
alcoholic beverage and squamous-cell esophageal cancer in
northern Italy. Int J Cancer 2000; 86: 144-9.
44. Gammon MD, Schoenberg JB, Ahsan H, et al. Tobacco, alco-
hol and socioeconomic status and adenocarcinomas of the eso-
phagus and gastric cardia. J Natl Cancer Inst 1997; 89: 1277-
84.
45. Lagergren J, Bergstrm R, Lindgren A, et al. The role of to-
bacco, snuff and alcohol use in the aetiology of cancer of the
oesophagus and gastric cardia. Int J Cancer 2000a; 85340-6.
IV.
46. Jaskiewicz K, Marasas WF, Lazarus C, et al. Association of
esophageal cytological abnormalities with vitamin and lipotro-
pe deficiences in populations at risk for esophageal cancer.
Anticancer Res 1988; 8: 711-15.
47. Cheng KK, Day NE. Nutrition and esophageal cancer. Cancer
Causes Control 1996; 7: 33-40.
48. Wu Y, Chen J, Ohshima H, et al. Geographic association bet-
ween urinary excretion of N-nitroso compouds and oesopha-
geal cancer mortality in China. Int J Cancer 1993; 54: 713-19.
49. Cheng KK, Day NE, Duffy SW, et al. Pickled vegetables in the
aetiology of oesophageal cancer in Hong Kong Chinese. Lan-
cet 1992; 339: 1314-18.
50. Parkin DM, Whelan SL, Ferlay J, et al. Cancer Incidence in
five Continents. Vol. VII. Lyon: International Agency for Re-
search on Cancer, 1997.
51. Mirvish SS. The etiology of gastric cancer. Intragastric nitrosa-
mide formation and other theories. J Natl Cancer Inst 1983;
71: 629-647.
52. Steinmetz KA, Potter JD. Vegetables, fruit and cancer preven-
tion: a review. J Am Diet Assoc 1996; 96: 1027-39.
53. Terry P, Lagergren J, Ye W, et al. Inverse association between
intake of cereal fiber and risk of gastric cardia cancer. Gastro-
enterology 2001; 120: 387-91.
54. Nyrn O, Adami HO. Stomach cancer. In: Adami HO, Hunter
D, Trichopoulos D. Textbook of Cancer Epidemiology. New
York: Oxford University Press, 2002: 173-174.
55. Kono S, Hirohata T. Nutrition and stomach cancer. Cancer
Causes Control 1996; 7: 41-55.
56. RC Working Group on the Evaluation of Carcinogenic
Risks to Humans. Some natural occurring substances: food
items and constituents, heterocyclic aromatic amines and my-
cotoxins. IARC Monogr Eval Carcinog Risk Chen Hum 1993;
56: 165-95.
57. Franceschi S, La Vecchia C. Alcohol and the risk of cancers of
the stomach and colon- rectum. Dig Dis 1994; 12: 276-89.
58. Ye W, Ekstrm AM, Hansson LE, et al. Tobacco, alcohol and
the risk of gastric cancer by sub-site snd histologic type. Int J
Cancer 1999; 83: 223-9.
59. Lopez-Carrillo L, Lopez-Cervantes M, Ramirez-Espitia A, et
al. Alcohol consumption and gastric cancer in Mexico. Cad
Saude Publica 1998; 14: 25-32.
60. Tredaniel J, Bofetta P, Buiatti E, et al. Tobacco smoking and
gastric cancer: review and meta-analysis. Int J Cancer 1997; 72:
565-73.
61. Hansson LE, Baron J, Nyrn O, et al. Early-life risk indicators
of gastric cancer. A population-based case-control study in Swee-
den. Int J Cancer 1994; 57: 32-7.
62. Lagergren J, Bergstrm R, Nyrn O. Association between bo-
dy mass and adenocarcinoma of the esophagus and gastric car-
dia. Ann Intern Med 1999b; 130: 883-90.
63. Nakamura K. Stomach cancer in atomic-bomb survivors. Lan-
cet 1977; 2: 866-7.
64. Darby SC, Radford EP, Whitley E. Radon exposure and can-
cers other than lung cancer in Swedish iron miners. Environ
Health Perspect 1995; 103 Suppl 2: 45-7.
65. Ekstrm AM, Held M, Hansson LE, et al. Helicobacter pylori
283
in gastric cancer established by CagA Immunoblot as a marker
of past infection. Gastroenterology 2001; 121: 784-9.
66. Uemura N, Olamoto S, Yamamoto S, et al. Helicobacter pylo-
ri infection and the development of gastric cancer. N Engl J
Med 2001; 345: 784-9.
67. Ekstrm AM, Held M, Hansson LE, et al. Helicobacter pylori
in gastric cancer established by CagA Immunoblot as a marker
of past infection. Gastroenterology 2001; 121: 784-9.
68. Correa P, Fontham ET, Bravo JC, et al. Chemoprevention of
gastric dysplasia: randomized trial of antioxidant supplements
and anti-Helicobacter pylori therapy. J Natl Cancer Inst 2000;
92: 1881-8.
69. American Cancer Society, 2001.
70. Ferlay J, Bray F, Pisani P, Parkin DM. GLOBOCAN 2000:
Cancer Incidence, Mortality and Prevalence Worldwide, Ver-
sion 1.0. IARC CancerBase No. 5. Lyon: International Agency
for Research on Cancer, 2001.
71. Giovannucci E, Rimm EB, Stampfer MJ, et al. A prospective
study of cigarette smoking and the risk of colorectal adenoma
and colorectal in U.S. men. J Natl Cancer Inst 1994a; 86: 183-
91.
72. Tavani A, Gallus, Negri E, et al. Cigarette smoking and risk of
cancers of the colon and rectum: a case-control study from
Italy. Eur J Epidemiol 1998; 14: 675-81.
73. Potter JD. Colorectal cancer: molecules and populations. J
Natl Cancer Inst 1999; 91: 916-32.
74. Potter JD, Slattery ML, Bostik RM, et al. Colon cancer: review
of the epidemiology. Epidemiol Rev 1993; 15: 499-545.
75. Howe GR, Benito E, Castellato, et al. Dietary intake of fiber
and dicreased risk of cancers of the colon and rectum: eviden-
ce from the combined analysis of 13 case-control studies. J
Natl Cancer Inst 1992; 84: 1887-96.
76. Giovannucci E, Stampfer MJ, Colditz G, et al. Relationship of
diet to risk of colorectal adenoma in men. J Natl Cancer Inst
1992; 84: 91-8.
77. Mac Lennan R, Macrae F, Bain C, et al. Randomized trial of
intake of fat, fiber, and beta carotene to prevent colorectal a-
denomas. J Natl Canc Inst 1995; 87: 1760-6.
78. Schatzkin A, Lanza E, Corle D, et al. Lack of a low-fat, high-
fiber diet on the recurrence of colorectal adenomas. Polyp Pre-
vention Trial Study Group. N Engl Med 2000; 342: 1149-55.
79. White E, Shonnon JS, Patterson RE. Relation between vita-
min and calcium supplement use and colon cancer. Cancer E-
pidemiol Biomarkers Prev 1997; 6: 769-74.
80. Whelan RL, Horvath KD, Gleason NR, et al. Vitamin and cal-
cium supplument use in associated with decreased adenoma
recurrence in patients with a previous history of neoplasia. Dis
Colon Rectum 1999; 42: 212-17.
81. Willet WC, Stampfer MJ, Colditz GA, et al. Relation of meat
fat and fiber intake to the risk of colon cancer in a prospective
study among women. N Engl J Med 1990; 323: 1664-72.
82. John D, Potter Hunter D. Colorectal cancer. n: Adami HO,
Hunter D, Trichopoulos D. Textbook of Cancer Epidemiolo-
gy. New York: Oxford University Press, 2002: 199.
83. Gerhardsson de Verdier M, Hagman U, et al. Meat, cooking
methods and colorectal cancer: a case-referent study in Stock-
holm. Int J Cancer 1991; 49: 520-25.
284
84. Baron JA, Beach M, Mandel JS, et al. Calcium supplements
for the prevention of colorectal adenomas. Calcium Polyp Pre-
vention Study Group. N Engl J Med 1999; 340: 101-7.
85. Bostick RM, Fosdick L, Wood JR, et al. Calcium and colore-
ctal erithelial cell proliferation in sporadic adenoma patients: a
randomized, double-blinded, placebo-controlled clinical trial.
J Natl Cancer Inst 1995; 7: 1307-15.
86. WCRF Panel (Potter JD, Chair). Diet, Nutrition, and the Pre-
vention of Cancer: A Global Perspective. World Cancer Re-
search Fund/American Institute for Cancer Research. Wa-
shington, DC, 1997, chapter 4.10.
87. Farinati F, Espina N, Lieber CS, et al. In vivo inhibition by
chronic ethanol exposure of methylguanine transferase activity
and DNA repair. Ital J Gastroenterol 1985; 17: 48-9.
88. Potter JD, Slattery ML, Bostick RM, et al. Colon Cancer: a re-
view of epidemiology. Epidemiol Rev 1993; 15: 499-545.
89. Mckeown-Eyssen G. Epidemiology of colorectal cancer revi-
seted: are serum triglycerides and/or plasma glucose associated
with risk? Cancer Epidemiol Biomarkers Prev 1994; 3: 687-95.
90. Slattery ML, Pottery JD, Curtin K, et al. Energy balance and
colon cancer-beyond physical activity. Cancer Res 1997a; 57:
75-80.
91. Austin H. The role of tobacco use and alcohol consumption in
the etiology of hepatocellular carcinoma. In: Tabor E, Di Bis-
ceglie AM, Purcell RH, eds. Etiology, Pathology, and Treat-
ment of Hepatocellular Carcinoma in North America. Vol. 13.
Houston: Advances in Applied Biotechnology Series, 1991: 57-
75.
92. Trichopoulos D, Mac Mahon B, Sparros L, et al. Smoking and
hepatitis B-negative primary hepatocellular carcinoma. J Natl
Cancer Inst 1980; 65: 111-14.
93. Harpel PC. Protease inhibitors: A precarious balance. New
Engl J Med 1983; 309: 725-26.
94. Petridou E, Chapuis-Cellier C, Roukas K, et al. Tobacco Smok-
ing and Other Factors in Relation to Serum Alpha-1-Anti-
trypsin. Human Biology 1993; 65: 425-32.
95. Yeh F-S, Yu MC, Mo C-C, et al. Hepatitis B virus, aflatoxins,
and hepatocellular carcinoma in Southern Guangxi, China.
Cancer Res 1989; 49: 2506-9.
96. Ross PK, Yuan JM, Yu MC, et al. Urinary aflatoxin biomar-
kers and risk of hepatocellular carcinoma. Lancet 1992; 339:
943-6.
97. Srivatanakul P, Parkin DM, Khlat M, et al. Liver cancer in
Thailand, II. A case-control study of hepatocellular carcinoma.
Int J Cancer 1991; 48: 329-32.
98. International Agency for Research on Cancer. Alcohol Drink-
ing. IARC Monogr Ecal Carcinog Risk Humans. Vol. 44. Lyon:
IARC, 1988.
99. Adami HO, Hsing AW, McLaughlin JK, et al. Alcoholism and
liver chirrhosis in the etiology of primary liver cancer. Int J
Cancer 1992; 51: 898-902.
100. Kuper H, Ye W, Broom U, et al. The risk of liver and bile
duct cancer in patients with chronic viral hepatitis, alcoho-
lism, or cirrhosis. Hepatology 2001; 34: 714-8.
101. Kuper H, Tzonou A, Kaklamani E, et al. Tobacco smoking,
alcohol consumption, and their interactions in the causation
of the hepatocellular carcinoma. Int J Cancer 2000b; 85: 498-
OY
502.
102. International Agency for Research on Cancer. Overall Eva-
luations of Carcinogenity: An Updating of IARC Monographs
1-42. IARC Monogr Ecal Carcinog Risk Humans. Suppl 7.
Lyon: IARC, 1987.
103. Thompson DE, Mabuchi K, Ron E, et al. Cancer incidence in
atomic bomb survivors. Part II: solid tumors, 1958-1987. Ra-
diat Res 1994; 137: 517-67.
104. Chen CJ, Yu MW, Liaw YF, et al. Epidemiological characte-
ristics and risk factors of hepatocellular carcinoma. J Gastro-
enterol Hepatol 1997; 12(Suppl): S294-308.
105. Wartenberg D, Reyner D, Scott CS. Trichloroethylene and
cancer: epidemiologic evidence. Environ Health Perspect 2000;
108: 161-76.
106. Zatonksi WA, Lowenfels AB, Boyle P, et al. Epidemiologic
aspects of gallbladder cancer: a case-control study of the
SEARCH Program of the International Agency for Research
on Cancer. J Natl Cancer Inst 1997; 89: 1132-8.
107. World Cancer Research Fund, Food, Nutrition and the Pre-
vention of Cancer: a Global Perspective. Washington, DC: A-
merican Institute for Cancer Research, 1997.
108. Ekbom A, Hunter D. Pancreatic Cancer. In: Adami O, Hun-
ter D, Trichopoulos D. Textbook of Cancer Epidemiology.
New York: Oxford University Press, 2000: 234.
109. Boyle P, Maisonneuve P, Bueno de Mesquita B, et al. Ciga-
rette smoking and pancreas cancer: a case control study of the
search programme of the IARC. Int J Cancer 1996; 67: 63-71.
110. Fernadez E, La Vecchia C, Decarli A. Attributable risks for
pancreatic cancer in northern Italy. Cancer Epidemiol Bio-
markers Prev 1996; 5: 23-7.
111. Hecht SS, Carmell SG, Foiles PG, et al. Tobacco-specific ni-
trosamine adducts: studies in laboratory animals and humans.
Environ Health Perspect 1993; 99: 57-63.
112. Rivenson A, Hoffmann D, Prokopczyk B, et al. Induction of
lung and exocrine pancreas tumors in F344 rats by tobacco-
specific and Areca-derived N-nitrosamines. Cancer Res 1988;
48: 6912-17.
113. Howe GR, Burch JD. Nutrition and pancreatic cancer. Can-
cer Causes Control 1996; 7: 69-82.
114. Giovannucci E. Tomatoes, tomato-based products, lycopene,
and cancer: review of the epidemiologic leterature. J Natl Can-
cer Inst 1999; 91: 317-31.
115. Gordis L. Consumption of methylxanthine-containing bevera-
ges and the risk of pancreatic cancer. Cancer Lett 1990; 52: 1-
12.
116. Alcohol and pancreatic cancer in blacks and whites in the
United States. Cancer Res 1995; 55: 4899-905.
117. Farrow DC, Davis S. Risk of pancreatic cancer in relation to
medical history and the use of tobacco, alcohol and coffee. Int
J Cancer 1990b; 45: 816-20.
118. Veenstra J, Sckenkel JA, Van Erp- Baart AM, et al. Alcohol
consumption in relation to food intake and smoking habits in
the Dutch National Food Consumption Survey. Eur J Clin
Nutr 1993; 47: 482-9.
119. Friedman GD, van den Eeden SK. Risk factors for pancreatic
cancer: an exploratory study. Int J Epidemiol 1993; 22: 30-7.
IV.
120. Kalapathaki V, Tzonou A, Hsieh CC, et al. Tobacco, ethanol,
coffee, pancreatitis, diabetes mellitus, and cholelithiasis as
risk factors for pancreatic carcinoma. Cancer Causes Control
1993; 4: 375-82.
121. Matanoski GM, Seltser R, Sartwell PE, et al. The current
mortality rates of radiologists and other physician specialists:
specific causes of death. Am J Epidemiol 1975; 101: 199-210.
122. Smith PG, Doll R. Mortality from cancer and all causes
among British radiologists. Br J Radiol 1981; 54: 187-94.
123. Ojajarvi IA, Partanen TJ, Ahlbom A, et al. Occupational ex-
posures and pancreatic cancer: a meta-analysis. Occup Envi-
ron Med 2000; 57: 316-24.
124. Boffetta P, Pershagen G, Jckel KH, et al. Cigar and pipe
smoking and lung cancer risk: a multicenter study from Euro-
pe. J Natl Cancer Inst 1999; 91: 697-701.
125. Doll R, Peto R. Cigarette smoking and bronchial carcinoma:
dose and time relationships among regular smokers and life-
long non-smokers. J Epidemiol Commun Health 1978; 32:
303-313.
126. Wynder EL, Kabat GC. The effect of low-yield cigarette
smoking on lung cancer risk. Cancer 1988; 62: 1223-30.
127. Lubin JH, Blot WJ, Berrino F, et al. Patterns of lung cancer
risk according to type of cigarette smoked. Int J Cancer 1984;
33: 569-76.
128. Lubin JH, Blot WJ, Berrino F, et al. Patterns of lung cancer
risk according to type of cigarette smoked. Int J Cancer 1984;
33: 569-76.
129. Doll R, Peto R. Cigarette smoking and bronchial carcinoma:
dose and time relationships among regular smokers and life-
long non-smokers. J Epidemiol Commun Health 1978; 32:
303-313.
130. Hammond EC. Smoking in relation to the death rates of one
million men and women. Natl Cancer Inst Monogr 1966; 19:
127-204.
131. Trichopoulos D, Kalandidi A, Sparros L, MacMahon B. Lung
cancer and passive smoking. Int J Cancer 1981; 27: 1-4.
132. alandidi A, Katsouyanni K, Voropoulou N, et al. Passive
smoking and diet in the etiology of lung cancer among non-
smokers. Cancer Causes Control 1990; 1: 15-21.
133. Blot WJ, McLaughlin JK. Passive smoking and lung cancer
risk: what is the story now? J Natl Cancer Inst 1998; 90: 1416-
17.
134. Boffetta P, Agudo A, Ahrens W, et al. Multicenter case-con-
trol study of exposure to environmental tobacco smoke and
lung cancer in Europe. J Natl Cancer Inst 1998; 90: 1440-50.
135. Fang JL, Vaca CE. Detection of DNA adducts of acetaldeyde
in peripheral white blood cells of alcohol abusers. Carcinoge-
nesis 1997; 18: 627-32.
136. Adami HO, McLaughlin JK, Hsing AW, et al. Alcoholism and
cancer risk: a population-based cohort study. Cancer Causes
Control 1992; 3: 419-25.
137. Katsouyanni K, Pershagen G. Ambient air pollution exposure
and cancer. Cancer Causes Control 1997; 8: 284-91.
138. Nyberg F, Gustavsson P, Jarup L, et al. Urban air pollution
and lung cancer in Stockholm. Epidemiology 2000; 11: 487-95.
139. Smith KR, Liu Y. Indoor air pollution in developing coun-
285
tries. In: Samet JM, ed. Epidemiology of Lung Cancer. Lung
Biology in Health and Disease. Vol. 74. New York: Marcel
Dekker, 1994: 151-84.
140. World Cancer Research Fund. Lung. In: Food, Nutrition and
the Prevention of Cancer: a Global Perspective (Part II, Can-
cers, Nutrition and Food). Washington, DC: American Insti-
tute for Cancer Research, 1997: 130-47.
141. International Agency for Research on Cancer. Vitamin A.
IARC Handbooks of Cancer Prevention. Vol. 3. Lyon: IARC,
1998b.
142. Lotan R. Lung cancer promotion by beta carotene and tobac-
co smoke: relationship to suppression of retinoic acid recep-
tor-beta and increased activator protein-1? J Natl Cancer Inst
1999; 91: 7-9.
143. Garcia-Closas R, Agudo A, Gonzalez CA, et al. Intake of spe-
cific carotenoids and flavonoids and the risk of lung cancer in
women in Barcelona, Spain. Nutr Cancer 1998; 32: 154-8.
144. Knekt P, Jarvinen R, Seppanen R, et al. Dietary flavonoids
and the risk of lung cancer and other malignant neoplasms.
Am J Epidemiol 1997; 146: 223-30.
145. Zhou B, Wang T, Sun G, et al. A case-control study of the re-
lationship between dietary factors and risk of lung cancer in
women of Shenyang, China. Oncol Rep 1999; 6: 139-43.
146. Sinha R, Kulldorff M, Curtin J, et al. Fried, well-done red
meat and risk of lung cancer in women (United States). Can-
cer Causes Control 1998; 9: 621-30.
147. Swanson CA, Brown CC, Brownson RC, et al. Re: Saturated
fat intake and lung cancer risk among nonsmoking women in
Missuri. J Natl Cancer Inst 1997; 89: 1724-5.
148. International Agency for Research on Cancer Monographs,
Vols. 1-77 (IARC, 1972-2001).
149. Hughes JM, Weill H. Asbestos and man-made fibers. In: Sa-
met JM, ed. Epidemiology of Lung Cancer. Lung Biology in
Health and Disease, Vol. 74. New York: Marcel Dekker, 1994:
185-205.
150. Lubin JH, Boice JD, Edling C, et al. Radon and lung cancer
risk: a joint analysis of 11 underground miner studies. In: Pu-
blic Health Service and National Institute of Health, eds. NIH
Pub. No. 94-3644. Washington, DC: U.S. Department of
Health and Human Services, 1994.
151. Boice DJ Jr, Land CE, Preston DL. Ionizing radiation. In:
Schottenfeld D, Fraumeni JF Jr, eds. Cancer Epidemiology
and Prevention. 2nd ed. New York: Oxford University Press,
1996: 319-54.
152. Austin DF, Reynolds P. Laryngeal cancer. In: Schottenfeld D,
Fraumeni JF Jr, eds. Cancer Epidemiology and Prevention.
2nd ed. New York: Oxford University Press, 1996: 619-36.
153. nternational Agency for Research on Cancer. Occupational
exposures to mists and vapours from sulfuric acid and other
strong inorganic acids. In: Occupational Exposures to Mists
and Vapours from Strong Inorganic Acids and Other Indu-
strial Chemicals. IARC Monographs on the Evaluation of
Carcinogenic Riskw to Humans. Vol. 54. Lyon: IARC, 1992:
41-119.
154. Peto J, Hodgson JT, Matthews FE, et al. Cantinuing increase
in mesothelioma mortality in Britain. Lancet 1995; 345: 535-9.
155. International Agency for Research on Cancer. IARC Mono-
286
graphs on the Evaluation of Carcinogenic Risks to Humans.
Vol. 55, Solar and Ultraviolet Radiation. Lyon: IARC, 1992.
156. Whiteman DC, Green AC. Melanoma and sun exposure: where
are we now? Int J Dermatol 1999; 38: 481-9.
157. Armstrong BK, Kricker A. Cutaneous melanoma. Cancer Surv
1994; 19-20: 219-40.
158. Hunter DH, Golditz G, Stampfer M, et al. Risk factors for
basal cell carcinoma in a prospective cohort of women. Ann
Epidemiol 1990; 1: 13-23.
159. van Dam RM, Huang Z, Rimm EB, et al. Risk factors for ba-
sal cell carcinoma of the skin in men: results from the health
professionals follow-up study. Am J Epidemiol 1999; 50: 459-
68.
160. Moore S, Johnson N, Pierce A, et al. The epidemiology of lip
cancer: a review of global incidence and etiology. Oral Dis
1999; 5: 185-95.
161. Green A, Bain C, McLennan R, et al. Risk factors for cuta-
neous melanoma in Queensland. Recent Results Cancer Res
1986; 102: 76-97.
162. Green A, Trichopoulos D. Skin Cancer. In: Adami O, Hunter
D, Trichopoulos D. Textbook of Cancer Epidemiology. New
York: Oxford University Press; 2000: 288.
163. Sahl W, Glore S. Basal cell carcinoma and lifestyle characteri-
stics. Int J Dermatol 1995; 34: 398-402.
164. Ringborg U. Alcohol and risk of cancer. Alcohol Clin Exp
Res 1988; 22: 3235-3285.
165. Whiteman DC, Green AC. Melanomas and sun exposure:
where are we now? Int J Dermatol 1999; 38: 481-9.
166. Armstrong BK. Epidemiology of malignant melanoma: inter-
mittent or total accumulated exposure to the sun. J Dermatol
Surg Oncol 1988; 14: 835-49.
167. Elwood JM, Jopson J. Melanoma and sun exposure: an over-
view of published studies. Int J Cancer 1997; 73: 198-203.
168. Franceschi S, Levi F, Randimbison L, et al. Site distribution
of different types of skin cancer: new etiological clues. Int J
Cancer 1996; 67: 24-8.
169. English DR, Armstrong BK, Kricker A. Case- control study of
sun exposure and SCC of the skin. Int J Cancer 1998; 77: 347-
53.
170. Rosso S, Zanetti R, Martinez C, et al. The multicentre south
European study Helios II: different sun exposure patterns in
the etiology of basal cell and squamous cell carcinomas of the
skin. Br J Cancer 1996; 73: 1447-54.
171. Elwood JM, Jopson J. Melanoma and sun exposure: an over-
view of published studies. Int J Cancer 1997; 73: 198-203.
172. Parkin DM. The global burden of Cancer. Semin Cancer Biol
1998; 8: 219-35.
173. Tominaga S. Cancer incidence in Japanese in Japan, Hawaii,
and western United States. Natl Cancer Inst Monogr 1985;
69: 83-92.
174. Ziegler RG, Hoover RN, Pike MC, et al. Migration patterns
and breast cancer risk in Asian-American women. J Natl Can-
cer Inst 1993; 85: 1819-27.
175. Lalen F, Hunter DJ. Enviromental risk factors and female
breast cancer. Annu Rev Public Health 1998; 19: 101-23.
176. Hankinson S, Hunter D. Breast Cancer. In: Adami HO, Hun-
OY
ter D, Trichopoulos D. Textbook of Cancer Epidemiology.
New York: Oxford University Press, 2002: 309.
177. Howe GR, Hirohata T, Hislop TG, et al. Dietary factors and
risk of breast cancer: combined analysis of 12 case-control
studies. J Natl Cancer Inst 1990; 82: 561-9.
178. Hunter DJ, Spiegelman D, Adami HO, et al. Cohort studies
of fat intake and the risk of breast cancer- a pooled analysis.
N Engl J Med 1996; 334: 356-61.
179. Willet WC, Rockhill B, Hankinson SE, et al. Non-genetic fa-
ctors in the causation of breast cancer. In: Harris J, Lippman
ME, Morrow M, Osborne CK, eds. Diseases of the Breast.
Philadelphia: Lippincott-Raven Press, 2000: 175-220.
180. Zhang S, Hunter DJ, Forman MR, et al. Dietary carotenoids
and vitamins A, C and E and risk of breast cancer. J Natl Can-
cer Inst 1999a; 91: 547-56.
181. Hunter DJ, Willet WC. Diet, body size, and breast cancer. E-
pidemiol Rev 1993; 15: 110-32.
182. Howe GR, Hirohata T, Hislop TG, et al. Dietary factors and
risk of breast cancer: combined analysis of 12 case-control
studies. J Natl Cancer Inst 1990; 82: 561-9.
183. Fournier DB, Erdman JW Jr, Gordon GB. Soy, its compo-
nents, and cancer prevention: a review of the in vitro, animal,
and human data. Cancer Epidemiol Biomarkers Prev 1998; 7:
1055-65.
184. Wu AH, Ziegler RG, Nomura AM, et al. Soy intake and risk
of breast cancer in Asians and Asian Americans. Am J Clin
Nutr 1998; 68: 1437S-1443S.
185. Longnecker MP. Alcoholic beverage consumption in relation
to risk of breast cancer: meta-analysis and review. Cancer Cau-
ses Control 1994; 5: 73-82.
186. Height and weight in relation to breast cancer morbidity and
mortality. A prospective study of 570,000 women in Norway.
Int J Cancer 1989; 44: 23-30.
187. Ursin G, Longnecker MP, Haile RW, et al. A meta-analysis of
body mass index and risk of prememopausal breast cancer.
Epidemiology 1995; 6: 137-41.
188. Hunter DJ, Willet WC. Diet, body size and breast cancer. E-
pidemiol Rev 1993; 15: 110-32.
189. Huang Z, Willet WC, Colditz GA, et al. Dual effects of
weight and weight gain on breast cancer risk. JAMA 1997;
278: 1407-11.
190. Petridou E, Syrigou E, Toupadaki N, et al. Determinants of
age at menarche as early life predictors of breast cancer risk.
Int J Cancer 1996; 68: 193-98.
191. Adami HO, Adams G, Boyle, et al. Chapter II: breast cancer
etiology. Int J Cancer 1990; 55:22-39.
192. Bernstein L, Henderson BE, Hanisch R, et al. Physical exerci-
se and reduced risk of breast cancer on young women. J Natl
Cancer Inst 1994; 86: 1403-8.
193. Wolff MS, Collman GW, Barrett JC, et al. Breast cancer and
enviromental risk factors: epidemiological and experimental
findings. Annu Rev Pharmacol Toxicol 1996; 36: 573-96.
194. Davis DL, Axelrod D, Bailey L, et al. Rethinking breast can-
cer risk and the environment: the case for the precautionary
principle. Environ Health Perspect 1998; 106: 523-9.
195. Laden F, Hunter DJ. Enviromental risk factors and female
IV.
breast cancer. Annu Rev Public Health 1998; 19: 101-23.
196. wertz M, Holmberg L, Karjalainen S, et al. Incidence of ma-
le breast cancer in Scandinavia, 1943-1982. Int J Cancer 1989;
43: 27-31.
197. Petridou E, Giokas G, Kuper H, et al. ndocrine correlates of
male breast cancer risk: a case-control study in Athens, Gree-
ce. Britist Journal of Cancer 2000; 83: 1234-37.
198. Beral V, Hemon C, Muoz N, et al. Cervical cancer. In: Doll
R, Fraumeni JF, Muir CS, eds. Trends in Cancer Incidence
and Mortality. New York: Cold Spring Harbor Laboratory
Press, 1994: 265-85.
199. zur Hausen H. Human genital cancer: synergism between two
virus infections or synergism between a virus infection and
initiating events? Lancet 1982; 2: 1370.
200. Eluf-Neto J, Booth M, Muoz N, et al. Human papilomavirus
and invasive cervical cancer in Brazil. Br J Cancer 1994; 69:
114-19.
201. Wilkelstein W, Jr. Smoking and cervical cancer-current sta-
tus: a review. Am J Epidemiol 1990; 131: 945-57.
202. Potischman N, Brinton LA. Nutrition and cervical neoplasia.
Cancer Causes Control 1996; 7: 113-26.
203. Parkin DM. Epidemiology of cancer: global patterns and
trends. Toxicol Lett 1998; 102-103: 227-34.
204. Waterhouse J, Muir C, Correa P. Cancer Incidence in Five
Continents. IARC Sci Pub. No. 143. Lyon: International A-
gency for Research on cancer, 1992: 120.
205. Grady D, Gebretsadik T, Kerlikowshe K, et al. Hormone re-
placement therapy and endometrial cancer risk: a meta-analy-
sis. Obstet Gynecol 1995; 85: 304-13.
206. Goodman MT, Wilkens LR, Hankin JH, et al. Diet, body size,
physical activity, and the risk of endometrial cancer. Cancer
Res 1997a; 57: 5077-85.
207. Swanson CA, Potischman N, Wilbanks GD, et al. Relation of
endometrial cancer risk to past, contemporary body size and
body fat distribution. Cancer Epidemiol Biomarkers Prev 1993;
2: 321-7.
208. Mac Donald PC, Edman CD, Hansell DL, et al. Effect of obe-
sity in conversion of plasma androstenedione to estrone in
postmenopausal women with and without endometrial cancer.
Am J Obstet Gynecol 1978; 30: 448-55.
209. Key TJ, Pike MC. The dose-effect relationship between un-
opposed estrogens and endometrial mitotic rate: its central
role in explaining and predicting endometrial cancer risk. Br J
Cancer 1988; 57: 205-12.
210. Sturgeon SR, Brinton LA, Berman ML, et al. Past and pre-
sent physical activity and endometrial cancer risk. Br J Cancer
1993; 68: 584-9.
211. Moradi T, Nyrn O, Bergstrom R, et al. Risk for endometrial
cancer in relation to occupational physical activity: a nation-
wide cohort study in Sweden. Int J Cancer 1998; 76: 665-70.
212. Booth M, Beral V, Smith P. Risk factors for ovarian cancer: a
case-control study. Br J Cancer 1989; 59: 92-6.
213. Lagiou P, Ye W, Wedren S, et al. Incidence of ovarian cancer
among alcoholic women: a cohort study in Sweden. Int J Can-
cer 2001; 91: 264-6.
214. Shu Xo, Gao YT, Yuan JM, et al. Dietary factors and epithe-
287
lial ovarian cancer. Br J Cancer 1989; 59: 92-6.
215. Steinmetz KA, Potter JD. Vegetables, fruit, and cancer. J. E-
pidemiology. Cancer Causes Control 1991; 2: 325-57.
216. Kushi LH, Mink PJ, Folsom AR, et al. Prospective study of
diet and ovarian cancer. Am J Epidemiol 1999; 149: 21-31.
217. Mink Pd, Folsom AR, Sellers TA, et al. Physical activity,
waist-to-hip ratio, and other risk factors for ovarian cancer: a
follow-up study of older women. Epidemiology 1996; 7: 38-45.
218. Gertig D, Hunter D. Ovarian Cancer. In: Adami HO, Hunter
D, Trichopoulos D. Textbook of Cancer Epidemiology. New
York: Oxford University Press, 2002: 391.
219. Farrow DC, Weiss Ns, Lyon JL, et al. Association of obesity
and ovarian cancer in a case-control study. Am J Epidemiol
1989; 129: 1300-4.
220. Muir C, Waterhouse J, Mack T, et al, eds. Cancer Incidence
in Five Continents, Vol V. International Agency for Research
on Cancer. Lyon: IARC Press, 1987.
221. Lumey LH, Pittman B, Zang EA, et al. Cigarette smoking and
prostate cancer: no relation with six measures of lifetime
smoking habits in a large case-control study among U.S. whi-
tes. Prostate 1997; 33: 195-200.
222. Jensen OM, Paine SL, McMichael AJ, Ewertz M. Alcohol. In:
Schottenfeld D, Fraumeni JF, eds. Cancer Epidemiology and
Prevention. 2nd ed. New York: Oxford University Press, 1996:
290-318.
223. Tonnesen H, Moller H, Andersen JR, et al. Cancer morbidity
in alcohol abusers. Br J Cancer 1994; 69: 327-32.
224. Hiatt RA, Armstrong MA, Klatsky AL, et al. Alcohol consum-
ption, smoking, and other risk factors, and prostate cancer in
a large health plan cohort in California (United States). Can-
cer Causes Control 1994; 5: 66-72.
225. Kolonel LN, Nomura AMY, Cooney RV. Dietary fat and pro-
tate cancer: current status. J Natl Cancer Inst 1999; 91: 414-
28.
226. Zhang J, Sasaki S, Amano K, et al. Fish consumption and
mortality from all causes, ischemic heart disease, and stroke:
an ecological study. Prev Med 1999; 28: 520-9.
227. Augustsson K, Michaud D, Rimm E, et al. A prospective stu-
dy of intake of fish and marine fatty acids and prostate cancer.
Submitted (2002).
228. Giovannucci E. Tomatoes, tomato-based products, lycopene,
and cancer: review of the epidemiologic literature. J Natl Can-
cer Inst 1999; 91: 317-31.
229. Redman C, Scott JA, Baines AT, et al. Inhibitory affect of se-
lenomethionine on the growth of three selected human tumor
cell lines. Cancer Lett 1998; 125: 103-10.
230. Menter DG, Sabichi AL, Lippman SM. Selenium effects on
prostate cell growth. Cancer Epidemiol Biomarkers Prev 2000;
9: 1171-82.
231. Rayman MP. The importance of selenium to human health.
Lancet 2000; 356: 233-41.
232. O Clarke LC, Coombs GF, Turnbull BW, et al. Effects of se-
lenium sumplemetation for cancer prevention in patients with
carcinoma of the skin. A randomised trial. JAMA 1996; 276:
1957-63.
233. Meydani M. Vitamin E. Lancet 1995; 345: 170-5.
288
234. Hartman TJ, Albanes D, Pietinen P, et al. The association
between baseline vitamin E, selenium, and prostate cancer in
the alpha-tocopherol beta-carotene cancer prevention study.
Cancer Epidemiol Biomarkers Prev 1998; 7: 335-40.
235. Messina MJ, Persky V, Setchell KDR, et al. Soy intake and
cancer risk: a review of the in vitro and in vivo data. Nutr
Cancer 1994; 21: 113-31.
236. Bylund A, Zhang JX, Bergh A, et al. Rye bran and soy protein
delay growth and increase apoptosis of human LNCaP prosta-
te adenocarcinoma in nude mice. Prostate 2000; 42: 304-14.
237. Hsing AW, Deng J, Sesterhenn IA, et al. Body size and pro-
state cancer: a poputation-based case-control study in China.
Cancer Epidemiol Biomarkers Prev 2000a; 9: 1335-41.
238. United Kingdom Testicular Cancer Study Group. Social, be-
havioural and medical factors in the aetiology of testicular
cancer: results from the U.K. study. Br J Cancer 1994a; 70:
513-20.
239. Sigurdson AJ, Chang S, Annegers JF, et al. A case-control
study of diet and testicular carcinoma. Nutr Cancer 1999; 34:
20-6.
240. La Vecchia C, Airoldi L. Human bladder cancer: epidemiolo-
gical, pathological and mechanistic aspects. In: Capen CC,
Dybing E, Rice JM, Wilbourn JD, eds. Species Differences in
Thyroid and Urinary Bladder Carcinogenesis. IARC Sci Pub.
No. 147. Lyon: International Agency for Research on Cancer,
1999: 139-57.
241. nternational Agency for Research on Cancer. Tobacco Smo-
king. IARC Monographs on the Evaluation of Carcinogenic
Risks to Humans. Vol. 38. Lyon: IARC, 1986.
242. Brennan P, Bogillot O, Cordier S, et al. Cigarette smoking
and bladder cancer in men: a pooled analysis of 11 case-con-
trol studies. Int J Cancer 2000; 86: 289-94.
243. Doll R, Peto R, Wheatley K, et al. Mortality in relation to
smoking: 40 years observation on male British doctors. Br
Med J 1994; 309: 901-11.
244. Chyou PH, Nomura AM, Stemmermann GN. A prospective
study of diet, smoking, and lower urinary tract cancer. Ann
Epidemiol 1993; 3: 211-6.
245. Gabbani G, Nardini B, Bordin A, et al. Urinary mutagenicity
on TA98 and YG1024 Salmonella typhimurium strains after a
hamburger meal: influence of GSTM1 and NAT2 genotypes.
Mutagenesis 1998; 13: 187-91.
246. Steineck G, Hagman U, Gerhardsson M, et al. Vitamin A
supplements, fried foods, fat and urothelial cancer. A case-
referent study in Stockholm in 1985-87. Int J Cancer 1990; 45:
1006-11.
247. La Vecchia C, Negri E. Nutrition and bladder cancer. Cancer
Causes Control 1996; 7: 95-100.
248. alaveille C, Hautefeuille A, Pignatelli B, et al. Antimutage-
nic dietary phenolics as antigenotoxic substances in urothe-
lium of smokers. Mutat Res 1998; 18: 219-24.
249. La Vecchia C, Negri E. Nutrition and bladder cancer. Cancer
Causes Control 1996; 7: 95-100.
250. Rothman N, Talaska G, Hayes RB, et al. Acidic urine pH is
associated with elevated levels of free urinary benzitine and
N-acetylbenzidine and urothelial cell DNA adducts in exposed
workers. Cancer Epidemiol Biomarkers Prev 1997; 1039-42.
OY
251. Momas J, Daures JP, Festy B, et al. Bladder cancer and black
tobacco cigarette smoking. Some results from a French case-
control study. Eur J Epidemiol 1994; 10: 599-604.
252. Coffee consumption and bladder cancer in non-smokers: a
pooled analysis of case-control studies in European countries.
Cancer Causes and Control 2000; 11: 928-31.
253. Michaud DS, Spiegelman D, Clinton SK, et al. Fluid intake
and the risk of bladder cancer in men. N Engl J Med 1999a;
340: 1390-7.
254. Zeegers MP, Volonics A, Dorant E, et al. Alcohol consump-
tion and bladder cancer risk: results from the Netherlands
Cohort Study. Am J Epidemiol 2001; 153: 38-41.
255. Boice JD Jr, Engholm G, Kleinerman RA, et al. Radiation
dose and second cancer risk in patients treated for cancer of
the cercix. Radiat Res 1988; 116: 3-55.
256. McGeoghegan D, Binks K. The mortality and cancer morbidi-
ty experience of workers at the Capenhurst uranium enrich-
ment facility 1946-95. J Radiol Prot 2000; 20: 381-401.
257. Kogevinas M, Kauppinen T, Boffetta P, Saracci R. Estimation
of the burden of occupational cancer in Europe. Final Report
to the European Commission of a project funded by the pro-
gramme Europe against Cancer (Contract SOC 96-200742
05F02). Barcelona, Institut Municipal d Investigaci Mdica,
1998a.
258. Sellers C, Markowitz S. Reevaluating the carcinogenicity of
ortho-toluidine: a new conclusion and its implications. Regul
Toxicol Pharmacol 1992; 301-17.
259. Kogevinas M, Kauppinen T, Boffetta P, Saracci R. Estimation
of the burden of occupational cancer in Europe. Final Report
to the European Commission of a project funded by the pro-
gramme Europe against Cancer (Contract SOC 96-200742
05F02). Barcelona, Institut Municipal d Investigaci Mdica,
1998a.
260. Vineis P, Pirastu R. Aromatic amines and cancer. Cancer
Causes Control 1997; 8: 346-55.
261. Clacel J, Mandereau L, Limasset JC, et al. Occupational ex-
posure to polycyclic aromatic hydrocarbons and the risk of
bladder cancer: a French case-control study. Int J Epidemiol
1994; 23: 1145-53.
262. nternational Agency for Research on Cancer. Chlorinated
drinking-water; chlorination by-products; some other haloge-
nated compounds; cobalt and cobalt compounds. IARC Mo-
nographs on the evaluation of the carcinogenic risk of chemi-
cals to humans. Vol. 52. Lyon: IARC, 1991.
263. Koivusalo M, Hakulinen T, Vartiainen T, et al. Drinking wa-
ter mutagenicity and urinary tract cancers: a population-based
case-control study in Finland. Am J Epidemiol 1998; 148: 704-
12.
264. King WD, Marrett LD. Case-control study of bladder cancer
and chlorination by-products in treated water (Ontario, Cana-
da). Cancer Causes Control 1996; 7: 596-604.
265. Hopenhayn-Rich C, Biggs ML, Fuchs A, et al. Bladder cancer
mortality associated with arsenic in drinking water in Argenti-
na. Epidemiology 1996; 7: 117-24.
266. Smith AH, Goycolea M, Haque R, et al. Marked increase in
bladder and lung cancer mortality in a region of northern Chi-
le due to arsenic in drinking water. Am Epidemiol 1998; 147:
IV.
660-9.
267. McLaughlin JK, Lindblad P, Mellemgaard A, et al. Interna-
tional renal-cell cancer study. I. Tobacco use. Int J Cancer
1995b; 60(2): 194-8.
268. Yuan JM, Castelao JE, Gago-Dominguez M, et al. Tobacco
use in relation to renal cell carcinoma. Cancer Epidemiol Bio-
markers Prev 1998b; 7: 429-33.
269. Yuan JM, Gago-Dominguez M, Castelao JE, et al. Crucife-
rous vegetables in relation to renal cell carcinoma. Int J Can-
cer 1998c; 77: 211-6.
270. Dragsted LO, Strude M, Larsen JC. Cancer-protective factors
in fruits and vegetables: biochemical and biological background.
Pharmacol Toxicol 1993; 72(Suppl 1): 116-35.
271. Nogueira E, Cardesa A, Mohr U. Experimental models of
kidney tumors. J Cancer Res Clin Oncol 1993; 119: 190-8.
272. Munro IC, Kennepohl E, Erickson RE, et al. Safety asses-
ment of ingested heterocyclic amines: initial report. Regul
Toxicol Pharmacol 1993; 17: 51-109.
273. Wilkins JR 3rd, Comstock GW. Source of drinking water at
home and site-specific cancer incidence in Washington Coun-
ty, Maryland. Am J Epidemiol 1981; 114: 178-90.
274. Koivusalo M, Hakulinen T, Vartiainen T, et al. Drinking wa-
ter mutagenicity and urinary tract cancers: a population-based
case-control study in Finland. Am J Epidemiol 1998; 148: 704-
12.
275. Wolk A, Lindblad P, Adami HO. Nutrition and renal cell can-
cer. Cancer Causes Control 1996b; 7: 5-18.
276. Yuan JM, Castelao JE, Gago-Dominguez M, et al. Hyperten-
sion, obesity and their medication in relation to renal cell car-
cinoma. Br J Cancer 1998a; 77: 1508-13.
277. Prineas RJ, Folsom AR, Zhang ZM, et al. Nutrition and
other risk factors for renal cell carcinoma in postmenopausal
women. Epidemiology 1997; 8: 31-6.
278. Burch JD, Craib KJP, Choi BCK, et al. An exploratory case-
control study of brain tumors in adults. J Natl Cancer Inst
1987; 78: 601-9.
279. Burch JD, Craib KJP, Choi BCK, et al. An exploratory case-
control study of brain tumors in adults. J Natl Cancer Inst
1987; 78: 601-9.
280. Lee M, Wrensch M, Miike R. Dietary and tobacco risk factors
for adult onset glioma in the San Francisco Bay Area. (Cali-
fornia, USA). Cancer Causes Control 1997; 8: 13-24.
281. Preston-Martin S, Mack W. Gliomas and meningiomas to n-
nitroso compounds. In: O Neil IK, et al, eds. Relevance to
Human Cancer of N-Nitroso Compounds, Tobacco Smoke and
Mycotoxins. IARC Sci. Pub. No. 105. Lyon: International A-
gency for Research on Cancer, 1991: 1977-1203.
282. Boeing H, Schlehofer B, Blettner M, et al. Dietary carcino-
gens and the risk for glioma and meningioma in Germany. Int
J Cancer 1993; 53: 561-5.
283. Burch JD, Craib KJP, Choi BCK, et al. An exploratory case-
control study of brain tumors in adults. J Natl Cancer Inst
1987; 78: 601-9.
284. Giles GG. What do we know about risk factors for glioma?
Cancer Causes Control 1997; 8: 3-4.
285. Ron E, Modan B, Boice JD, et al. Tumors of the brain and
289
nervous system after radiotherapy in childhood. N Engl J
Med 1988; 319: 1033-9.
286. Savitz D, Trichopoulos D. Brain Cancer. In: Adami HO,
Hunter D, Trichopoulos D. Textbook of Cancer Epidemiolo-
gy. New York: Oxford University Press, 2002: 494.
287. Rodvall Y, Ahlbom A, Spnnare B, et al. Glioma and occupa-
tional exposure in Sweden, a case-control study. Occup Envi-
ron Med 1996; 53: 526-32.
288. Khuder SA, Mutgi AB, Schaub EA. Meta-analysis of brain
cancer and farming. Am J Ind Med 1998; 34: 252-60.
289. Thomas TL, Waxweiler RJ. Brain tumors and occupational
risk factors: a review. Scand J Work Environ Health 1986; 12:
1-15.
290. Longnecker MP, Rogan WJ, Lucier G. The human health ef-
fects of DDT (dichlorodiphenyltrichloroethane) and PCBs
(polychlorinated biphenyls) and an overview of organochlori-
nes and public health. Annu Rev Public Health 1997; 18: 211-
44.
291. Kheifets LI, Afifi AA, Buffler PA, et al. Occupational electric
and magnetic field exposure and brain cancer: a meta-analy-
sis. J Occup Environ Med 1995; 37: 1327-41.
292. Cantor KP, Lynch CF, Hildesheim ME, et al. Drinking water
source and chlorination byproducts in Iowa. III. Risk of brain
cancer. Am J Epidemiol 1999; 150: 552-60.
293. Parkin DM, Whelan SL, Ferlay J, Raymond L, Young J. Can-
cer Incidence in Five Continents. Vol. VII. No. 143. Interna-
tional Agency for Research on Cancer. Lyon: World Health
Organization, 1997.
294. Fisher CL, Mannino DM, Herman WH, et al. Cigarette
smoking and thyroid hormone levels in males. Int J Epidemiol
1997; 26: 972-7.
295. Rossing MA, Cushing K, Voight L, et al. Risk of papillary thy-
roid cancer in women in relation to smoking and alcohol con-
sumption. Epidemiology 2000; 11: 49-54.
296. Franceschi S, Boyle P, Maisonneuve P, et al. The epidemio-
logy of thyroid carcinoma. Crit Rev Oncogen 1993; 4: 25-53.
297. Pettersson B, Adami HO, Wilander E, et al. Trends in thyroid
cancer incidence in Sweden, 1958-1981, by histopathologic ty-
pe. Int J Cancer 1991; 48: 28-33.
298. Horn-Ross PL, Morris JS, Lee M, et al. Iodine and thyroid
cancer risk among women in a multiethnic population: The
Bay Area Thyroid Cancer Study. Cancer Epidemiol Biomar-
kers Prev 2001; 10: 979-85.
299. Franceschi S, Levi F, Negri E, et al. Diet and thyroid cancer: a
pooled analysis of four European case-control studies. Int J
Cancer 1991; 48: 395-8.
300. Ron E, Kleinerman RA, Boice JD Jr, et al. A population-
based case-control study of thyroid cancer. J Natl Cancer Inst
1987; 79: 1-12.
301. Rossing MA, Cushing K, Voight L, et al. Risk of papillary thy-
roid cancer in women in relation to smoking and alcohol con-
sumption. Epidemiology 2000; 11: 49-54.
302. Franceschi S, Levi F, Negri E, et al. Diet and thyroid cancer: a
pooled analysis of four European case-control studies. Int J
Cancer 1991; 48: 395-8.
303. Goodman MT, Kolonel KM, Wilkens LR, et al. The associa-
tion of body size, reproductive factors and thyroid cancer. Br
290
J Cancer 1992; 66: 1180-4.
304. United Nations Scientific Committee on the Effects of atomic
Radiation (UNSCEAR). Sources and effects of ionizing ra-
diation. UNSCEAR 2000 Report to the General Assembly,
with Scientific Annexes. New York: United Nations, 2000.
305. nskip PD, Ekbom A, Galanti MR, et al. Medical diagnostic x
rays and thyroid cancer. J Natl Cancer Inst 1995; 87: 1613-21.
306. Parkin DM, Pidani P, Ferlay J. Global cancer statistics. CA
Cancer J Clin 1999; 49: 33-64.
307. Hjalgrim H, Frisch M, Begtrup K, et al. Recent increase in
the incidence of Non-Hodkins lymphoma among young men
and women in Denmark. Br J Cancer 1996; 73: 951-4.
308. Bernard SM, Cartwright RA, Darwin CM, et al. Hodgkins di-
sease: case-control epidemiological study in Yorkshire. Br J
Cancer 1987; 55: 85-90.
309. Zahm SH, Weisenburger DD, Holmes FF, et al. Tobacco and
non-Hodgkins lymphoma: combined analysis of three case-
control studies (United States). Cancer Causes Control 1997;
8: 159-66.
310. Adami J, Nyrn O, Bergstrm R, et al. Smoking and the risk
of leukemia, lymphoma, and multiple myeloma (Sweden). Can-
cer Causes Control 1998; 9: 49-56.
311. Davis MK. Review of the evidence for an association between
infant feeding and childhood cancer. Int J Cancer 1998; 11(S):
29-33.
312. Ron E. Ionizing relation and cancer risk: evidence from epi-
demiology. Radiat Res 1998; 150: 30-41.
313. Petridou E, Trichopoulos D. Leukemias. In: Adami HO, Hun-
ter D, Trichopoulos D. Textbook of Cancer Epidemiology.
New York: Oxford University Press, 2002: 559.
314. Petridou E, Hsieh C-C, Kotsifakis G, et al. Evolution and Di-
stribution of Childhood Leukemia Mortality in Greece: Etio-
logical Implications. Eur J Pub Health 1992; 2: 29-33.
315. Severson RK. Cigarette smoking and risk of leukemia. J Clin
Epidemiol 1989; 42: 1025-8.
316. MacLaughlin JK, Hrubec Z, Linet MS, et al. Cigarette smok-
ing and leukemia. J Natl Cancer Inst 1989; 81: 1262-3.
317. Adami J, Nyrn O, Bergstrm, et al. Smoking and the risk of
leukemia, lymphoma, and multiple myeloma (Sweden). Can-
cer Causes Control 1998; 9: 49-56.
OY
318. Petridou E, Trichopoulos D, Kalapothaki V, et al. The risk
profile of childhood leukemia in Greece: a nationwide case-
control study. Br J Cancer 1997; 76: 1241-47.
319. American Institute for Cancer Research. Food, Nutrition and
the Prevention of Cancer: A Global Perspective. Washington,
DC: American Institute for Cancer Research, 1997: 1-670.
320. Petridou E, Trichopoulos D. Leukemias. In: Adami HO,
Hunter D, Trichopoulos D. Textbook of Cancer Epidemiolo-
gy. New York: Oxford University Press, 2002: 562.
321. Broomhall J, May R, Lilleyman JS, et al. Height and lympho-
blastic leukemia. Arch Dis Child 1983; 58: 300-1.
322. Petridou E, Skalkidou A, Dessypris N, et al. Endogenous risk
factors for childhood leukemia in relation to the IGF System
(Greece). The Childhood Haematologists-Oncologists Group.
Cancer Causes Control 2000; 11: 765-71.
323. United Nations Scientific Committee on the effects of Atomic
Radiation. Sources, Effects and Risks of Ionizing Radiation.
Report to the General Assembly with annexes. United Na-
tions Sales Pub. No. E. 88 IX.7. New York, 1988, 1993, 1994.
324. United Nations Scientific Committee on the effects of Atomic
Radiation. Sources, Effects and Risks of Ionizing Radiation.
Report to the General Assembly with annexes. United Na-
tions Sales Pub. No. E. 94 IX.2. New York, 1993.
325. Monson RR, MacMahon B. Prenatal x-ray exposure and can-
cer in children. In: Boice JD Jr, Fraumeni JF Jr, eds. Radia-
tion Carcinogenesis: Epidemiology and Biological significan-
ce. New York: Raven Press, 1984: 107-18.
326. Petridou E, Trichopoulos D, Dessypris N, et al. Infant leuke-
mia after in utero exposure to radiation from Chernobyl. Na-
ture 1996; 382: 352-3.
327. Petridou E, Trichopoulos D, Kravaritis A, et al. Electrical
Power Lines and Childhood Leukemia: A study from Greece.
Int J Cancer 1997; 73: 345-48.
328. Petridou E, Hsieh C-C, Skalkidis Y, et al. Suggestion of con-
comitant changes of electric power consumption and child-
hood leukemia in Greece. Scand J Soc Med 1993; 4: 281-85.
329. Adami HO, Day NE, Trichopoulos D, Willett WC. Primary
and secondary prevention in the reduction of cancer morbidi-
ty and mortality. European Journal of Cancer 37 (2001); S118-
S127.
V
K

. K ............................................................................................................ 293

. .......................................................................................................... 311

.

H (transformation)
1890 David Hansemann . -

1. 1914 Theodor Boveri
- .
, (metastasis) -
-
2. -
O - . -
, .
.
-
, - (constitutional mu-
. O - tation), ( -
- ). -
- -
. -
. . -
O , ,
, 3: , .
(immortalization) , -
, - , (.
. 1):

1. -
--
-
. - -
-
- -
--

-
. -

-

.
- -
-
,
- -
.
-

293
294 OY

()

()



(, & )

()

(V)

2. , -
, , , .

- -
- (S) -
. .
- - .
, , - H
, ( GTP), - - -
.
(-
) 4 (. 2). - OOI O-OOOI

--
-
,
- .
, -
, -
O-OOOI
, -
- -
- 8.
, , - ras (N-ras, H-ras, K-ras) -
, - 9.
5. O -
-
OI O-OOOI
. ,
- (CML)
- - abl
. 9 -
- 22 10.
. -
- - ,
. DNA -
6,7 ( - ,
) -
.
V. 295

DNA11.
INT-2 c-erbB2
N-myc 4. . -
,
-, sis,
. -
PDGF (platelet derived growth factor)13.
OOOI -
, , ,
33,
, -
. , .
-
5. 1 -
O )
.
) -
. -
- : ) -- -
- .
, -
( ), ) -- erb,
, (EGF)4. c-erbB2
) erbB, -
, , -
- . 14.
YO OOOI
, -
, -
.

1. 12

Abl Abelson 9q34
Src Rous () 20q12-13
Trk 1q32
H-ras Harvey 11p15.5 GTP
N-ras () 1p13 GTP
DNA
yc 8p24 DNA
N-myc 2p24

Sis Simian 22q12.3-13.1
PDGF

ErbA 17q21-22
296 OY

, -
15. Burkitts, 3
abl - . t(2;8), t(8;22) t(8;14),
17, src - 24. -
Rous17. myc 8
-
14 . O -
O - 2 22
-
. raf - 25.
-
18.
-
. ,
fos, jun19 erbA20 - (CML), abl
- 9q34 -
22
(bcr) 22q1126.
DNA. - , -
. -
. , ras
27.
-
bcl-2 -
21. (viral oncogenes)
4.
OOOI OY

IH O

-
22: .

. OOOO OI
-
- . O
. - - DNA RNA. O -
, - RNA -
. .
-
-myc ( 2q) DNA OOOO OI
- O DNA papova .
O
DNA - . -
23. N-myc - Rb / p53.
DNA -
HSR ( ). 3 4.
- - O DNA
. O in vitro. -
(promoter) DNA - : -
5 , (permis-
, , sive cells) ,
mRNA5. - (non permissive cells)28.
V. 297

1 (adeno) SV40 -:
- (SV40) p53
E2F E7 (HPV) E2F
Rb
HPV E6:
p53
p53
Rb
,
1:
S p53

3. DNA 4. DNA
Rb. p53.

, -
, . O
. , -
, (splicing) , -
, - ( tumor, -
- ). -
, , DNA
-
. O -
SV40
28 (. 5). -

() () - ,
DNA .

-
. SV40

(15-18 h) - t- -
29.
-
-
, 1 130.

RNA OOOO OI
DNA

(24-28 h) RNA 8.500 . RNA -
tRNA . -
DNA
50 DNA
,
31 (. 6). O

-
DNA
RNA (. 7). -


tRNA ,

DNA31.
DNA -
(>48 h):
LTRs (long terminal repeats). O
: , -

.
DNA . DNA

- ,


5. - ().
papova SV40. -
298 OY

6.
.

()

5' 3'
m7GpppG
m R U5 PBS gag pol env U3 R A(A)nAOH

5' 3'
- tRNA -

7.
-
3' ,
RNA 5' R U5 PBS U3 R 3' -
DNA.

DNA
1. To RNA , R U5
3'
DNA
5' RNA 5' R U5 PBS U3 R

2. H RNase R U5
RNA PBS U3 R

3. : DNA R U5
RNA R PBS U3 R

U3 R U5
4. DNA
PBS U3 R

5. 5'
U3 R U5
RNA
5' 3'

5'
U3 R U5
6. 3'
DNA U3 R U5 PBS 5'

7. RNA tRNA U3 R U5 5'

U3 R U5 PBS 3'

3' U3 R U5 5'
8.
5' U3 R U5 PBS 3'

3' U3 R U5 5'
9.
5' U3 R U5 PBS 3'
LTR LTR
V. 299

-, - DNA

. O -
DNA : ) LTR LTR (c-abl)
DNA
) DNA -

-
, DNA LTR gag pol env LTR
- -
.
-
DNA
.
Rous,
, , -
RNA n
, -
32.
O -
mRNA n
- ( -

transducing viruses) (slow-acting RNA
viruses)33.
mRNA n
O
, RNA n
.

33. -
. n
- RNA
-- Adelson (A-MulV)

c. 8. .
O - -
- c-abl. O
(. 8). - ( ).
, -
RNA
gag, pol env - RNA . RNAs
. - ( ) DNA
-
-
Adelson (A-MulV) ( ).
, .
, , -
- - c-myc. O , -
. c-myc -
- , -
3,34. , 3,34.
( - -
) - . O
, -
. O - -
- .
, , -
:
. -

. -. (-
. ), -
300 OY

. )
-
- . O IV (human immunodeficiency virus)
- -,
. 38.
.
OO-A OI
OOOO OI O O
-
-
22. --
-
, -
.
-


,
39. -
,

gag, pol env,
,
DNA .
O Epstein-Barr, DNA
, - .
35: Burkitt -
. ,
O , DNA , - 2.
. O - - (TS)
RNA . , -
DNA - -
-- . -
36.
O papilloma, DNA
papova, - , -
, 37.
- -
, , RSV, - .
. -
AIDS ( - -

2. -

APC K K ; O

DCC K M M
NF1 N K E GTA N 1
NF2 2

P53 , Li-Fraumeni
..
RB
RET -

VHL ; ; von Hippel-Lindau
WT-1 Wilms
BRCA 1

V. 301

. O -

-. -
--
-
- , -
.

O O KNUDSON
1971 Alfred nudson

TS,

40. -
9. . -
-
(. 9). -
.

. O Knudson -
:

, -

RB1
- , -
40. . .
(
40%) -
. - -
- , . -
. (. 10).
O Knudson - , -
: , ,
) (. -
, ) 42,43.
) (.
). RB1 -
RB1 - -
- (. 6).
pRB41.

10. -
,
, WAGR
(Wilms Tumor-Aniridia-Genitourinary
Anomalies-Mental Retardation Syndro-
me)
.

302 OY

. O - 5.
Wilms .
, ,
- E E O OOY-
5. O A OO- O-
I
-
, Wilms
13 (13q14) , -
. O - , -
-
- - . O -
. () WT1,
11p1344. O
OI (LOH)
. -
-
, - 11p13 11
. - Wilms.
. -
O
-
- 10%
, . - . O
, - ,
. O
(. 11). DNA - ,
- 40 45.
. -
- p53 ( Li-Fraumeni)46, BRCA 1
- - BRCA 247. T BRCA 1 BRCA 2 -
17q2148 13q12.349 -
.
-
, ,
A 1 2
RB1 rb + . BRCA
B 1 2
1 -
-
, G1
S -
50. mRNA BRCA 1 -
1 2 1 2 1 1 1
rb rb rb rb rb rb rb
1 2 1 1 1 1 1 51. BRCA 2
- , ,
- - BRCA 1, - .


11.
DNA - : 1
- (NF1) 2 (NF2)52. O NF1

. -
, , -
.
13q. 1/4.000 53. O -
V. 303

OA OI
-

, -
E.coli. o-
, -
.
-
DNA
. -
DNA
.
-
12. .
.
() NF1 - (care takers). -
17q11 , MSH2 MLH1, -
, - , -
, , - 61. MLH1 -
, - 62,63.
Wilms54. O NF2
- O
55.
NF2 22q1256. - 64. -
NF1 , :
)
GAP, ) () .
Ras57. -
Ras, GTP
54. p53 DNA
. - -
NF1 NF2 - 58,59. (TS) .
12 -
.
( ),
, -
Li-Fraumeni
65.
, TP53, -
(- ,
, ) -
. .
. --
p53 O OO O p53
60. - p53 p53
. .
, 17p13.166. p53
Li-Fraumeni , :
p53, -
. -
( )
60. 67.
304 OY

p53 - .
-
. ,
DNA 68. , .
DNA -
, p53 - -
G1 - . -
. p53 - -
, -
bcl-2 bax69. bax - , -
, bcl-2 bax, .
69. p53 - -
bcl-2 bax70.
, . -
. O -
p53 -
, - .
. p53 ,
.
. p53 O -
- (TS), -
-- -,
,
66. . -
p53 - , -
. p53 . -
. - -
- -
p53, . -

p5371. -
.
p53 IO -
O p53 -
. - , -
-
70% . O .
p53 60% , -
.
. Li-Fraumeni ,
-
p53 - -
( . , -
)60. 50% -
30 ( ,
1% ). -
. -
OE I
OH OO
O - 9;22, Philadelphia -
. -
V. 305

(CML). - . -
, abl bcr, -
- , Wilms,
72. , Ewing,
(AML) - . -
1 7 - , -
73. - G-banded. ,
-
. 8;21 - ,
2, 15;17 3 -
16 . FISH
4. O - -
. - . , (probes) FISH
15;17 , bcr abl Phila-
AML delphia ,
3 - bcr , abl
. 77.
-
- 12;21 (ALL)78. -
. MLL (Mixed Li- FISH MLL ,
neage Leucaemia) 11q23, 11
5 - -
7 . .

, .. - OOH Y O IO
, -
73.
(ALL) - . -
- , -
- .
74. (FAP FAPC) (.
50 - 13)
. -
, - 79. -
4, 6, 10, 14, 18 21. - -
Philadelphia t(9;22)(q34;q11) -
ALL -
75. 4;11
MLL76.
12 21
ALL75.

12 21,

in situ (FISH,
Fluorescent in situ Hybridisation).
, -
-
. O - 13. O
, -
- .
306 OY

. -
- , -
, - o .
, -
79. OH A O IO
O Fearon Vogelstein80 -

- -
. (, ), (-
FAP - )
APC ( - -
) 5q2181. H .
-
,
-
,
, . -
82. APC
. O in
- , -
situ (Fluorescent in situ hybridi-

sation FISH)
APC, -
, ,
83.
-

86.
-
APC. - 2% -
. H FISH
, -
K-ras84, - Southern Blot ,
18q ( SMAD4)85 - HER2 87.
p53 Southern Blot -
G1 S 84 (. 14). ,
- / 88.
(PCR)
, , -
bcl-2/IgH. RT-PCR
APC
( )
89. -
-
12p: M -ras
-
. -
18q: DCC PCR ,
( ) N-cam 100.000
. -
-
17p: p53 90. -

real-time PCR -
PCR91.

DNA OOI (MICROARRAYS)

IO
14. .
O

- - -
- ras. RNA. -
V. 307

DNA . -
microarrays , ,
FAP, , -
. E .
O -
- DNA -
, - . , -
92. microarrays , , -
- .
, , , , -
- , - gatekeeper,
. -
,
p53, -

, .
93.
( -
microar-
)
rays , -
C ELISA,
. . -
-
I
, .

, .

1. Hansemann D von. Uber asymmetrische Zellkeilung in Spi-
thelkrebser and deren biologische Bedenkung Virch. Arch 1890;
119: 299.
2. Boveri T. Zur Frage des Entstehung Maligner Tumoren. Jena:
Gustav Fisher, 1-64.
3. Bishop JM. The molecular genetics of cancer. Science 1987;
235: 305-311.
4. http://dorakmt.tripod.com/genetics/notes06.html
5. Thomson MW, McInnes RR, Willard HF. - 14. Meden H, Kuhn W. Overexpression of the oncogene c-erbB-2
. - (HER2/neu) in ovarian cancer: a new prognostic factor. Eur J
, 2001: 419-439.
6. Stehelin, D, Varmus HE, Bishop JM, Vogt PK. DNA related
to the transforming gene(s) of avian sarcoma viruses is present
in normal avian DNA. Nature 1986; 260: 170-173.
7. Bishop JM. Enemies within: the genesis of retroviral oncoge-
nes. Cell 1981; 23: 5-6.
8. Tabin CJ, et al. Mechanism of activation of a human oncoge-
ne. Nature 1982; 300: 143-149.
9. Taparowsky E, et al. Activation of the T24 bladder carcinoma
transforming gene is linked to a single amino acid change. Na-
ture 1982; 300: 762-765.
10. Nowell PC, Rowley JD, Knudson AG Jr. Cancer genetics, cy-
togenetics - defining the enemy within. Nature Med 1998; 10:
1107-1111.
11. Miller DM, Blume S, Borst M, Gee J, Polansky D, Ray R, Ro-
du B, Shrestha K, Snyder R, Thomas S, et al. Oncogenes, ma-
lignant transformation, and modern medicine. Am J Med Sci
1990; 300(1): 59-69.
12. Park M, Van de Woude GF. Oncogenes: genes associated
with neoplastic disease. In: The metabolic basis of inherited
disease. 6th ed. New York: McGraw-Hill, 1989: 251-276.
13. Heller S, Scheibenpflug L, Westermark B, Nister M. PDGF B
mRNA variants in human tumors with similarity to the v-sis
oncogene: expression of cellular PDGF B protein is associated
with exon 1 divergence, but not with a 3UTR splice variant.
Int J Cancer 2000; 85(2): 211-22.
Obstet Gynecol Reprod Biol 1997; 71(2): 173-9.
15. Sattler M, Scheijen B, Weisberg E, Griffin JD. Mutated tyrosi-
ne kinases as therapeutic targets in myeloid leukemias. Adv
Exp Med Biol 2003; 532: 121-40.
16. Hubbard SR. Protein tyrosine kinases: autoregulation and
small-molecule inhibition. Curr Opin Struct Biol 2002; 12 (6):
735-41.
17. Martin GS. The hunting of the Src. Nat Rev Mol Cell Biol
2001; 2(6): 467-75.
18. Williams NG, Roberts TM. Signal transduction pathways in-
volving the Raf proto-oncogene. Cancer Metastasis Rev 1994;
13(1): 105-16.
19. Hartl M, Bader AG, Bister K. Molecular targets of the onco-
genic transcription factor jun. Curr Cancer Drug Targets 2002;
3(1): 41-55.
20. Shepel LA, Gorski J. Steroid hormone receptors and oncoge-
nes. Biofactors 1988; 1(1): 71-83.
21. Vogel MW. Cell death, Bcl-2, Bax, and the cerebellum. Cere-
308
bellum 2002; 1(4): 277-87.
22. Friend SH, Dryja TP, Weinberg RA. Oncogenes and Tumor-
suppressing genes. N Engl J Med 1988; 318: 618-622.
23. Manhani R, Cristofani LM, Odone Filho V, Bendit I. Conco-
mitant p53 mutation and MYCN amplification in neuroblasto-
ma. Med Pediatr Oncol 1997; 29(3): 206-7.
24. Hecht JL, Aster JC. Molecular biology of Burkitts lymphoma.
J Clin Oncol 2000; 18(21): 3707-21.
25. Popescu NC, Zimonjic DB. Chromosome-mediated altera-
tions of the MYC gene in human cancer. J Cell Mol Med 2002;
6(2): 151-9.
26. Clarkson B, Strife A, Wisniewski D, Lambek CL, Liu C. Chro-
nic myelogenous leukemia as a paradigm of early cancer and
possible curative strategies. Leukemia 2003; 17(7): 1211-62.
27. Takahashi T, Munakata M, Ohtsuka Y, Nisihara H, Nasuhara
Y, Kamachi-Satoh A, Dosaka-Akita H, Homma Y, Kawakami
Y. Expression and alteration of ras and p53 proteins in pa-
tients with lung carcinoma accompanied by idiopathic pulmo-
nary fibrosis. Cancer 2002; 95(3): 624-33.
28. , . O 49. Wooster R, Neuhausen SL, Mangion J, Quirk Y, Ford D, Col-
. , 2002: 174-208. lins N, Nguyen K, Seal S, Tran T, Averill D, Fields P, Marshall
29. Chiou WJ, Wang J, Berg CE, Wu-Wong JR. SV40 virus trans-
formation down-regulates endothelin receptor. Biochim Bio-
phys Acta 1999; 1450(1): 35-44.
30. Fukuda K, Abei M, Ugai H, Seo E, Wakayama M, Murata T,
Todoroki T, Tanaka N, Hamada H, Yokoyama KK. E1A, E1B
double-restricted adenovirus for oncolytic gene therapy of gall-
bladder cancer. Cancer Res 2003; 63(15): 4434-40.
31. Leib-Mosch C, Brack-Werner R, Salmons B, Schmidt J, Strauss
PG, Hehlmann R, Erfle V. The significance of retroviruses in
oncology. Onkologie 1990; 13(6): 405-14.
32. Lipsick JS, Wang DM. Transformation by v-Myb. Oncogene
1999; 18(19):3047-55.
33. Ellis E (2000) Genes and Cancer
http://homepages.strath.ac.uk/~dfs97113/GenesCancer/GC2/
RV.html
34. Weinberg RA. The genetic basis of cancer. Arch Surg 1990;
125: 257-260.
35. Magrath I, Jain V, Bhatia K. Epstein-Barr virus and Burkitts
lymphoma. Semin Cancer Biol 1992; 3(5): 285-95.
36. Nassal M. Hepatitis B virus replication: novel roles for virus-
host interactions. Intervirology 1999; 42(2-3): 100-16.
37. McGlennen RC. Human papillomavirus oncogenesis. Clin Lab
Med 2000; 20(2): 383-406.
38. Alimonti JB, Ball TB, Fowke KR. Mechanisms of CD4+ T
lymphocyte cell death in human immunodeficiency virus infe-
ction and AIDS. J Gen Virol 2003; 84: 1649-61.
39. Balmain A. Cancer genetics: from Boveri and Mendel to mi-
croarrays. Nat Rev Cancer 2001; 1(1): 77-82.
40a.Knudson A. Mutation and cancer: statistical study of retino-
blastoma. Proc Natl Acad Sci USA 1971; 68(4): 820-3.
40b. Knudson A. Alfred Knudson and his two-hit hypothesis (Inter-
view by Ezzie Hutchinson). Lancet Oncol 2001; 2(10): 642-5.
41. Harbour JW. Molecular basis of low-penetrance retinoblasto-
ma. Arch Ophthalmol 2001; 119(11): 1699-704.
42. Brantley MA Jr, Harbour JW. The molecular biology of reti-
noblastoma. Ocul Immunol Inflamm 2001; 9(1): 1-8.
OY
43. Zheng L, Lee WH. Retinoblastoma tumor suppressor and ge-
nome stability. Adv Cancer Res 2002; 85: 13-50.
44. Call KM, Glaser T, Ito CY, et al. Isolation and characteriza-
tion of a zinc finger polypeptide gene at the human chromoso-
me 11 Wilms tumor locus. Cell 1990; 60: 509-520.
45. Claus EB, Risch NJ, Thomson WD. Age of onset as an indica-
tor of familial risk of breast cancer. Am Epidemiol 1990; 131:
961-972.
46. Malkin D, Li FP, Strong LC, et al. Germline p53 mutations in
a familial syndrome of breast cancer, sarcomas, and other neo-
plasms. Science 1990; 250: 1233-1238.
47. Ford D, Easton DF, Stratton M, et al. Genetic heterogeneity
and penetrance analysis of the BRCA1 and BRCA2 genes in
breast cancer families. Am J Hum Genet 1998; 62: 676-689.
48. Albertsen H, Plaetke R, Ballard L, Fujimoto E, Connolly J,
Lawrence E, Rodriguez P, Robertson M, Bradley P, Milner B,
Fuhrman D, Marks A, Sargent R, Cartwright P, Matsunami N,
White R. Genetic mapping of the BRCA1 region on chromo-
some 17q21. Am J Hum Gen 1994; 54: 516-525.
G, Narod S, Lenoir GM, Lynch H, Feunteun J, Devilee P,
Cornelisse CJ, Menko FH, Daly PA, Ormiston W, McManus
R, Pye C, Lewis CM, Cannon-Albright LA, Peto J, Ponder
BAJ, Skolnick MH, Easton DF, Goldgar DE, Stratton MR.
Localization of a breast cancer susceptibility gene, BRCA2, to
chromosome 13q12-13. Science 1994; 265: 2088-2090.
50. Lou Z, Chen J. BRCA proteins and DNA damage check-
points. Front Biosci 2003; 8: 718-21.
51. Scully R, Puget N. Hereditary breast and ovarian cancer genes.
Methods Mol Biol 2003; 222: 41-57.
52. Gabriel KR. Neurofibromatosis. Curr Opin Pediatr 1997; 9(1):
89-93.
53. North K. Neurofibromatosis type 1. Am J Med Genet 2000;
97(2): 119-27.
54. Shen MH, Harper PS, Upadhyaya M. Molecular genetics of
neurofibromatosis type 1 (NF1). J Med Genet 1996; 33(1): 2-
17.
55. Araki N, Takeshima H, Saya H. Neurofibromatosis type 2
(NF2). Gan To Kagaku Ryoho 1997; 24(11): 1427-31.
56. Ruttledge MH, Narod SA, Dumanski JP, Parry DM, Eldridge
R, Wertelecki W, Parboosingh J, Faucher MC, Lenoir GM,
Collins VP, et al. Presymptomatic diagnosis for neurofibroma-
tosis 2 with chromosome 22 markers. Neurology 1993; 43(9):
1753-60.
57. Xu GF, OConnell P, Viskochil D, Cawthon R, Robertson M,
Culver M, Dunn D, Stevens J, Gesteland R, White R, et al.
The neurofibromatosis type 1 gene encodes a protein related
to GAP. Cell 1990; 62(3): 599-608.
58. Uhlmann EJ, Gutmann DH. Tumor suppressor gene regula-
tion of cell growth: recent insights into neurofibromatosis 1 and
2 gene function. Cell Biochem Biophys 2001; 34(1): 61-78.
59. Dupuis L, Nezarati MM. Neurofibromatosis type I as a model
of autosomal dominant inheritance. Pediatr Dermatol 2001;
18(5): 445-7.
60. Frebourg T, Abel A, Bonaiti-Pellie C, Brugieres L, Berthet P,
Bressac-de Paillerets B, Chevrier A, Chompret A, Cohen-Ha-
guenauer O, Delattre O, Feingold J, Feunteun J, Frappaz D,
V.
Fricker JP, Gesta P, Jonveaux P, Kalifa C, Lasset C, Leheup B,
Limacher JM, Longy M, Nogues C, Oppenheim D, Sommelet
D, Soubrier F, Stoll C, Stoppa-Lyonnet D, Tristant H. Li-
Fraumeni syndrome: update, new data and guidelines for cli-
nical management. Bull Cancer 2001; 88(6): 581-7.
61. Jacob S, Praz F. DNA mismatch repair defects: role in colore-
ctal carcinogenesis. Biochimie 2001; 84(1): 27-47.
62. Wood R, Mitchell M, Sgouros J, Lindahl T. Human DNA Re-
pair Genes. Science 2001; 291: 284-1289.
63. Goode , Ulrich C, Potter J. Polymorphisms in DNA Repair
Genes and Associations with Cancer Risk. Cancer Epidemio-
logy Biomarkers & Prevention 2002; 11: 1513-1530.
64. Blaho JA. Virus infection and apoptosis: an introduction. Int
Rev Immunol 2003; 22(5-6): 321-326.
65. Nagata S. Apoptosis in death factor. Cell 1997; 86: 355-365.
66. Chang F, Syrjanen S, Kurvinen K, Syrjanen K. The p53 tumor
suppressor gene as a common cellular target in human carci-
nogenesis. Am J Gastroenterol 1993; 88(2): 174-86.
67. Fojo T. p53 as a therapeutic target: unresolved issues on the
road to cancer therapy targeting mutant p53. Drug Resist. Up-
date 2002; 5(5): 209-16.
68. Lane DP. p53 guardian of the genome. Nature 1992; 358: 15-
16.
69. Larsen CJ. The BCL2 gene, prototype of a gene family that
controls programmed cell death (apoptosis). Ann Genet 1994;
37(3): 121-34.
70. Wu X, Deng Y. Bax and BH3-domain-only proteins in p53-
mediated apoptosis. Front Biosci 2002; 7: 151-6.
71. Roemer K. Mutant p53: gain-of-function oncoproteins and wild-
type p53 inactivators. Biol Chem 1999; 380(7-8): 879-87.
72. Sattlermc M, Griffin JD. Molecular mechanisms of transfor-
mation by the BCR-ABL oncogene. Semin Hematol 2003; 40
(3): 4-10.
73. Hayhoe FG. Classification of acute leukaemias. Blood Rev
1988; 2(3): 186-93.
74. Lafage-Pochitaloff M, Charrin C. Cytogenetic abnormalities in
acute lymphoblastic leukemia. Pathol Biol 2003; 51(6): 329-36.
75. Harrison CJ, Foroni L. Cytogenetics and molecular genetics of
acute lymphoblastic leukemia. Rev Clin Exp Hematol 2002;
6(2): 91-113.
76. Auxenfants E, Morel P, Lai JL, Sartiaux C, Detourmignies L,
Bauters F, Fenaux P. Secondary acute lymphoblastic leukemia
with t (4;11): report on two cases and review of the literature.
Ann Hematol 1992; 65(3): 143-6.
77. Campbell LJ, Martinow A, Michael PM, White JS, Rayeroux
KC, Januszewicz EH. Correlation of cytogenetics, BCR-ABL
PCR studies and fluorescence in situ hybridisation (FISH) in
adult acute lymphoblastic leukaemia. Aust NZ J Med 1999;
29(5): 707-12.
78. Zemanova Z, Michalova K, Brezinova J, Sindelarova L, Kur-
kova S, Smisek P, Zuna J, Trka J, Stary J. Fluorescent in situ
hybridization (FISH) in the diagnosis of acute childhood lym-
phatic leukemia (ALL). Cas Lek Cesk 2001; 140(17): 519-24.
79. Bronzino P, Rassu PC, Cassinelli G, Stanizzi T, Casaccia M.
Familial adenomatous polyposis: review of the literature and
report of 3 cases. G Chir 2003; 24(1-2): 39-42.
309
80. Fearon ER, Vogelstein B. A genetic model for colorectal tu-
morigenesis. Cell 1990; 61(5): 759-67.
81a. Kinzler KW, Nilbert MC, Vogelstein B, Bryan TM, Levy DB,
Smith KJ, Preisinger AC, Hamilton SR, Hedge P, Markham
A, et al. Identification of a gene located at chromosome 5q21
that is mutated in colorectal cancers. Science 1991a; 251 (4999):
1366-70.
81b. Kinzler KW, Nilbert MC, Su LK, Vogelstein B, Bryan TM,
Levy DB, Smith KJ, Preisinger AC, Hedge P, McKechnie D, et
al. Identification of FAP locus genes from chromosome 5q21.
Science 1991b; 253(5020): 661-5.
82. Fearnhead NS, Wilding JL, Bodmer WF. Genetics of colore-
ctal cancer: hereditary aspects and overview of colorectal tu-
morigenesis. Br Med Bull 2002; 64: 27-43.
83. Laurent-Puig P, Broud C, Soussi T. APC gene: database of
germline and somatic mutations in human tumors and cell li-
nes. Nucleic Acids Research 1998; 26(1): 269-270.
84. Leslie A, Pratt NR, Gillespie K, Sales M, Kernohan NM,
Smith G, Wolf CR, Carey FA, Steele RJ. Mutations of APC,
K-ras, and p53 are associated with specific chromosomal aber-
rations in colorectal adenocarcinomas. Cancer Res 2003; 63
(15): 4656-61.
85. Miyaki M, Kuroki T. Role of Smad4 (DPC4) inactivation in
human cancer. Biochem Biophys Res Commun 2003; 306 (4):
799-804.
86. Kaeda J, Chase A, Goldman JM. Cytogenetic and molecular
monitoring of residual disease in chronic myeloid leukaemia.
Acta Haematol 2002; 107(2): 64-75.
87. Pauletti G, Godolphin W, Press MF, Slamon DJ. Detection
and quantitation of HER-2/neu gene amplification in human
breast cancer archival material using fluorescence in situ hybri-
dization. Oncogene 1996; 13(1): 63-72.
88. Guitart J, Camisa C, Ehrlich M, Bergfeld WF. Long-term im-
plications of T-cell receptor gene rearrangement analysis by
Southern blot in patients with cutaneous T-cell lymphoma. J
Am Acad Dermatol 2003; 48(5): 775-9.
89. Palmieri G, Ascierto PA, Perrone F, Satriano SM, Ottaiano A,
Daponte A, Napolitano M, Caraco C, Mozzillo N, Melucci
MT, Cossu A, Tanda F, Gallo C, Satriano RA, Castello G.
Prognostic value of circulating melanoma cells detected by re-
verse transcriptase-polymerase chain reaction. J Clin Oncol
2003; 21(5): 767-73. Erratum in: J Clin Oncol 21(10): 2048.
90. Kunieda K, Yamaguchi K, Saji S. Significance of detection of
micrometastases in regional lymph nodes in cancer patients
using RT-PCR. Nippon Geka Gakkai Zasshi 2001; 102(6):
449-52.
91. Van der Velden VH, Hochhaus A, Cazzaniga G, Szczepanski
T, Gabert J, van Dongen JJ. Detection of minimal residual di-
sease in hematologic malignancies by real-time quantitative
PCR: principles, approaches, and laboratory aspects. Leuke-
mia 2003; 17(6): 1013-34.
92. Yeatman TJ. The future of clinical cancer management: one
tumor, one chip. Am Surg 2003; 69(1): 41-4.
93. Macgregor PF, Squire JA. Application of microarrays to the
analysis of gene expression in cancer. Clin Chem 2002; 48(8):
1170-7.

.

.
20
, - . -

. 100 ,
10.
, - O
1,2. , -
1930 - 510%. O -
-
.
- -
3. 1960 - , -
, , .
, -
4. 1980 O O OO
O .
,
5,6,7. 1990 - -
. -
. , -
- . , -
. -
- -
- .
. -
- 11,12.
. -
. . O -
- DNA, -
. -
. -
(30%)8,
.
510%9. ,
O - DNA
- ,
, - .
, -
. O , - , -
, .

311
312 OY

DNA - , -
(insertions), DNA -
(point mutations), (deletions), (am- -
plifications) (translocations)13. .
O - -
. - .
-
. O -
. , -
, , - ,
, ..13.
DNA
. OOO O
100 14.
, ,
,
. , ..15,16,17. -
, DNA
- .
Mendel
. , - 50%

1.

APC O , , ,
(FAP)
MSH2 HNPCC ( , , ,
MSH6 ) , , ,
MSH3
MLH1
PMS1
PMS2
BRCA 1 O / / ?
BRCA 2 O ?, /
STK11 Peutz-Jeghers , , ,

VHL Von Hippel Lindau ,
CDKN2

RB O
NF2 , ,

NF1 , ,
, , -
, ,

Wilms WT1 Wilms
p53 Li-Fraumeni , , ,
,
RET MEN 2A, MEN 2B, ,

V. 313

. O O (GENETIC TESTING)
. -
. .. -
2 (multiple endocrine neopla-
5% 10%18,19. sia type 2 2)
O
- . O -
, .
(penetran- , -
ce), (
23.
),
O -
,
DNA, RNA, ,
15.
,

, ,
1. O
. O
-

(.. -
. O

,
), -
,
, -
,
. -
,
1 -
- 24.
. - O
, -
20. -
, .
. - -

. O - . -
..
. O RET
.. - 2, -
.
. -
. RET 8595% -
, - 25.
-
. . O
, - ( = -
21, )
22.

, - . -
. BRCA 1 BRCA
2, , -
, 26.
, -
,
- . O -
20. -
314 OY

. - 32.
, - -
. O -
. -
2 RET - -
, - -
- ,
. -
, -
, 33,34. -
. O
BRCA 1 BRCA 2 , -
, -
,
- 33.
. O , - -
, . -
2685%. O - , -
, - (pedigree), -
27,28,29.
-
, - ,
- . -
24. -
( , ,
), -
(penetrance) - .
.
, 35.
- O -
. .
100% . .
, -
, -
75%. - -
. - .
-
, - OOO O O
O
30,31. -
, - . O
DNA, ... 2002 205.000.
- 40.000
. O 33. -
( - , 510%,
), 10.250 20.500 .
. - O

. -
, ,
, -
V. 315

-
BRCA 1/BRCA 2. O - -
, BRCA 1 BRCA
, 242. , -
Li-Fraumeni ( p53),
. - 52 Cowden ( pTEN)
12,9% Peutz-Jeghers (
STK11/LKB1),
38. ,
- 74 37.
43. -
. O - , -
- CHEK,
, - -
, - , -
. - 44.
BRCA 1 BRCA 2 --
- , -
, .
- -
, ,
50 . - ,
- Newman et al 198845. Hall et al
5% - BRCA 1 -
13% 38. 17q2146.
-
. ,

, -
. O , - 47.
, , O 1994, -
BRCA 1 -
. O
. -48. -
, - -
, -
. - BRCA 1. O -
. - ,
, ,
. - 13q1217
- 1995 -
39,40. BRCA 1.
- BRCA 2 49. -
-
10% 41:
1. (< 45). , -
2. . BRCA 1 BRCA 250,
3. 2 . 51,52,53.
4. . -
5. -. . -
6. . .
316 OY

BRCA DNA.
0,1% 54, ,
42. - DNA
( , -
BRCA. ,
(1 40) ), ,
(185 . O -
delAG 538insC BRCA 1 6174delT BRCA BRCA,
2)55,56,57,58. 6 -
10% , Fan-
30 coni65. -
40% DNA -
57,58. - ,
, .. -
41. . , -
O BRCA 1 BRCA 2 - BRCA, -
. - -
BRCA 1 BRCA 2
, .
5987% BRCA 1
DNA,
3880% BRCA 2. -
66. -
. -
,

,
, 40% 50%
59,56,57. O -
. -
-
BRCA 1
4060%,
BRCA 2, -
2231%60. O -
- - , -
BRCA 2 6,3%61. O . O
BRCA BRCA
1 25% 65% (- -
BRCA 2, .
15% 25%)62,63. BRCA 1
O BRCA - -
- -
. O -
( .
) -
64. O -
35%
45% BRCA 161. O -
BRCA 2 67,68,65.
, , -
, 60, , -
61,62,63. BRCA,
. O
BRCA 1 50 49% 28% -
BRCA 2, - BRCA 1 BRCA 2 42. -
. O -
- , BRCA
V. 317

, -
50 79% -
BRCA 1 67% - BRCA, -
BRCA 2. - .
,
BRCA69. -
O - .
BRCA - -
: -
( - ,
- . -
), -
. -
76.
. O - -
BRCA 1 , , - ,
, - 72. O
BRCA 2. -
HER2/neu , 25% 30% -
BRCA 1, . O
p5370. -
O - .
BRCA , -
. 72,77.
-
- -
. - -
, - , BRCA
p5371. , -
. O -
. - : 1. -
- ( / ), 2.
, -
- 3. .

BRCA. -
, - -
, - 78,79. -
- 90% -
. - 81% -
- ,
, 80. 105 ,
72, ,
73,74. -
. - 6,4 . O
,
BRCA - 78.
, - . 70%
- -
, 75. 19%
81,82. (
318 OY

) , . 2004 56.000
-
83. , 10%
- .
- 5% - 88.
. - O
.
83. BRCA ,
- , -
- .
. - O , -
,
- . 70%
, . . 50
O - . -
- -
. 88,89.
: -
1. 10% . -
18 .
2. - , -
25 . .
3. ,
25 . Peutz-Jeghers .
4. - O
CA-125, ,
35 84. Lynch II
, -
H - 90,91.
- O -
85. 20% -
. O
- ,
. .
-
- ,
86. , . O -
-
, - 1,7 -
- BRCA. - . O
-
89,90.
, - 1990 Fearon Vogelstein92
BRCA 1. - -
, - . -
87. ,

OOO O O -. O -
O -
O - . O -
, , - , -
V. 319

- O, 80% -
. . -
- 300 APC
. O O98.
- APC (adenomatous po- APC, -
lyposis coli), -
. O , -
- . APC
, DNA -
(mismatch repair MMR). O - DNA O -
15% . 90%
. APC - -
MMR - . -
, - -
-. O , -
APC - , -.
, COX-2 K-ras, APC , - -
- , Tcf-4 (T
, DCC / DPC4 p53. cell factor-4), .
(OA)
Turcots (- G1
O ), Gard- ,
ner (O ) -
99,100,101.
, -
- APC -
- .
. - 169 1393 -
,
.
, - 102. -
.
-
, -
, 40 .
. - 1307,
- ,
93,94. 1465, 15465 2621,
- ..103,104,105.
APC (ade- -
nomatous polyposis coli). , -
O --
Herrera et al, - ( 100). O -
5q21 -
Gardner95. O -
1991 APC96. 106.
APC - . -
15 .
8.538 , - 16 107. -
2.834 97. -
APC 8085% - 100 -
320 OY

. O . , Bethesda,
-
- , -
- 4. Bethesda -
, , - 94%114.
.
, - 2. Amsterdam (1990)
. , -
108,109. 3 ,
. -
, :
( -
) -
50
O93.
O

- . - 3. Amsterdam
(1999)
1:1.000
5%
. O - (-
, ,
80% ) :

. O -
- 60%
. -
- 50

, ,

, ,
.
,
4. Bethesda
(1997)
,
. O -
:

110,111.
Amsterdam
2 -
. Amster- , -
dam 1990 -
O
-
(. 2). - / -
60%
112. / - . -
Amsterdam 1999 45
(. 3). Amsterdam, 40
-
45
, 80% 113.
1996 NCI (National Can- 45
cer Institute) -
, - 40
- -
45
. O -
V. 321

6 - ( -
DNA (mismatch repair genes MMR) - Bethesda). -
,
. - . O
- , -
hMSH2
DNA - hMLH1119.
. 90%
MMR : -
hMSH2 (human mutS homolog 2) - , -
2p16 hMSH2. 30% -
hMLH1 (human mutL homolog 1) - -
3P21 . -
hPMS1 hPMS2 (human postmeiotic segregation
1 2) 2Q31 7p22 . -
hMSH6 (human mutS homolog 6) EXO1 ..
2p16 120,121.
hMLH3, O
MLH1115. :
O -
, - Lynch I
Lyn-
, . ch II.
O - O . -
,
116.
-
. - . O
hMSH2 .. ,
, , 5
117. , -
O 118.
48 , -
DNA, - 20 .
. 10% , -
90% , -
(
, -
Amsterdam, - 6 -
15% - )91.
. Lynch II -
, -
MMR. - , -
, - 43%
- .
118. , ,
, , -
- . -
-
,
322 OY

122,123. O
O - -
DNA -
- -
. , 128. -
( 812% -
), - 129.
- -
. - ,
- ,
, 5--
124. .

: -
10 , -
(
100) -
-
100%130. O


O -

.
. 33
- ,
. .
-
. 131.
: O
, , , -
, -
, , - .
, . K
- 9q21 , -
. - 132. -
, Fallot MTS1 CDKN2.
, ..125. , p16
p14ARF. CDK2A
O -

-
p16 -
.
133. p16 ,
34 .
CDK4 CDK6, -

, -
DPC4/ -
SMAD4, - - (RB gene family proteins). -
18;21. - RB1 -
- E2F-1
PTEN, - RB1, -
. S.
, G1 S. p16 -
, CDK4.
Cowden, p16
PTEN 126,127. CDK4,
V. 323

, , /
134,135. . -
CDKN2A - . O -
, ,
. O , -
- .
, Peutz-Jeghers -
136. 142.
- O
, - . O -
- , , -
. - , , . O
, , - Peutz-Jeghers 13
, -
137. 142.
- Peutz-Jeghers
- STK11/LKB1 19p. -
. . .
5% -
, - -
- . -
138.
O CDKN2A 143,144.
,
Gardner
138,139.
, BRCA 2,
RB1 MC1R (melanocortin-1 receptor gene), - -
- . -
, , -
59,140,141. , , (
), ,
OO O .

Peutz-Jeghers
. -
E , - 713%
Peutz 1921 Gardner. O -
Jeghers 1949. Peutz-Jeghers Gardner
, - . -
, , - , , -
, , .. Gardner
, -
, . O - APC145,146,147.
39%143.
- Li-Fraumeni
Peutz- M .
Jeghers. .
p53 17p31 70%
, .
: 1. -
, 2. - Li-Fraumeni, :
Peutz-Jeghers, 3. - 1. ,
324 OY

45 . 1, -
2. - 153.
45
3. ( - 2
) ( (ultiple endocrine neoplasia MEN 2)
45 ). E ,
-
O 50% -
. 2
30 90% 70 . -
-
57%
. -
30 . O
DNA -
: ,
2
, , ,

, , -
.
.
2 3 -
,
: 2, 2
, ,

148,149,150.
(familial medullary thyroid cancer FMTC)154.
2
(ultiple endocrine neoplasia 1)
X -
E , ,

, - .
- 2 90% -
. O , 4050% 1020%
, .
1,
. , - 2 , -
. 1 -
Werner. ,
, 1, - 155.
. , , -
2
, 151.
1 X, 2, -
-
, -
Zollinger-Ellison, .
. O 2 -
O
, -
25 .
-
, -
Marfan. -
. O -
. O -
Zollinger-Ellison


2155.
. O 1 -
- O
. O 1 - E 2, -
. - -
152.
1 11q13 . -
- . - . RET
, .
V. 325

- , ,
: .
1. 10 - , RET --
. . -
2. RET . O
> 50 . RET -
3. 155. . 70% -

156,157.
- 2
. - RET - 90%, 2 85%
10. RET - 85%.
, - DNA
100% .
. RET
- -
- DNA158.

1. Cripps WH. Two cases of disseminated polyps of the rectum.
Trans Path. Soc Lond 1882; 33: 165-168.
2. Smith T. Three cases of multiple polypi of the lower bowel oc-
curring in one family. St Bartholomews Hosp Rep 1887; 23:
225-229.
3. Macklin MT. Inheritance of cancer of stomach and large inte-
stine in man. J Natl Cancer Inst 1960; 24: 551-571.
4. Lynch HT, Shaw MW, Magnuson CW, et al. Hereditary fa-
ctors in cancer: study of two large Midwestern kindreds. Arch
Intern Med 1966; 117: 206-212.
5. Herera L, Kakati S, Gibas L, et al. Gardner syndrome in a man
with an interstitial deletion of 5q. Am J Med Gene 1986; 25:
473-476.
6. Leppert M, Dobbs M, Scambler P, et al. The gene for familial
polyposis coli maps to the long arm of chromosome 5. Science
1987; 238: 1411-1413.
7. Kinzler KW, Nilbert MC, Su LK, et al. Identification of FAP
locus genes from chromosome 5q21. Science 1991; 253: 661-
665.
8. Haber DA, Housman DE. Rate-limiting steps: The genetics of
pediatric cancers [Review]. Cell 1991; 64: 5-8.
9. Marx J. New colon cancer gene discovered. Science 1993; 260:
751-752.
10. Scotto J, Fraumeni JF. Skin (other than melanoma). In: Schot-
tenfeld D, Fraumeni JF, eds. Cancer epidemiology and pre-
vention. Philadelphia: WB Saunders, 1982: 254.
11. Bishop JM. Molecular themes in oncogenesis. Cell 1991; 64:
235-238.
12. Vogelstein B, Kinzler KW. The multistep nature of cancer.
Trends Genet 1993; 9: 138-141.
13. Kirsch IR. Oncogenesis. In: Oldman KT, Foglia RB, Colom-
bani PM, eds. Surgery of infants and children: Principles and
Practice. Philadelphia: Lippincott-Raven, 1996: 549-567.
14. Cheng A, Keith C, Loeb LA. Genomic Instability and Tumor
Progression: Mechanistic Considerations. Advances in Cancer
Research 1993; 60: 121-156.
15. Kinzler KW, Vogelstein B. Lessons from hereditary colorectal
cancer. Cell 1996; 87: 159-170.
16. Miki Y, Katagiri T, Kasumi F, et al. Mutation analysis in the
BRCA2 gene in primary breast cancers. Nat Genet 1996; 13:
245-247.
17. Wooster R, Neuhausen SL, Mangion J, et al. Localization of a
breast cancer susceptibility gene, BRCA2, to chromosome
13q12-13. Science 1994; 265: 2088-2090.
18. Marra G, Boland GR. Hereditary nonpolyposis colorectal can-
cer: the syndromes, the genes, and historical perspectives. J
Natl Cancer Inst 1995; 87: 1114-1125.
19. Ford D, Easton DF, Bishop DT, et al. Risks of cancer in
BRCA1-mutation carriers. Breast Cancer Linkage Consortium.
Lancet 1994; 343: 692-695.
20. Grogan L, Kirsch IR. Genetic testing for cancer risk assess-
ment: A Review. The Oncologist 1997; 2: 208-222.
21. Doll R, Peto R. Mortality in relation to smoking: 20 years ob-
servations on male British doctors. Br Med J 1976; 2: 1525-
1536.
22. Loeb LA, Ernster VL, Warner KE, et al. Smoking and lung
cancer: an overview. Cancer Res 1984; 44: 5940-5958.
23. Hoff AO, Cote GJ, Gagel RE. Multiple endocrine neoplasias.
Annu Rev Physiol 2000; 62: 377-411.
24. Holtzman NA, Watson MS, eds. Promoting safe and effective
genetic testing in the United States: final report of the Task
Force on Genetic Testing. Baltimore: Johns Hopkins Univer-
sity Press, 1999.
25. Kebebew E, Ituarte PH, Siperstein AE, et al. Medullary thy-
roid carcinoma: clinical characteristics, treatment, prognostic
factors, and a comparison of staging systems. Cancer 2000; 88:
1139-1148.
26. Brody LC, Biesecker BB. Breast cancer susceptibility genes:
BRCA1 and BRCA2. Medicine (Baltimore) 1998; 77: 208-226.
326
27. Wells SA jr, Skinner MA. Prophylactic thyroidectomy, based
on direct genetic testing, in patients at risk for the multiple en-
docrine neoplasia type 2 syndromes. Exp Clin Endocrinol Dia-
betes 1998; 106: 29-34.
28. Niccoli-Sire P, Murat A, Baudin E, et al. Early or prophylactic
thyroidectomy in MEN2/FMTC gene carriers: results in 71
thyroidectomized patients. Eur J Endocrinol 1999; 141: 468-
474.
29. Statement of the American Society of Clinical Oncology: Ge-
netic testing for cancer susceptibility, adopted on February 20,
1996. J Clin Oncol 1996; 141: 1730-1740.
30. Welch HG, Burke W. Uncertainties in genetic testing for chro-
nic disease. JAMA 1998; 280: 1525-1527.
31. Burke W. Genetic Testing. N Engl J Med 2002; 347: 1867-1875.
32. Biesecker BB, Boehnke M, Calzone K, et al. Genetic counsel-
ing for families with inherited susceptibility to breast and ova-
rian cancer. JAMA 1993; 269: 1970-1974.
33. American Society of Clinical Oncology Policy Statement Up-
date: Genetic testing for cancer susceptibility. J Clin Oncol
2003; 21: 2397.
34. Matloff ET, Peshkin BN. Complexities in cancer genetic coun-
seling: breast and ovarian cancer. Principles and Practice of
Oncology Updates 1998; 12:1-3.
35. Jemal A, Thomas A, Murray T, et al. Cancer statistics, 2002.
CA Cancer J Clin 2002; 52: 23-47.
36. Yang Q, Khoury MJ, Rodriguez C, et al. Family history score
as a predictor of breast cancer mortality: Prospective data
from the cancer prevention study II, United States, 1982-1991.
Am J Epidemiol 1998; 147: 652-660.
37. Pharoah PD, Day NE, Duffy S, et al. Family history and the
risk of breast cancer: A systematic review and meta-analysis.
Int J Cancer 1997; 71: 800-811.
38. Collaborative Group of Hormonal Factors in Breast Cancer.
Familial breast cancer: collaborative reanalysis of individual
data from 52 epidemiological studies including 58,209 women
with breast cancer and 101,986 women without the disease.
Lancet 2001; 358: 1389-1399.
39. Claus EB, Schildkraut JM, Thomson WD, et al. The genetic
attributable risk of breast and ovarian cancer. Cancer 1996; 77:
2318-2324.
40. Newman B, Austin MA, Lee M, et al. Inheritance of human
breast cancer: evidence for autosomal dominant transmission
in high-risk families. Proc Natl Acad Sci USA 1988; 85: 3044-
3048.
41. Frank TS, Deffenbaugh AM, Reid JE, et al. Clinical characte-
ristics of individuals with germline mutations in BRCA1 and
BRCA2: analysis of 10,000 individuals. J Clin Oncol 2002; 20:
1480-1490.
42. Ford D, Easton DF, Stratton M, et al. Genetic heterogeneity
and penetrance analysis of the BRCA1 and BRCA2 genes in
breast cancer families. The Breast Cancer Consortium. Am J
Hum Gent 1998; 62: 676-689.
43. Martin AM, Weber BL. Genetic and hormonal risk factors in
breast cancer. J Natl Cancer Inst 2000; 92: 1126-1135.
44. Olsen JH, Hahnemann JM, Boressen-Dale AL, et al. Cancer
in patients with ataxia-telangiectasia and in their relatives in
Nordic countries. J Natl Cancer Inst 2001; 93: 121-127.
OY
45. Hall JM, Lee MK, Newman B, et al. Linkage of early-onset fa-
milial breast cancer to chromosome 17q21. Science 1990; 250:
1684-1689.
46. Miki Y, Swensen J, Shattuck-Eidens D, et al. A strong candi-
date for the breast and ovarian cancer susceptibility current
BRCA2 6174delT mutations in Ashkenazi Jewish women affe-
cted by breast cancer. Nat Genet 1996; 13: 126-128.
47. Offit K, Gilewski T, McGuire P, et al. Germline BRCA1
185delAG mutations in Ashkenazi Jewish women with breast
cancer. Lancet 1996; 347: 1643-1645.
48. Tonin P, Serova O, Lenoir G, et al. BRCA1 mutations in Ash-
kenazi Jewish women. Am J Hum Genet 1995; 57: 189.
49. Tonin P, Weber B, Offit K, et al. Frequency of recurrent BRCA1
and BRCA2 mutations in Ashkenazi Jewish breast cancer
families. Nat Med 1996; 2: 1179-1183.
50. Wilson CA, Ramos L, Villasenor MR, et al. Localization of
human BRCA1 and its loss in high-grade, non-inherited breast
carcinomas. Nat Genet 1999; 21: 236-240.
51. Bieche I, Nogues C, Lidereau R. Overexpression of BRCA2
gene in sporadic breast tumours. Oncogene 1999; 18: 5232-5238.
52. Chan KY, Ozcelik H, Cheung AN, et al. Epigenetic factors
controlling the BRCA1 and BRCA2 genes in sporadic ovarian
cancer. Cancer Res 2002; 62: 4151-4156.
53. Hughes-Davis L, Huntsman D, Ruas M, et al. EMSY links the
BRCA2 pathway to sporadic breast and ovarian cancer. Cell
2003; 115: 523.
54. Ford D, Easton DF, Peto J. Estimates of the gene frequency of
BRCA1 and its contribution to breast and ovarian incidence.
Am J Hum Genet 1995; 57: 1457-1462.
55. Breast Cancer Linkage Consortium. Cancer risks in BRCA2
mutation carriers. J Natl Cancer Inst 1999; 91: 1310-1316.
56. Prevalence and penetrance of BRCA1 and BRCA2 mutations
in a population-based series of breast cancer cases. Anglian
Breast Cancer Study Group. Br J Cancer 2000; 83: 1301-1310.
57. Struewing JP, Hartge P, Wacholder S, et al. The risk of cancer
associated with specific mutations of BRCA1 and BRCA2
among Aschkenazi Jews. N Engl J Med 1997; 336: 1401-1408.
58. Abeliovich D, Kaduri L, Lerer I, et al. The founder mutations
185delAG and 5382insC in BRCA1 and 6174delT in BRCA2
appear in 60 percent of ovarian cancer and 30 percent of early-
onset breast cancer patients among Ashkenazi Jewish women.
Am J Hum Genet 1997; 60: 505-514.
59. Breast Cancer Linkage Consortium. Cancer risks in BRCA2
mutation carriers. J Natl Cancer Inst 1999; 91: 1310-1316.
60. Brose MS, Rebbeck TR, Calzone KA, et al. Cancer risk esti-
mates for BRCA1 mutation carriers identified in a risk evalua-
tion program. J Natl Cancer Inst 2002; 94: 1365-1372.
61. Liede A, Karlan BY, Narod SA. Cancer risks for male carriers
of germline mutations in BRCA1 and BRCA2: a review of the
literature. J Clin Oncol 2004; 22: 735-742.
62. Easton DF, Ford D, Bishop DT. Breast and ovarian cancer in-
cidence in BRCA1-mutation carriers. Breast Cancer Linkage
Consotrium. Am J Hum Genet 1995; 56: 265-271.
63. Antoniou A, Pharoah PD, Narod S, et al. Average risks of
breast and ovarian cancer associated with BRCA1 or BRCA2
mutations detected in case series unselected for family history:
a combined analysis of 22 studies. Am J Hum Genet 2003; 72:
V.
1117-1130.
64. Garber JE, Syngal S. One less thing to worry about: the shrink-
ing spectrum of tumors in BRCA founder mutation carriers. J
Natl Cancer Inst 2004; 96: 2-3.
65. Venkitaraman AR. Cancer susceptibility and the functions of
BRCA1 and BRCA2. Cell 2002; 108: 171-182.
66. Cass I, Baldwin RL, Varkey T, et al. Improved survival in wo-
men with BRCA-associated ovarian carcinoma. Cancer 2003;
97: 2187-2195.
67. Moygnahan ME, Chiu JW, Koller BH, et al. BRCA1 controls
homology-directed DNA repair. Mol Cell 1999; 4: 511-518.
68. Moyanahan ME, Pierce AJ, Jasin M. BRCA2 is required for
homology-directed repair of chromosomal breaks. Mol Cell
2001; 7: 263-272.
69. Warner E, Foulkes W, Goodwin P, et al. Prevalence and pene-
trance of BRCA1 and BRCA2 gene mutations in unselected
Ashkenazi Jewish women with breast cancer. J Natl Cancer
Inst 1999; 91: 1241-1247.
70. The Breast Cancer Linkage Consortium. Pathology of familial
breast cancer: differences between breast cancers in carriers of
BRCA1 and BRCA2 mutations and sporadic cases. Lancet
1997; 349: 1505-1510.
71. Risch HA, McLaughlin JR, Cole DE, et al. Prevalence and pe-
netrance of germline BRCA1 and BRCA2 mutations in a po-
pulation series of 649 women with ovarian cancer. Am J Hum
Genet 2001; 68: 700-710.
72. Robson M, Levin D, Federici M, et al. Breast conservation
therapy for invasive breast cancer in Ashkenazi women with
BRCA gene founder mutations. J Natl Inst 1999; 91: 2112-
2117.
73. Chappuis PO, Kapusta L, Begin LR, et al. Germline BRCA1/2
mutations and r27(Kip1) protein levels independently predict
outcome after breast cancer. J Clin Oncol 2000; 18: 4045-4052.
74. Foukes WD, Wong N, Brunet JS, et al. Germ-line BRCA1
mutation is an adverse prognostic factor in Ashkenazi Jewish
women with breast cancer. Clin Cancer Res 1997; 3: 2465-
2469.
75. Boyd J, Sonoda Y, Fedrici MG, et al. Clinicopathologic featu-
res of BRCA-linked and sporadic ovarian cancer. JAMA 2000;
283: 2260-2265.
76. Haffty BG, Harrold E, Matloff E, et al. Outcome of conserva-
tive managed early-onset breast cancer by BRCA1/2 status.
Lancet 2002; 359: 1471-1477.
77. Verhoog LC, Brekelmans CT, Seynaeve C, et al. Contralateral
breast cancer risk is influenced by the age at onset in BRCA1-
associated breast cancer. Br J Cancer 2000; 83: 384-386.
78. Rebbeck TR, Friebel T, Lynch HT, et al. Bilateral Prophyla-
ctic Mastectomy Reduces Breast Cancer Risk in BRCA1 and
BRCA2 Mutation Carriers: The PROSE Study Group. J Clin
Oncol 2003; 22: 1055.
79. Stefanek M, Hartmann L, Nelson W. Risk-reduction maste-
ctomy: Clinical issues and research needs. J Natl Cancer Inst
2001; 93: 1297-1306.
80. Hartmann LC, Sellers TA, Woods JE, et al. Efficacy of bilate-
ral prophylactic mastectomy in women with a family history of
breast cancer. N Engl J Med 1999; 340: 77-84.
81. Frost MH, Schaid DJ, Sellers TA, et al. Long term satisfaction
327
and psychological and social function following bilateral pro-
phylactic mastectomy. JAMA 2000; 284: 319-324.
82. Borgen PI, Hill AD, Tran KN, et al. Patient targets after bila-
teral prophylactic mastectomy. Ann Surg Oncol 1998; 5: 603-
606.
83. Burke W, Daly M, Garber J, et al. Recommendations for fol-
low-up care of individuals with an inherited predisposition to
cancer. JAMA 1997; 277: 997-1000.
84. Brekelmans CT, Seynaeve C, Bartels CC, et al. Effectiveness
of breast cancer surveillance in BRCA1/2 gene mutation car-
riers and women with high familial risk. J Clin Oncol 2001; 19:
924-930.
85. Stoutjesdijk MJ, Boetes C, Jager GJ, et al. Magnetic resonance
imaging and mammography in women with a hereditary risk of
breast cancer. J Natl Cancer Inst 2001; 93: 1095-1102.
86. Narod SA, Brunet JS, Ghadirian P, et al. Tamoxifen and risk
of contralateral breast cancer in BRCA1 and BRCA2 muta-
tion carriers: a case-control study. Hereditary Breast Cancer
Clinical Study Group. Lancet. 2000; 356: 1876-1881.
87. King MC, Wieand S, Hale K, et al. Tamoxifen and breast can-
cer incidence among women with inherited mutations in
BRCA1 and BRCA2: National Surgical Adjuvant Breast and
Bowel Project (NSABPP1) Breast Cancer Prevention Trial.
JAMA 2001; 286: 2251-2256.
88. Ries L, Kosary CL, Hankey BF, et al. SEER cancer statistics
review 1973-1995. Bethesda, National Cancer Inst, 1998.
89. Wei EK, Giovannuci E, Wu K, et al. Comparison of risk fa-
ctors for colon and rectal cancer. Inst J Cancer 2004; 108: 433-
442.
90. Burt RW, DiSario JA, Cannon-Albright L. Genetics of colon
cancer: Impact of inheritance on colon cancer risk. Annu Rev
Med 1995; 46: 371-379.
91. Lynch HT, Smyrk TC, Watson P, et al. Genetics, natural histo-
ry, tumor spectrum, and pathology of hereditary non-polyposis
colorectal cancer: An updated review. Gastroenterology 1993;
104: 1535-1549.
92. Fearon ER, Vogelstein B. A genetic model for colorectal tu-
morigenesis. Cell 1990; 61: 759-767.
93. Sieber OM, Lipton L, Crabtree M, et al. Multiple colorectal a-
denomas, classic adenomatous polyposis, and germline muta-
tions in MYH. N Engl J Med 2003; 348: 791-799.
94. Wennstrom J, Pierce ER, McKusick VA. Hereditary benign
and malignant lesions of the large bowel. Cancer 1974; 34:
suppl: 850-857.
95. Herrera L, Kakati S, Gibas L, et al. Gardner syndrome in a
man with an interstitial deletion of 5q. Am J Med Genet 1986;
25: 473-476.
96. Kinzler KW, Nilbert MC, Su LK, et al. Identification of FAP lo-
cus genes from chromosome 5q21. Science 1991; 253: 661-665.
97. Groden J, Thiveris A, Samowitz W, et al. Identification and
characterization of the familial adenomatous polyposis coli ge-
ne. Cell 1991; 66: 589-600.
98. Aaltonen LA, Peltomaki P, Leach FS, et al. Clues to the pa-
thogenesis of familial colorectal cancer. Science 1993; 260:
812-816.
99. Shibata H, Toyama K, Shioya H, et al. Rapid colorectal ade-
noma formation initiated by conditional targeting of the APC
328
gene. Science 1997; 278: 120-123.
100. Goss KH, Groden J. Biology of the adenomatous polyposis
coli tumor suppressor. J Clin Oncol 2000; 18: 1967-1979.
101. Korinek V, Barker N, Morin PJ, et al. Constitutive transcri-
ptional activation by a beta-catenin-Tcf complex in APC+ co-
lon carcinoma. Science 1997; 275: 1784-1787.
102. Spirio L, Olschwang S, Groden J, et al. Alleles of the APC ge-
ne: an attenuated form of familial polyposis. Cell 1993; 75:
951-957.
103. Laken SJ, Petersen GM, Gruber SB, et al. Familial colorectal
cancer in Askenazim due to a hypermutable tract in APC. Nat
Genet 1997; 17: 79-83.
104. Nagase H, Miyoshi Y, Horii A, et al. Correlation between the
location of germ-line mutations in the APC gene and the
number of colorectal polyps in familial adenomatous polypo-
sis patients. Cancer Res 1992; 52: 4055-4057.
105. Giardello FM, Petersen GM, Piantadosi S, et al. APC gene
mutations and extraintestinal phenotype of familial adenoma-
tous polyposis. Gut 1997; 40: 521-526.
106. Hernegger GS, Moore HG, Guillem JG. Attenuated familial
adenomatous polyposis: an evolving and poorly understood
entity. Dis Colon Rectum 2002; 45: 127-134.
107. Petersen G, Slack J, Nakamura Y. Screening guidelines and
premorbid diagnosis of familial adenomatous polyposis using
linkage. Gastroenterology 1991; 100: 1658-1661.
108. Statement of the American Society of Clinical Oncology. Ge-
netic testing for cancer susceptibility. J Clin Oncol 1996; 14:
1730-1736.
109. NCCN colorectal cancer screening practice guidelines. Natio-
nal Comprehensive Cancer Network. Oncology 1999; 13: 152-
157.
110. Ahlquist DA. Aggressive polyps in hereditary nonpolyposis
colorectal cancer: targets for screening. Gastroenterology 1995;
108: 1590-1592.
111. Rijken FE, Hollema H, Kleibeuker JH. Proximal adenomas
in hereditary non-polyposis colorectal cancer are prone to ra-
pid malignant transformation. Gut 2002; 50: 382-386.
112. Syngal S, Fox EA, Eng C, et al. Sensitivity and specificity of
clinical criteria for hereditary non-polyposis colorectal cancer
associated mutations in MSH2 and MSH1. J Med Genet
2000; 37: 641-645.
113. Vasen HF, Watson P, Mecklin JP. New clinical criteria for he-
reditary nonpolyposis colorectal cancer. (HNPCC, Lynch syn-
drome) proposed by the International Collaborative group on
HNPCC. Gastroenterology 1999; 116: 1453-1456.
114. Rodriguez-Bigas MA, Boland CR, Hamilton SR, et al. A Na-
tional Cancer Institute workshop on hereditary nonpolyposis
colorectal cancer syndrome: Meeting highlights and Bethesda
guidelines. J Natl Cancer Inst 1997; 89: 1758-1768.
115. De Jong AE, Morreau H, Van Puijenbroek M, et al. The role
of mismatch repair gene defects in the development of adeno-
mas in patients with HNPCC. Gastroenterology 2004; 126: 42-
48.
116. Prolla TA, Baker SM, Harris AC, et al. Tumor susceptibility
and spontaneous mutation in mice deficient in Mlh1, Pms1
and Pms2 DNA mismatch repair. Nat Genet 1998; 18: 276-
279.
OY
117. Lynch HT, Smyrk TC. Identifying hereditary nonpolyposis co-
lorectal cancer (editorial). N Engl J Med 1998; 338: 1537-
1538.
118. Gryfe R, Kim H, Hsieh ETK, et al. Tumor microsatellite in-
stability and clinical outcome in young patients with colore-
ctal cancer. N Engl J Med 2000; 342: 69-77.
119. Boland CR, Thibodeau SN, Hamilton SR, et al. A National
Cancer Institute Workshop on microsatellite instability for
cancer detection and familial predisposition: development of
international criteria for the determination of microsatellite
instability in colorectal cancer. Cancer Res 1998; 58: 5248-
5257.
120. Wu Y, Berends MJ, Post JG, et al. Germline mutations of
exo1 gene in patients with hereditary nonpolyposis colorectal
cancer and atypical hnpcc forms. Gastroenterology 2001; 120:
1580.
121. Lynch HT, Coronel SM, Okimoto R, et al. Afounder muta-
tion of the MSH2 gene and hereditary nonpolyposis colore-
ctal cancer in the United States. JAMA 2004; 291: 718-724.
122. Aarnio M, Mecklin J, Aaltonen LA, et al. Lifetime risk of dif-
ferent cancers in hereditary nonpolyposis colorectal cancer
syndrome. Int J Cancer 1995; 64: 430-433.
123. Mecklin JP, Jarvinen HJ. Tumor spectrum in cancer family
syndrome (hereditary nonpolyposis colorectal cancer). Cancer
1991; 68: 1109-1112.
124. Carethers JM, Smith EJ, Behling CA, et al. Use of 5-fluorou-
racil and survival in patients with microsatellite-unstable colo-
rectal cancer. Gastroenterology 2004; 126: 394-401.
125. Howe JR, Roth S, Ringold JC, et al. Mutations in the
SMAD4/DPC4 gene in juvenile polyposis. Science 1998; 280:
1086-1088.
126. Olschwang S, Serova-Sinilnikova OM, Lenoir GM, et al. PTEN
germ-line mutations in juvenile polyposis coli. Nat Genet
1998; 18: 12-14.
127. Olschwang S, Serova-Sinilnikova OM, Lenoir GM, et al. PTEN
germ-line mutations in juvenile polyposis coli. Nat Genet
1998; 18: 12-14.
128. Haluska FG, Hodi FS. Molecular genetics of familial cuta-
neous melanoma. J Clin Oncol 1998; 16: 670-682.
129. Rivers JK. Melanoma. Lancet 1996; 347: 803-806.
130. Lynch HT, Frichot BC, Lynch JF. Familial atypical multiple
mole-melanoma syndrome. J Med Genet 1978; 15: 352-356.
131. Goldstein AM, Fraser MC, Clark WH, et al. Age at diagnosis
and transmission of invasive melanoma in 23 families with cu-
taneous malignant melanoma/dysplastic nevi. J Natl Cancer
Inst 1994; 86: 1385-1390.
132. Fountain JW, Karayiorgou M, Ernstoff MS, et al. Homozy-
gous deletions within human chromosome band 9q21 in mela-
noma. Proc Natl Acad Sci USA 1992; 89: 10557-10561.
133. Piepkorn M. Melanoma genetics: An update with focus on
the CDKN2A(P16)/ARF tumor suppressors. J Am Acad Der-
matol 2000; 42: 705-722.
134. Sviderskaya EV, Hill SP, Evans-Whioo TJ, et al. r16(Ink4a) in
Melanocyte Senescence and Differentiation. J Natl Cancer
Inst 2002; 94: 446-454.
135. Sviderskaya EV, Gray-Schopfer VC, Hill SP, et al. r16/Cyclin-
Dependent Kinase Inhibitor 2A deficiency in Human Mela-
V.
nocyte Senescence, Apoptosis and Immortalization: Possible
Implications for Melanoma Progression. J Natl Cancer Inst
2003; 95: 723-732.
136. Bishop DT, Demenais F, Goldstein AM, et al. Geographical
Variation in the Penetrance of CDKN2A Mutations for Mela-
noma. J Natl Cancer Inst 2002; 94: 894-903.
137. Tsao H, Zhang X, Kwitkiwski K, et al. Low prevalence of germ-
line CDKN2A and CDK4 mutations in patients with early-on-
set melanoma. Arch Dermatol 2000; 136: 1118-1122.
138. Blakwood MA, Holmes SR, Synnestvedt M, et al. Multiple
primary melanoma revisited. Cancer 2002; 94: 2248-2255.
139. Goldstein AM, Fraser MC, Struewing JP, et al. Increased risk
of pancreatic cancer in melanoma-prone kindreds with r161nk4
mutations. N Engl J Med 1995; 333: 970-974.
140. Eng C, Li FP, Abramson DH, et al. Mortality from second tu-
mors among long-term survivors of retinoblastoma. J Natl
Cancer Inst 1993; 85: 1121-1128.
141. Kennedy C, ter Huurne J, Sikkink S, et al. Melanocortin 1 re-
ceptor (MC1R) gene variants are associated with an increased
risk for cutaneous melanoma which is largely independent of
skin type and hair color. J Invest Dermatol 2001; 117: 294-
300.
142. Tomlinson JP, Houlston RS. Peutz-Jeghers syndrome. J Med
Genet 1997; 34: 1007-1011.
143. Hemminki A, Markie D, Tomlinson I, et al. A serine/threoni-
ne kinase gene defective in Peutz-Jeghers syndrome. Nature
1998; 391: 184-87.
144. Gruber SB, Entius MM, Petersen GM, et al. Pathogenesis of
adenocarcinoma in Peutz-Jeghers syndrome. Cancer Res 1998;
58: 5267-5270.
145. Gardner EJ, Richards RC. Multiple cutaneous and subcuta-
neous lesions occurring simultaneously with hereditary poly-
posis and osteomatosis. Am J Hum Genet 1953; 5: 139-147.
146. Gardner EJ. Follow-up study of a family group exhibiting do-
minant inheritance for a syndrome including intestinal polyps,
osteomas, fibromas and epidermoid cysts. Am J Hum Genet
329
1962; 14: 376-390.
147. Dobbie Z, Spycher M, Mary JL, et al. Correlation between
the development of extracolonic manifestations in FAP pa-
tients and mutations beyond codon 1403 in the APC gene. J
Med Genet 996; 33: 274-280.
148. Li FP, Fraumeni JF. Familial breast cancer, soft-tissue sarco-
mas, and other neoplasms. Ann Int Med 1975; 83: 833-834.
149. Macklin D, Li FP, Stron LC, et al. Germ line r53 mutations in
a familial syndrome of breast cancer, sarcomas, and other
neoplasms. Science 1990; 250: 1233-1238.
150. Hisada M, Garber JE, Fung CY, et al. Multiple primary can-
cers in families with Li-Fraumeni syndrome. J Natl Cancer
Inst 1998; 90: 606-611.
151. Werner P. Genetic aspects of adenomatosis of endocrine
glands. Am J Med 1954; 16: 363-367.
152. Skogseid B, Eriksson B, Lundqvist G, et al. Multiple endocri-
ne neoplasia type I: a 10-year prospective screening. J Clin
Endocrinol Metab 1991; 73: 281-287.
153. Chandrasekharappa SC, Guru SC, Manickam P, et al. Positio-
nal cloning of the gene for multiple endocrine neoplasia-type
I. Science 1997; 276: 404-407.
154. Brandi ML, Gagel RF, Angeli A, et al. Guidelines for diagno-
sis and therapy of MEN type 1 and 2. J Clin Endocrinol Me-
tab 2001; 86: 5658-5671.
155. Mulligan LM, Ponder BA. Genetic basis of endocrine disease:
multiple endocrine neoplasia type 2. J Clin Endocrinolo Me-
tab 1995; 80: 1989-1995.
156. Eng C. RET proto-oncogene in the development of human
cancer. J Clin Oncol 1999; 17: 380-393.
157. Mulligan LM, March DJ, Robinson BG, et al. Genotype-phe-
notype correlation in multiple endocrine neoplasia type 2: re-
port of the International RET Mutation Consortium. J Intern
Med 1995; 238: 343-346.
158. Ponder BA, Ponder MA, Coffey R, et al. Risk estimation and
screening in families of patients with medullary thyroid carci-
noma. Lancet 1999; 1: 397-401.
V

E
. , E. .................................................................................. 333

. .................................................................................................................... 341

. .................................................................................................................. 357

. ...................................................................................................... 371

(...)
. , . , . , . .................. 393

PSA
. .............................................................................................................. 405

. ...................................................................................................... 419


. , .

O , ,
O , .
, -
- -
1. 20002020 - , -
50% . -
- , -

1/3 ,
2. -
10.000.000 3. -
1 8 - .
,
. -
,
, -
- .
- -
.

(), . -
-
( / ), , -
-
. . -
- ,
: , , , -
- .
(.. , - -
) ,
(.. , - , -
) , - -
- .
, -
. -
- -
, -
4,5. -
-
.
- -

333
334 OY

, ,
/ , -
. , - , ,
-
, - . -
, - -

. - ,
- ( )
, -
-
, - 7.
, - 1 -
, - , -
. - , -
- -
- . -
. , -
, , -
. (.. -),
- -
- -
.
. 2 -
-
. H - ,
- 2000,
, - 20002020,
. .
-
: ,
-
6. 13%, -
, - 6% (2000, -
, - ). O , 20

1. -

(%)

/ 33
/ / / 31
>3
5
/ / <9
/ 6
/ 5
5

: Adami O, Day NE, Trichopoulos D, Willett WC. Primary and secondary prevention in the reduction of cancer morbidity and mortality.
European Journal of Cancer 2001; 37: S118-S127 ()
VI. 335

2. 2000, -
2020

, 2000 , 2020 , 2020

25 100 60
15 100 30
/ 10 30 1020
/ 0 0 0
/ 10 20 10
0 15 5
/ 5 30 15
0 0 0
5 20 10
30 60 45
20 50 30
5 15 10
0 15 5

,
30% - . -
4% - -
8. ,

E A (.. -
(.. - , ).
) , - -
- , -
, - .

. -

, . -

-

-
.
.
, -

,
, ,
.
- .
-
, - , -
( ) ,
. - 5.
- -
, -
, , -
. - . , -
-
. , -
- -
, - , -
.
. 45%
336 OY

, .
, 30% ,
, - -
3. . , ..
O -
,
, -
- (.. C),
. : . -
-
,
. - , -
, - -
- .
-. .
- -
.
(- .
) () -
, -
. .
- O
- .
. .. - -
- ,
, .
-
, -
. .

O EO

, - / -
, -
. . O -
,
.
. -

. -
, . O -
,
. , , -
,
, .
. O
,
, , -
9. O
. ,
, 50 ,
VI. 337

, - 12 -
- 4049 .
- -
60 10,11. ,
- . -
5074 -
(Pap test)11,12. 12 9,14.
O -
70% 50 ... -
- 17. O
9,13.
... -
Pap test , -
- ,

3 , - 21,22. -
65 9,14. O
-
30 -
20 .
- 5080 , 12
60 . , . H -
50
30 60 . - ,
35 23. -
3 5 15.
O - ,
. -

16. O
, , -
, 50 74 ,
12 15. O -
17. -
- -

18-20. O - .
O
50 69 , - ...
2 3 17. O
15. O -
40-49 (PSA).
, -
- .
, PSA
-
. ,
- 10 -
... 24-27. -
-
, 40 , - -
338 OY

28. 17.
..., 37%, -
. ...
50 11. - 1990
, -
(80% >65 31. -
), -
, -
() ,
.
-

29,30.
( ) -


15. - .
3 4
-
. ,
O -
, 75%
- .

3. O ...

/ 3 65

40 12 69
A 50 12
+
50 A 80
,
35
PSA ( 50
)

[ O , 2002]

4. O

20 35 60
50 23 69
A 50 12 74
+
O
PSA

, 1999
VI. 339

AI H IO BOCAN, EUCAN, WHOSIS, Harvard Center for Cancer

(Disease Registers) Prevention, Center for Diseases Control)32-36.
-
-
. - -
,
, -
, -
-
,
-
,
, -
-

.

-
.

, - -
-
-
(population or community register), 17.
-
,
- .
.
O , : 1.
2003 500.000 - , ,
, 2. ,
1.500 . -
4 ... - , 3.
. - , -
- , , -
, , -
(GLO- .

1. Murray CJL, Lopez AD, eds. The Global Burden of Disease. cology. 5th ed. Philadelphia: Lippincott-Raven, 1997, 231-257.
Cambridge, MA: Harvard University Press, 1996a. 7. Lagiou P, Trichopoulou A, Trichopoulos D. Nutritional epide-
2. WHO, World Cancer Report, Geneva, 2003. miology of cancer: accomplisments and prospects. Proceedings
3. Vainio H. Social Responsibility in Cancer Prevention Reseach: of the Nutrition Society 2002; 61: 217-222.
IARC as a Global Science Force. Asian Pac J Cancer Prev 8. Adami O, Day NE, Trichopoulos D, Willett WC. Primary and
2002; 3: 267-72. secondary prevention in the reduction of cancer morbidity and
4. . : , , . mortality. European Journal of Cancer 2001; S118-S127.
: . . . , 1982: 332-336. 9. Cancer and Figures 2002, American Cancer Society, 2002.
5. T , , . - http://www.cancer.org/downloads/SST/CancerFacts&Figures
& . - 2002TM.pdf (accessed on August, 2003).
. 2 . : , 10. Saslow D, Runowicz CD, Solomon D, et al. American Cancer
2000: 44-46. Society Guideline for the Early Detection of Cervical Neopla-
6. Harvard Center for Cancer Prevention. Harvard report on sia and Cancer. CA Cancer J Clin 2002; 52: 342-362.
cancer prevention, volume 2: prevention of human cancer. 11. Centers for Disease Control and Prevention.
Prevention of tobacco use. Cancer Causes and Control 1997, 8 http://www.cdc.gov/health/cancer.htm
(Suppl. 1), S5-S12. Trichopoulos D, Petridou E, Lipworth L et (accessed on February 3, 2003).
al. Epidemiology of Cancer. In: DeVita VT Jr, Hellman S, Ro- 12. Coste J, Cochand-Priollet B, de Cremoux P, Le Gales C, Car-
senberg SA, et al, eds. Cancer: Principles and Practice of On- tier I, Molinie V, Labbe S, Vacher-Lavenu MC, Vielh P.
340
French Society of Clinical Cytology Study Group. Cross sectio-
nal study of conventional cervical smear, monolayer cytology,
and human papillomavirus DNA testing for cervical cancer
screening. BMJ 2003 Apr 5; 326(7392): 733.
13. WHO and EUROGIN Press Release, 2000.
http://www.digene.com/corporate01/press_release/PR04_10_
2000.htm (accessed on February 3, 2003).
14. U.S. Preventive Services Task Force, 1996.
http://www.ahrq.gov/clinic/cps3dix.htm#cancer
(accessed on February 3, 2003).
15. eder FH, Paulson DF, Middleton AW Jr, Rukstalis DB, Smith
. JA Jr, Schellhammer PF, Ohori M, Chodak GW. Results of
http://europa.eu.int/comm/health/index_en.html
(accessed on February 3, 2003)
16. Smith RA, Cokkinides V, Eyre HJ. American Cancer Society.
American Cancer Society guidelines for the early detection of
cancer, 2003. CA Cancer J Clin 2003; 53: 27-43.
17. Hackshaw A. EUSOMA review of mammography screening.
Ann Oncol 2003 Aug; 14(8): 1193-5.
18. Hackshaw AK, Paul EA. Breast self-examination and death
from breast cancer: a meta-analysis. Br J Cancer 2003 Apr 7;
88(7): 1047-53.
19. Humphrey LL, Helfand M, Chan BK, Woolf SH. Breast cancer
screening: a summary of the evidence for the U.S. Preventive
Services Task Force. Ann Intern Med 2002 Sep 3; 137(5 Part
1): 347-60.
20. Oestreicher N, White E, Lehman CD, Mandelson MT, Porter
PL, Taplin SH. Predictors of sensitivity of clinical breast exa-
mination (CBE). Breast Cancer Res Treat 2002 Nov; 76(1):
73-81.
21. Pignone M, Rich M, Teutsch SM, Berg AO, Lohr KN.
Screening for Colorectal Cancer in Adults at Average Risk.
Summary of the Evidence for the U.S. Preventive Services
Task Force. Originally in Annals of Internal Medicine 2002;
137: 132-41.
22. Mulcahy HE, Farthing MJ, ODonoghue DP. Screening for
asymptomatic colorectal cancer. BMJ 1997; 314: 285-91.
23. American Cancer Society colorectal cancer screening guide-
lines.
http://www.cancer.org/docroot/CRI/content/CRI_2_4_3X_Can
_colon_and_rectum_cancer_be_found_early.asp?sitearea=CR
OY
(accessed on September 15, 2003).
24. Galic J, Karner I, Cenan L, Tucak A, Vranjes Z, Bilandzija-
Peranovic M, Hegedus I. Role of screening in detection of cli-
nically localized prostate cancer. Coll Antropol 2003; 27 Suppl
1: 49-54.
25. Mistry K, Cable G. Meta-analysis of prostate-specific antigen
and digital rectal examination as screening tests for prostate
carcinoma. J Am Board Fam Pract 2003 Mar-Apr; 16(2): 95-
101.
26. Gerber GS, Thisted RA, Scardino PT, Frohmuller HG, Schro-
radical prostatectomy in men with clinically localized prostate
cancer. JAMA 1996 Aug 28; 276(8): 615-9.
27. Krongrad A, Lai H, Lai S. Survival after radical prostatectomy.
JAMA 1997 Jul 2; 278(1): 44-6.
28. Holmberg L, Bill-Axelson A, Helgesen F, Salo JO, Folmerz P,
Haggman M, Andersson SO, Spangberg A, Busch C, Nordling
S, Palmgren J, Adami HO, Johansson JE, Norlen BJ. Scandi-
navian Prostatic Cancer Group Study Number 4. A randomiz-
ed trial comparing radical prostatectomy with watchful waiting
in early prostate cancer. N Engl J Med 2002 Sep 12; 347(11):
781-9.
29. Gann PH, Hennekens CH, Stampfer MJ. A prospective evalu-
ation of plasma prostate-specific antigen for detection of pro-
static cancer. JAMA 1995 Jan 25; 273(4): 289-94.
30. http://www.cdc.gov/cancer/prostate/prostate.htm
(accessed on September 17, 2003).
31. Adami HO, Hunter D, Trichopoulos D. Textbook of Cancer
Epidemiology. New York: Oxford University Press, 2002.
32. http://www.hsph.harvard.edu/cancer/
(accessed on September 18, 2003).
33. http://www3.who.int/whosis/menu.cfm
(accessed on September 18, 2003).
34. http://www-dep.iarc.fr/eucan/eucan.htm
(accessed on September 18, 2003).
35. http://www-dep.iarc.fr/globocan/globocan.html
(accessed on September 18, 2003).
36. http://www.cdc.gov/cancer/npcr/index.htm
(accessed on September 18, 2003).

.

E ,
- -
- . -

1. - -
- , , -
, , , , , -
. -
3.
-
, -

(promotion) (pro-
,
gression). 13-

cis-retinoic acid (13-cRA) (. 1), all-trans-retinoic
.
acid (ATRA), 9-cis-retinoic acid (9-cRA) .. -
-
in vitro -
1020 . ,
.
- -
. - RARs RxRs
(Field carcinogenesis)

, CH2OH

.
, - ( A)

(, , ),
, , , , -
.. COOH
(- 13-cis- ()
, ) ( ,
O
) .
CNH OH
- -
(.. ), -
4-HPR ()
-
. O
- COOH2CH3

2025% -
CH3O
2. -
.

O
-
-
1. .

341
342 OY

ATRA /13-cRA ATRA /13-cRA

2.


RAR- mRNA RAR-
.

RAR-

, - . 6 ,
- , - , -
4. , 4497%8,9. -
-
, -
. RAR- - -
, RAR- , .
RAR- . O -
RAR- -,
. - (placebo)
12 ,
14,8%, 27,5% 3%10 .
- - vs Retinyl Palmate placebo -
, 5 (. 2). - 33%, 52% 10% -
(preformed vit A) - 11.
, Usbekistan
. , - 6 -
-
OO ON O [dds ratio ( ) = 0,62, 95%, CI
-O = 0,390,98].
- - 13-cRA 2 mg/kgr 67%
) - ( ) 10% -
- placebo -
) . -
: )
. ) 13-cRA
, 50%
OOY O 3
O 13-cRA13.
- 13-cRA
3040% vs placebo, 13-cRA 3
, 5% - (1,5 mg/kgr*/)
. - 0,5/kgr*/ 13-cRA - (30 mg / kgr/
- ) 9 . 55% (95%,
3040% - CI = 4267%) -
6. .
8% 13-cRA -
, 55% -. -
13-cRA
7. 14.
- (4-HPR)
, ,
VI. 343

Laser, OO ON O
52 TOY O
( 3 ). - OOY O
6% - OI
4-HPR 30% -
TYLER (Texas) 755 -
15,16.
-
OOY O IO H- (50 mg / ) (25.000 IV / -
HO ) placebo. O
, .
-, 58 -
25% 2 -
. Hong 103 19. -
- -V 20 mg/kgr/
(0) 50100 mg/m2 13-cRA 12 (mi-
placebo. 32 cronuclei counts),
, - , 20.
(, , - ,
) 17. 8-x-7, 8-
13-cRA 2 (4%) - dihydro-2-deoxyguanosine,
12 (24%) placebo.
70% - .
-, . O - -
-
, , . , etretinate 25 mg / -
30% 13-cRA, 6 , -
18% 12 .
. - , -
55 , - 25 mg
1 etretinate placebo 6
. -
- .
etretinate placebo 316 - (etretinate) placebo21.
(1,2, 0) (1,2, 1) ... 93 -
. etre- -
tinate 50 mg / 1 - 13-cRA placebo
25 mg / 2 . 6 . -
41 - 2 . -
,
18. , -
etretinate - 2 .
, 2 (4-HRP)23 -
- placebo
. .. 13-cRA --
, -
etretinate. O .

(, OOY ON IO O Y-
), ( , OA
) 29.139 5068 ,
, , . 1
344 OY

36 , -- .
2 2, - , ,
(20 mg / ), a-tocopherol 50 mg / , -
placebo 58 - 28.
. O - - 307 -
-tocopherol -
18% retinyl palmitate
(RR: 1,18, 95%, CI = 1,031,36) 8% - (300.000 IU) .
(RR: 1,8, 95%, CI = 1,011,16). - 46 5
64% -
24. - 45% (p = 0,054)
, 62% 54% (p = 0,44). -
29
32% 41% -
a-tocopherol24. . ,
- 80%
- 1 29. M -
-, - 2 .
(Euroscan)
- (30 mg / ) (25.000 2 2, 2.592
IU / ) placebo. (Carotene x, T1-2,3, N0 1 --
and Retinol efficacy trial) , 1,2, 0 1, 3-0
retinyl
, - palmitate, N-acetylcysteine, placebo
28% (RR: 2 . -
1,28, 95%, CI = 1,041,57) - , -
(RR: 1,17, 95%, CI = 1,031,33) -
. - 30.
NCI (National Cancer Institute)
. - isotretinoin -
. -
O -
- 0,90 (95%, CI = 0,5 31.
1,4), 0,78 (95%, CI= 0,34 O
1,78)25. ,
, (.. -
( 2,1 - -
), Womens Health Study26. ).

-, -
XOO TON O
, - TOY O
-
- - H
- -
, - . -
27. - , -
-, ( -
- ), , -
450, - -
.
- -
VI. 345

, [< 49
, (44%), 5059 (51%) 60 (55%)]. O -
.
- (Lobular non-invasive
- Carcinoma, LCIS) 56%,
. .. 86% -
- Gail.
, ) -
(p < 0,002).
. - ) ,
, - -
- 69%,
. -
- .
. ) 20% -
, -
OE
(Colles). -
:
(Selective Estrogen Receptor ) -
Modulator, SERM), - .
) O 50
, - -
(adjuvant) . - ,
.
,
- -
. , -
NSABP-P1 -
. -
. , -
(1) Na- ,
tional Surgical Adjuvant Breast and Bowel Project -
(NSABP). , 1992, - 2 . -
13.388 20 , -
mg / placebo 5 . .
-
60 (
0,8%), ,
3559 - ,
(1,66% 5 ) -
Gail ( 1 - . -
, , - O
, ... (Food and Drug Administration
)32. FDA) -
69 - -
: Gail.
) M 49% -
(p < 0,00001) 12/1.000 NSABP-P1 -
- . , , -
43,4/1.000 O 1992
placebo. 1997 5.408 3570 , -
346 OY

, -
placebo33. - -
46 2 35.

(19 22 place-
bo). - -
1 , . NSABP-P1 -

(11 vs 19, p = 0,16)33. ,
,
- ,
(1 - -
362 - .
, 8
390 placebo, -
RR: 0,13, 95%, CI = 0,021,02). -
, , - .
(38 vs 18, p = 0,0053), - . O -
, (15 vs 2, p = (1520%)
0,0013). -
- . -
(LDL), (HDL) -
, - (1520%),
, - ,
. ,
LDL 2/3 - , . -
, . -
- , -
- , ,
, - . O-
- (, -
, - , )
. O - , -
, , -
, . -
( , -
, - , -
). ,
, , Royal .
Marsden 2.494 30 70 O -
- ) (..
, 1986 - 10 mg ),
1996 20 mg / , -
placebo 8 35. - Insulin-Growth Factor-1 (IGF-1)
70 10 mg ) -
- SERMs.
placebo ( 34, placebo 36, RR: 1,1,
95%, CI=0,71,7, p = 0,8). - OE
SERM
, - -
, .
VI. 347

- M -
, - 1987
. , 2.972
LDL - DCIS
, 200 mg / -
. 5 ,
, - . O
36.
, .
. , 8
-
, - 2 . -

placebo (1,7 1.000 / - -
3,7 - (27 42
1.000 / RR = 0,66, 95%, CI = 0,411,07),
placebo, RR: 0,46, CI = 0,280,75), -
54% . , (RR = 1,32, 95%, CI = 0,822,15).
35%
37. , -
39. -
- -
, , , -
IGF-140.
(NSABP-P2).
O I OE
I
(-4-HYDROXYPHENYL-RETINAMIDE 4-HPR) -
all- , in vitro in vivo -
trans , - -
. -
. 20 mg /
- .
. -
. -
-
, - 41,42,43,44.

. O - OI A ()
- O (
- ) -
.
, in vitro, . O
IGF-1. -
in vitro in -
vivo , , , - , , -
, . ( , ,
, , , ). O
-
, -
all-trans 38. . - -
348 OY

, O
O (dietery fibers) -
-

. . , ,
(ATAC), - , , 51.
- -
. O
45. ,
- . -
. , , ,
- ,
- 52. O
. -
- 53. 1970 Burkitt

. , ,
, -
OO TON O , -
TOY O O .
OI AO ,
,

. O -
-
, -
. O , -
- -
-
. 54.
. - , , -
(, ) - , , -
. 55-60.
, - , -
, -
, .. , -

46. - -
- (SCFAs), ,
- -
. - , -
61.
. - -
, - 13 -
- .
, -
- , p21
47-49. -
(Nurses Health Study) - c-fos, c-jun, -
- 62-63.

50.
VI. 349

a-difluro-methyl-ornithine (DFMO)
, DFMO
, - (ODC),
, -
. . ODC -
- ,
- .
- , - -
, - ,
61-63. .
Polyp Prevention Trial ODC, DFMO, -
35 - 68.
3 . O 45 DFMO
ODC -
(< 20% ) .
(18 g fiber / 1.000 calories),
(58 ) - 3 12 DFMO.
. -
Womens Health Clinical Trial 64.500 - DFMO69,70.
-
O OO O O-
, - (NSAIDs) OOY O
, , 3 : ) IO EO EO
(<20% ), -
7 4050% -
5 / 16 g
- -
, -

, )
NSAIDs,
, ) (1.000 mg / ), -
-
D3 (400 IU / placebo)
71.
64.
NSAIDs -
Arizona Phase III Study ,
(13,5 gr vs 2,0 gr . O , -
) 945 azothy-
, methane, , APC,
- -
65,66. - 72. NSAIDs
, , ,
O
, ,
, 3080%
. . NSAIDs -
- (
, , - ),
. 73.
930 , - NSAIDs , -
, - ( ),
vs ( -
placebo. O - ).
1 -
. 1 127 73.
(31%) 159 (38%) - 14/15 -
(RR: 0,81, 95%, CI = 0,670,99)67. -
350 OY

, 80% 78.
, O COX-2 -
, , . COX-2
. - (promotor)
- COX-2
, (disrup-
, tion) APC 79.
, - 5 -
. - COX FAP -
- .
10 . 12 6
150 Familial . -
Polyp Adenosis (FAP) - 3 (PGD2,
- PG2 6-keto PGF-1a) -
. - .
NSAIDs ( )74. , -
3 FAP 6-7 mm 80.
- -
- COX-2
. : -
) NSAIDs ,
) , (promotion) . -
) - COX-2 -
NSAIDs (..., -
, ). . O
OE O-OA 2 (COX-2)
COX-2 -
,
O - 1 2 (COX-1 COX-2) - NSAIDs. ,
-
-
(PG) 2
, -
, -
-
75. COX-1
.

- OO TON O
- TOY O
76. COX-2, -
OE IO O OA
, -
, , -
. .
COX-2 - ( ) -
,
. 81. -
COX-2 -
- 77.
- ,
- 40% - () 82. O
, - -
COX-277. -
APC - , 83. -
, APC -
COX-2 (knoking out cox-2 APC mice)
VI. 351

. 510% .
. 4. GSTP-1.
, .
2 3 1 DHT
, - -
. 5-, -
-
- DHT97. -
, - (Prostate Can-
cer Prevention Trial PCPT) placebo 18.882 -
55 84. > 55 -
1 (1q 2425, 1q 4243, 1q 36) PSA 3 ng/mc.
10 (q 2743).
K-RAS85,86, C- ,
myc87, 80% ,
, 6 2
. -- . -
cl-288,89, p5390,91 90% 25% -
RB - -
92,93.
.
(GSTP-1),
-
, - ) . -
-
(40%) -
94,95,96. 99. -
5-- -
- 5-- -
, (DHT), - 100. -
-
. - DHT - (
DNA )
, .
, . 13%,
-
- < 13 gr / 100.
. ) . stress -

H OOY TON IO .
O OAH (
), ( 450, -
, O -)
- . -
. (proliferate inflammatory atrophy PIA)
- PIN101.
4 : O (102, 103,
1. DHT. 104) -
2. () . -
. -
3. - -
352 OY

, , . O -
2-amino-1- -
methyl-6-phenylimidazol (4,5-) pyridine (PhIP). PhIP . -
- 104, (-
DNA , , , ),
, . Ol-
- tipraz105, , -
-
. aflatoxin-B.

GSTP-1 A OOE
, GSTP-1, -
-, -
. -
GSTP-1 . -
(caretaker), DNA -
.
. GSTP- -
1 - .
- -
DNA. , -
GSTP-1 () - -
() . - -
.
GSTP-1

1. Lippman SM, Benner SE, Hong WK. Cancer chemopreven-
tion. J Clin Oncol 1994; 12: 851.
2. Lippman SM, Spitz MR, Huberb M, Hong WK. Strategies for
chemoprevention study of premalignant lesions and second
primary tumors in the head and neck. Curr Opin Oncol 1995;
7: 234.
3. Wolbach SB, Howe PR. Tissue changes following deprivation
of fat soluble A vitamin. J Exp Med 1925; 42: 753.
4. Mangelsdor DJ, Umesomo K, Evans RM. The retinoid recep-
tors. In: Spom MB, Roberts AB, Goodman DS, eds. The reti-
noids. 2nd ed. New York: Raven Press, 1994: 319.
5. Chambon P. The retinoid signaling pathway: modecular and
genetic analyses. Semin Cell Biol 1994; 115.
6. Lippman SM, Hong WK. Retinoid chemoprevention of upper
aerodigestive tract carcinogenesis. In: De Vita VT, Hellman S,
Rosenberg SA, eds. Important advances in oncology. Philadel-
phia: Lippincott, 1992: 93.
7. Vokes EE, Weichselbaum RR, Lippman SM, Hong WK. Head
and Neck Cancer. N Engl J Med 1993; 328: 184.
8. Stick HF, Rosin MP, Vallejera MO. Reduction with vitamin A
and beta-carotene administration of proportion of micronu-
cleated buccal mucosal cells in Asian betel nut and tobacco
chewers. Lancet 1984; 1: 1204.
9. Stich HF, Homby AP, Dunn BP. A pilot beta-carotene inter-
vention trial with Inuits using smokeless tobacco. Int Cancer
1985; 36: 321.
10. Stick HF, Rosin MP, Homby P, et al. Remission of oral leuko-
plakias and micronuclei in tobacco/betel quid chewers treated
with beta-carotene plus vitamin A. Int J Cancer 1988; 42: 195.
11. Sankaranararayanan R, Mathew B, Varghese C, et al. Chemo-
prevention of oral leukoplakia with vitamin A beta-carotene:
an assessment. Oral Oncol 1997; 33: 231.
12. Zaridze D, Evstifeeva T, Boyle P. Chemoprevention of oral
leukoplakia and chronic esophagitis in an area of high inciden-
ce of oral and esophageal cancer. Ann Epidemiol 1993; 3: 225.
13. Hong W, Endicott J, Itri LM, et al. 13-cis retinoic acid in the
treatment of oral leukoplakia. N Engl J Med 1986; 315: 1501.
14. Lippman SM, Batsakis JC, Toth BB, et al. Comparison of low-
dose isotretinoin with beta-carotene to prevent oral carcinoge-
nesis. N Engl J Med 1993; 328: 15.
15. Chiesa F, Tradati N, Marazza M, et al. 4HPR in chemopre-
vention of oral leukoplakia. J Cell Biochem suppl., 1993; 17F:
255.
16. Costa A, Formelli F, Chiesa F, et al. Prospects of chemopre-
vention of human cancers with the synthetic retinoid fenretini-
de. Cancer Res 1994; 54: 2032.
17. Hong WK, Lippman SM, Itri LM, et al. Prevention of second
primary tumors with 13cRA in squamous-cell carcinoma of
the head and neck. N Engl J Med 1990; 323: 795.
18. Bolla M, Lefur R, Ton Van J, et al. Prevention of second pri-
VI.
mary tumours with etretinate in squamous-cell carcinoma of
the oral cavity and oropharynx. Results of a multicentric dou-
ble-blind randomized study. Eur J Cancer 1994; 30A: 767.
19. McLarry JW, Holiday DB, Girard WM, et al. Beta-carotene,
vitamin A and lung cancer chemoprevention: results of an in-
termediate endpoint study. Am J Clin Nutr 1995; 62 (Suppl):
143IS.
20. Van Poppel G, Poulsen H, Loft S, Verhagen H. No influence
of beta-carotene on oxidative DNA damage in male smokers. J
Natl Cancer Inst 1995; 87: 310.
21. Arnold AM, Browman GP, Levine MN, et al. The effect of the
synthetic retinoid etretinate on sputum cytology: results from a
randomized trial. Br J Cancer 1992; 65: 737.
22. Kurie JM, Lee JS, Khuri FR, et al. 4-Hydroxyphenylretinami-
de (4-HPR) in the reversal of bronchial metaplasia and dyspla-
sia in smokers. Proc Am Soc Clin Oncol 1999; 18: 473a (abst).
23. Lee JS, Lippman SM, Benner SE, et al. Randomized placebo-
controlled trial of isotretinoin in chemoprevention of bron-
chial squamous metaplasia. J Clin Oncol 1994b; 12: 937.
24. The Alpha-Tocopherol, Beta-Carotene Cancer Prevention Stu-
dy Group. The effect of vitamin E and beta-carotene on the in-
cidence of lung cancer and other cancers in male smokers. N
Engl J Med 1994; 330: 1029.
25. Omenn GS, Goodman GE, Thornquist MD, et al. Effects of a
combination of beta-carotene and vitamin A on lung cancer
and cardiovascular disease. N Engl J Med 1996; 334: 1150.
26. Lee IM, Cook NR, Manson JE, Buring JE, Hennekens CH.
Beta-carotene supplementation and incidence of cancer and
cardiovascular disease: the Womens Health Study. J Natl Can-
cer Inst 1999; 91: 2102.
27. Salgo MG, Cueto R, Winston GW, Pryor WA. Beta-carotene
and its oxidation products have different effects on microsome
mediated binding of benzo [a] pyrene to DNA. Free Radical
Biol Med 1998; 26: 162.
28. Paolini M, Cantelli-Forci G, Peroccor P, et al. Co-carcinoge-
netic effect of b-carotene [Letter]. Nature 1999; 398: 760.
29. Pastorino U, Infante M, Maiolo M, et al. Adjuvant treatment
of stage I lung cancer with high-dose vitamin A. J Clin Oncol
1993; 11: 1216.
30. Van Zandwijk N, Pastorino U, De Vries N, et al. Randomized
trial of chemoprevention with vitamin A and N-acetylcysteine
in patients with cancer of the upper and lower airways: the Eu-
roscan study. Proc Am Soc Clin Oncol 1999; 18: 464a(abst).
31. Lippman SM, Lee JJ, Karp DD, et al. Phase III Intergroup
trial of 13-cis-retinoic acid to prevent second primary tumors
in stage I non-small-cell cancer (NSCLC): Interim Report of
NCI # 119-0001. Proc Am Soc Clin Oncol 1998; 17, 456a (abst):
1753.
32. Fisher B, Constantino JP, Wickerham DL, et al. Tamoxifen for
prevention of breast cancer: report of the National Surgical
Adjuvant Breast and Bowel P-1 Study. J. Natl Cancer Inst
1998; 90: 1371-1388.
33. Veronesi U, Maisonneuve P, Costa A, et al. Prevention of
breast cancer with tamoxifen: preliminary findings from the
Italian randomised trial among hysterectomised women. Ita-
lian Tamoxifen Prevention Study. Lancet 1998; 352: 93-97.
34. Veronesi U, Maisonneuve P, Costa A, Rotmensz N, Boyle P.
353
Drop-outs in tamoxifen prevention trials. Lancet 1999; 353:
244.
35. Powels T, Eeles R, Ashley S, et al. Interim analysis of the inci-
dence of breast cancer in the Royal Marsden Hospital tamoxi-
fen randomised chemoprevention trial. Lancet 1998; 353: 98-
101.
36. Delmas PD, Bjarnason NH, et al. Effects of raloxifene on bone
mineral density, serum cholesterol concentrations, and uterine
endometrium in postenopausal women. N Engl J Med 1997;
337: 1641-1647.
37. Jordan VC, Glusman JE, Eckert S, et al. Raloxifen reduces in-
cident primary breast cancers: integrated data from multicen-
tre, double-blind, placebo-controlled, randomized trials in po-
stenopausal women. Breast Cancer Res Treat 1998; 50: 227.
38. Fanjul A, Dawson MI, Hobbs PD, et al. A new class of reti-
noids with selective inhibition of AP-1 inhibits proliferation.
Nature 1994; 372: 107-111.
39. Costa A, Formelli F, Chiesa F, Decensi A, De Palo G, Verone-
si U. Prospects of chemoprevention of human cancers with the
synthetic retinoid fenretinide. Cancer Res 1994; 54: 20342s-
2037s.
40. Favori RE, de Cupis A, Bruno S, et al. Modulation of the insu-
linlike growth factor-I system by N-(4-hydroxyphenyl)-retina-
mide in human breast cancer cell lines. Br J Cancer 1998; 77:
2138-2147.
41. Sporn MB. Combination chemoprevention of cancer. Nature
1980; 287: 107-108.
42. Ratko TA, Detrisac CJ, Dinger NM, Thomas CF, Kelloff GJ,
Moon RC. Chemoprevention efficacy of combined retinoid and
tamoxifen treatment following surgical excision of a primary
mammary cancer in female rats. Cancer Res 1989; 49: 4472-
4476.
43. Cobleigh MA, Dowlatshahi K, Deutsch TA, et al. Phase I/II
trial of tamoxifen with or without fenretinide, an analog of vi-
tamin A, in women with metastatic breast cancer. J Clin Oncol
1993; 11: 474-477.
44. Conley B, OShaughnessy J, Prindiville S, et al. Pilot trial of
the safety, tolerability, and retinoid levels of N-(-4-hydroxy-
phenyl) retinamide in combination with tamoxifen in patients
at high risk for developing invasive breast cancer. J Clin Oncol
2000; 18: 275-283.
45. Trialists Group. The ATAC (Arimidex, Tamoxifen Alone or
in Combination). Anastrazole alone or in combination with ta-
moxifen versus tamoxifen alone for adjuvant treatment of po-
stenopausal women with early breast cancer: first results of the
ATAC randomized trial. Lancet 2002; 359: 2131-2139.
46. Giovannucci E, Stampfer MJ, Colditz GA, et al. Relationship
of diet to risk of colorectal adenoma in men. J Natl Cancer
Inst 1992; 84: 91.
47. Armstrong B, Doll R. Environmental factors and cancer inci-
dence and mortality in different countries, with special referen-
ce to dietary practices. Int J Cancer 1975; 15: 617.
48. Rose DP, Boyar AP, Wynder EL. International comparisons
of mortality rates for cancer of the breast, ovary, prostate, and
colon, and per capita food consumption. Cancer 1986; 58:
2263.
49. Howe GR, Meeting Presentation. Advances in the biology and
354
therapy of colorectal cancer. M.D. Andersons Thirty-seventh
Annual Clinical Conference. M.D. Anderson Cancer Center,
Houston, TX, 1993.
50. Willett WC, Stampfer MJ, Colditz GA, et al. Relation of meat,
fat, and fiber intake to the risk of colon cancer in a prospective
study among women. N Engl Med 1990; 323: 1664.
51. Steinmetz KA, Potter JD. Vegetables, fruit, and cancer pre-
vention: a review. J Am Diet Assoc 1996; 96: 1027.
52. Hill MJ. Cereals, cereal fibre and colorectal cancer risk; a re-
view of the epidemiological literature. Eur J Cancer Prev 1998;
7: S5.
53. Moore MA, Park CB, Tsuda H. Soluble and insoluble fiber in-
fluences on cancer development. Crit Rev Oncol Hematol 1998;
27: 229.
54. Kritchevsky D. Dietary fibre and cancer. Eur J Cancer Prev
1997; 6: 435.
55. Greenwald P, Clifford C. Fiber and cancer: prevention re-
search. In: Kritchevsky D, Benfield C, eds. Dietary fiber in
health and disease. St. Paul: Eagen Press, 1995: 159.
56. Chaplin MF. Bile acids, fibre and colon cancer: the story un-
folds. J R Soc Health 1998; 118: 53.
57. Nagengast FM, Grubben MJAL, Van Munster IP. Role of bile
acids in colorectal carcinogenesis. Eur J Cancer 1995; 31A:
1067.
58. Kritchevsky D. Cereal fibres and colorectal cancer: a search
for mechanisms. Eur J Cancer Prev 1998; 7: S33.
59. Pickering JS, Lupton JR, Chapkin RS. Dietary fat, fiber, and
carcinogen alter fecal diacylglycerol composition and mass. Can-
cer Res 1995; 55: 2293.
60. Assert R, Kotter R, Bisping G, et al. Anti-proliferative activity
of protein kinase C in apical compartments of human colonic
crypts: evidence for a less activate protein kinase C in small a-
denomas. Int J Cancer 1999; 80: 47.
61. Scheppach W, Bartram HP, Richter F. Role of short-chain
fatty activators prevention of colorectal cancer. Eur J Cancer
1995; 31A: 1077.
62. Lupton JR, Turner ND. Potential protective mechanisms of
wheat brain fiber. Am J Med 1999; 106: 24S.
63. Hassig CA, Tong JK, Schreiber SL. Fiber-derived butyrate and
the prevention of colon cancer. Chem Bil 1997; 4: 783.
64. The Womens Health Initiative Study Group. Design of the
Womens Health Initiative clinical trial and observational stu-
dy. Controlled Clin Trials 1998; 19: 61.
65. Earnest DL, Sampliner RE, Roe DJ, et al. Progress report: the
Arizona Phase III study of the effecy of wheast bran fiber on
recurrence of adenomatous colon polyps. Am J Med 1999;
106: 43S.
66. Martinez ME, Ried ME, Guillen-Rodriguez J, et al. Design
and baseline characteristics of study participants in the Wheat
Bran Fiber trial. Cancer Epidemiol Biomark Prev 1998; 7: 813.
67. eron JA, Beach M, Mandel JS, et al. Calcium Supplement for
the prevention of colorectal adenomas. Calcium Polyp Preven-
tion Study Group. N Engl J Med 1999; 340: 101-107.
68. Vema AK. The enzyme-activated irreversible inhibitor of orni-
thine decarboxylase, DL-alpha-difluromethylornithine: a che-
moprevention agent. Prevent Med 1989; 18: 646-652.
OY
69. Mesyskens FLJ, Gerner EW. Development of difluoromethyl-
ornithine as a chemoprevention agent for the managenement
of colon cancer. J Cell Biochem 1995; 22 (suppl.): 126-131.
70. Love RR, Jacoby R, Newton MA, et al. A randomized, place-
bo-controlled trial of low-dose alpha-difluoromethylornithine
in individuals at risk for colorectal cancer. Cancer Epidemiol
Biomarkers 1998; 7: 989-992.
71. Smalley WE, DuBois RN. Colorectal cancer and nonsteroidal
anti-inflammatory drugs. Adv Pharmacol (New York) 1997; 39:
1-20.
72. Rao CV, Rivenson A, Simi B, et al. Chemoprevention of colon
carcinogenesis by sulindac, a nonsteroidal anti-inflammatory
agent. Cancer Res 1995; 55: 1464-1472.
73. Waddell WR, Ganser GF, Cerise EJ, Loughry RW. Sulindac
for polyposis of the colon. Am J Surg 1989; 157: 175-179.
74. Taketo MM. Cyclooxygenase-2 inhibitors in tumorigenesis
(part I). J Natl Cancer Inst 1998; 90: 1529-1536.
75. Taketo MM. Cyclooxygenase-2 inhibitors in tumorigenesis (part
II). J Natl Cancer Inst 1998; 90: 1609-1620.
76. Eberhart CE, Coffey RJ, Radhika A, Giardiello FM, Ferren-
bach S, DuBois RN. Up-regulation of cyclooxygenase 2 gene
expression in human colorectal adenomas and adenocarcino-
mas. Gastroenterology 1994; 107: 1183-1188.
77. Oshima M, Dinchuk JE, Kargman SL, et al. Suppression of
intestinal polyposis in Apc delta 716 knockout mice by inhibi-
tion of cyclooxygenase 2 (COX-2). Cell 1996; 87: 803-809.
78. Yang VW, Shields JM, Hamilton SR, et al. Size-dependent in-
crease in prostanoid levels in adenomas of patients with fami-
lial adenomatous polyposis. Cancer Res 1998; 58: 1750-1753.
79. Donelly MT, Hawkey CJ. Review article: COX-II inhibitors a
new generation of safer NSAISs; Aliment Pharm Ther 1997;
11: 227-236.
80. Thompson RC, Southgate I, Kitchener, et al. Multistage carci-
nogenesis induced by ras and myc oncogenes in a reconstituted
organ. Cell 1989; 56: 917.
81. Carter HB, Piantadosi S, Isaacs JT. Clinical evidence for and
implications of the multistop development of prostate cancer.
J Urol 1990; 143: 72.
82. Meikle AW, Smith JA, West DW. Familial factors affecting
prostatic cancer risk and plasma sex-steroid levels. Prostate
1985; 6: 121.
83. Gronberg H, Wiklund F, Damber JE. Age specific risks of fa-
milial prostate carcinoma: a basis for screening recommenda-
tions in high risk populations. Cancer 1999; 86: 477.
84. Peehl DM, Wehner N, Stamey TA. Activated Ki-ras oncogene
in human prostatic adenocarcinoma. Prostate 1987; 10: 281.
85. Carter BS, Epstein JL, Issacs WB. Ras gene mutations in hu-
man prostate cancer. Cancer Res 1990; 50: 6830.
86. Thompson TC, Southgate J, Kitchener G, Land H. Multistage
carcinogenesis induced by ras and myc oncogenes in a recon-
stituted organ. Cell 1989; 56Z: 917.
87. Hockenbery DM. The bcl-2 oncogene and apoptosis. [Review].
Semin Immunol 1992; 4: 413.
88. Reed JC, Cuddy M, Slabiak T, et al. Oncogenic potential of
bcl-2 demonstrated by gene transfer. Nature 1988; 336: 259.
89. Nanone NM, Troncoso P, Pisters LL, et al. p53 protein accu-
VI.
mulation and gene mutation in the progression of human pro-
state carcinoma. J Natl Cancer Inst 1993; 85: 1657.
90. Bookstein R, MacGrogan D, Hilsenbeck SG, Sharkey F,
Allred DC. p53 is mutated in a subset of advanced-stage pro-
state cancers. Cancer Res 1993; 53: 3369.
91. Isaacs WB, Carter BS. Genetic changes associated with prosta-
te cancer in humans. Cancer Surv 1991; 11: 15.
92. Bookstein R, Shew JY, Chen PL, Scully P, Lee WH. Suppres-
sion of tumorigenicity of human prostate carcinoma cells by
replacing a mutated RB gene. Science 1990; 247: 712.
93. Brooks JD, Weinstein M, Lin X, et al. CG island methylation
changes near the GSTP1 gene in prostatic intraepithelial neo-
plasia. Cancer Epidemiol Biomarkers Prev 1998; 7: 531-536.
94. Lee WH, Issacs WB, Bova GS, et al. CG island methylation
changes near the GSTP1 gene in prostatic carcinoma cells de-
tected using the polymerase chain reaction: A new prostate
cancer biomarker. Cancer Epidemiol Biomarkers Prev 1997; 6:
443-450.
95. Lee WH, Morton RA, Epstein JL, et al. Cytidine methylation
of regulatory sequences near the pi-class glutathione S-transfe-
rase gene accompanies human prostatic carcinogenesis. Proc
Natl Acad Sci USA 1994; 91: 11733-11737.
96. Sudduth SL, Koronkowski MJ. Finasteride: the first 5 alpha-
reductase inhibitor. Pharmacotherapy 1993; 13: 309.
97. Coltman CA Jr, Thompson IM Jr, Feigl P. Prostate Cancer
Prevention Trial (PCPT) update. Eur Urol 1999; 35: 544.
355
98. Wang Y, Cprr JG, Thaler HT, et al. Decreased growth of e-
stablished human prostate LNCaP tumors in nude mice fed a
low-fat diet. J Natl Cancer Inst 1995; 87: 1456.
99. Giovannucci E, Rimm EB, Colditz CA, et al. A prospective
study of dietary fat and risk of prostate cancer. J Natl Cancer
Inst 1993; 85: 1571.
100. Prestera T, Talalay P. Electrophile and antioxidant regulation
of enzymes that detoxity carcinogens. Proc Natl Acad Sci USA
1995; 92: 8965-8969.
101. Clark LC, Dalkin B, Krongrand A, et al. Decreased incidence
of prostate cancer with selenium supplementation: results of a
double-blind cancer prevention trial. Br J Urol 1998; 81: 730.
102. Chan JM, Stampfer MJ, Giovannucci EL. What causes pro-
state cancer. A brief summary of the epidemiology. Semin
Cancer Bil 1998; 8: 263.
103. Gann PH, Ma J, Giovannucci E, et al. Lower prostate cancer
risk in men with elevated plasma lycopene levels: results of a
prospective analysis. Cancer Res 1999; 59: 1225.
104. Zhang Y, Kensler TW, Cho CG, et al. Anticarcinogenic neti-
vities of sulforaphane and structurally related synthetic nor-
bornyl isothiocyanates. Proc Natl Acad Sci USA 1994; 91:
3147-3150.
105. Kensler TW, He X, Otieno M, et al. Olsipraz chemopreven-
tion trial in Qidong, Peoples Republic of China: Modulation
of serum aflatoxin albumin adduct biomarkers. Cancer Epide-
miol Biomarkers Prev 1998; 7: 127-134.

.

H ..
(tumour-associated),
, , -
-
. .
- -
- ,
, , - .
. O MHC (-
, - MHC class I, -
-
, - MHC class II).
, - -,
, - ,
, - .
(Major
. Histocompatibility Complex MHC)
O MHC class I , -
- -
- , MHC class II , -
. O - -
(antigen presenting cells APCs)
-

1. -
.
,
- (antigen present-
-
ing cells APCs) ,
. O
B-, , .., -

APCs (dendritic cells
,
DCs).
, -
(co-stimulatory molecules)
. B7 -
- APCs.
T- APCs
- : 1 --
- (T-cell receptor TCR) 2 CD28.
. O -
-
E E OOOI O CD28--
: . Thy-1, -2, CD2,
(tumour-specific), CD5, CD7 ..
- - -

357
358 OY

- (viral-specific antigens) -
: T-- (true mutated tumour-specific pro-
(CTLs), CD8, - teins) , -
T- (TH cells), CD4. T -
: TH1 cells, - , -
( IL-2, IL-3, IFN-, .
TNF-, TNF-, GM-CSF), TH2 cells, -
( IL-3, IL-4, IL-5,
IL-10, IL-13, TNF-, GM-CSF) TH0 cells, .
T 1 T 2. -
,
A O O (MUC-1),
(SPECIFIC TUMOUR ANTIGENS) 5,6.

. -- - (CTLs),
, - , -
() - .
MHC (Major Histocompatibility Complex) - -
I II. , - (genomic and proteomic tech-
nologies),
-. , - -
,
. (probe)
- DNA (tumour DNA
5 (. 1). libraries). -
- (cancer-testis -
antigens) - cDNA SEREX (serologic analysis of recom-
- binant cDNA expression libraries). O IgG -
(testicular germ cells)
. - ,
, - CD4+ T--
, , , - . -
, 2.
(differentiation antigens) -
-
- Ludwig -
3,4.

1.

A Y

MAGE MART / Melan-A HPV16 Beta-catenin MUC-1

GAGE gp100 E6 / E7 MCM-1 Sialyl-Tn
BAGE tyrosinase EBV MCM-3
RAGE TRP-2 LMP1 p53
LAGE PSA HTLV p15
SAGE CEA p16
HAGE HER2 / neu caspase
NY-ESO-1 EGFR HLA-A2
all X-linked RU2AS
VI. 359

(http://www.licr.org/SEREX.html).
- (transfected), -
- (tumour-associated genes).
7,8. - O (non-cellular vaccines)
- :
, A-
X ,
-
, , ..,
. -
-

, ..
- (self proteins),
-
, -
(recombinant viruses).
-
CTL9. - A O (CELLULAR VACCINES)

, O -
. - -
-
- . -
, , -
- ,
MHC , -
. - -- -
-, (APCs) . O
-
- -
10. , (-
-
E OY OOY )
- (
- ). -
, -
-
. ,
, (cellular vaccines) - .
:
O ( (
) ) -
, , -
: , -
- , BCG, , GM-CSF
, .., ..11.
, (naked) DNA, -
- OO A O
, O
(vector)
, . O ,
(fused)
, , -
(pulsed) .
, -
360 OY

-
- -
BCG. . -
98 - - , Melacine -
Dukes B2 C3, - , 18.
Melacine
BCG (OncoVax) , ,
93 . -
Melacine

12. - , -
ECOG 412 - LA
-
- HLA-A2
13. HLA-C3, -
254 - 19.
Dukes B C
A OOOE A
, 3 O
6 .
C,
B
, ,
(IL-2, GM-CSF, TNF, IFN-) , CD80,
14. CD8620.
(transfection / transduction)
OH A O
(, ..).
-
/
(shared antigens) -
,
.
, .


, -
, -
C (MHC mismatch)
-
. O
21. -
Morton 15 -
-
, G-CSF -
22 -
16. ( GVax) (.
1).
, CancerVax, GM-CSF -

BCG, (NSCLC) 3 (CRs)
. 5 26 , -
26% 23. -
6% , - -
IV 17. - -
Me- (naked) DNA -
lacine (Corixa, Seattle, WA), gene
gun DNA
Detox. (DNA-coated gold beads),
VI. 361

GM-CSF

GM-CSF
CD8 T-
TCR

CD28

B7

HLA

HLA

CD4 T-

ex vivo

E 1. GM-CSF .

. - ) 27. O -
- , -
, -
-. . -
- -
A Y O -28. -
A O (loaded with peptides) -
- (TAAs)
- (antigen-presenting cells). -
C , 29.

, - 5 -
- -ras
24. - (Cs),
- (pulsed) ,
L-4 G- 30.
CSF 25,26. O - , -
, - , MUC,
MAGE, MART-1, gp100 / tyrosinase ..31, -
, - . -
, - -
- -
. - . -
(hybrids) -
( -
) ( - 25%
- , -
362 OY

30% - . -
30,32. - , , -
CTL ,
- -
, 16
18 , - -
- .
33. :
- -
, ,
CTL . (
- ) .
. ,
17 - OOA
- -
4 (CRs), 2 - ,
(PRs) 2 (SDs)34. -
- -,
, - (idiotype) -
35. -
- 40. -
, -
, - ( -
. - , single chain Fv)
(-
(prostate specific antigen SA) )41,42.
(prostate specific - -
membrane antigens PSMA, prostate acid phosphatase -
PAP), - - 43. - CEAVac -
, 8019, -
SA CEA (carcinoem-
50%, 30% 36,37. - bryonic antigen)
-
R SA 3 .

- -
(anti-PSA T-cell response) - CEA. -
11 13 - CEAVac -
38. -
, , , , -
. -
, -
(.
, ), .
- CEAVac -
- 39. /
Dukes
A O C,
(NON-CELLULAR VACCINES) -
- 44,45.
, -- -
VI. 363

. ,
- TriAb, HMFG [.. - (CEA) -
(Human milk fat globulin) 23 ]48,49.
- - -
, - - -
. - -
- . , elan-A / MART-1
. - , gp100, -
- -
46. GE
50. -
E OA O ex vivo, -
(PURIFIED IMMUNOGENS) HLA /
(peptide tetramer staining technique), -
- in vitro 51.
O -
- (APCs). -
, 100
- 1.000 g , -
, (carbohydrates) , ,
(gangliosides). 2050% , -
(adjuvants) -
.
- -
. ,
, - ( -) , -
(shared antigens) -
-, 52. -
-
- . -
810 -
, , -
PCR. . -
in vivo - , -
- , -
(adjuvants) 20%, -
- 53,54,55.
. -
in vitro, -
- .
-
47. -
O -
. - 10. , -
HLA-- - -
T- , in vitro (BLs) ,
ex vivo - 56.
. -
- (adjuvants)
Melan-A/MART-1, gp100, MAGE-3, , G-CSF, -
HLA-A2, Cs 57.
364 OY

, HER2 / neu (tu-

- mour rejection antigen) 63, DNA
- neu
, FA (incomplete Freunds
adjuvant). - HER2 / neu transgenic 64. HER2 / neu
, -
FA, G-CSF QS-21, HER2 / neu -
() , Fc ( ).
QS-21 G-CSF ,
FA - 58. .
,
,
20 59. - .
-ras,
90% --
, V , - (CTLs), -
(CIN). . CTLs , -
- , CTLs -
, (low affinity)
(ignorant),
(50%) CI. O - CTLs .
, , -


. Polymorphic Epithelial Mu-
cin (PEM) Mucin-1 (MUC-1: cancer-associated
R2/neu - mucin), -
- . O -- , -
- 65,66,
G-CSF -- > 90% . MUC-1
60. HER2/neu ,
67. -
. - -
- - . MUC-1-
KLH + QS-21 -
. . -
i.d. +/ GM-CSF 26 , -
64 . , , -
68. -
- , 5
HER2/neu - UC-5, -
. -
(epitope spread)61. - --
E75, HER2/neu - .
HLA-A2- , 14 -
i.d. +/ GM-CSF , Thomsen-Friedenreich (TF)
. - Sialyl-Tn (sTn),
- -
HER2 / neu, -
/ KLH (key-
62. hole limpet hemocyanin),
VI. 365

Detox GM2-BCG -
quillaja saponaria69,70. - 74,75. -
Theratope ( Sialyl-Tn-KLH +/
Detox-B), . Intergroup (E1694), -
/ - GM2-KLH / QS-21 FN-2b
> 400 . -
- .
-
. (- 76.
).
Theratope 40 O IO OO
-
, (V), -
, - . -
71. C
- V FA 50% -
- 58. O -
V, - -
, > 4 - -
- ,
. -V , ,
, - - V,
950 77.
1 , -
heratope - -
sTn, / -
KLH-Detox. O - (genetic vaccination / recombinant vaccines)
(ime to progression, TP) - O -
.
. -
(gangliosides) (vectors) ,
-
(plasmids).
, , , -
, - , -
. , (Major
- Histocombatibility Complex MHC) -
- (co-stimulatory molecules).
,
. ,

72.
- . -
1995 Livingston et al73. To
GM2, ,

. , -
GM2 CG cross-priming.
CG 122
. -
DNA .
366 OY

,
- , APCs -
. , -
, (downregulation)
MHC I
. -
, 5 (adenovirus 5) (TGF-, Fas ligand)81
(bias) -
RT-1 gp100
, 1 APCs,
16 , (co-stimulatory
, molecules)
78. -
.
, pox (poxvirus)
- IOO
CEA -
(canarypox vaccinia-based .
vector ALVAC) , ,
79. . -
-
OI H O ,
O O OOOO Y

-
. ,
- . ,
, , MHC, -
, -
. - ,
(
, - ), -
, --
, CD4+T-, , - .
, -
- , -
. . -
-
- -
- (immune surveillance). - . H ,
CTLs -
, , -
, Fas-Fas ligand, Tumour necro- -
sis factor (TNF), T- ,
. - -
- . ,
80. -
-
82.
:
VI.
1. Espinoza-Delgado I. Cancer vaccines. Oncologist 2002; 7 (sup-
pl 3): 20-33.
2. Boon T, Old LJ. Cancer tumour antigens. Curr Opin Immunol
1997; 9: 681-683.
3. Rosenberg SA. Interleukin-2 and the development of immu-
notherapy for the treatment of patients with cancer. Cancer J
Sci Am 2000; 6 (suppl 3): S2-S7.
4. Wang RF, Rosenberg SA. Human tumour antigens for cancer
vaccine development. Immunol Rev 1999; 170: 85-100.
5. Gilewski T, Ragupathi G, Bhuta S, et al. Immunisation of me-
tastatic breast cancer patients with a fully synthetic globo H
conjugate: a phase I trial. Proc Natl Acad Sci USA 2001; 98:
3270-3275.
6. Holmberg LA, Oparin DV, Gooley T, et al. Clinical outcome
of breast and ovarian cancer patients treated with high-dose
chemotherapy, autologous stem-cell rescue and THERATO-
PE STn-KLH cancer vaccine. Bone Marrow Transplant 2000;
25: 1233-1241.
7. Tureci O, Sahin U, Pfreundschuh M. Serological analysis of
human tumour antigens: molecular definition and implications.
Mol Med Today 1997; 3: 342-349.
8. Le Naouf F, Misek DE, Krause MC, et al. Proteomics-based i-
dentification of RS/DJ-1 as a novel circulating tumour antigen
in breast cancer. Clin Cancer Res 2001; 7: 3328-3335.
9. Houghton AN. Cancer antigens: immune recognition of self
and altered self. J Exp Med 1994; 180: 1-4.
10. Disis ML, Cheever MA. Oncogenic proteins as tumor anti-
gens. Curr Opin Immunol 1996; 8: 637-642.
11. Soiffer R, Lynch T, Mihm M, et al. Vaccination with irradiated
autologous melanoma cells engineered to secret human granu-
locyte-macrophage colony-stimulating factor generates potent
antitumour immunity in patients with metastatic melanoma.
Proc Natl Acad Sci USA 1998; 95: 13141-13146.
12. Hoover H, Brandhorst J, Peters L, et al. Adjuvant active speci-
fic immunotherapy for human colorectal cancer. 6.5 year me-
dian follow-up of a Phase III prospectively randomised trial. J
Clin Oncol 1993; 11: 390-399.
13. Harris J, Ryan L, Adams G, et al. Survival and relapse in adju-
vant autologous tumour vaccine therapy for Dukes B and C
colon cancer. Proc Am Soc Clin Oncol 1994; 13: 294.
14. Vermorken JB, Blaessen Anke ME, van Tinteren H, et al. A-
ctive specific immunotherapy for stage II and stage III human
colon cancer: A randomised trial. Lancet 1999; 353: 345-350.
15. Morton D, Foshag L, Hoon D, et al. Prolongation of survival
in metastatic melanoma after active specific immunotherapy
with a new polyvalent melanoma vaccine. Ann Surg 1992; 216:
463-483.
16. Wallack M, Sivanandam M, Balch C, et al. Surgical adjuvant
active specific immunotherapy for patients with stage III mela-
noma: final analysis of data from a phase III randomised dou-
ble blind multi-center vaccinia melanoma oncolysate trial. J
Am Coll Surg 1998; 187: 69-77.
17. Hsueh EC, Gupta RK, Qi K, Morton DL. Correlation of speci-
fic immune responses with survival in melanoma patients with
367
distant metastases receiving polyvalent melanoma cell vaccine.
J Clin Oncol 1998; 16: 2913-2920.
18. Mitchell MS, Rechtman DJ, Von Eschen KB. A randomised
phase III trial of Melacine versus combination chemotherapy
in patients with disseminated melanoma. Can J Infect Dis 1995;
6 (suppl C): 347.
19. Sosman JA, Unger JM, Liu PY, et al. Adjuvant immunothera-
py of resected, intermediate thickness, node-negative melano-
ma with an allogeneic tumour vaccine: impact of HLA class I
antigen expression on outcome. J Clin Oncol 2002; 20: 2067-
2075.
20. Gilboa E, Lyerly HK. Specific active immunotherapy of cancer
using genetically modified tumour vaccines. Biol Ther Cancer
1994; 6: 1-16.
21. Parmiani G, Rodolfo M, Melani C. Immunological gene thera-
py with ex vivo gene modified tumour cells: a critique and a re-
appraisal. Hum Gen Ther 2000; 11: 1269-1275.
22. Dranoff G, Soiffer R, Lynch T, Mihm M. A phase I study of
vaccination with autologous irradiated melanoma cells engi-
neered to secrete human GM-CSF. Human Gene Therapy
1997; 8: 111-123.
23. Nemunaitis JJ, Smith J, Sterman D, et al. A phase I/II trial of
bystander GVAX cancer vaccine in non-small cell lung cancer
(NSCLC). Proc Am Soc Clin Oncol 2002; 21: 13a.
24. Steinman RM, Dodhapkar M. Active immunisation against
cancer with dendritic cells: the near future. Int J cancer 2001;
94: 459-473.
25. Kochman S, Bernard J. Antitumour immune response and
cancer vaccination: the critical role of dendritic cells. Curr Med
Res Opin 1999; 15: 321-326.
26. Hart D. Dendritic cells: unique leukocyte populations which
control the primary immune response. Blood 1997; 90: 3245-
3287.
27. Gong J, Dongshu C, Masahiro K, et al. Induction of antitu-
mour activity by immunisation with fusions of dendritic and
carcinoma cells. Nature Med 1997; 3: 558-561.
28. Guo Y, Wu M, Chen H, et al. Effective tumour vaccine gene-
rated by fusion of hepatoma cells with activated B cells. Scien-
ce 1994; 263: 518-520.
29. Mayordomo J, Zorina T, Storkus W, et al. Bone marrow-de-
rived dendritic cells pulsed with synthetic tumour peptides eli-
cit protective and therapeutic antitumour immunity. Nature
Med 1995; 1: 1297-1302.
30. Gjertsen MK, Bakka A, Breivik J, et al. Vaccination with mu-
tant ras peptides and induction of T-cell responsiveness in pan-
creatic carcinoma patients carrying the corresponding RAS mu-
tation. Lancet 1995; 346: 1399-1400.
31. Nestle F, Alijagics S, Gilliet M, et al. Vaccination of melanoma
patients with peptide-or tumour lysate-pulsed dendritic cells.
Nature Med 1998; 4: 328-332.
32. Schadendorf D, Nestle FO. Autologous dendritic cells for
treatment of advanced cancer- an update. Recent Res Cancer
Res 2001; 158: 236-248.
33. Banchereau J, Palucka AK, Dhodapkar M, et al. Immune and
368
clinical response in patients with metastatic melanoma to
CD34+ progenitor-derived dendritic cell vaccine. Cancer Res
2001; 61: 6451-6458.
34. Kugler A, Stuhler G, Walden P, et al. Regression of human
metastatic renal cell carcinoma after vaccination with tumour
cell-dendritic cell hybrids. Nat Med 2000; 3: 332-336.
35. Trefzer U, Weingart G, Chen T, et al. Hybrid cell vaccination
for cancer immunotherapy: first clinical trial with metastatic
melanoma. Int J Cancer 2000; 85: 618-626.
36. Small EJ, Fratesi P, Reese DM, et al. Immunotherapy of hor-
mone-refractory prostate cancer with antigen loaded dendritic
cells. J Clin Oncol 2000; 18: 3894-3903.
37. Murphy GP, Tjoan BA, Simmons SJ, et al. Infusion of dendri-
tic cells pulsed with HLA-A2-specific prostate-specific mem-
brane antigen peptides: a phase II prostate cancer vaccine trial
involving patients with hormone-refractory metastatic disease.
Prostate 1999; 38: 73-78.
38. Heiser A, Coleman D, Dannull J, et al. Autologous dendritic
cells transfected with prostate-specific antigen RNA stimulate
CTL responses against metastatic prostate tumours. J Clin In-
vest 2002; 109: 409-417.
39. Parmiani G, Pilla L, Castelli C, Rivoltini L. Vaccination of pa-
tients with solid tumours. Ann Oncol 2003; 14: 817-824.
40. Kwak LW, Campbell MJ, Czerwinski DK, et al. Induction of
immune responses in patients with B-cell lymphoma against
the surface-immunoglobulin idiotype expressed by their tu-
mours. New Engl J Med 1992; 327: 1209-1215.
41. Hawkins R, Zhu D, Ovecka M, et al. Idiotypic vaccination
against human B-cell lymphoma. Rescue of variable region
gene sequences from biopsy material for assembly as single-
chain Fv personal vaccines. Blood 1994; 83: 3279-3288.
42. Vuist WM, Levy R, Maloney DG. Lymphoma regression in-
duced by monoclonal anti-idiotypic antibodies correlates with
their ability to induce Ig signal transduction and is not preven-
ted by tumour expression of high levels of bcl-2 protein. Blood
1994; 83: 899-906.
43. Bhattacharya-Chatterjee M, Chatterjee SK, Foon KA. Anti-
idiotype vaccine against cancer. Immunol Lett 2000; 74: 51-58.
44. Foon KA, Chakraborty M, John WJ, et al. Immune response
to the carcinoembryonic antigen in patients treated with an
anti-idiotype vaccine. J Clin Invest 1995; 96: 334-342.
45. Foon KA, Chakraborty M, John WJ, et al. Clinical and immu-
ne responses in resected colon cancer patients treated with
anti-idiotype monoclonal antibody vaccine that mimics the car-
cinoembryonic antigen. J Clin Oncol 1999; 17: 2889-2895.
46. Reece DE, Foon KA, Chatterjee MB, et al. Use of anti-idioty-
pe breast cancer vaccine 11D10 in conjuction with autologous
stem cell transplantation in patients with metastatic breast
cancer. Clin Breast Cancer 2003; 3 (suppl 4): S152-S157.
47. Rosenberg SA, Yang JC, Schwartzentruber DJ, et al. Immuno-
logic and therapeutic evaluation of a synthetic peptide vaccine
for the treatment of patients with metastatic melanoma. Nat
Med 1998; 4: 321-327.
48. Renkvist N, Castelli C, Robbins PF, et al. A listing of human
tumour antigens recognised by T lymphocytes. Cancer Immu-
nol Immunother 2001; 50: 3-15.
49. Rivoltini L, Kawakami Y, Sakaguchi K, et al. Induction of tu-
OY
mour-reactive CTL from peripheral blood and tumour-infil-
trating lymphocytes of melanoma patients by in vitro stimula-
tion with an immunodominant peptide of the human melano-
ma antigen MART-1. J Immunol 1995; 154: 2257-2265.
50. Benlalam H, Labarriere N, Lienard B, et al. Comprehensive a-
nalysis of the frequency of recognition of melanoma-associat-
ed antigen (MAA) by CD8 melanoma infiltrating lymphocytes
(TIL): implications for immunotherapy. Eur J Immunol 2001;
31: 2007-2015.
51. Romero P, Dunbar R, Valmori D, et al. Ex-vivo staining of
metastatic lymph nodes by class I major histocompatibility
complex tetramers reveals high numbers of antigen-experienc-
ed tumour-specific cytolytic T lymphocytes. J Exp Med 1998;
188: 1641-1650.
52. Ogg GS, Dunbar PR, Romero P, et al. High frequency of skin-
homing melanocyte-specific cytotoxic T lymphocytes in auto-
immune vitiligo. J Exp Med 1998; 188: 1203-1208.
53. Cormier JN, Salgaller ML, Prevette T, et al. Enhancement of
cellular immunity in melanoma patients immunised with a pe-
ptide from MART-1/Melan-A. Cancer J Sci Am 1997; 3: 37-44.
54. Marchand M, van Baren N, Weynants P, et al. Tumour regres-
sion observed in patients with metastatic melanoma treated
with an antigenic peptide encoded by gene MAGE-3 and pre-
sented by HLA-A1. Int J Cancer 1999; 80: 219-230.
55. Belli F, Testori A, Rivoltini L, et al. Vaccination of metastatic
melanoma patients with autologous tumour-derived heat shock
protein peptide-complex-96 (Oncophage): clinical and immu-
nological findings. J Clin Oncol 2002; 20: 4169-4180.
56. Lee KH, Wang E, Nielsen MB, et al. Increased vaccine-speci-
fic T cell frequency after peptide-based vaccination correlates
with increased susceptibility to in vitro stimulation but does
not lead to tumor regression. J Immunol 1999; 163: 6292-6300.
57. Gjersten MK, Buanes T, Rosseland AR, et al. Intradermal ras
peptide vaccination with granulocyte-macrophage colony-sti-
mulating factor as adjuvant: clinical and immunological res-
ponses in patients with pancreatic adenocarcinoma. Int J Can-
cer 2001; 92: 441-450.
58. Schaed SG, Klimek VM, Panageas KS, et al. T-cell response
against tyrosinase 368-376(370D) peptide in HLA*A0201+
melanoma patients: randomised trial comparing the incomple-
te Freunds adjuvant, granulocyte macrophage colony stimu-
lating factor, and QS-21 as immunological adjuvants. Clin Can-
cer Res 2002; 8: 967-972.
59. Muderspach L, Wilczynski S, Roman L et al. A phase I trial of
a human papilloma virus (HPV) peptide vaccine for women
with high grade cervical and vulvar intraepithelial neoplasia
who are HPV16 positive. Clin Cancer Res 2000; 6: 3406-3416.
60. Disis ML, Gooley TA, Rinn K, et al. Generation of T-cell im-
munity to the HER2/neu protein after active immunization
with her2/neu peptide-based vaccines. J Clin Oncol 2002; 20:
2624-2632.
61. Disis ML, Grabstein KH, Sleath PR, et al. Generation of im-
munity to the HER-2/neu oncogenic protein in patients with
breast and ovarian cancer using a peptide-based vaccine. Clin
Cancer Res 1999; 5: 1289-1297.
62. Disis ML, Knutson KL, Schiffman K, et al. Pre-existent immu-
nity to the HER-2/neu-oncogenic protein in patients with
VI.
HER-2/neu overexpressing breast and ovarian cancer. Breast
Cancer Re Treat 2000; 62: 245-252.
63. Reilly RT, Gottlieb MB, Ercolini AM, et al. HER-2/neu is a
tumour rejection target in tolerized HER-2/neu transgenic mi-
ce. Cancer Res 2000; 60: 3569-3576.
64. Amici , Smorlesi A, Noce G, et al. DNA vaccination with
full-length or truncated neu induces protective immunity against
the development of spontaneous mammary tumours in HER-
2/neu transgenic mice. Gene Ther 2000; 7: 703-706.
65. Taylor-Papadimitriou J, Stewart L, Burchell J, et al. The poly-
morphic epithelial mucin as a target for immunotherapy. Ann
NY Acad Sci 1993; 690: 69-79.
66. Kotera Y, Fontenot JD, Pecher G, et al. Human immunity
against a tandem repeat epitope of human mucin MUC-1 in
sera from breast, pancreatic and colon cancer patients. Cancer
Res 1994; 54: 2856-2860.
67. Hareuveni M, Gautier C, Kieny MP, et al. Vaccination against
tumour cells expressing breast cancer epithelial tumour anti-
gen. Proc Natl Acad Sci USA 1990; 87: 9498-9502.
68. Gilewski , Adluri S, Ragupathi G, et al. Vaccination of high
risk breast cancer patients with mucin-1 (MUC1) keyhole lim-
pet hemocyanin conjugate plus QS-21. Clin Cancer Res 2000;
6: 1693-1701.
69. Miles D, Towlson K, Graham R, et al. A randomised phase II
study of sialyl-Tn and DETOX-B adjuvant with or without cy-
clophosphamide pretreatment for the active specific immuno-
therapy of breast cancer. Br J Cancer 1996; 74: 1292-1296.
70. Adluri S, Helling F, Ogata S, et al. Immunogenicity of synthe-
tic TF-KLH (keyhole limpet hemocyanin) and sTn-KLH con-
jugates in colorectal carcinoma patients. Cancer Immunol Im-
munother 1995; 41: 185-192.
71. Sandmaier BM, Oparin DV, Holmberg LA, et al. Evidence of
a cellular immune response against sialyl-Tn in breast and ova-
rian cancer patients after high-dose chemotherapy, stem cell
rescue, and immunisation with Theratope STn-KLH cancer
vaccine. J Immunother 1999; 22: 54-66.
72. Livingston PO, Ragupathi G, Musselli C. Autoimmune and
antitumour consequences of antibodies against antigens shar-
369
ed by normal and malignant tissues. J Clin Immunol 2000; 20:
85-93.
73. Livingston PO, Wong GYC, Adluri S, et al. Improved survival
in stage III melanoma patients with GM2 antibodies: a rando-
mised trial of adjuvant vaccination with GM2 ganglioside. J
Clin Oncol 1995; 12: 1036-1044.
74. Helling F, Zhang A, Shang A, et al. GM2-KLH conjugate vac-
cine: increased immunogenicity in melanoma patients after ad-
ministration with immunological adjuvant QS-21. Cancer Res
1995; 55: 2783-2788.
75. Minasian LM, Yao TJ, Steffens TA, et al. A phase I study of
anti-GD3 ganglioside monoclonal antibody R24 and recombi-
nat human macrophage colony stimulating factor in patients
with metastatic melanoma. Cancer 1995; 75: 2251-2257.
76. Kirkwood JM, Ibrahim JG, Sosman JA, et al. High dose inter-
feron -2b significantly prolongs relapse-free and overall survi-
val compared with the GM2-KLH/QS-21 vaccine in patients
with resected stage IIB-III melanoma: results of intergroup trial
E1694/S9512/C509801. J Clin Oncol 2001; 19: 2370-2380.
77. Harro CD, Pang Y-YS, Roden RB, et al. Safety and immuno-
genicity trial in adult volunteers of a human papillomavirus
16L1 virus-like particle vaccine. J Natl cancer Inst 2001; 93:
284-292.
78. Rosenberg SA, Zhai Y, Yang JC, et al. Immunising patients
with metastatic melanoma using recombinant adenoviruses en-
coding MART-1 or gp100 melanoma antigens. J Natl Cancer
Inst 1998; 90: 1894-1900.
79. Berinstein NL. Carcinoembryonic antigen as a target for the-
rapeutic anticancer vaccines: a review. J Clin Oncol 2002; 20:
2197-2207.
80. Marincola FM, Jaffe EM, Hicklin DJ, et al. Escape of human
solid tumours from T cell recognition: molecular mechanisms
and functional significance. Adv Immunol 2000; 74: 181-271.
81. Andreola G, Rivoltini L, Castelli C, et al. Induction of lympho-
cytes apoptosis by tumour cell secretion of FasL-bearing mi-
crovesicles. J Exp Med 2002; 195: 1303-1316.
82. Berd D. Cancer vaccines: reborn or just recycled? Semin On-
col 1998; 25: 605-610.

.

O OI (contrast)
-
-.

3.
. -
- : )
, -
. (
1913 ) ) -
Albert Solomon - .
. 80 -
- -
. -
. -
, -
. -
- 4.
, (/ ),
(, ), - -
, . - ,
, - ,
.
. - ) --
-
1,2. , ) , ) -
- -
, - , )
, - , ) -
, ) -
. .
- O
, ( ).
- -
. .
- (45) (mediolateral oblique)
- -
, . ,
- . : )
- , ) -
. - ,

371
372 OY

) ) .
. ( 100%) -
(cranio caudal) - -
, (50% , 3040% -
- 90% in situ
. ).
: ) -
) - , 2535% -
. (
O ).
, - (interval cancers).
(spot compression views), ( -
(magnification views) (tan- )
genital views), - (6570%).
. 5:
O , - -
,
-
. , , , -
O

. (98%
O ) -
-
, -
,
. - -
90 - .
,
, -
, (-
-
. ,
O , , ,
- , ).
.
(
( Eklund - , , )6.
-
).
- ,
-
- . -
,
.
( - .
)
8590% ( 10% .
),
100%. , (, -
-
VI. 373

), - -
(, - 50% 50%
, , , - 1,11,8 mGy7.
) -
7.

- . -
, - . O -
, - , -
, - -
, - , ,
- -
8. -
, -
, - .
, -
- OOH OH O
. - O OE OE -
, - E AO I
, - O . -
,
- . O
. - , . O
-
9. ()
10.
, - -
- (
() - ), -
(phantom). .
, phantom (-
. ),
-
(contrast), - .
. -
(grid) 2530 KV,

0,003 mm. .
(AEC) ,
- ,
( ) 11. -
. , ,
, -
. .
contrast ( -
. ). O
- ,
( 3 mm , -
1 mm) - . O Cooper -
-
. .
374 OY

( ) -
- -
- .
. -
, .
12. -
, -
, - .
, -
/ . - , -
. -
-
: , -
) - 9899% (, -
. ).
) - O -
. -
) -
.
6 3 (
OOH OH OOI 12%).
-
H
FNAC (

-
. -
) Core Biopsy ( -
,
).
,



. 14.

,
, - () -
. () .
O (-
( ), )
, - .
(- ,
) . , (radial scar) -
O , -
( ), - ,
, , - . -
. -
- .
.
.
,
. . -
, , , , - , ,
-
13.
, .
VI. 375

- ,
, , ) -
. - , , -
( , , , ,
) . .
- : ) , ) -
, - , ) ( )
- , ) , ) -
(). .
-
- OH I OOO
. -
-
. -
.
. , , -
- .
,
. , ,
0,5 mm, - . -
, 0,5 mm. - .
- ( ), -
. 1/3 (, -
- ) -
(in situ) . O - .
, -
O
.
, , ,
-
.
( -
), ( ), - i.
(pop-corn), - , -
( , .
, ), -
( - ii.
, ) - -
. -
- .
() . : ) , ) -
- , ) -
, - , ) ) .
, , - , ,
. -
,
5 1 cm. 30% - .
,
, . -
: ) , ) , ) , ) -
1,5 mm. , ) , ) , ) -
, ) , ) , ) , ) -
. : ) , ) , ) , )
- .
376 OY

, . , -
- , , -
, 2%. .
O - ()
. . -
(TDLU, terminal duct lobu-
lar unit) - .
.
, -
, - .
- O
. -
, - . O -
. -

- .
. - -
, , -
. - .
-
. - -
- . -
. , , -
.
-
, 30. ,
, - ( -
. pop-corn - ). -
, , , -
. - , ,
, 25% - ,
.
. - .
O
.

115 .
. -
-
( -
) -
.
-

( -
),
.
.
E 1. 48 -
O - .
. 0,3 .,
, , .
VI. 377

, - -
-
(. 1), - . -
-
. in situ () - ,
, - . -
. - -
, () .
.
iii.
( -
, ). ,
O 16. -
, , -
- ( ) .
. , , -
- .
. ,
. -
- .
. iv.
.
-
(, )
. O -
.
- .

-
-
. -
. : ) , )
. O
, ) ) ,
, -
,
-
.
.
.
. O v.
- -
, . O
.
.
, - vi.
NOS (not
otherwise specified), - -
, 6580%. 3
14% . -
. , 20 30.
O , O 3050 -
, -
. - .
, 5 .
-
- .
-
. - . -
, , - -
. - ,
378 OY

. -
-
.

OH I O-

O -

. 3050%
.
O
. 90% DCIS
E 2. 60 -
(ductal carcinoma in situ) 70% -
.
( 0,5 . -
DCIS) - DCIS comedo.
17 (. 2).
O - , -
. O
) (. 1) )
- (. 2). -
. , , -
-
- (. 3).

1.

I.
( )
( , , )
( )
( , , )
pop-corn ( )
(, , )
milk of calcium ( , )
( )
( )
( 1 mm, , )
II.
( , )
III.
(, . 0,5 mm)
/ ()

2.

O : (< 2 cm3)
:
: ( )
: ( )
: ( )
VI. 379

,
3.
( ). -
I. . , , .
O -


12 mm. -
O
, , -
II. ,
.
()


-
.
.
A OH O O -
O -
(1 mm ) -
. - .
-
, H A OH
. ,
O - , .
,
. , , : )
, (>1 cm).
. , -
- , ) ,
, , ) -
(). - 18.
-
. , , , -
O , ,
. -
. .
-
(). .
. - -
. . -
O pop-corn - -
. -
- .
. - O -
-
. A - .
-
, - , 90%
. .
O , - -
, -
, ,
. () (. 3). -
O milk of calcium - -
,
380 OY

-
-
20.

. -

. -
(BIRADS cat III) -
. follow up
1 -
4 . -
.
, .

O OEO O
-
-
,
-
E 3. 48 . -
. -
, -
-
(). , (25 -
, -
) , -
(branching) ,
DCIS (ductal carcinoma in situ). 3 .
-
. .
. O ( -
56 ) 3
. O - .
- 2
. - (
, . 3 ).
O -
I O
. 5 -
-
, - . -
19. -
O 5 , -
, , ,
-
. , -
-
OH O .
O OO -
.
,
. O- 5%
- 10% . -
5 . -
-
VI. 381

21. - -
: ) - screening
, ) - . -
(.. - ,
), ) ( , .
,
- , -
)24. - , -
: ) , - -
(.. - , ,
, - -
), ) .
( ), )
(- -
, , -
)22,23. -
27.
. -
- 1921 G, 79 cm.
-
,
, (hook)
.
- 12 .. ( ).
. O O
- , ,
, - 12
. - , -
-
25,26. , -
3
4 , , .
. -
, (specimen mammogra-
. phy) -
28.
, - O (.. -
, , - ) -
( ) - , ,
, , - ,
, , ( - , -
). .

E A O OH , -
OH , -
- ,
,
, ,
. - .
- (add-on) -
, -
382 OY

, -
, - -
, - . CB
, -
. ,
- ( , ) -
(add-on) .
. , -
- . -
,
, -
, , , -
, .
20 21G.
- O BIRADS OA
(18G), - OOY EO
( - ,
)29.
-
, , -
30. -
(
- screening ), (-
, ) ,
, .
, BIRADS (Breast Imaging Re-
- porting and Data System). 6
, 32:
(FNAC) Cat 0: . -
- .
(16G) (Core biopsy Cat I: , -
CB). CB - .
, 31. - Cat I: .
FNAC CB : Cat III: .
) . Cat IV: .
) - Cat V: .
. cat II : -
) - , -
, , DNA .. -
) - , , , -
- ( -
. ), -
, , -
, milk
FNAC, CB. of calcium.
FNAC cat III : )
- ,
, - ) , , -
, )
,
VI. 383

, ) , - -
.
, (
- OOO EO O
), ) ( ) - OI
( , ) O -
. . O -
cat IV -
- -
, 25%, , -
. () ,
cat V
, , - 50%.
O
, , - :
. )
O IV 4 - )
V.
- ) .
BIRADS cat II 0%,
cat III 23%, cat IV 2030% cat V -
7080%. ,
... cat III -
-
612 24 . Si- , .
ckles 10% cat III, -
O E OE A
, -
OI
-
033. cat IV O -
1985
( -
core biopsy). - -
, -
. - : 2235 KV,
IV - , -
34. , / , 3
1 mm, 650 mm, -
Susan G. Komen, Dallas Texas, (bucky), -

(needle core biopsy) cat IV. - (C: Auto Exposure Control), -
- (24 30 cm) (18 24 cm)
( ).
. A -
-
.
O - contrast,
(- .
) -
. -
, , - ,
, - ( ), -
384 OY

, , , -
- V.

. (underexposure).

OO E E Y- .
A -
- (-
- , -
: , masking ).
(contrast)
-


O . , , -
,
(, -
. ),
contrast.
( MLO CC) (sharpness) -
- -
. . .
- O (noise)
.
- , . O
, , - -
. .
MLO , - -
, -
- .
. CC - , ,
- -
. .
, - , -
. -

(18 24 cm) , -
.
( ) , ,
. , -
(KV, ms) -
- .
, -
, - I
. , (OY OOO OY)
, ACR,
. :
, 1. -
MA/sec. .
phototimer 2. 240 -
mAs 6 .
VI. 385

3. 480 . 5 -
4. 40 3 76% -
. 20%, -
O ( , , ,
: ).
1. . 5
2. -
1 - (screen-
. ing). -
3. 5 -
.

O .
: -
1. . (in
2. - situ ).
. -
3. 5
. , -
ACR - .
- : )
. )
.

, .

-
Test phantom
-
. -
AEC, KVp . 1960 Egan


-
. -
, Shapiro
OI O OO EO ,
(SCREENING)
M in situ .
, - -
..., ,
12,6% (1 8 ). -
,
. lead time bias ( -
1999 181.000 ,
44.000 ) length-bias sampling ( -
.
). -
-
, -
, 5 97%. - -
386 OY

.
. -
.
.

, (NBSS)36. O
- . -
. - (intervals)
.
( ) -
. , 1 , -
2, 4 6 -
. -
, - 3, 5 7 . O
, - Kopparberg Ostergottland
(p 0,05). (Two-County trial), Stockholm, Malmo Gothenberg
To 1963 -
HIP (Health Insurance Plan of New York), - , . -
- ( -
4 31.000 11%
4064 , )37.
62.000 . O 32.000 50 24 .
Gothenberg 18 -
. 4 , HIP NBSS -
, . ,
2/3 , -
. group 4049,
1977 Shapiro , NBSS -
9 -
: 30% - ( -
)38.
.
1014 . 1989 National Cancer Insti-
HIP - tute American Cancer Society,
,
- : -
35. (baseline mammo-
O - graphy) 3540 , -
12 4049 -
group 4049 5064 50 .
. 5064 - Breast Imaging Committee American College of Ra-
, - diology
4049 - group 4049, -
5 6 . -
5064 (40%), 5059 -
4049 (1520%) , -
. HIP -
, -
50 - 39.
, 9
-
VI. 387

4.

Follow up

(1963-1969) 4064 2 12 30.131 18 23%

Malmo (1976-1986) 4569 12 1824 20.695 12 29%
Kopparberg (1977-1983) 4074 1 24 38.562 13 32%
Ostergottland (1977-1983) 4074 1 24 38.405 13 22%
Edinburgh (1979-1988) 4564 12 24 23.226 10 26%
Stockholm (1981-1985) 4064 1 28 38.525 8 20%
Gothenberg (1983-1988) 4059 2 18 20.724 7 14%
Canada 1 (1980-1987) 4049 2 12 25.216 7
Canada 2 (1980-1987) 5059 2 12 19.711 7 3%

1963 (. 4), 5 - 1. O
.
group - 2. ,
22% (Edinburgh) 29% .
(Malmo) 2 - 3. -
( ). O - .
, 4. O -

, - .
( 26% - 5. < 15 mm -
control group ), ,
- .
6.
. 50 -

-
-
.

7. , -
-
-
, -
. -
,
: ,
.
1. O
2.
,
, ; ;
, 5
,
( ) -
group - 4049, -
, 7079 . -
1432%. -
. 40 .
O L. Tabar 1999 (
Two-county study 70, 75 ), -

40 : -
388 OY

68%
5. -
(1995) ...*
85%. -
4049

2029 600 0,3%
group 4049
3039 8.400 4,6% -
4049 33.800 18,6% .
5059 28.300 15,6%
6069 41.300 22,7% 4.
7079 44.100 24,3% ;
80+ 25.300 13,9%
-
182.000 , -
* : American Cancer Society SEER program incidence rates

, .
Harvard 199942 J.
. - Michaelson D. Kopans, -
75 -
, - -
,
o - 50 -
. 80 , 5070 157
70 188 . -
3. 40-49 -
5070
; , -
1
- ( ,
5059. - , ).
T
Nijmegen O43, -
group 5069. 25%
( 1/5 ),
group ,
. 18% -
, - . ,
- , -
- -
.
-
, , -

- -
, 4049 .
- -
, -
5069, - ,
-
(1014 ). 183.134 , -
41 - 4075.
54% 40 , -
77% 4049 , 78% 5064 -
81% 64 . :
VI. 389

) T .
( -
, , ( -
, - ) (
).
) ( - ,
, ). ). -
) . , -
( 1 .
2 ). -
-
. - , -
-
- CAD.
(18 24
). -
) T , 74 . -
-
. ,
, ( )
(, . -
, , , - ,
).
, -
-
.
:
2000 2001 -
1. 41.000 -
Lancet 44,45
.
, (meta-
2.
analysis)
70%.
,
3.
,
10% -
. -
.
-
4. 1,5% -
-
.
30%, -
5. -
in situ -
0,55%.
, -
6. >0,30,
, -
4049 , .
> 0,50 50 . O -
7. 25% -
in situ . ,
8. < 15%, , -
2 . -
- -

.
40 , - -
,
, -
- ,
390 OY

. ,
, ( 350 ),
, 30% -
,
( 4 ).


(.. 1.500.000 ) - , -
-
(1.500.000 ) - ,
, - -
. ,
1.500.000 - 6,6 -
, - , rad,
10 -
. - 47,48.
( , NCI (National Cancer Institute)
) 7,5
, rad, -
, - 35 3,5
, 35 .
, 50%
1 2.000.000
,
. O -
( )
200

, 30 , -
(U/S, MRI),
60
,
49.
.
O

H O O OOI
OI

30 .
2530 -
50.
25 -
46. . O -
, -
0,1 -
rad, , ,
. -
, .
- -
-
. , 815% -
, - -
. - .

1. American Association of Physicists in Medicine 1990. Equip- CB. Anthropomorphic radiologic phantoms. Radiology 1986;
ment requirements and quality control for mammography. 158: 550-552.
2. Yaffe MJ, Johns PC, Nishikawa RM, Mawdsley GE, Caldwell 3. Moores BM, Henshaw ET, Watkinson SA, Pearcey BJ. Practi-
VI.
cal guide to quality assurance in medical imaging. Chichester:
Wiley, 1987.
4. Eklund GW, Gardenosa G. The art of mammographic positio-
ning. Radiol Clin North Amer 1992; 30: 21-53.
5. Azzopardi JG. Problems in breast pathology. London, Eng-
land: Saunders, 1979.
6. Kopans DB, Swann CA, White G. Asymmetric breast tissue.
Radiology 1989; 171: 639-643.
7. White DR, Tucker AK. A test object for assessing image quali-
ty in mammography. British Journal of Radiology 1980; 53:
331-335.
8. Cowen AR, Coleman NJ. Design of test objects and phantoms
for quality control in Mammographic screening. In: Institute
of Physical Sciences in Medicine, Report 61. Physics in Dia-
gnostic Radiology. New York: 1990: 30-36.
9. Hendrick RE. Standardization of image quality and radiation
dose in mammography. Radiology 1990; 174: 648-654.
10. Kinne DW, Kopans DB. Physical examination and mammo-
graphy in the diagnosis of breast disease. In: Harris JR, Hen-
derson JC, Hellman S, Kinne DW, eds. Breast diseases. Penn-
sylvania: JB Lippincott, 1987: ch. 3.
11. Wolfe JN. Breast patterns as an index of risk for developing
breast cancer. AJR 1976; 126: 1130-1139.
12. Wolfe JN. Breast parenchymal patterns and their changes with
age. Radiology 1976; 121: 545-552.
13. Urbanski S, Jensen WM, Cooke G, Mc Farlane D, Shannon P,
Kmikov V, Boyd NF. The association of histological and radio-
logical indicators of breast cancer risk. BJC 1988; 58: 474-479.
14. Sickles EA. Nonpalpable, circumscribed, noncalcified solid
breast masses: likelihood of malignancy based on lesion size
and age of patient. Radiology 1994; 192: 439-442.
15. Moskowitz M. Circumscribed lesions of the breast. In: Ms-
kowitz M, ed. Syllabus: a diagnostic categorical course in breast
imaging. Oak Brook, III: Radiologic Society of North America
1983; 31-33.
16. Mitnick JS, Roses DF, Harris J, Feiner HD. Circumscribed in-
traductal carcinoma of the breast. Radiology 1989; 170: 423-
425.
17. Leborgne R. Diagnosis of tumors of the breast by simple ro-
entgenography: calcifications in carcinoma. AJR 1951; 65: 1-
11.
18. Feig SA, Galkin BM, Muir HD. Evaluation of breast microcal-
cifications by means of optically magnified tissue specimen ra-
diographs. Recent Results in Cancer Research 1987; 105: 111-
124.
19. Feig SA, Shaber GS, Patchefsky A. Analysis of clinically occult
and mammographically occult breast tumors. AJR 1977; 128:
403-408.
20. Wolfe JN. Analysis of 462 breast carcinomas. AJR 1974; 121:
846-853.
21. Wingo PA, Tong T, Bolden S. Cancer statistics, 1995. CA
1995; 45: 8-30.
22. Gravelle H. Mammography. In: Sutton D, ed. A textbook of
radiology and imaging. Edinburg: Churchill-Livingstone, 1980:
1396-1410.
23. Feig SA. The breast. In: Grainger R, Allison D, eds. Diagno-
391
stic radiology: an Anglo-American textbook of imaging. Edin-
burgh: Churchill Livingstone, 1986: 1631-1668.
24. Sadowsky N, Kopans DB. Breast cancer. Radiologic Clinics of
North America 1983; 21(1): 51-65.
25. Rosen PR. The pathology of breast carcinoma. In: Harris JR,
Henderson JC, Hellman S, Kinne DW, eds. Breast diseases.
Philadelphia: JB Lippincott, 1987: ch. 7.
26. Love SM, Schnitt SJ, Connoly JL, Shirley RL. Benign breast
disorders. In: Harris JR, Hellman S, Henderson IC, Kinne DW,
eds. Breast diseases. Philadelphia: JB Lippincott, 1987.
27. Fajardo L, Davis J, Wiens J, Trego D. Mammography-guided
stereotactic fine-needle aspiration cytology of nonpalpable
breast lesions: prospective comparison with surgical biopsy re-
sults. AJR 1990; 181: 359-361.
28. Evans WP, Cade SH. Needle localization and fine-needle aspi-
ration biopsy of nonpalpable breast lesions with use of stan-
dard and stereotactic equipment. Radiology 1989; 173: 53-56.
29. Liberman L, Dershaw DD, Rosen PP, et al. Stereotactic core
biopsy of breast carcinoma: accuracy at predicting invasion.
Radiology 1995; 194: 379-381.
30. Homer MJ. Localization of nonpalpable breast lesions with
the curved-end, retractable wire: leaving the needle in vivo
AJR 1988; 151: 919-920.
31. Helvie MA, Ikeda DM, Adler DD. Localization and needle a-
spiration of breast lesions: complications in 370 cases. AJR
1991; 157: 711-714.
32. American College of Radiology. Breast imaging repeating and
data system. Reston, Va: American College of Radiology, 1993.
33. Sickles EA. Periodic follow-up of probably benign mammogra-
phic lesions: results of 3184 consecutive cases. Radiology 1991;
179: 463-468.
34. Sullivan DC. Needle core biopsy of mammographic lesions.
AJR 1994; 162: 601-608.
35. Shapiro S. Screening: assessment of current studies. Cancer
1994; 74: 231-238.
36. Kopans DB, Feig SA. The Canadian National Breast Screen-
ing Study: a critical review. AJR 1993; 161: 755-760.
37. Muir BB, Kirkpatrick A, Roberts MM, Duffy SW. Oblique-
view mammography: adequacy for screening. Radiology 1984;
151: 39-41.
38. Eddy DM, Hasselblad V, McGivney W, Hendee W. The value
of mammography screening in women under 50 years. JAMA
1988; 259: 1512-1519.
39. Moskowitz M. Breast cancer: age-specific growth rates and
screening strategies. Radiology 1986; 161: 37-41.
40. Tabar L, et al. The natural history of Breast carcinoma. What
have we learned from screening? Cancer 1999; 86: 449-62.
41. Rosenberg RD, et al. Effects of age, breast density, ethnicity
and estrogen replacement therapy on screening mammogra-
phy sensitivity and cancer stage at diagnosis: review of 183.134
screening mammograms in Albuquerque, New Mexico. Radio-
logy 1998, Nov; 209(2): 511-8.
42. Michaelson J, et al. Breast cancer: Computer Simulation Me-
thod for estimating optimal intervals for screening. Radiology
1999; 212: 551-560.
43. Van Gils CH, et al. High mammographic breast density and its
392
implications for the early detection of breast cancer. J Med
Screen 1999; 6(4): 200-4.
44. Olsen O, et al. Cochrane review on screening for breast cancer
with mammography. Lancet 2001; 358: 1340-42.
45. Gotzsche P, et al. Is screening for breast with mammography
justifiable? Lancet 2000; 355: 129-34.
46. Shapiro S, Venet W, Strax P, Venet L. Periodic screening for
breast cancer: the health insurance plan project and its seque-
lae, 1963-1986. Baltimore, Md: Johns Hopkins Press, 1988.
47. Tabar L, Farenberg CJG, Gad A, et al. Reduction in mortality
from breast cancer after mass screening with mammography:
randomized trial from the Breast Cancer Screening Working
OY
Group of the Swedish National Board of health and Welfare.
Lancet 1985; 1: 829-832.
48. Tabar L, Farenberg G, Duffy SW, Day NE. The Swedish two-
county trial of mammographic screening for breast cancer: re-
cent results and calculation of benefit. J Epidemiol Commu-
nity Health 1989; 43: 107-114.
49. Dodd G. American Cancer Society guidelines on screening for
breast cancer: an overview. Cancer 1992; 42: 177-180.
50. Hurley SF, Kaldor JM. The benefits and risks of mammogra-
phic screening for breast cancer. Epidemiologic Reviews 1992;
14: 101-130.

(...)
. , . , . , .

O (...)
. -
700.000 - ,
1. ,
- 15% 4.
2. - -
,
300.000 : , . -
. - -
-
. 5.
O - -
: -
- , -
, . - .
, - , -
, ,
, ,
.
, -
-
. -
- (screening).
: ) -
- -
. -
6 ml 3. -
- )
-
. - -
, () -
.
.
OOH I IO O-
- (FECAL OCCULT BLOOD TEST F.O.B.T.)
. - E E OH OOI -
- EO OA
, - O
- - ..., ,
. E

393
394 OY

(). - , 98%10.
(positive predictive
(Hemoccult test, Hemoccult II, Hemoccult value) ... (5,6%
Sensa), 2,2%
(Hemo Quant), Mandel et al)
(He- 11.
me Select), 46.500 50
-
. ...
Hemo Quant Hemoccult , ,
...
, - 12.
- -
. Hemo Quant - -
,
. - ...
6. -
Hemo Quant -
Hemoccult II, 13.
... O Y (WHO)
..., - 50 -
(26%)7. .
Hemoccult Heme Se-
lect -
..., Heme Se- 4050%14.
lect (94% 58%), , -
F.O.B.T. ...
8. -
, - .
, Hemoccult II, Hemoccult Sensa, Heme Select , 13
Hemo Quant, ... 62.000 , Jorgensen et
- al F.O.B.T.
, Heme Select Hemoccult Sensa - 30% -
... - - 15. , -
- -
... - Minnesota ... Nottingham
90%, - , -
- Hemoccult II9. F.O.B.T.
, , - ...11,16.
C - Minnesota
, , -
, 33%,
, - 6%11.
,
-
, - 1518%
15,16.
. - ,
-
-
, ,
VI. 395

12% 17. 15 -
- K-ras, APC
- p53 , BAT 26
- DNA.
... - -
, (28
- , 11
. - 22 ...),
91%
, 82% , -
- 93%.

( - DNA -
). . -
, -
, - ,
. - , , -
.
, - -

... TP53, 26, -ras 26, 26 -
18,19. 27 APC28,
- .

- OOO EO (Y OO-
RT-PCR - OOO OONOO)
20. 70 Gilbertsen
O DNA - Nelms
- ... 29 (. 1).
21. DNA - 1980
-
50
22. 1995 -
DNA ... 30,31.
... -
23,24.
K-ras , , -
50% -
.

DNA,
, K-ras
-
.
-


, -
DNA25. -
DNA 1. -
, - .
396 OY

1990 -
-
- 50% , -
... .
-
. , -
-
Y OOOOO , -
O Selby et al Newcomb et al .
O Lemmel et al 23%
..., , ...
- -
36. -
...32,33.
5 . - ...
, -
- ... -
70%.
45% ... -
(
(. > 1 cm )
2). . -
-
- 37,38.
15%
...
- . -
,
. - 50% 39,40,41.
-
. -
- 50%. 30%
-
34,35. . -
1/3

.
50% 5070 -
.
5% ... -
. ,
,
.
-
-
40%
. O -


2. - .
. -
VI. 397

.
-
-
.
-
-
,
.
40-47.
-



. 4. .
(> 1 cm) -
... -
48,49 (. 3). -
818% 48,49. 50,54. -
- ... -
(5% 50 ), ... -

... (. 4). O , -
3,23,6 50,51. -
38.
-
(< 1 cm). , E-
. 35 ,
- 55. -
- -
, -
48,49,52,53. 3
32% 42% ... 3,3%38.
-
. - OONOO

. ...

( ,
...). -
-

, ... -
55 55.
-
-
, -
... -
11.
3. -
.
398 OY

55 , - ,
... ..., -

OO O OY O- -
OY OOOY EO ,
- -
, , -
: . -
10, 55 - -,
, (- ...,
- 58,59.
, O Frazier et al -
- 1, -
- , ,
), - ... (1998),
- ...
... .
56.
O Eddy et al - H E O OOY
- -

. - ,
-- .
, -
,
. , -
-
, -- 60.

57. ,
F.O.B.T. ... 5$61.

1. - ...

- -

(1998, $ ) () (1998, $ ) ... (%) ... (%)

1.052 17.3481
Sig1 55 1.070 17.3632 1.200 14 16
Sig2 55 1.095 17.3654 11.000 15 19
.... 55 1.200 17.3585 8 11
Sig1 10 1.218 17.3732 15.800 28 32
Sig2 10 1.288 17.3775 16.100 32 38
55 1.312 17.3760 27 31
Sig1 5 1.438 17.3806 37 40
.... Sig2 10 1.810 17.4022 21.200 55 70
10 2.028 17.3959 58 64
.... Sig2 5 2.034 17.4066 51.200 61 75

Sig1:
Sig2:
....:
VI. 399

2. O ...
,
1. -
. , -
2. O , -
Turcot Gardner

3. ... -
4. -
Peutz-Jeghers

5. O ( ):
.
... 70
A O EO
6. : O (FAP)

,
FAP PC (adenoma-
tous polyposis coli) . -
, APC -
, FAP. O -
... APC
2. FAP, -
- (
- 10
, ), -
, - FAP 20 -

- 10 -
FAP.
.

KOOOYO IO EO O
EO O EO FAP ,
- , -
- , -
(FAP: Familial adenoma- . O -
tous polyposis) - -
(HNPCC: Hereditary -
nonpolyposis colorectal cancer), - , -
.
, -
. ,
: -
-
. - -
- , .
- FAP -
, - ,
,
, -
, . -
. ,
400 OY

ENEIEI:
- FAP
( 100 . )
-
FAP
- 20
. ( FAP)
- APC
AFAP (
FAP/AFAP)
APC
(
FAP/AFAP)
APC
(
ENETIKH KAOHHH: K - APC
FAP/AFAP)
- E

- E / E

- E
APC
-
( )
-

K



APC
( ,
K

APC )
M/ M
PC
( FAP/AFAP)
APC





APC
( E 5.
FAP/AFAP) FAP.

- MSI, ,
(. 5). . -
HNPCC -
-- Amster-
(Hereditary nonpolyposis colorectal
dam, ,
cancer HNPCC)
-
Bethesda -
HNPCC .
DNA -
(hMLH1, hMSH2, hPMS1, hPMS2, hMSH6).
(MSI, Microsatellite instabi- O
lity) DNA - NPCC , -
( - , -
) - ,
- .
. hMSH2 hMLH1, o SI
HNPCC, Bethesda, -
 VI.

(
HNPCC )
(
HNPCC )

(
MSI HNPCC)

MS MSH2 / MLH1


MSI
MSS ( )
-


MSH2/MLH1 ( )

ENEIEI: ENETIKH KAOHHH:

- -
Amsterdam
- - /
Bethesda- - ( HNPCC )
-
-
( ,
)
MSH2 / MLH1


( )
(
HNPCC )



( PCC)

6. HNPCC .
401
402 OY

, < 40 )
HNPCC.
SI DNA < 50
, -
(CSGE) , <50
(SSCP) -
hMSH2 hMLH1 . - , < 50
( < 40 .
hMSH2 hMLH1) -
. , -
, - -
- , -
- 62, ,
. 63.
, -
- ... , -
, FAP. 64.
MSI -
(N/SS) - -
, , ,
- ... -
. SI - 65 -
/ 23 66.
3 -
Bethesda, - 2 ,
. Crohn
, - (. 7).
, - -

. -
, E A.
8 12-15

(. 6).
E 1-2
H O AMSTERDAM B 10-12 cm

3 ,
E

2 E X Y
1 ,

50 .
E K
H A BETHESDA-OOOE 1-2 3-6

Amsterdam
X +
2 HNPCC ( X
/ ) E

/ K

HNPCC / 7. O O (WHO)
( < 50 , .
VI.
5%
... 10 20
67. - 69. -
68.
, 5 .
1. Parkin DM, Pisoni P, Ferlay J, et al. Estimates of the worldwi-
de incidence of eighteen major cancers in 1985. Int J Cancer
1993; 55: 594-606.
2. Garfinkel L, Mushinski MUS. Cancer incidence, mortality and
survival: 1973-1996. Stat Bull 1999; 80: 23-32.
3. ercal FA, Saint John DJB. Relationship between patients of
bleeding and Hemoccult sensitivity in patients with colorectal
cancers and adenomas. Gastroenterology 1982; 82: 891.
4. Silverman AI, Desai TK, Dhar R, et al. Clinical features, eva-
luation and detection of colorectal cancer. Gastroenterol Clin
N Am 1988; 17: 713-725.
5. Bentler B, Cerami A. Cachectin: More than a tumor necrosis
factor. N Engl J Med 1987; 316: 379.
6. St John DJ, Young GP, McHutchison JG, et al. Comparison
of the specificity and sensitivity of Hemoccult and Hemo-
Quand in screening for colorectal neoplasia. Ann Int Med
1992; 117; 376.
7. Ahlquist DA, Wieand HS, Moertel CG, et al. Accuracy of fe-
cal occult blood screening for colorectal neoplasia. A prospe-
ctive study using Hemoccult and HemoQuant tests. JAMA
1993; 269: 1262-1267.
8. Thomas WM, Hardcastle JD, Jackson J, et al. Chemical and
immunological testing for fecal occult blood. A comparison of
two tests in symptomatic patients. Br J Cancer 1992; 65: 618-
620.
9. St John DJB, Young GP, Alexeyeff MA, et al. Evaluation of
new occult blood tests for detection of colorectal neoplasia.
Gastroenterology 1993; 104: 1661-1668.
10. Allison JE, Feldman R, Tekawa IS. Hemoccult screening in
detecting colorectal neoplasm: sensitivity, specificity and pre-
dictive value long-term follow-up in a large group practice set-
ting. Ann Intern Med 1990; 112: 328-333.
11. Mandel JS, Bond JH, Church TR, et al. Reducing mortality
from colorectal cancer by screening for fecal occult blood. N
Engl J Med 1993; 328: 1365-1371.
12. Jensen BM, Kronborg O, Fenger C. Interval cancers in screen-
ing with fecal blood test for colorectal cancer. Scand J Gastro-
enterol 1992; 27: 779-782.
13. Simo JB. Occult blood screening for colorectal carcinoma: A
critical review. Gastroenterolgoy 1985; 88: 820-837.
14. Winawer SJ, John DJSL, Bond JH, et al. Prevention of colore-
ctal cancer guidelines based on new data. Bulletin of WHO
1995; 73: 7-10.
15. Jorgensen OD, Kronborg O, Fenger C. A randomized study of
screening for colorectal cancer using faecal occult blood test-
ing: results after 13 years and seven biennial screening rounds.
Gut 2002; 50: 29-32.
16. Hardcastgle JD, Chamberlain JD, Robinson MHE, et al. Ran-
403
domised controlled trial of faecal-occult-blood screening for
colorectal cancer. Lancet 1996; 348: 1472-1477.
17. Autier P, Boyle P, Buyse M, et al. Is FOB screening really the
answer for lowering mortality in colorectal cancer. Recent Re-
sults. Cancer Res 2003; 16: 254-263.
18. Ahlquist DA, Harrington JJ, Burgart LJ, et al. Morphometric
analysis of the molecular layer overlying exfoliated stool
screening markers. Hum Pathol 2000; 31: 51-57.
19. Loktionov A, ONeill IK, Sylvester KR, et al. Quantitation of
DNA from exfoliated colonocytes isolated from human stool
surface as a novel non-invasive screening test for colorectal
cancer. Clin Cancer Res 1998; 4: 337-342.
20. Chung KY, Mullick T, Motevalli S, et al. Evaluation of sensiti-
vity and specificity of CD44 expression in fecal colonocytes as
a non-invasive marker for detecting colonic polyps and cancer.
Gastroenterology 1998; 114: A580.
21. Boland CR, Sato J, Saito K, et al. Genetic instability and chro-
mosomal aberrations in colorectal cancer: a review of current
models. Cancer Detect Prev 1998; 22: 377-382.
22. Poiner HN, Hofreiter M, Spaulding WG, et al. Molecular co-
proscopy: dung and diet of the extinct ground sloth. Nothe-
riops shastensis. Science 1998; 281: 402-406.
23. Puig P, Urgell E, Capella G, et al. A highly sensitive method
for K-ras mutation detection is useful in diagnosis of gastroin-
testinal cancer. Int J Cancer 2000; 85: 73-77.
24. Villa E, Dugani A, Rebecchi AM, et al. Identification of sub-
jects at risk for colorectal carcinoma through a test based on
K-ras determination in stool. Gastroenterology 1996; 110:
1346-1353.
25. Ahlquist DA, Skoletsky JE, Boynton KA, et al. Colorectal can-
cer screening by detection of altered human DNA in stool:
feasibility of a multitarget assay system. Gastroenterology 2000;
119: 1219-1227.
26. Dong SM, Traverso G, Johnson C, et al. Detecting colorectal
cancer in stool with the use of multiple genetic targets. J Natl
Cancer Inst 2001; 93: 858-865.
27. Traverso G, Shuber A, Olsson L, et al. Detection of proximal
colorectal cancers through analysis of faecal DNA. Lancet
2002; 359: 403-404.
28. Traverso G, Shuber A, Levin B, et al. Detection of APC muta-
tions in fecal DNA from patients with colorectal tumors. N
Engl J Med 2002; 346: 311-320.
29. Gilbertsen VA, Nelms JM. The prevention of invasive cancer
of the rectum. Cancer 1978; 41: 1137-1139.
30. Eddy D. ACS report on the cancer-related health check-up.
Cancer 1980; 30: 193-240.
31. Guide to Clinical Preventive Services: Report of the US Pre-
ventive Services Task Force. 2nd ed. Washington DC: Depart-
404
ment of Health and Human Services, 1995.
32. Selby JV, Friedman GD, Quesenberry CP, et al. A case control
study of screening sigmoidoscopy and mortality from colore-
ctal cancer. N Engl J Med 1992; 326: 653-657.
33. Newcomb PA, Norfleet RG, Storer BE, et al. Screening sigmo-
idoscopy and colorectal cancer mortality. J Natl Cancer Inst
1992; 84: 1572-1575.
34. Atkin WS, Cuzick J, Northover JMA, et al. Prevention of colo-
rectal cancer by once-only sigmoidoscopy. Lancet 1993; 341:
736-740.
35. Grandqvist S. Distribution of polyps in the large bowel in rela-
tion to age. Scand J Gastroenterol 1981; 16: 1025-1031.
36. Lemmel GT, Haseman JH, Rex DK, et al. Neoplasia distal to
the splenic flexure in persons with proximal colon cancer. Ga-
strointest Endosc 1996; 44: 109-111.
37. Muller AD, Sonnenberg A. Prevention of colorectal cancer by
flexible sigmoidoscopy and polypectomy. Ann Intern Med 1995;
123: 904-910.
38. Winawer BJ, Zauber AG, Ho NH, et al. Prevention of colore-
ctal cancer by colonoscopic polypectomy. N Engl J Med 1993;
329: 1977-1981.
39. Foutch PG, Mai H, Pardy K, et al. Sigmoidoscopy may be inef-
fective for secondary prevention of colorectal cancer in asymp-
tomatic, average-risk men. Dig Dis Sci 1991; 36: 924-928.
40. Lieberman D, Smith F. Screening for colon malignancy with
colonoscopy. Am J Gastroenterol 1991; 86: 946-951.
41. Rex D, Smith JJ, Ulbright TM, et al. Distal colonic hyperpla-
stic polyps do not predict proximal adenomas in asymptomatic
average-risk subjects. Gastroenterology 1992; 102: 317-319.
42. Achkar E, Carey W. Small polyps found during fiberoptic sig-
moidoscopy in asymptomatic patients. Ann Intern Med 1988;
109: 880-883.
43. Ansher AF, Lewis JH, Fleischer DE, et al. Hyperplastic colo-
nic polyps as a marker for adenomatous colonic polyps. Am J
Gastroenterol 1989; 84: 113-117.
44. Blue MG, Sivak MV, Achkar E, et al. Hyperplastic polyps seen
at sigmoidoscopy are markers for additional adenomas seen at
colonoscopy. Gastroenterology 1991; 100: 564-566.
45. Brady PG, Straker RJ, McClare SA, et al. Are hyperplastic re-
ctosigmoid polyps associated with an increased risk or proxi-
mal colonic neoplasms? Gastrointest Endosc 1993; 39: 481-
485.
46. Foutch PG, DiSario JA, Pardy K, et al. The sentinel hyperpla-
stic polyp: A marker for synchronous neoplasia in the proximal
colon. Am J Gastroenterol 1991; 86: 1482-1485.
47. Provenzale D, Garrett J, Condon S, et al. Risk for colon ade-
nomas in patients with rectosigmoid hyperplastic polyps. Ann
Intern Med 1990; 13: 760-763.
48. Grossman S, Milos ML, Tekawa IS, et al. Colonoscopic
screening of persons with suspected risk factors for colon can-
cer: II. Past history of colorectal neoplasms. Gastroenterology
1989; 96: 299-306.
49. Zarchy TM, Ershoff D. Do characteristics of adenomas on fle-
xible sigmoidoscopy predict advanced lesions on baseline colo-
noscopy? Gastroenterology 1994; 106: 1501-1504.
OY
50. Atkin WS, Morson BC, Cusick J. Long term risk or colorectal
cancer after excision of rectosigmoid adenomas. N Engl J Med
1992; 326: 658-622.
51. Lofti AM, Spencer RJ, Ilstrup DM, et al. Colorectal polyps
and the risk of subsequent carcinoma. Mayo Clin Proc 1986;
61: 337-343.
52. Ryan ME, Norfleet RG, Kirchner JP, et al. The significance of
diminutive colonic polyps found at flexible signoidoscopy. Ga-
strointest Endosc 1989; 35: 85-89.
53. Tripp MR, Morgan TR, Sampliner RE, et al. Synchronous
neoplasms in patients with diminutive colorectal adenomas.
Cancer 1987; 60: 1599-1603.
54. Spencer RJ, Melton LJ, Ready RL, et al. Treatment of small
colorectal polyps: A population-based study of the risk of sub-
sequent carcinoma. Mayo Clin Proc 1984; 59: 305-310.
55. Levin B, Murphy GP. Revision in the American Cancer Socie-
ty recommendations for the early detection or colorectal can-
cer. Cancer 1992; 42: 296-299.
56. Lieberman D. Cost-effectiveness model for colon cancer screen-
ing. Gastroenterology 1995; 109: 1781-1790.
57. Eddy DM. Screening for colorectal cancer. Ann Intern Med
1990; 113: 373-384.
58. Frazier AL, Colditz GA, Fuchs CS, et al. Cost-effectiveness of
screening for colorectal cancer in the general population. JAMA
2000; 284: 1954-1961.
59. Inadomi JM, Sonnenberg A. An evidence-based medicine ap-
proach to economic studies: Assessing the cost-effectiveness of
competing strategies for colorectal cancer screening. Clin Ga-
stroent Hepatol 2003; 1: 404-413.
60. Luk GD. Colorectal cancer. Gastroenteral Clin N Am 1988;
17: 655-656.
61. Luk GD. Cancer Surveillance Strategies. In: Sleisenger, Ford-
tran, eds. Gastrointestinal Disease. 5th ed. Philadephia: Saun-
ders, 1993: 115-126.
62. Bussey HJR. Familial polyposis coli. Familian studies, histopa-
thology, differential diagnosis and results of treatment. Balti-
more: John Hopkins University Press, 1975.
63. Lynch HT, Lynch PM, Albano WA, et al. The cancer family
syndrome: A status report. Dis Colon Rectum 1981; 24: 311.
64. Rozen P, Fireman Z, Ron E, et al. Family history of colorectal
cancer as a marker of potential malignancy within a screening
program. Gastroenterology 1986; 90: 1068 (Abstr).
65. Stryker S, Wolff BG, Culp CE, et al. Natural history of un-
treated colonic polyps. Gastroenterology 1987; 93: 1009.
66. Williams CB. Polyp follow-up: How, who and how often? Br J
Surg 1985; 72: 25.
67. OConner TW, Rombeau JL, Levine HS, et al. Late develop-
ment of colorectal cancer subsequent to pelvic irradiation. Dis
Colon Rectum 1979; 22: 123.
68. Sandler RS, Sandler DP. Radiation-induced cancer of the co-
lon and rectum: Assessing the risk. Gastroenterology 1983; 84:
51.
69. Starling JR, Vehling DT, Gilchrist KW. Value of colonoscopy
after urefero-sigmoidoscopy. Surgery 1984; 96: 84.

PSA
.

O O O EO -
- A
, -
.
. - O (screening) -
, , ,
, , -
-
. . O ,
- -
, . -
-
. - .

. - -
, . , -
-
. -

-
. . -
, -
30% -
PSA ,


3 , 30%
. -

, -
1. ,

, -
4.
10 2.
, - OO I O OO O OY
, 40% - OY EO;
. O (screening) -
10% , -

-
. , -
1/3 - .
screening, -
3. -

405
406 OY

, , , ...7.
. 66%
- , -
. , 19%
O 8.
-

- . -
.
4 -
: 5
1. ( - 11 -
- 9.
). .
2. (
- OO O O
, - O O
, - ,
-
).
3. - -
( - .
-
, - ,
, ). , ,
4. - , ,
. . , -
,
O O TOY OO O .
O O O O -
-
, .
.
E , / ,
, , - , , -
. O
. . -
, PSA -
- (TRUS), -
. , .
-
H E O OA
5. O . -
... 810%, , -
3%6. . -
- -
, , -
2%10.
. , 11,
, -
- , 12,
VI. 407

O OO OO (PSA)
. - To PSA 33 Kda, -
,
.
13. PSA ,
3045% , .
2231%.
. PSA -
21,22.
. - PSA , -
. ,
- , -
5070% - PSA
14, - -
, .
, - , TRUS, -
, , , -
..23.
15,16. PSA 10 80 -
- , -
- .
PSA (< 3 ng/ml)17. 1990
-
OO OA (TRUS)
- PSA. -
TRUS, PSA, - -
- 40%24.
. 70% -
, 30% -
-
25.
. -
1,82,6% ,
TRUS 1,31,4% 18. PSA
, - PSA, ,
, 60% , .
, 25% 20% -
, - PSA, 2 3
0,5 cc 25% - PSA . ,
19. 4,0 ng/ml, 80%,
T 5972%
. O - 33%. -
PSA
, - 2,9%26.
, -
20. -
- TRUS
3,64,5%27.
Doppler . -
- 14,5%28.
31.953 ,
. 5093 , PSA
408 OY

( 4,0 ng/ml). 3,6% PSA 34 ng/ml (Glea-

PSA, 3,0% 4,7% - son score >7, Gleason 45),
. PSA > 4 ng/ml . ,
31,6% 25,5%. PSA - PSA < 4,0 ng/ml
- -
29. 34.

PSA; -
5575 PSA -
4,0 ng/ml - (1c)
1/3 O 1c ( /TRUS,
30. PSA) .
H PSA - O Scardino et al -
. -
PSA 1.002 - -
4580 , Labrie et al 37.
3,0 ng/ml. H O Partin et al 60%
PSA 81% 85% 1c -
31. ,
O Lodding et al 1c -
30%, - 38.
PSA 4,0 ng/ml 3,0 , -
ng/ml. - -

32. .
ERSPC Rotterdam PSA, :
PSA < 1 ng/ml - PSA, PSA, -
2,2% (.. 50 -
, , PSA.
-
)33. PSA (PSA Density)
PSA < 1 ng/ml ( PSA
37% 5575 ). 4,010,0 ng/ml -
PSA 33,9% ng/ml (benign prostatic hypertrophy BPH) -
12%
4,7 , PSA39.
PSA34. - , -
ERSCP PSA ( PSA -
,
PSA > 3 ng/ml35. ). PSA
-
- 4,010,0 ng/ml.
PSA PSAD 0,15
H - , 40.
PSA <4 ng/ml . O Noldus
et al 9% 41.
( <0,5 ml) - O Ohori et al
, PSAD, PSA > 10,0
PSA < 4,0 ng/ml36. ng/ml,
O Schroder et al 42.
--
VI. 409

PSA .
, -

43. , -
- . O
PSA .
- PSA 4,0 ng/ml 50.
PSA . O Bassler et al
PSA 4,010,0 ng/ml, - 6069 .
PSA ,
, 4,5
30 cc44. ng/ml51.
-
PSA (PSA Velocity)
PSA, 4,0 ng/ml ,
To PSAV PSA
, .
. 3
2 - PSA (f/t PSA)
1218 . - To PSA
0,75 ng/ml/ - (1-, 2--
45. ) . -
PSAV - PSA
PSA. - . f/t,
0,75 ng/ml/ -
(< 70 ) . f/t PSA -
PSA < 4,0 ng/ml. > 70
PSA 0,75 . , -
PSA > 4,0 ng/ml - PSA52,53.
(> 0,4 ng/ml/)46.
/ PSA PSA
- 4,010,0 ng/ml .
- f/t PSA < 0,20
PSA. 44%
, 19% -
( ) . -
- , 35%
, 12% -
, - . PSA 4,010,0 ng/ml f/t PSA -
PSA (.. 2,5, -
3,5, 4,5, 6,5 ng/ml 4, 5, 6 54.
7 )47. -
, PSA
40% . PSA,
48. -
60% 229 1.709 -
5 .
- PSA
49. 9,1% 18,9% -
O Crawford et al . fPSA ,
PSA PSA.
4,0 ng/ml fPSA 15% PSA 4,09,9 ng/ml,
410 OY

85,4%, 32,1% . O -
39,2%, 21,2%, PSA 510 .
14,6% .
fPSA 20%, 96,9%, -
12,3% 36,2%. O . -
12,7%, , -
3,1% 55.
O Tornblom et al .
PSA PSA < 3 ng/ -
ml. fPSA 18% - -
56.
- . -
/ PSA -
57, in vitro - (.. , )
PSA - .
58.
f/t PSA -
. -
59. -
- , -
.
, - -
; .
; PSA -
; , 15 -
; 60. -

, f/t PSA
,
410 ng/ml. .
-
EXEI AOTEEMA O HYMIAKO EE-
XO TH BETIH TH KINIKH EKBAH; -
- , O -
PSA , 695 1 2 .
, - 6,2
,
- ,
, - 61.
. O -
OI OO
, O OY OY EO
(lead H -
time bias), (length time ... 199162. -
bias) . 2,1%,
9,7% 1991199663.
, -
- 19911996 9,6%,
. - Quebec
, 23% 1991199764. -
PSA ,
VI. 411

H PLCO screening
75 . , -
- -
PSA 73.
,
65. - PSA. -
-
. -
PSA . CA-125 -
.
PSA. 148.000
5574 10
... 5
66,67, , 13 . -
, .. 90%,
68. 20% .
- .

, Quebec O O O O
. 46.193 45 O O
80 . -
PSA 3 ng/ml .
. 8 - . -
67% , -
69.
- . PSA
, 22,1% - 2
, 26.
70. ,
-
, -
6%71. .

- . O
..., -
. (-).
- -
(ERSPC) - .
1994 -
. , -
: , , , , , .
O.
160.000 5074 17 -
260.000. -

, . -
PSA, , - , -
4 . O -
ERSPC .
1/3 50 -
20%72. 2/3 70 -
412 OY

74.
O - , -
. , ,
- ..
- , ,
. , -
, ,
, , -
.
- -
- -
. ,
-
79,80.
75.
- , ,
- .
. - -
ERSPC Rotterdam. - , -
,

14,6 -

2,3 76. -
I O IO O O
,
OA OY OY , .
EO A OI; O
5069 PSA -

3.5004.500

H..A. .
. , -

, -
20.00050.000 , 33.000
77.
29.000113.000 .
PSA -
-
-

,
, 81.
, -
, - -
PSA78. . -
, < 0,5 cc . -
11% PSA -
6%
.
82.
OO N POPAM-
MATN O O O O O -
O O

. O - O O HYMIAKOY EEXOY
, -
-
VI. 413

PSA. - , 70
, , 75 ,
- PSA , -
, -
. - .
- 65
PSA PSA (< 0,5 ng/ml
< 2 ng/ml83. < 1 ng/ml) -
-
I E KOY HYMIAKOY
EEXOY (SCREENING) ,
O A A E PSA85.
PSA 50 -
. - ,
- 75 ,
( 45 ). O PSA 75 .

50 O OE HYMIAKOY
- EEXOY
. - -
- , ERSPC , -
. , ,
- -
, ..., -
,
.
4080 . 2005 -
, PSA 4 ng/ml 2008. -
50 ,
PSA 40 -
, PSA ,
- .
. PSA 3
ng/ml 2,5 ng/ml - , -
, - -
- -
84. .
American Urological Association American
O I E A O - Cancer Society 1992 -
O EO; PSA
> 50
PSA, (-, )
> 40 86. O
10 ,

, -
,
.
. O
- 2001, ,
. PSA < 1 ng/ml, -
414 OY

87. -
American Medical Association, Ameri- -
can College of Physicians American Task Force for .
Preventive Disease

88-90. H
E .
- -
- - -
-
. O . -
- PSA
-
-
91.
, .
- E -
,
. - , -
92. -
. - .
, - -
, , - , -
, - PSA .
. PSA (< 1,0
< 2,0 ng/ml) -
93. , -
-
. - .
- -
, ,

- . -
9% - ,
15 -
94,95. -
, . O
. -
-- . ,
96. -
PSA - .

1. Austenfiield MS, Davis BE. New concepts in the treatment of
stage D1 adenocarcinoma of the prostate. Urol Clin North Am
1990; 17: 867-884.
2. Mench HR, Garfinkel L, Dodd GD. Preliminary report of the
National Cancer Data Base. CA 1991; 41: 7-18.
3. Lepor H, Kimball AW, Walsh PC. Cause-specific actuarial
survival analysis: A useful method for reporting survival data
in men with clinically localized prostatic cancer: Long term re-
sults. J Urol 1989; 141: 82-84.
4. The Royal College of Radiologist Clinical Oncology Informa-
tion. British Association of Urological Surgeons-Guidelines
on the management of prostate Cancer. BJU International
1999; 84: 987-1014.
5. Greenlee RT, Hill-Harmon MB, Murray T, Thun M. Cancer
statistics. CA Cancer J Clin 2001; 51: 15-36.
6. Seidman H, Mushinski MH, Geib SK, et al. Probabilities of e-
VI.
ventually developing or dying of cancer-United States 1985.
CA 1985; 35: 36-56.
7. Muir CS, Nectoux J, Staszewski J. The epidemiology of prosta-
te cancer. Geographical distribution and time trends. Acta On-
col 1991; 30: 133.
8. Morten RA. Radical differences in adenocarcinoma of the
prostate in North American man. Urology 1994; 44: 637.
9. Rodriguez C, Calle EE, Miracle-McMahill HL, et al. Family
history and the risk of fatal prostate cancer. Epidemiol 1997; 8:
653-7.
10. Lee F, Littrup PJ, Top-Pedersen ST, et al. Prostate cancer:
comparison of trans-rectal US and digital rectal examination
for screening. Radiology 1988; 168: 389-394.
11. Smith DS, Catalona WJ. Interexaminer variability of digital re-
ctal examination in detecting prostate cancer. Urology 1995; 45:
70-4.
12. Mc Neal JE. The prostate gland: morphology and pathobiolo-
gy. Monogr Urol 1988; 9: 36.
13. Mueller EJ, Crain TW, Thompson IM, et al. An evaluation of
serial digital rectal examination in screening for prostate can-
cer. J Urol 1988; 149: 124-45.
14. Jacobsen SJ, Bergstralh EJ, Kautsic K, et al. Screening digital
rectal examination and prostate cancer mortality: a population-
based case-control study. Urology 1998; 52: 173-9.
15. Friedman GD, Hiatt RA, Quesenberry CP Jr, et al. Case-con-
trol study of screening for prostate cancer by digital rectal exa-
minations. Lancet 1991; 337: 1526-9.
16. Chodak GW, Keller P, Schoenber HW. Assessment of screen-
ing for prostate cancer using digital rectal examination. J Urol
1989; 141: 1136-8.
17. Beemsterboer PMM, Kranse R, de Koning HJ, et al. Changing
role of 3 screening modalities in the European Randomized
study of Screening for Prostate Cancer (Rotterdam). Int J
Cancer (Pred Oncol) 1999; 84: 437-41.
18. Mettlin C, Lee F, Drago J, Murphy CP, Investigators of the A-
merican Cancer Society National Prostate Cancer Detection
Project. The American Cancer Society national prostate can-
cer detection project. Findings on the detection of early pro-
state cancer in 2.425 men. Cancer 1991; 67: 2949-2985.
19. Littrup PJ, Bailey SE. Prostate cancer. The role of transrectal
ultrasound and its impact on cancer detection and manage-
ment. Radiol Clin North Am 2000; 38: 87-113.
20. Rietbergen JBW, Boeken Kruger AE, et al. Complications of
transrectal ultrasound (TRUS) guided systematic sextant biop-
sies of the prostate. Evaluation of complication rates and risk
factors within a population based screening program. Urology
1997; 49: 875-80.
21. Yu H, Diamandis EP. Measurement of prostate specific level
in the serum of females and prostatectomized males with an
ultrasensitive immunoassay technique. J Urol 153:1004-8, 1995.
22. Levesque MA, Yu H, DCosta M, Diamandis ER. Prostate
specific antigen expression by various tumors. J Clin Lab Anal
1995; 9: 123-6.
23. Nadler RB, Humphrey PA, Smith DS, et al. Effect of inflam-
mation and benign prostatic hyperplasia on elevated serum
prostate-specific antigen levels. J Urol 1995; 154: 407-13.
24. Mettlin C, Murphy G, Babian R, et al. Observations on the
415
early detection of prostate cancer from the American Cancer
Society National Prostate Cancer Detection Project. Cancer
1997; 80: 1814-1817.
25. Smith DS, Catalona WJ, Herschman JD. Longitudinal screen-
ing for prostate cancer with prostate specific antigen. JAMA
1996; 276: 1309-15.
26. Catalona WJ, Smith DS, Ratliff TL, et al. Measurement of
prostate-specific antigen in serum as a screening test for pro-
state cancer. N Engl J Med 1991; 324: 1156-61.
27. Catalona WJ, Richie P, Ahmann FR, et al. Comparison of di-
gital rectal examination and serum prostate specific antigen in
the early detection of prostate cancer: results of a multicenter
clinical trial of 6.630 men. J Urol 1994; 151: 1283-1290.
28. Cooner WH, Mosley BR, Rutherford CL, et al. Prostate can-
cer detection in a clinical urological practice by ultrasonogra-
phy, digital rectal examination and prostate specific antigen. J
Urol 1990; 143: 1146-1154.
29. Crawford ED, De Antoni EP, Etzioni R, et al. Serum prostate-
specific antigen and digital rectal examination for early dete-
ction of prostate cancer in a national community-based pro-
gram. The Prostate Cancer Education Council. Urology 1996;
47: 863-9.
30. Kranse R, Beemsterboer PMM, Rietbergen JBW, et al. Predi-
ctors for biopsy outcome in the European Randomized Study
of Screening for Prostate Cancer (Rotterdam region). Prostate
1996; 39: 316-22.
31. Labrie F, Dupont A, Suburu R, et al. Serum prostate specific
antigen as pre-screening test for prostate cancer. J Urol 1992;
147: 846-51.
32. Lodding P, Aus G, Bergdahl S, et al. Characteristics of
screening detected prostate cancer in men 50-60 years old with
3-4 ng/ml prostate specific antigen. J Urol 1998; 159: 899-903.
33. Hoedemaeker RF, Rietbergen JB, Kranse R, et al. Compari-
son of pathologic characteristics of T1c and non-T1c cancers
detected in a population-based screening study, the European
Randomized Study of Screening for Prostate Cancer. World J
Urol 1997; 15: 339-45.
34. Schroder FH, van der Cruijsen-Koeter I, de Koning HJ, et al.
Prostate cancer detection at low prostate specific antigen. J
Urol 2000; 163: 806-12.
35. Schroder FH, Roobol-Bouts M, Vis AN, et al. Prostate-speci-
fic antigen-based early detection of prostate cancer-validation
of screening without rectal examination. Urology 2001; 57: 83-
90.
36. Noldus J, Stamey TA. Histological characteristics of radical
prostatectomy specimens in men with a serum prostate specific
antigen of 4 ng/ml or less. J Urol 1996; 155: 441-3.
37. Scardino PT, Weaver R, Hudson MA. Early detection of pro-
state cancer. Hum Path 1992; 23: 211-22.
38. Partin AW, Kaltan MW, Subong ENP, et al. Combination of
prostate-specific antigen, clinical stage, and Gleason score to
predict pathological stage of localized prostate cancer: a multi-
institutional update. JAMA 1997; 277: 1445-51.
39. Partin AW, Carter HB, Chan DW, et al. Prostate specific anti-
gen in the staging of localized prostate cancer: influence of tu-
mor differentiation, tumor volume and benign hyperplasia. J
Urol 1990; 143: 747-52.
416
40. Benson MC, Whang IS, Disson CA, et al. The use of prostate
specific antigen density to enhance the predictive value of in-
termediate levels of serum prostate specific antigen. J Urol
1992; 147: 817-821.
41. Brawer MK, Aramburu EAG, Chen GL, et al. The inability of
prostate specific antigen index to enhance the predictive value
of prostate specific antigen in the diagnosis of prostatic carci-
noma. J Urol 1993; 150: 369.
42. Ohori M, Dunn JK, Scardino PT. Is prostate-specific antigen
density more useful than prostate-specific antigen levels in the
diagnosis of prostate cancer? Urology 1995; 46: 666-71.
43. Abdalla I, Ray P, Ray V, et al. Comparison of serum prostate-
specific antigen levels and PSA density in African-American,
white, and Hispanic men without prostate cancer. Urology 1998;
51(2): 300-5.
44. Djavan B, Zlotta Ar, Buttebler G, et al. Prostate specific anti-
gen density of the transition zone for early detection of prosta-
te cancer. J Urol 1998; 160(2): 411-8.
45. Carter HB, Pearson JD, Metter J, et al. Longitudinal evalua-
tion of prostate-specific antigen levels in men with and without
prostate disease. JAMA 1992; 267: 2215-20.
46. Smith DS, Catalona WJ. Rate of change in serum prostate spe-
cific antigen levels as a method for prostate cancer detection. J
Urol 1994; 152: 1163-7.
47. Oesterling JE, Jacobsen SJ, Chute CG, et al. Serum prostate-
specific antigen in a community-based population of healthy
men. Establishment of age-specific reference ranges. JAMA
1993; 270: 860-4.
48. Morgan TO, Jacobsen SJ, McCarthy WF, et al. Age specific
reference ranges for serum prostate-specific antigen in black
men. N Engl J Med 1996; 335: 304-10.
49. Borer JC, Sherman J, Solomon MC, et al. Age specific prosta-
te specific antigen reference ranges: population specific. J Urol
1998; 159(2): 444-8.
50. Crawford ED, Leewansangtong S, Coktas S, et al. Efficiency of
prostate-specific antigen and digital rectal examination in
screening, using 4.0 ng/ml and age-specific reference range as
a cutoff for abnormal values. Prostate 1999; 38: 296-302.
51. Bassler TJ, Orozco R, Bassler IC, et al. Most prostate cancers
missed by raising the upper limit of normal prostate-specific
antigen for men in their sixties are clinically significant. Uro-
logy 1998; 52: 1064-9.
52. Stenman UH, Leinonen J, Alfthan H, et al. A complex between
prostate-specific antigen and a1-antichymotrypsin is the major
form of prostate-specific antigen in serum of patients with pro-
static cancer: assay of the complex improves clinical sensitivity
for cancer. Cancer Res 1991; 51: 222-6.
53. Alivizatos G, Deliveliotis C, Mitropoylos D, et al. Does free to
total ratio of prostate-specific antigen alter the decision-mak-
ing on prostatic biopsy. Urology 1996; 48(6A): 71-75.
54. Bangma CH, Rietbergen JBW, Kranse R, et al. The free-to-
total prostate specific antigen improves the specificity of pro-
state specific antigen in screening for prostate cancer in the
general population. J Urol 1997; 157: 2191-6.
55. Mettlin C, Chesley AE, Murphy GP, et al. The association of
free PSA percent, total PSA, age, and gland volume in the de-
tection of prostate cancer. Prostate 1999; 39: 153-8.
OY
56. Tornblom M, Norming U, Adolfsson J, et al. Diagnostic value
of percent free prostate-specific antigen: retrospective analysis
of a population-based screening study with emphasis on men
with PSA levels less than 3,0 ng/ml. Urology 1999; 53(5): 945-
50.
57. Kingler HC, Woo H, Rosario D, et al. The value of prostate
specific antigen (PSA) density and the free: total PSA ratio in
selecting patients with a normal digital rectal examination and
intermediate total PSA levels for further investigation. Br J
Urol 1998; 82(3): 393-7.
58. Paus E, Nilsson O, Bormer OP, et al. Stability of free and total
prostate specific antigen in serum from patients with prostate
carcinoma and benign hyperplasia. J Urol 1998; 159(5): 1599-
605.
59. Jung K, Meyer A, Lein M, et al. Ratio of free-to-total prostate
specific antigen in serum cannot distinguish patients with pro-
state cancer from those with chronic inflammation of the pro-
state. J Urol 1998; 159(5): 1595-8.
60. Johansson JE, Holmberg L, Johansson S, et al. Fifteen-year
survival in prostate cancer: A prospective, population-based
study in Sweden. JAMA 1997; 277: 467-71.
61. Holmberg L, Bill-Axelson A, Helgesen F, et al. For the Scan-
dinavian Prostatic Cancer Group Study Number 4. A randomi-
zed trial comparing radical prostatectomy with watchfull wait-
ing in early prostate cancer. N Engl J Med 2002; 347: 781-9.
62. Stephenson RA. Population-based prostate cancer trends in
the PSA era: Data from the Surveillance, epidemiology, and
end Results (SEER) program. Monogr Urol 1998; 19: 3-19.
63. Wingo PA, Ries LA, Giovino GA, et al. Annual report to the
nation on the status of cancer, 1973-1996, with a special se-
ction on lung cancer and tobacco smoking. J Natl Cancer Inst
1999; 91: 675-90.
64. Meyer F, Moore L, Bairati J, Fradet Y. Downward trend in
prostate cancer mortality in Quebec and Canada. J Urol 1999;
161: 1189-91.
65. Etzioni R, Legler JM, Feuer EJ, et al. Cancer surveillance se-
ries: interpreting trends in prostate cancer-part III: Quantify-
ing the link between population prostate-specific antigen test-
ing and recent declines prostate cancer mortality. J Natl Can-
cer Inst 1999; 91: 1033-9.
66. Landis SH, Murray T, Bolden S, Wingo PA. Cancer statistics.
CAJ 1999; 49: 8-31.
67. Bartsch G, Horninger W, Klocker H, et al. Prostate cancer
mortality after introduction of prostate-specific antigen mass
screening in the Federal State of Tyrol, Austria. Urology 2001;
58: 417-24.
68. Oliver SE, Gunnell D, Donovan JL. Comparison of trends in
prostate-cancer mortality in England and Wales and the USA.
Lancet 2000; 355: 1788-9.
69. Labrie F, Candas B, Dupont A, et al. Screening decreases pro-
state cancer death. First analysis of the 1998 Quebec prospecti-
ve randomized controlled trial. Prostate 1999; 38: 83-91.
70. Alexander FE. Screening decreases prostatic cancer death.
First analysis of the 1998 Quebec prospective randomized con-
trolled trial. Prostate 1999; 40: 135-6.
71. Boer R, Schroder FH. Quebec randomized controlled trial on
prostate cancer screening shows no evidence for mortality re-
VI.
duction (letter). Prostate 1999; 40: 130-4.
72. Standaert B, Deniss L. The European Randomized Study of
Screening for Prostate Cancer: an update. Cancer 1997; 80:
1830-4.
73. Gohagan JK, Prorok PC, Kramer BS, et al. The Prostate,
Lung, Colorectal, and Ovarian Cancer Screening Trial of the
National Cancer Institute. Cancer 1995; 75: 1869-73.
74. Stemmeman GN, Normura AG, Choyou PH, Yatani R. A pro-
spective comparison of prostate cancer at autopsy and as a cli-
nical event: The Hawaii Japanese experience. Cancer Epide-
miol Biomarkers Prevent 1992; 1: 189-93.
75. Optenberg SA, Thoppson IM. Economics of screening for
carcinoma of the prostate. Urol Clin N Am 1990; 17: 719-737.
76. Schroder FH, Wildhagen MF. he Rotterdam study Group of
the European Randomized Study of screening for Prostate
Cancer (ERSCP). Screening for prostate cancer: evidence and
perspectives. BJU International 2001; 88: 811-817.
77. Terris MK, Mc Neal JE, Stamey TA. Detection of clinically
significant prostate cancer by transrectal ultrasound-guided sy-
stematic biopsies. J Urol 1992; 148: 829.
78. Oesterling JE, Suman VJ, Zincke H, Bostwick DG. PSA de-
tected (clinical stage T1c or Bo) prostate cancer. Urol Clin N
Am 1993; 20: 687-693.
79. Barry MJ, Fleming C, Coley CM, et al. Should Medicare provi-
de reimbursement for prostate-specific antigen testing for ear-
ly detection of prostate cancer? Part IV: Estimating the risks
and benefits of an early detection program. Urology 1995; 46:
445.
80. Khran MD, Mahoney JE, Eckman MH, et al. Screening for
prostate cancer: A decision analytic view. JAMA 1994; 272: 773.
81. Benoit RM, Naslund MJ. The socioeconomic implications of
prostate-specific antigen screening. Urol Clin North Am 1997;
24: 451-8.
82. Madalinska JB, Essink-Bot ML, de Koning HJ, et al. Health-
related quality-of-life effects of radical prostatectomy and pri-
mary radiotherapy for screen-detected or clinically diagnosed
localized prostate cancer. J Clin Oncol 2001; 19: 1612-28.
83. Carter HB, Epstein JI, Chan DW, et al. Recommended prosta-
te-specific antigen testing intervals for the detection of curable
prostate cancer. JAMA 1997; 277: 1475-6.
84. Ross KS, Pearson JD, Guess HA, et al. Rational PSA screen-
417
ing strategies for prostate cancer: Computer simulations of age
ranges, PSA cutoffs, and testing intervals. J Urol 1999; 161: 210.
85. Pearson JD, Landis P, Fozard JL, Carter HB. When is PSA
testing no longer necessary? J Urol 1998; 159: 178.
86. American Urological Society. Executive Committee Report.
Baltimore: American Urological Association, 1992.
87. Smith RA, von Eschenbach AC, Wender A, et al. American
Cancer Society guidelines for the early detection of cancer: up-
date of early detection guidelines for prostate, colorectal and
endometrial cancers. CA Cancer J Clin 2001; 51: 38-75.
88. American Medical Association. AMA report 9 of the Council
of Scientific Affairs. Screening and Early Detection of Prostate
Cancer. Report 2000; 9-a-00: 1-22.
89. Ferrini R, Woolf SH. Screening for prostate cancer in Ameri-
can men. American College of Preventive Medicine Practice
Policy Statement mm. American cancer Society Prostate Can-
cer Screening Guideline Conference 2000 Update, Atlanta:
May 4-6, 2000.
90. American College of Physicians. Clinical guidelines: Part III:
Screening for prostate cancer. Ann Intern Med 1997; 126: 480-
4.
91. Advisory Committee on Cancer Prevention: Recommendations
on cancer screening in the European Union. Eur J Cancer 2000;
36: 1473-8.
92. Chan ECY, Sulmasy DP. What should men know about pro-
state-specific antigen screening before giving informed consent?
Am J Med 1998; 105: 266-74.
93. Beemsterboer PM, de Koning HJ, Birnie E, et al. Advanced
prostate cancer. Course, care, and cost implications. Prostate
1999; 40: 97-104.
94. Albertsen PC, Hanley JA, Gleason DF, Barry MJ. Competing
risk analysis of men aged 55-74 years at diagnosis managed
conservatively for clinically localized prostate cancer. JAMA
1998; 280: 975-980.
95. Albertsen PC, Fryback DG, Storer BE, et al. Long-term survi-
val among men with conservatively treated localized prostate
cancer. JAMA 1995; 274: 626-31.
96. Epstein JI, Walsh PC, Carmichael M, Brendler CB. Pathologic
and clinical findings to predict tumor extent of nonpalpable
(stage T1c) prostate cancer. JAMA 1994; 271: 368-74.

.

O )
, , - . -
, . - -

. -
. .
O - test -
3045 , , -
().
5060 . O - -
65 .
-
- 1950, -
. - 3,4.
. - ,
471.000 - . O Ole-
, sen5
. - 428 -

, -
. 55% -
10 . ... 15.700 -
(6% ) 32% .
4.900 -
1.
, - test -
0,25. -
- -
. . 5 , -
- 0,67.
, . ( 20)
- (incidence rate)
, - (2535 ).
, -
. O ,
2. , -
-
-
(CIN: cervical intraepithelial neoplasia SIL: 6. 1975 (-
squamous intraepithelial lesion). , , ) -
(

419
420 OY

.
, -
7,8,9.

,
,
-
. O rinton Fraumeni10

. -

11. -
2. . -
- HPV CIN I.

,
, , , - 5359 68
. - 95%, -
- 15,16,17 (.
1, 2).
. HPV ( )
O (herpes 1627
simplex type 2) . O .
,
12. - , -
- , -
. O -
. O 18. -
HPV (human papilloma virus). - HPV
DNA .
80 ,
40 . O -
HPV -
DNA13. . , -
- . -
-
2314. O 16, 18, 31, 33, 35, 39, 45, 51, 52, . O -
-
19, -
20,
21.

O
O OO O
:

;
,
. -
. -
, ,
1. -
HPV. 76% E -
VI. 421

. 19% - , , -
-
(test ). O 61% . test -
test - -
, , -
. .
,
(, , ), O , 2002 -
89%22. -
HPV test - test .
HPV,
23 198728. O )
, - , ) , )
.

O O H
, ) -
- )
O O- .
O -
O O O O (Gynecologic Cancer Advi-
... 50 sory Group, National Cancer Institute, American College
of Obstetricians, Harvard School of Public Health ..).
70%! O
test . O - .
,
, 13 29.
24.
O O O TEST
2003 13.000 -
OO;
-
..., 4.100 -
. O - 21 .
test ,
. O - -
- , -
5 100%, - -
92%24. . 3 -
- -
93100% ,
DNA HPV -
HPV ( 16, 18, 31,
33, 35)25,26. , -
, , - -
test , 30,31,32,33. -
-
. -
, -
, . -
, test (HIV -
70% 80%27. - ) -
: 34.
422 OY

O PEEI NA O O OO
O TEST OO; -
, , , test -
test 70 , . -
: ) -
, ) - 41,42,43,44,45.
test, ) - 19
10
. test - ,
, .

OO
.
-
- test43,44,45.
-

. - . -
Ca 50
-
35. - . -
,
. 70 , ,

(, , ),
, - -
36. -
. ,
O O O O
O (..
test DNA HPV ).
-
. O OOO O -
OO OO
,
(Y BETHESDA 2001)46

OOO
, 37.
1. . -
O O
- . -
test
test - .
, - 2. . .
, 2 , - -
. .
30
tests .
, 1.
. -
. :
.
( )38,39,40. 2. .
VI. 423

E 3. CIN II. E 4. CIN III ( ).

E 5. CIN II ( ). E 6. Ca .

: -
A: (Atypi- in situ: CIN , CIN
cal squamous cells of undetermined significans (. 3, 4, 5).
ASC-US). : (. 6).
: (LSIL, Low- :
grade squamous intraepithelial lesion). - : -
: 1. .
HPV ( ), 2. : -
- - .
HPV (. 2). : in situ.
: : (, -
(HSIL, High-grade intraepithelial lesion). - ).

1. National Institutes of Health Consensus Development Confe-
rence Statement on Cervical Cancer. Gynecologic Oncology
1997; 66: 351-361.
2. Park TW, Fuziwara H, Wright TC. Molecular Biology of Cer-
vical Cancer and its precurcors. Cancer 1995; 76: 1902-1913.
3. Hazdou SI. American Cancer Society report on the cancer re-
lated health checkup. Acta Cytol 1980; 24: 369-370.
4. Hakama M, Chamberlain J, Day NE, Miller AB, Prorok PC.
Evaluation of screening programmes for gynecological cancer.
Br J Cancer 1985; 52: 669-673.
5. Olesen F. A case control study of cervical cytology before dia-
gnosis of cervical cancer in Denmark. I. J Epidemiol 1988; 17:
501-508.
6. Van der Graaf Y, Zielhuis GA, Vooijs GP. Cervical screening
424
revisited. Acta Cytol 1990; 34: 366-372.
7. Armstrong B, Holman D. Increasing mortality from cancer of
the cervix in young Australian women. Med J Aust 1981; 1:
460-462.
8. Cook GA, Draper GJ. Trends in cervical cancer and carcino-
ma in situ in Great Britain. Brit J Cancer 1984; 50:367-375.
9. Green GH. Rising cervical cancer mortality in young New
Zealand women. NZ Med J 1979; 89: 89-91.
10. Brinton LA, Fraumeni JF Jr. Epidemiology of uterine cervical
cancer. J Chronic Dis 1986; 39: 1051-1105.
11. Beral V. Cancer of the cervix: A sexually transmitted infection?
Lancet 1974; I: 1037-1040.
12. Morse AR, Coleman DV, Gardner SD. An evaluation of cyto-
logy in the diagnosis of herpes simplex virus infection and cyto-
megalovirys infection of the cervix uteri. Br J Obstet Gynaecol
1974; 81: 393-398.
13. Lorincz AT. Molecular methods for the detection of human
papillomavirus infection. Obset Gynecol Clin N mer 1996;
23: 707-730.
14. Pfister H. The role of Human Papillomavirus in Anogenital
Cancer. Obset Gynecol Clin N Amer 1996; 23: 579-598.
15. von Knebel Doeberitz M, Rittmuler C, Geitz D, zur Hausen
H, Durst M. Inhibition of tumorigenicity of cervical cancer cells
in nude mice by HPV 18-E7 antisense RNA. Cancer 1992; 51:
831.
16. Kitchener H. Viral infection and lower genital tract neoplasia.
In: Luesley D, Zordan I, Richard RM, eds. Intraepithelial
Neoplasia of the Lower Genital Tract. London: Churchill Li-
vingston, 1995: 83-94.
17. Bosch FX, Manos M, Munoz N. Human Papillomavirus in cer-
vical cancer: a worldwide perspective international biological
study on cervical cancer. J of National Cancer Institute 1995;
87: 796-802.
18. Franco E. Epidemiology of genital warts and cancer. Obset
Gynecol Clin N Amer 1996; 23: 597-623.
19. Schafer A, Friedmann W, Mielke M. The increased frequency
of cervical dysplasia-neoplasia in women infected with the Hu-
man Immunodeficiency Virus is related to the degree of im-
munosupression. Am J Obset Gynecol 1991; 164: 593-599.
20. Katj RL, Veanattukalathil S, Weiss KW. Human Papillomavi-
rus infection and neoplasia of the cervix and anogenital region
in women with Hodgkins Disease. Acta Cytol 1987; 31: 845-
854.
21. Sasson I, Haley NJ, Hoffman D. Cigarette smoking and neo-
plasia of the uterine cervix. Smoke constituents in cervical mu-
cus. N Eng J Med 1985; 312: 315-318.
22. Linos A, Rixa E, van Ballegooijen. Cervical cancer screening.
European J of Cancer 2000; 36: 2227-2232.
23. Syrjanen S. Basic concepts and practical applications of recom-
binant DNA techniques in detection of Human Papillomavirus
infection. APMIS 1990; 98: 95-110.
24. American Cancer Society, Cancer Facts & Figures 2002.
25. Bosch FX, Manos MM, Munoz N, et al. Prevalence of human
papillomavirus in cervical cancer: A worldwide perspective. In-
ternational biological study on cervical cancer (IBSCC) Study
Group. J Natl Cancer Inst 1995; 87: 796-802.
OY
26. Walboomers JM, Jacobs MV, Manos MM, et al. Human papil-
lomavirus is a necessary cause of invasive cervical cancer world-
wide. J Pathol 1999; 189: 12-19.
27. Sherman ME, Schiffman M, Herrero R, et al. Performance of
a semiautomated Papanicolaou smear screening system: Re-
sults of a population-based study conducted in Guanacaste,
Costa Rica. Cancer 1998; 84: 273-280.
28. Fink DJ. Change in American Cancer Society Checkup Guide-
lines for detection of cervical cancer. CA Cancer J Clin 1988;
38: 127-128.
29. Saslow D, Runovitcz C, Solomon D, Moscicki AB, Smith R,
Cohen C. American Cancer Society Guidelines for the early
detection of cervical neoplasia and cancer. Ca Cancer J Clin
2002; 52: 342-362.
30. Centers for Disease Control. CDC guideline for immunocom-
promised women; USPHS/IDSA Guidelines for the preven-
tion of opportunistic infections in persons infected with human
immunodefiency virus: A summary. Morb Mortal Wkly Rep
1995; 44(RR-8): 1-34.
31. Syrjanen K, Kataja V, Yliskoski M, et al. Natural history of
cervical human papillomavirus lesions does not substantiate
the biologic relevance of the Bethesda System. Obstet Gynecol
1992; 79: 675-682.
32. Nasiell KV, Roger V, Nasiell M. Behavior of mild cervical dys-
plasia during long-term follow-up. Obstet Gynecol 1986; 67:
665-669.
33. Nash JD, Burke TW, Hoskins VJ. Biologic course of cervical
human papillomavirus infection. Obstet Gynecol 1987; 69: 160-
162.
34. Goldie SJ, Kim J, Moscicki AB. Alternative policies for the
initiation of cervical cancer screening. Plenary presentation at
the National Meeting of the Society for Medical Decision Mak-
ing. San Diego, CA: October 2001. Abstract available: http://
www.smdm.org/.
35. Gustafsson L, Sparn P, Gustafsson M, et al. Low efficiency of
cytologic screening for cancer in situ of the cervix in older wo-
men. Int J Cancer 1995; 63: 804-809.
36. Mandelblatt JS, Lawrence WF, Womack SM, et al. Benefits
and costs of using HPV testing to screen for cervical cancer.
JAMA 2002; 287: 2372-2381.
37. Fox J, Remington P, Layde P, et al. The effect of hysterectomy
on the risk of an abnormal screening Papanicolaou test result.
Am J Obstet Gynecol 1999; 180: 1104-1109.
38. Frame PS, Frame JS. Determinants of cancer screening fre-
quency: The example of screening for cervical cancer. J Am
Board Fam Pract 1998; 11: 87-95.
39. International Agency for Research on Cancer Working Group
on Evaluation of Cervical Cancer Screening Programmes.
Screening for squamous cervical cancer: Duration of low risk
after negative results of cervical cytology and its implication
for screening policies. Br Med J 293: 659-664.
40. Lynge E, Poll P. Risk of cervical cancer following negative
smears in Maribo County Denmark 1966-1982. IARC Sci Publ
1986; 76: 69-86.
41. Diaz-Rosario LA, Kabawat SE. Performance of a fluid-based
thin-layer Papanicolaou smear method in the clinical setting of
an independent laboratory and an outpatient screening popu-
VI.
lation in New England. Arch Pathol Lab Med 1999; 123: 817-
821.
42. Lee KR, Ashfaq R, Birdsong GG, et al. Comparison of con-
ventional Papanicolaou smears and a fluid-based thin-layer
system for cervical cancer screening. Obstet Gynecol 1997; 90:
278-284.
43. Marino JF, Fremont-Smith M. Direct-to-vial experience with
AutoCyte PREP in a small New England regional cytology
practice. J Reprod Med 2001; 46: 353-358.
44. Hutchinson ML, Zahniser DJ, Sherman ME, et al. Utility of
liquid-based cytology for cervical carcinoma screening: results
425
of a population-based study conducted in a region of Costa Ri-
ca with a high incidence of cervical carcinoma. Cancer 1999;
87: 48-55.
45. Belinson J, Qiao YL, Pretorius R, et al. Shanxi Province Cervi-
cal Cancer Screening Study: A cross-sectional comparative
trial of multiple techniques to detect cervical neoplasia. Gyne-
col Oncol 2001; 83: 439-444.
46. Solomon D, Darey D, Kurman R, Moriarty A, OConnor D,
Prey M, Raab S, Sherman M, Wilbur D, Wright, Young N.
The 2001 Bethesda System. Terminology for reporting results
of cervical cytology. JAMA 2002; 287: 2114-2119.

VII
A

.. , . ........................................................................................ 431

. , N.. M ........................................................................ 445

B. . M, . K, . .................................................. 477

X.. T .................................................................................................................... 557

N.E. , A. M ........................................................................................ 575


. . , .

OKTHH
-
.
- -
(. 1). - .
O
, , .
. - 1992 -
...
- (National Cancer Institute NCI) 30.521
, - , 17.260 (),
2. 2.197 , 12.938 -
, 5.767 ..1. O
-
1. - . 19901995 -

30.000 , -
1. , NCI2-3.
2. Burkitt -
3. Hodgkin 400.000 . -
4.
5. O

6. -
7. OM NCI -
8. : (Taxol) -
9.
(Taxotere),
10.
11. taxus brevifolia taxus beccata ,
vinca rosea
O:
OM:
. O

, halichondrin-B
4, bryostatin 1
2. - Bugular neritina5 fu-
magillin aspergillus fumigatus6.
1. IAOH
2.
3.

4. (screening). O -
5. I
6. II
7. III
8.
(production and formulation).
NCI

431
432 OY

(model) -
L1210 388.
19751985 48
(, , -
..), -
-
(xenografts) (. 1).
1970

(established cell lines).
O -
1. (athymic, nude mou- -
se) (xenograft) MIA PA-CA-2. -
. -
MIA PA-CA-2 -
. O
MIA PA-CA-2 - 6 . -
2-106.
(cell
suspension) (. 2),
(monolayer)
(. 3). O
in vitro -
, , :
) ( -
12 12 -
-
), ) ( -

,
) )
.
2.
HL-60 . 1985 NCI
,
, - (29 .
.
/) (-
35
)7 .
60
-
( , ,
, , ,
). -
(multiple drug resistance MDR)

-
, -
-
3.
C26-10 .
, -
,
, - 8,9. 1990
. 64
VII. 433

, A
100

. -

K
50


0
, -
,
-50
( ) ..
,
-100
20.000 -10 -9 -8 -7 -6 -5
Log10

IGROV 1 SK-OV -3
. 5%
OVCAR -8 OVCAR -4
- OVCAR -3 OVCAR -5
.
4. -
CI 6
,
. NCI.
-
, - 60 . -
- -
, (3,4,5-
--2) 2,5-- - NCI
()10-13 - (. 4). (composi-
- (SRB)14. te) -
13.
-
, - ,
(10-4 10-9 mol), -
. O
64 NCI. (percentage growth PG), -
-
( 96 ) 50% (growth inhibition 50%
0, 24 . - GI50), -
- (total growth inhibition TGI) -
50%
48 9. (lethal concentration 50% LC50).
( )
SRB. O -
- O (O)
, ,
. - . O
GI50, TGI
(dose-response curves) LC50 -
(mean-graphs). NCI.
O -

( ), -
, GI50
. .
- O
. -
434 OY

K Halichondrin-B

3 2 1 0 1 2 3 2 1 0 1 2 3 2 1 0 1 2 3
Leukenia
CCRF-CEN
HL-60 (TB)
K-562
MOLT-4
RPHI-8226
SR
Non-Small Cell Cancer
A549/ATCC
EKVX
HOP-18
HOP-62
HOP-92
NCI-H226
NCI-H23
NCI-H322N
NCI-H460
NCI-H522
LX FL-529L
Small cell lung cancer
DMS 114
DMS 273
Colon cancer
COLO 205
DLD-1
HCC-2998
HCT-116
HCT-15
HT29
KM12
KM20L2
SW-620
CNS cancer
SF-268
SF-295
SF-539
SNB-19
SNB-75
SNB-78
U251
XF 498
Melanoma
LOX IMVI
MALME-3M
M14
M19-MEL
SK-MEL-2
SK-MEL-28
SK-MEL-5
UACC-257
UACC-62
Ovarian cancer
IGROV1
OVCAR-3
OVCAR-4
OVCAR-5
OVCAR-8
SK-OV-3
Renal cancer
786-0
A498
ACHN
CAKI-1
RXF-1
RXF-631
SN12C
TK-10
UP-31
3 2 1 0 1 2 3 2 1 0 1 2 3 2 1 0 1 2 3

5. .

-
. , .
-
,
. , O,
3 . -
GI50 O GI50 - -
1.000 - 170 17-19.
GI50 (. 5). -

Compare , -
Compare - . -
- -
,
NCI. Compare -
NCI.
O 6.

VII. 435

.
3.
Compare - -
CI -
O . -
1/12 LD10

MTD 1/9 LD10
O - ( mg/kg) 1/7 LD10
1/3 LD10
. 1/2 LD10
Compare

( spon- 10% ), LD50 LD90.
gistatin 1, - LD10
)20, ( ), -
23. O Freireich et al23
( Halomon, - -
Portieria hornemannii)21. -
, NCI LD10
in vitro (. 3).
-

.
in vivo . ,
,
OO ,
- .

I
. -

- -
- -
. (. 4)24-27. O
( 15
OOO ), -
- .
, ,
. - .
- -
(, ) - ,
-
1980 - (
. O ). -
, -
LD10 (lethal dose 10%, .

4. O

(subtoxic dose)

(minimal toxic dose)

H
(recommended dose for therapeutic trial)
436 OY

5. - 6. -

1. A .
2. A .
3. A .
4. B
5. K V. :
6. M )
7. O )
8. O )
9. N Hodgkin )
10. M Hodgkins )
11. K )

. -
O - 35 -
- , 70
(. 5), .

. O - OO O OO IAOH
6. O NCI
- -
-
,
. O - NCI, -
1530. -
, . -
- -

, - .
. -
-
,
- -
, - . , , -
.
.
- -
, -
. ,
- - -
(randomization), - .
- 64
, - NCI,
. , -
- ,
, - .
- -
. -
-
- ,
VII. 437

28.876195.706. -
. CpG
- , 228.876
, -
. -
-. CpG
- , -
,
- 30,31. PTGS2, COX-2,
. CALCA, MTHFR, ESR1, MGMT, MYOD1 APC -
CpG
C-DNA MICROARRAYS (O)
- .
NCI Hamon
Cancer Center (47 NSCLC 44 SCLC 7 -
). - , 78%
23 91 - SCLC .
DNA
PCR Methyl-Light. NSCLC SCLC -
- -
CpG -
, - ,
-
. -
-
DNA -
- PCR Methyl-Light 32-34.
CpG 28,29. -
CpG -

Diagnostic ALL BM samples (n= 327)

E 6. -

ALL. -
Genes for class distinction (n= 271)

327
ALL ( ) -
271 ( -
).
40
-
2
7 -
. -
-

.
:

,
E2A- MILL T-ALL >50 BCR- Novel TEL-AML1
37. PBX1 ABL

-3 -2 -1 0 1 2 3 = sid deviation from mean

438 OY

, - 80%, -
- .
360 ALL. DNA
(ALL) -

- 35.
. - -
-
-- ,
, . , -
- DNA -
- (), -
- 12.600 -
(. 6). 360 -
, : ALL.
t(9;22) [BCR-ABL], t(1;19) [E2A-PBX1], t(12;21) [TEL-
AML1], MLL chr 11q
q23. ALL,
T-ALL. H , -
, - . -
. , -
E2A-PBX1 - ,
-
, - 36,37 (. 7, 8, 9).

B-ALL T-ALL B-ALL

CD2
CD3
CD3 T
CD3
CD8

-4 -2 0 2 4
CD19
CD22 B
CD10

>50 MLL T-ALL TEL-AML1
BCR- E2A-
ABL PBX1 -4 -2 0 2

MLL E2A-PBX1 TEL-AML1

104 104 104
103 103 103
CD19

2 2
10 10 102
1 1
10 10 101

101 102 103 104 101 102 103 104 101 102 103 104
CD10 CD10

7. ALL. . set -
CD2, CD3 CD8 CD19, CD22 CD10
327 . O
, . X
. .
CD10 CD19 . -
, CD19,
CD10 , MLL, -
F2A-PBX TEL-AML1.
VII. 439

E2A- BCR-
PBX1 MLL TEL-AML1 ABL >50 Novel
U08023 MERTK Y09443
AL049381 PBX1 D31762
U33017 SLAM AF001601
Z15108 PRKCZ M55531
AB014555 KIAA0655 D88153
AB018345 KIAA0802 U26455
AB023139 KIAA0922 U07563
X87241 FAT U60519
D87119 GS3955 U84388
D86425 nidogen 2 J03040
AJ001687 NKG2-D X81109
U41813 HOXA9 M64925
A1201310 S100 A10 X02317
L05424 CD44 M33882
Y00062 PTPRC AL031177
U85707 Mcis 1 V00572
AF030339 Plexin CI X99584
AI535946 LGALSI M74524
AB007888 MBNL J02621
M94345 CAPG U56833
Z49194 POU2AF1 AF062006
U69883 KCNN1 X58288
M63928 TNFRSF7 AB029022
AB010419 MTG16 AJ222967
AB012124 TCFL5 D86961
Z46973 PIK3C3 AB014679
AF041434 PTP4A3 D21260
AB029035 ARHGEF4 U66306
AF070644 FLJ20154 AL050289
X17025 X17025 AI524125

-3 -2 -1 0 1 2 3 = sid deviation from mean

8. . . 10 40 -
2 -
, .
DNA. -
38.

9. (profile) Support vector machine
- p= (Permutation test)
. -
T-ALL 97% 0,007
-
- A >50 100% 0,018

. - CCR
Z82206
X83301
UQCRFS1
SMA 5
- AB007851 PRPSAP2
T-ALL D29954
D34625
KIAA0056
Thromboxanc synthetase
. U01923 HMRPH2

1.000 - L05424 CD44

.
1.000 - CCR
W73822
J04132
FLJ22448
CD3zeta
- D83702
AB002344
CRY1
KIAA0346
, p. B . AB023207
AF042729
KIAA0990
IMPA1
AB007863 KIAA0403
T 7 20 AA151971 IMAGE 588365
U57693 TAF12
- HD AF000984
U04735
DBY
STCH
CCR T-ALL HD - W72733
AB023152
KIAA1536
KIAA0935
. X90999
D26067
HAGH
KIAA0033
M58459 Ribosomal protein S4
- AL080218 DKFZp586N1323
U79363 DHPS
DNA . U69559 RNF11
M29960 NR2C1
440 OY

O O
OO -
O O O ALL O
A , 11 12 -
. - RNA- -
-
- , ,
. - , , , , , -
, - , - / -
, , 70%
(. 10). ...
12.600 (set)
, -
20% ,
-
41-42. -
90%
175 , 9
12 . -
-
-
,
-
.

10. A -
, -

AML
ML TEL-AML1, ALL. A. -
ALL 2 A

A AML (2 AML) -
-
-
2 AML -
Support vector machine ALL 39. . -
p= (Permutation test) ALL BM -
-
TEL-AML1 100% 0,031
AML. -

TEL-AML1 CCR 2 AML 1.000 -
p
AA524802 -
AA255502
Z78388
, -
AA887480
W26023
AL050205 AML. . -
AI249721
AI864120
-
AF045451
L09235
D83174 -
AA554945
L12535
AML TL-AML1 + ALLS. -
T75292
U61981
HG2715-HT2811 -
J05448 DNA (DNA-sequence)
M69043
40.
VII. 441

Pr BI Br Co Ga Ki Li Ov Pa LA LS

Pr
(100%)

BI
(95%)
Br
(91%)
Co
(93%)

148 "classifier" genes

A
Ga
Pr BI Br Co Ga Ki Li Ov Pa LA LS (92%)
Ki
(99%)
1,100 genes, 100 per class

Li
(99%)

Ov
(95%)

Pa
(99%)
LA
(91%)
LS
(95%)
100 tumors 100 tumors

11. .
.
. . 100 ( 1.100)
, Wilcoxon rank-sum test ,
. Pr: , Bl: / , Br: , Co: , Ga: , Ki: , Li:
, Ov: , Pa: , LA: , LS: . .
1.100 .
( ) (). -
, , .
.

.V.
ABO11105: laminin, alpha 5
M25809: vacuolar proton pump
U40434: mesothelin (CAK1)
S72869: putative cytoskeletal protein
X15357: natriuretic peptide receptor A
U90916: unknown
U71207: eyes absent homolog
AL049313: unknown
X58079: S100 alpha
U62801: kallikrein 6
M98447: keratinocyte transglutaminase
X81892: GPCR64
U85707: meist
AB018305: spondin 1
AI936826: GPCR39
AL050069: unknown
AF071219: mammaglobin2
U21551: branched chain aminotransferase 1
AF035528: Smad6
X51630: WT1
S67247: non-muscle myosin heavy chain
U90028: bicaudal-D
M77016: tropomodulin
L13698: gas1
X17360: HOX 5.1
AB020682: F-box only protein 21
X17360: HOX 5.1
A U66619: Human SWI/SNF complex 60 KDa

12. . . E
. O
, ( ) -
( ). . A
, 36 229 10 -
. , , E. I WT. . -
WT. .
WT. E. K , WT ( ).
.
442 OY

- DNA -
-
44.

-
, , -
-
PCR Methyl-Light 32-34.
-
. -
43 -
-



ALL.
44.
- -
-

. -
- .
, (data base)
- -
, , -
AML, - ,
- ,
,
. .

1. Grever MR, Schepartz S, Chabner BA. The National Cancer
Institute: Cancer drug discovery and development program.
Sem Oncol 1992; 622-639.
2. Paull KP, Hamel E, Malspeis L. Prediction of biochemical me-
chanism of action from the in vitro antitumor screen of the
National Cancer Institute. In: Cancer Chemotherapeutic A-
gents. Washington DC: American Chemical Society Books,
1995 (in press).
3. Van Osdol WW, Myers TG, Paull KD, et al. Use of the Koho-
nen self-organizing map to study the mechanisms of action of
chemotherapeutic agents. J Natl Cancer Inst 1994; 86: 1853-
1859.
4. Jenks S, Volker N. News: Anticancer Drug Origins: Truth in
stranger than fiction. J Natl Cancer Inst 1994; 86: 173.
5. Kraft AS. Editorial: Bryostatin 1: Will the Oceans provide a
cancer cure? J Natl Cancer Inst 1993; 85: 1790-1791.
6. Ingber D, Takeshi F, Kishimoto S, et al. Synthetic analogues
of Fumagillin that inhibit angiogenesis and suppress tumor
growth. Nature 1990; 348: 555-557.
7. Boyd MR. Status of the NCI preclinical antigumor drug disco-
very screen. n: De Vita VT Jr, Hellman S, Rosenberg SA,
eds. Cancer: Principles and Practice of Oncology. 4th ed. Phi-
ladelphia: PA Lippincott, 1993: 286-288.
8. Stinson SF, Alley MC, Fiebig H, et al. Morphologic and im-
munocytochemical characteristics of human tumor cells lines
for use in an anticancer drug screen. Anticancer Res 1992; 12:
1035-1054.
9. Monks A, Scudiero D, Skehan P, et al. Feasibility of a high-
flux anticancer drug screen utilizing a diverse panel of human
tumor cell lines in culture. J Natl Cancer Inst 1991; 83: 757-
766.
10. Rubinstein LV, Shoemaker RH, Paull KD, et al. Comparison
of in vitro anticancer drug screening data generated with a te-
trazolium assay versus a protein assay against a diverse panel
of human tumor cell lines. J Natl Cancer Inst 1990; 82: 1113-
1118.
11. Carmichael J, Mitchell JB, De Graff WG, et al. Chemosensiti-
vity of human lung cancer cell-lines using the MTT-assay. Br J
Cancer 1985; 57: 540-547.
12. Alley MC, Scudiero DA, Monks A, et al. Feasibility of drug
screening with panels of human tumor cell-lines using a micro-
culture tetrazolium assay. Cancer Res 1988; 48: 589-601.
13. Scudiero DA, Shoemaker RH, Paull KD, et al. Evaluation of a
soluble tetrazolium/formazen assay for cell-growth and surg
sensitivity in culture using human and other tumor cell-lines.
Cancer Res 1988; 48: 4827.
14. Skehan P, Storeng R, Scudiero D, et al. New coloremetric cy-
totoxicity assay for anticancer drug screening. J Natl Cancer
Inst 1990; 82: 1107-1112.
15. Michael R, Kenneth D. Some practical considerations and ap-
VII.
plications of the national cancer institute in vitro anticancer
drug discovery screen. Development Research 1995; 34: 91-
109.
16. Weinstein JN, Kohn KW, Grever MR, et al. Neural computing
in cancer drug-development. Predicting mechanisms of action.
Science 1992; 258: 447-451.
17. Khanna T. Foundations of neural networks. Telemat Informat
1990; 7: 403.
18. Johnson RK. Screening method in antineoplastic drug discove-
ry. J Natl Cancer Inst 1990: 1082-1083.
19. Paull KD, Lin EM, Malpespeis L, et al. Identification of novel
antimitotic agents acting at the tubulin-I level by computer
assisted evaluation of differential cytotoxicity data. Cancer Res
1992; 52: 3892-3900.
20. Petti GR, Cichacz ZA, Cao F, et al. Isolation and structure of
spongistatin 1. Org Chem 1993; 58: 1302-1304.
21. Fuller RW, Cardellina JH II, Kato Y, et al. A pentahaloge-
nated monoterpene from the red alga Portieria Hornemannii,
produces a novel cytotoxicity profile against a diverse panel of
human tumor cell lines. J Med Chem 1992; 35: 3007-3011.
22. Goldsmith MA, Slavik M, Carter SK. Quantitative prediction
of drug toxicity in human from toxicology in small and large
animals. Cancer Res 1975; 35: 1354-1364.
23. Freireich EJ, Gehan EA, Rall DP, et al. Quantitative compari-
son of toxicity of anticancer agents in mouse, rat, hamster, dog,
monkey and men. Cancer Chemotherapy Rep 1966; 50: 219-
244.
24. Homan ER. Quantitative relationships between toxic doses of
antitumor chemotherapeutic agents in animals and man. Can-
cer Chemother Rep 1972; 3: 3-19.
25. Rosencweig M, Von Hoff DD, Staquet MJ, et al. Animal Toxi-
cology for carly clinical trials with anticancer agents. Cancer
Clin Trials 1981; 4: 21-29.
26. Gieshaber KC, Marsoni S. Relation of preclinical toxicology to
findings in early clinical trials. Cancer Treat Rep 1986; 70.
27. Special Article: Joint screening Committee of the European
Organization for Research and Treatment of Cancer (EORTC)
and the Cancer Research Campaign (CRC). Eur J Cancer
1990; 26: 411-414.
28. Virmani AK, Tsou JA, Siegmund D, et al. Hierarchical cluster-
ing of Lung Cancer cell-lines using DNA methylation markers.
Cancer Epidemiology, Biomarkers and Prevention March 2002;
11: 291-297.
29. Costello JC, Fruhwald MC, Smiraglia DJ, et al. Aberrant
CpG-island methylation has non-random and tumor type spe-
cific patterns. Nat Genet 2000; 25: 132-138.
443
30. Esteller M, Corn PG, Baylin SB, et al. A gene hypermethyla-
tion profile of human cancer. Cancer Research 2001; 61: 3225-
3229.
31. Goessl K, Krause H, Miller M, et al. Fluorescent methylation
specific polymerase chain reaction for DNA-based detection
of prostate cancer in bodily fluids. Cancer Research 2000; 60:
5491-5495.
32. Eads CA, Lord RV, Wickramasinghe K, Long TI, et al. Epi-
genetic pattern in the progression of esophageal adenocarcino-
ma. Cancer Research 2001; 61: 3410-3418.
33. Venter JC, Adams MD, Myers EW, et al. The sequence of the
human genome. Science 2001; 291: 1304-1351.
34. Lander ES, Linton LM, Birren B, Nusbaum C, et al. Initial se-
quencing and analysis of the human genome. Nature 2001; 409:
860-921.
35. Alizadeh AA, Eisen MB, Dars RE, et al. Distinct types of dif-
fuse large B-cell lymphoma identified by gene expression pro-
filing. Nature 2000; 403: 503-511.
36. Yeoh EJ, Ross ME, Shurtleff SA, et al. Classification, subtype
discovery and predretion of outcome in pediatric acute lym-
phoblastic leukemia by gene expression profiling. Cancer Cell
March 2002; 1: 133-143.
37. Arico M, Valsecchi MG, Camitta B, et al. Outcome of treat-
ment in children with Philadelphia chromosome positive acute
lymphoblastic leukemia. N Eng J Med 2000; 342: 998-1006.
38. Bioudi A, Cimrco G, Prefers R, et al. Biological and therapeu-
tic aspects of infant leukemia. Blood 2000; 96: 24-33.
39. Armstrong SA, Staunton JE, Silverman LB, et al. MLL trans-
locations specify a distinct gene expression profile that distin-
guishes a unique leukemia. Nat Genet 2002; 30: 41-47.
40. Hunger SP. Chromosomal tranlocations involving the E2A ge-
ne in acute lymphoblastic leukemia: clinical futures and mole-
cular pathogenesis. Blood 1996; 87: 1211-1224.
41. Colub TR, Slonim DK, Tamayo P, et al. Molecular classifica-
tion of cancer; Class discovery and class prediction by gene ex-
pression monitoring. Science 1999; 286: 531-537.
42. Hogenesch JB, Chung KA, Batalov S, et al. A comparison of
the celera and fusembl predicted gene sets. Cell 2001; 106:
413-415.
43. Ramaswamy S, Tamayo P, Rifkin R, et al. Multiclass cancer
diagnosis using tumor gene expression signatures. Proc Natl
Acad Scien USA 2001; 98: 15148-15154.
44. Su AI, Welsh JB, Sapinoso LM, et al. Molecular classification
of human carcinomas by use of gene expression signatures.
Cancer Research 2001; 61: 7388-7393.

. , . .

KO YO A O OY YO
1. G1
. . -
. .
2. S D . -
, 10 .
.
3. G2 .
-
D . -
( )
. . .
- 4. . -
, , ,
( - (. 2).
) ,
, -
, -
( ). -
O . .
, - 5. G0 - . -
(-
G1. O-
).
G1

(G1) -
(G0). O - G1.

. H A O OY
- -
, , -
- .
(. 1). -

-
G2 M
. -
,
G0 , / -
S G1 (. 3).

-
,
1. . .

445
446 OY

, .

. .

- , .
.

( ).
, ,
"" .

,
.
.

2. .

1Kg 1012

1gr 109

1mg 106

1g 103

C 1

3. .
VII. 447

A O OY YO A
OY AO

O
D 2 2

-. -
DNA DNA

, , DNA
D
D,
D. CH2CH2CI
- CH3 N
CH2CH2CI
.
(Mechlorethamine)
O , -
, -
- CH3
. N

. CH2 CH2
- CH2 CH2
, -
, ,
, , -
-
2 2
. -
- DNA DNA
, , DNA
- 4. .
-
.
- , -
- DNA -
- . -
, - .
ii. -
. -
( -
(Nitrogen Mustard) ),
, G1 S.
A
. : 2---(2--
)--.
, : Cariolysin mp 10 mg.
. .
: - -
. .
7 DNA - : -
(. ,
4). -
i. O - . /
. -
448 OY

, - H
15 -
2% H
. O=P-R
10 ml -
. H
( 1 - 5. .
3 ) (push) -
. : Endoxan, Cyclophosphamide
: 100 mg, 200 mg, 500 mg, 1.000 mg, Tabl 50
/ + + + mg.
+ + : -
+ + 24 -
. 6 . -
: . - , .
- -
. - , O OOO OO.
, - 5%, -
. Ringer.
( dgkins - , -
, ). (
( ). ), -
: - -
dgkin .
, - -
(O) , , - .
O/VD. - : -
- . -
.
1020 mg - (Area Under Curve
- AUC) -
. .
, - , -
.
2030% -
, , - -
.. - .
- :
.

(Cyclophosphamide) 510 ,
: , , -
- ,
P450. - + + +
, - / + +
. - + +
( , Mes-
DNA. na)
: 2-[(2-)-]- (-
2-1,3,2--2- (. )
5).
VII. 449

( 50% -
, ) Mesna,
( - -
, Hodgkins , ). . O
: -
- ,
Hodgkins - -
, , - .
, , - : Mesna (Uromitexan) mp 200 mg,
, - 400 mg. 20% -
Ewing, , 0, 4 8 .
.. - Mesna ( Coca-Cola).
: , -
- .
Wegener. (Melphalan)
(Ifosphamide) (L-Phenylalanine Mustard, L-PAM)
: - :
- DNA.
. - : L-phenylalanine mustard (-
4 ), L-PAM (-
. ) (. 6).
in vivo
. -
NH2
34 R CH2CHCOOH
. -
3849%
. 6. .
: 1,3,2-O,3-(2--
)-2-[]--2-. : Alkeran 50 mg, Tabl 2
: Holoxan 200 mg, 500 mg, 5 mg.
mg, 1.000 mg. : -
: 200 mg
5 ml , 500 mg 13 ml 100 ml . O
1.000 mg 25 ml. - -
. , 0
336 . O 90 57 .
50%, , ,
20%. - AUC 39%
, - .
. -
.
- :
. / + +
: + +
+ + + +
/ + + +
+ + +
( ) +
. - +
450 OY

( - , , -
). , Walderstrom -
: - . -
- (.. ).
( Alexanian) - (Busulphan)
: . -
-
, , - DNA,
. - DNA.
- : 1,4---
. (. 8).
(Chlorambucil)
O O
: . O
- CH2 O S (CH2)4 S O CH3
.
O O
: 4-[(2-)-]-
8. .
(. 7).

: Myleran Tabl 0,5 mg 2 mg.

: -
R CH2CH2CH2COOH
.
.

7. . . O
3 .
: Leukeran Tabl 2 mg, 5 mg.
: - .
. - :
4070 + + + (.
1530 mg . O -
90 .
: . -
+++ (
2 , -
, - )
)
O ( < 400 mg) + +
( > 400 mg)
( ) + (
( - < 500 mg, , -
1 ) . )
+ Addison +
/ + +
( - ( -
). ).
: , : -
, - . -
- (.. -
, ( - , -)
), - . -
VII. 451

O
.
CICH2CH 2NCNH R
(Thiotepa)
NO
: -
9. .
. -
.

: (1-)-
, -
.
,
: Thiotepa 15 mg.
-
: 1,5 ml .
.

-
, 5% -
.
Ringer, .
, -
5 . -
-
.
. O
. -
-
.
DNA ,
:
RNA . -
+ + +
, -
/ +
, -
+
, DNA.
+
( - (Carmustine BCNU)
1.000 mg/m2, , - : DNA,
, ) -,
( -
- .
- : 1,3-(2-)-1-.
). : BiCNU 100 mg.
: : -
(3 ml )
27 ml .
. - 100 ml
. 5% (O -
- O). 3045
5 .
70%
. - , . -
- 1550%
- .
. :
/ + + +
OZOYPIE + + + ( ,
O -- 4 6
-- (MNU) (. 9). - )
- +
, +
, , , O .
OO O O,
. MNU -
452 OY

. )
. ( -
: - ).
, , : -
, , . .
(Lomustine CCNU) (Streptozocin)
: . :
: 1-(2-)-3--1-- Streptomyces achro-
. mogenes. DNA -
: CeCeNU Caps 5 mg, 40 mg. . -
: DNA-O6--
. O 15
-DNA- (O6-),
24 50%
.
. -
: 1---.
3050% . -
: Zanosar 1 gr.
, -
:
.
5%, -
.
2 mg/ml -
:
1560 . O
/ + + +
515 50%
+ + + ( ,
4 . 1020%
4 6
.
)
:
+
/ + +
+
(10% ). -
, -
-
.

: -
, Hodg- ( 3070% -
kin . )
(Methyl CCNU MeCCNU)
: . (, , , -
: 1-(2-)-3-(4-- , , Fanconi)
)-1-. +.
: Semustine Caps 10 mg, 50 mg, : O , -
100 mg. , , .
:
. - O
16 . - -
.
> 30% . -
:
/ + + -
+ + ( , -
, - .
) ,
+ ( ,
1.500 mg/m2, - -D
.
VII. 453

. -
, -
-
. . -
-
, , - DNA -
DNA RNA, DNA .
RNA, : ,
, . O
. 12 -
, , - . 20% -
. .
: Mitomycin C 2 mg.
-D (D-actinomycin)
:
: + + + (,
- DNA, )
RNA. + +
Streptomyces parvulus. + +
: Cosmegen 0,5 mg (- / +
). +
: . O - ( , -
3648 , , , -
. 15% , )
20 , + +
30% .
: O
/ + + + ( )
+ + + ( -
O O O OOO
) O O.
, + +
: , , -
+ ( -
, , -
)
-, , .


(- O ,
, ) S:
DNA:
-
O O O OO- DNA, -
O O O. DNA RNA.
: , Wilms, - -
, Ewing, , - : -
. - -
- .
, Paget, Kaposi -
. -
: P450 (-
(Mitomycin C) )
: O
Streptomyces caspitosus .
454 OY

(O2), - .
, - -
DNA. P-
- ,
(SOD) . O , - -
, - .
.
(Daunorubicin)
-
. - -
- -
1960. -
-
. -
.
: Daunoblastine 20 mg.
. : 100
, ml 1520 .
- :
. + + +
+ + + ( -
(), ) -
, - . OO -
. OOO DEXRAZOXANE (Cardioxa-
(- ne 500 mg)
), - + + +
, , , , / + +
, . , + +
,
, , -
, , , (-
. , )
1 O O O OO-
231 O O O.
( 33 , - : O , Wilms.
23 ).
- (Doxorubicin)
(multi-drug resistan-
ce). -
vinca, - ,
.. MDR 1 -
, -
, P-, 170 .
kd. P- - : Adriblastina, Doxorubicin
- 10 mg, 50 mg.
- : .
. :
+ + + ( )
P-- + + + ( -
, ) -
- ( 550 mg/m2 -
(gene amplification) , 450 mg/m2 -
VII. 455

- : .
) -
I (Idarubicin)
. -
, - (-) -
4872 . O- .
O OOO : Zavedos 5 mg, 10 mg.
DEXRAZOXANE (Cardioxane 500 mg) : -
+ + + (1014 ) , .
/ + + -. O -
, 22 -
, + +
.
:
(- + + +
, ) + + + ( -
O O O OO- ) -
O O O. ( ). OO
- OOO DEXRAZO-
( - XANE (Cardioxane)
, ). + + + (1014 )
: O , Hodgkin, / + +
Hodgkins , , - , + +
. , Wilms, -
, , - O O O OO-
. O O O
(Epirubicin) -
- , ,
. .
: Farmorubicin 10 mg, 50 : O (1
mg. ). O -
: . (2 ).
:
(Mitoxantrone)
+ + + ( )
+ + + ( -
) - .
( 1.100 mg/m2) - .
- -
. DNA -
. OO - -
OOO DEXRAZOXA- .
NE (Cardioxane) . -
+ + + (1014 )
/ + + S -
, + + G2,
.
-
(-
, ) . -
O O O OO- -
O O O. ,
456 OY

P- )
- + +
. + + (
: Novantrone, Genefantrone -
20 mg, 25 mg, 30 mg. )
: . O - , +
40 - ,
-
(, - O O O OOO
). , O O.
510% : -
. , -
: . -
+ + -
+ + + ( .
). - Kaposi
160 mg/m2 -
+ + CD4 (< 200 CD4 /mm3) -
.
: -
/ + + Caelyx ,

O O O OO- -
O O O .
160 mg/m2.
: O , -
, . .
O O
(Pegylated liposomal doxorubicin)
G1
o Caelyx

-
- L- (L-Asparaginase)
(MPEG). L-, -
- ,
- 1953.
(MPS), (Escheri-
. chia coli Erwinia cartovora) -
: Caelyx -
, .
Streptomyces peu- : L-,
cetius var. caesius. - , DNA
- RNA
. .
: Caelyx Amp 2 mg/ml. : Erwinase 10.000 IU.
: To Caelyx : , -
2050 mg/m2 30 , - . O
. 830 . -
: -
/ + + 1050%
+ + ( 1014 .
VII. 457

: (. 10).
( - , -
,
) DNA
+ + S -
+ + . -
+ -
+ . O
+ + - -
+ -
: - -
. - .
,
. -
: - .
- -
( -
5060%). - (, , ), -
- DNA,
3050%. .
.
S 5- (5-FU, Fluorouracil)
5- 1957 Hei-
O delberger et al -

, - DNA -
, - .
. : 5--2,4(1,3).
DNA : :
- FdUMP (fluorodeoxyuridine monophosphate) -
DNA, ,

DNA (. 11)
FUMP RNA -


FdUTP FdUMP, -
DNA (. 12).

FH4


5-FUTP dUMP dTMP
-

DNA RNA 5-FU DNA

10. - 11. 5-
DNA. .
458 OY

dUMP

FdUMP CH2THF
TK

TS
dTMP dTTP
DNA
TS

CH2THF dNTP
FdUMP
DNA
dUMP

dUMP UDG

12. .

: Fluorouracil (Roche) 250

mg, 20 mg, Fluorouracil (DBL /
Santa) 250, 500 mg. +
: 80% ,
. - , ().
FdUMP. O 5-FU -
24 . (. 1).
. - : , -
. ,
, - .
. : -
: -
( , ,
, , -
, ). -
.
+ + ( - . -
710 )
, - , .. -
-, -
(5060%) ,
+ + ( -
, - .
-
) , , ..
+ + (
)
1. -
- (
)
( - 5-FU 5-FU
)
(-) -
(, -

, -

, )
VII. 459

(Tegafur) +
: 1-(2)-5-- +
.
: 5-FU, (-
- )
- 5-. (-
: Ftorafur Amp 400 mg, Caps 400 , -
mg. )
: - ( )
.
2 . .
: - : -
5-FU. , .
+ : O , -
+ .
+
(Capecitabine)
+
+ : 5--5---.
+ : 5---
, 5-
( ). FU.
: Xeloda Caps 150 mg, 500 mg.
: , :
. 2.500 mg/m2 -

, 2 , -
.
- (Cytarabine) :
H - +
Cryptothethya crypta - +
, - +
, . -
: 1--D--.
: DNA-, - ( ).
DNA, DNA. -
: Aracytin 100 mg, 500 mg. ( ).
: , - : -
, . - .
, - : ,
- .
. -
720 . (Gemcitabine)
50% 2 : -.
. : -
-, -
S . DNA
- , -
. - -
: .
+ + : Gemzar. 200 mg, 1.000 mg.
/ + : .
+ :
460 OY

+ + + : -
+ + 6-.
+ + : O -
, , .
, 6- (6-Mercaptopurine)
,
: 1,7--6--6-.
,
: de novo -
.
. RNA DNA
: , .
, , - : Purinethol Tabl 50 mg.
, . - : .
:
-. + + +

+ +
6- 2-- , 6- (
, Hitching Elion ).
1954 1955 - : -
30 . , , -
6-- 3050%.
. - .
, - : O -
--- .
- (. 13).
(Azathioprine)
(Thioguanine) : --
: 2--1,7----6-- 6- -
. , -
: de novo - .
. RNA DNA : Imuran Amp 50 mg 100 mg,
. Tabl 50 mg.
: Lanvis Tabl 40 mg. : -
: . O . .
90 . :
. +
: +
+ + + +

+ + .
( :
).

O SH SH
H H H
N H N H N H

2 2

6- 6-

13. .
VII. 461

(
1/31/4 ).
:
-
.

(Hydroxyurea)
: .
: -

, DNA.
: Medroxyurea Caps 500 mg.
: , - DNA

12 .
-
3 . O 14. .
5,5 7080%
12 .
: , -
+ +. DNA RNA (. 14). O -
, - -
10 ,
. - ,

- .
12 : Methotrexate, Emthexate, Metho-
+ blastin.
+ : , , -
+ , (-
+ ( , , ).
). 15 mg.
-
. 24 ,
1012
: - .
,
, -
,
, .
- -
. .


, -
- (Methotrexate) .
: 4-,4-,-10---
- . . -
:
. - . 5080%
. - 12
(FH4), . -
462 OY

1 gr, ,
. DNA Fe--
: DNA.
+ + + tRNA.
, , + + : Bleocin Amp 15 mg.
O (, , : 1020 mg/m2 -
, , ) , -
+ . O -
+ ( 24
, . O
30% 3
) 5 .
+ ( ) :
(, 412
) + + +
/ + +
, OOO
/ +
+ +
( , - + +
, , ). , +
+
- +
. ( ).
, -
: 50%

.
.
, , -
70
, , -
300 mg/m2
, . -
Raynaud
-
O O
. -
300 mg/m2.
. -
, . : -, Hodg-
: O (O), Ca - kin, Hodgkins , , ,
, , , - , , , -
, , , .
-, , - (Mithramycin)
.
-
G2 ,
.

-
(Bleomycin) .
O - : Mithramycin Amp 2,5 mg.
Streptomyces verticul- :
lus, .
. 6 .
10 - :
, - + + +
2. ,
: H , (II, V, VII,
VII. 463

X) + + + ,
O , + + -
+ + + .
/ / +
(Etoposide VP 16)
,
: 4--9-
[4,6-O-(R)---].
. : , -
DNA-
: -
.
, -

,
S G2
.
G2 .
: Vepesid, Etoposide Amp 100 mg
/ 5 ml, Caps 100 mg.
-
:
,
. - 3060 100 mg
- 250500 ml 5%.
, O -
(. 2).
- -
. -
(, -
), -
-
. . () -
90
3 11 . -
2.
100 mg/m2 5 . -
(VP 16)
((VM 26) AUC (area under curve)
Vinca
100
mg/m2 600 mg/m2. -
. -
-
Taxus AUC

50% -
.
:
+ + +
(Podophy- / + +
lum peltatum) , -
, +
. +
+
. - +
1940, - +
(0,72%)
. -
, , - -
-
464 OY

Stevens-Johnson -
, - O -
-
.
-
. -
: , - ,
, Hodgkin,
Hodgkins , , - .
, , Wilms, . -
: -
. -
.
(Teniposide VM 26) -
: 4--9- ,
[4,6-O---D-]. , , , , -
: . .
: Vumon Amp 50 mg.
: . -
, ,
. - . -
-
. O
610 , - -
, .
2448 , (Vinblastine)
.
: .
:
:
+ + +
. -
/ + +
-
+ +
. -
+ +
Vinca Rosea. -
35% , -
( -

), .
.
: Velbe Amp 10 mg.
: , - : . -
, Hodgkin, , -
Hodgkins , , Wilms,
Ewing, , - -
- .
. (4399,7%).


. 50% -
Vinca Rosea ,
Vinca Rosea 20 . -
- 15%
-. .
,
. - 5
- . O -
VII. 465

5399 .
2024 . 55155 ,
:
( , 23 85 . -
) + + + .
, , + -
/ + 2030
( - .
- :
) + ,
, , - 40 . -
, , , - -
, , , - . , -
, , + ,
+ , -
Raynaud + , , -
+ , ,
+ , , , .
- -
() -
( , - , , ,
, , ) , -
. , -
. , , , , -
: Hodgkin, Hodgkins - , ,
, , Kaposi,
. +
: , / +
. +
, - +
. +
+ +
(Vincristine) + +
: 22-. +
: . -
Catharanthus rosea. ()
: Oncovin, Vincristine Amp 1 mg.
: . - ,
, - -
.
- : O , Hodg-
. kin, Hodgkins , , -
. , , -
(48% ). Ewing, Wilms.
70% : .
,
12% (Vindesine)
( ). : 3--4-O--3-
()-.
. - : .
5 - : Gesidine Amp 5 mg.
466 OY

: . - . -
, - . -
50% 50% -
- .
. H ,
, . , -
: .
. :
- -
, -
. .
: Taxol Amp 30 mg.
, - : , -
, 175 mg/m2 3 -
(, , ..). . -
O , -
.
.
,
+ +
. -
+ +
-
+
, -
+.
2 . -
: . -
: . 18 5 .
(Vinorelbine) , -
: . 30%
. .
: avelbine Amp 10 mg, 50 mg, :
Caps 20 mg, 30 mg. (, -
: - , , , )
Vinca .
- ,
. ,
:
( , - ,
) + + +
/ + /
+ +
+
.
: , , .
. : -
,
, -
-
.
,
(Taxus Brevifolia), : -
. -
, 450
(Paclitaxel) (, , -
Taxus Brevifolia , , , ). -
..., , .
VII. 467

, - . DNA
. -
- . -
(Docetaxel)
-
- .
Ta- : Cis--- (.
xus baccata, . 15).
: .
: Taxotere Amp 20 mg, 80 mg.
H3N CI
:
-
Pt
75100 mg/m2 3 . -
24 H3N CI
48 . 15. .
:
, , : (-SH) -
, ,
. , DNA (. 16).
, , : Platinol, Platamine, Cisplatin, Pla-
, , . - tosin Amp 10 mg, 25 mg, 50 mg, 100 mg.
5% : 3060 -
.
, . -
, ,
,
/ , -
. ,
: . O -
, -
. .
--
. , -
:
, , - -
, , , . . , -
20

, 1 24 . -
(Cisplatin) , -
H . 2370%
- 24 90%

H3N G G
Pt H3N
Pt G G
H3N G G
Pt
16. . H 3N H3N H3N

468 OY

5 . - , -
. , . -
:
/ + + + ( - .
). :
. - .
, - ,
, .
.
(Carboplatin)
-
, - -

-
5-3 -
. O

-

-
+ + + ( O A
-
, 100 ml /

)
.
( ) + +
: Cis--[1,1---
+
-(2-)O,O] .
+. 8 -
: O -
-

(), -
.

: Paraplatin, Carboplatin, Carbo-
-,
sin, Megaplatin Amp 50 mg, 150 mg, 450 mg.
. O -
: ,
, / -
250 ml
-
5%. -
, -


. 4 -
+ ( 60% -
-
, )
()
+ ( , -
. -
)
6 -
Raynaud +
1 .
( -
, -
, - . -
40% 12 ). , -
: - . -
- .
- -

. - . -
, .
, - :
, , , - + + + (
21 -
, , , - 28 ,
, , , - -
, Hodgkin, Hodgkins , )
VII. 469

/ + +
+ ( ) . 72
+ 8 . -
+ .
+. :
: / + + + ( )
, +
- (, -
, )
, , - ,
-
-, -

.

: -
+.
.
: Hodgkin, , -
O (Oxaliplatin) .
: - (DACH-
Pt). (Temodal)
: O H , -
. . MTIC
: Eloxatin Amp 1.000 mg. DTIC. O -
:
125130 mg/m2 34 . MTIC.
. - : 8--3-- (5,1-)
2 . -1,2,3,5--4 (3)-1.
: :
O - DNA.
, - : Temodal Caps 5 mg, 100 mg,
250 mg.
+ : 150 mg/m2 /
/ + +. 5 , 4 . 20
. -
: (- , 200 mg/
2 ), , m2. 1,8 .
, , , -, - .
. :

/ + +
+ ( 20 )
(Dacarbazine DTIC) +
H , - +
, , +
. - +.
: 5 (3,3--1-)-- : ,
4-. , ( ), -
: DNA, -- ( ).
DTIC IC (methyl-triazeno-imidazole car-
boxamide). (Procarbazine)
: Deticene Amp 100 mg. O,
: ( DNA,
150300 mg/m2 310 ). O - .
40 . 50% : --(2--
470 OY

-)-p-. . -
: . O - 3090 . O
- 710 .
- :
( - / + +
, , ) - + +
DNA. , ,
-
. ,
- ( , , -
. - )
S , (, , , -
. - )

-
. .
: Natulan Caps 50 mg. : ,
: , ( ), -
( ).

3. O

OO

,

.

-D
, , ,
, , trastusumab
5- .




. ( ) ,
, , , , .
. - ()


. O
/ , , .
(flush syndrome).
.
. O
,
. (, , ,
, ..)
,
VII. 471

:
( -
). -
, ,
,
(-
, ..), -
.

-
, ,

17.
,
(. 3).
.

OH OO OI
(. 4). O -
, -
, -
.
. -
, , OOO
, , -
- , -
. .
-
OOO ,
. -
(. 17) , (-
, - , ) (. 5).

4.

p.o.

> 100120 mg/kg 2 , /
/
> 550 mg/m2 ( ) ,
< 550 mg/m2 ( )
> 550 mg/m2 ( ) ,
5- ,


> 100140 mg/m2 ( ) ,


O
O
472 OY

5.

> 1.200 mg/m2 ( ) / / /

,
50200 mg/m2 (),
, ,
> 50 mg/kg (
), ,

1,2 gr/m2 /15


> 30 mg/m2 ( ) ,

-
.
10% .
40% - OOO
(- -
). O (93%) ,
(78%) . -
(. 6).
-
-

, , , . . -
VOD (veno-occlusive disease), -
, -
. Mesna - , , -
, - .

6.

. ,
,
VOD
VOD
VOD
VOD
, ,

VOD
.
. ,
, VOD
, /
1,5 gr
VOD
. , VOD

VOD: (veno-occlusive disease)

VII. 473

7.

B > 400 U ( ) / ,
.
, .

> 1 gr/m2 ( ) ,
/
/
-

OH OO . O -

, - (FIO2) 30%.
. - -
-
. > 400 U (. 7).
-
- H OO
, O
. - -
, , , ,
, - , , -
, - .
, , - - (-
, - ), -
(, , - , , -
, ). - , -
- (. 8).

8.

B ,


-
,


-

,
,
,

474 OY

H OO
9. -
O ,
,


.





(. 9).
- O
.
, O

-
- . -
. O (. 10):
1. O , 12
, , -
, . -
( - -
, , - .
2. , 24 -
). -
.
- 3. (anticipated emesis). -

. . -
, ( 4 )
(
). - -
- . .

10.

(6090%) (3060%) (1030%) <10%

> 75 mg < 75 mg > 1 gr

> 500 mg < 500 mg > 75 mg
> 200 mg > 1 gr < 250 mg p.o.
> 75 mg < 75 mg p.o.
- > 1 gr < 400 mg -
> 60 mg < 200 mg
< 60 mg
> 400 mg
-D 5-
VII.
1. Benjamin RS. The Cerenex Chemotherapy Handbook. Uni-
versity of Texas: Publ. Cerenex, 1993.
2. DeVita VT, Hellman S, Rosenberg SA. Cancer. Principles and
Practice of Oncology. 4th ed. Philadelphia: JB Lippincott, 1993.
3. Perry M. The chemotherapy Source Book. Baltimore: Williams
and Wilkins, 1992.
4. O. . : O, 2003. line chemotherapy in patients with metastatic breast cancer: a
5. British National Formulary (BNF). London: BMA and PCGB,
2000.
6. American Joint Committee on Cancer. Handbook for Staging
of Cancer. Philadelphia: JB Lippincott, 1993.
7. Katzung BG. Basic and clinical pharmacology. 7th ed. Apple-
ton and Lange, 1998.
8. Goodmans and Gilmans the pharmacological basis of thera-
peutics. 10th ed. McGraw-Hill, 2001.
9. Loehrer PJ, Einhorn LH, Elson PJ, et al. A randomized com-
parison of cisplatin alone or in combination with methotrexa-
te, vinblastine, and doxorubicin in patients with metastatic uro-
thelial carcinoma: a cooperative group study. J Clin Oncol 1992;
10: 1066-1072.
10. Rosier JF, Bruniaux M, Husson B, et al. Role of 22difluoro-
deoxycytidine (gemcitabine) induced cell cycle dysregulation
in radioenhancement of human head and neck squamous cell
carcinomas. Radioth and Oncol 2004; 70: 55-61.
11. van der Hage JA, Putter H, Bonnema J, Bartelink H, et al. Im-
pact of locoregional treatment on the earlystage breast cancer
patients. A retrospective analysis. Eur J Cancer 2003; 39(15):
2192-9.
12. Pectasides D, Pectasides M, Farmakis D, Bountouroglou N, et
al. Oxaliplatin plus high-dose leucovorin and 5-fluorouracil in
pretreated advanced breast cancer: a phase II study. Ann On-
col 2003; 14: 537-542.
13. Pectasides D, Fountzilas G, Rigipoulos A, Bountouroglou N,
et al. An outpatient second-line chemotherapy with irinotecan
and vinorelbine in patients with non-small cell lung cancer pre-
viously treated with cisplatinbased chemotherapy: a phase II
study of Hellenic Cooperative Oncology Group. ASCO Edu-
cational Book, 2002, poster 1307.
14. Athanassiou AE, Potamianou A, Bountouroglou N, Ziras N, et
al. Methotrexate, etoposide, ifosfamide and cisplatin (MVIP):
an effective firstline therapy for IGCCC intermediate/poor pro-
475
gnosis patients with germ cell tumors. J BUON 2002; 7: 35-41.
15. Porcu P, Bhatia S, Sharma M, et al. Results of treatment after
relapse from high-dose chemotherapy in germ cell tumors. J
Clin Oncol 2000; 18: 1181-1186.
16. Athanassiou AE, Radulovic S, Ziras N, Potamianou A, Pecta-
sides D, et al. Docetaxel with or without mitoxantrone as first
multicenter phase II study. J BUON 2001; 6: 371-381.
17. Hetzel DJ, Dent J, Reed WD, et al. Healing and relapse of se-
vere of peptic esophagitis after treatment with omeprazole.
Gastroenterology 1988; 95: 903.
18. Dergman OJ. Oral infections and septicemia in immunocom-
promized patients with hematologic malignancies. J Clin Mi-
crobiol 1988; 26: 2105.
19. Hersh EM, Wong WG, Henderson ES, Freireich EJ. Hepato-
toxic effects of methotrexate. Cancer 1966; 19: 1600.
20. Basurto C, Corgna E, et al. (Italian Group for Antiemetic Re-
search). Cisplatin induced delayed emesis: Pattern and pro-
gnostic factors during three subsequent cycles. Ann Oncol
1994; 5: 579-85.
21. Gregoire V, Hittelman WN, Rosier JF, Milas L. Chemoradio-
therapy: radiosensitizing nucleotide analogues. Oncol Rep 1999;
6: 949-57.
22. Lawrence TS, Davis MA, Loney TL. Fluoropyrimidine-media-
ted radisensitization depends on cyclin E depended kinase a-
ctivation. Cancer Res 1996; 56: 3202-6.
23. Bourthis J, Calais G, Eschwege F. Chemoradiotherapy of car-
cinomas of the upper aerodigestive tract. Cancer Radiother
1998; 2: 679-88.
24. Pectasides D, Glotsos J, Bountouroglou N, Kouloubinis A, et
al. Weekly chemotherapy with docetaxel, gemcitabine and cis-
platin in advanced transitional cell urothelial cancer: a phase
II trial. Ann Oncol 2002; 13: 243-250.
25. Taylor IV SG, Murthy AK, Griem KL, et al. Concomitant cis-
platin/5FU infusion and radiotherapy in advanced head and neck
cancer: 8 year analysis results. Head Neck 1997; 19: 684-91.
26. Pectasides D, Visvikis A, Kouloubinis A, Glotsos J, Bountou-
roglou N, Karvounis N, Ziras N, Athanassiou A. Weekly che-
motherapy with carboplatin, docetaxel and irinotecan in ad-
vanced non-small cell lung cancer: a phase II study. European
Journal of Cancer 2002; 38(9): 1194-200.

. . , . , .

OOO O ,
O ,
- 70 ml/min/1,73 m2.

, --
, , - (D).
. - -
- , p -
. , ,
- . -
/ -
. .
,
OO
.

O (CDD)
O - .
,
. - . O
,
,
. 2,3. -
, 4 ( -
, -
. ). 25% 35% -
,
.
- -
. p - -
- .
. , -
, - .
. 5. -
-
(Glomerular Filtration Rate , -
GFR). O - . O
, -
(effective renal plasma flow)
. -
. - 6. 13 CDDP
2- ,

477
478 OY

. ,
- 5 .

7. 1223% , -
(GFR), - 14,15.
, - -
.
2- - -
. -
.
, , -
, - -
. - CDDP16.
, , -
110% 8. - , -
, -
- -
. , .

. - -
. -
10% - CDDP -
9. , -
O - .
. O - O CDDP
23 L 312
, CDDP,
. 23 L -
. -
10. , -
- ,
- 3 L/m2 ,
, - -
, - . -
, 17, -
11.
CDDP. 24 CDDP -
(.. ). -
cis , 18.
- -
D12. O - CDDP -
, (sodium thiosulfate)
D - ,
12. - CDDP.
, F-,
13. - 19,20.
IV CDDP -
, . ,
.
- -
-
VII. 479

21,22. .
, , - ,
, 29. -
, -
, .
23. - .

O (ASCO) - -
- .
24. - -
- .
,
- O OO

. (C)
30, -
, - Coggins 1959. -
24. 10% -
- , 40%
-
25. . O -
- 31. -
, -
. - 4--
- , -
, - -
, ,
(Area Under the Curve AUC). , ,
- . -
, - -
26-28. -
. , ,

. .
-
CDDP. - , , ,
(IV) - .
, - -
. ,
,
, , -
( SIAD)32.
. -
.
12
- 24 ,
. -
55% . SIAD
, 27% 60 ,
ml/min. -
480 OY

33. S
100 - . -
, 45% -
, 43% 78% - GM-CSF 40.
, 5% - O S-
. 100% (. , -
1 1 40% ) -
2 8 16% . .
30. -
, - SIAD ,
- -
. -
- .
- -
41.
. , -

-
/

. -
.
- , 2,
, ,
F2, , -
-
, . -
Fanconi.
, ,
34-36. -
- 42. -
II,
, . - I, , , -
- , , -
, . .
- 43 (
- ).

. 100
O Brock et al 37, - g/m2.
, , -
ESNA.
, 2-merca- , -
ptoethane sulfonate (S). .
- 45.
, S , 4 S
,
. S -
, -
. .
-
- BO
,
S, ,
S -
38,39. -
VII. 481

, 11,5 g/m2 49.

. -
p .
- O
. -
.
(intrarenal obstructive
nephrpathy). -
50.
, - 51.
- -
- (CCNU), (BCNU)
. (menthyl-CCNU).

.
,
19 g/m2, ,
46.
1,5 g/m2.
-
OTIKA
-
C -
.
52.
-

O ( -
100 mg , 6
) -
. -
. -
-
, -
. < 4 10-7 48 ,
,
, - , , -
< 2,5 10-8 . 53. -
- ,
14 21 47, -
, - IgG -
. 54. -
, -
-
- .
, , -
. ,
40% .
OOIE
- 250500 g/kg
. 5 .
-
48 AOPA KYTTAPOTOIKA APMAKA
. -

, , , - (SIADH)55. 5--
, . - ,
, . -
- .
482 OY

, - . -
, , ,
. - (mg/mg) -
. 1. -
-
, -
.
, 61.
, -
1 mg/kg 3 5 , .
. , ( -
meCCNU VP) .
56. - , -
, - .
. 23 , -
1.200 mg/m2 meCCU . ,
- - 62.
. , -
, -
57. . /
- 63.
, , -
. OO OO
-2 (IL-2) capil- ,
lary leak syndrome ( ) -
58. ,
Burkit
. . -
(IFN-) -
. - .
59.
, Rituximab , , -
, 64.
,
CD2060. -
,
O O O OO O 24 -
- .
. -
-
, . -
- , .
, -
. - (Fasrutec),
- -
Burkit - .
.
. ,
, , . -
- G-6-PD.
VII. 483

, - OOO O O
, - O
6 mq/dl, - -
> 10 -
mg/dl. -
(. 1 2).

1.

-D
5-



,
6-

6-

2.

GFR
3060 ml/min 1030 ml/min <10 ml/min

50%
Calvert
150% 100% 75%
50%
75% 75% 50%
75% 75% 50%

75% 75% 50%
- 100% ( ) 50% 2550%
100% 0,75 mg/m2 ?
100% 75% 50%

CCNU 100% 50% 20%
100% 75% 50%
50% , > 60 mg/dl > 1,5 mg/dl.
Av CrCl < 40 ml/min:

1. Reed WE, Sabatini S. The use of drugs in renal failure. Semin
Nephrol 1986; 6: 259-295.
2. Dangaard G, Abildgaard U. Cisplatin nephrotoxicity. A review.
Cancer Chemother Pharmacol 1989; 25: 1-9.
3. Fillaster JP, Raquenez-Viotte G. Cisplatin nephrotoxicity. To-
xicol Lett 1989; 46: 163-175.
4. Watson PR, Guthrie TH, Caruana RJ. Cisplatin associated
hemolytic-uremic syndrome successful treatment with a sta-
phylococcal protein A column. Cancer 1989; 64: 1400-1403.
5. Patterson WP, Reams GR. Renal and electrolyte abnormali-
ties due to chemotherapy. In: Perry MC, ed. The Chemothera-
py Source book. Baltimore M.D.: Williams and Wilkins, 1991:
648-667.
6. Groth S, Nielsen H, Sorensen JB, et al. Acute and long term
nephrotoxicity of cis-platinum in man. Cancer chemother Phar-
macol 1986; 18: 276-279.
7. Hansen SW, Groth S, Dangaard G, et al. Long term effects of
renal function and blood pressure of treatment with cisplatin,
484
vinblastine, and bleomycin in patients with germ cell cancer. J
Clin Oncol 1988; 6: 1728-1731.
8. Schilsky RL, Anderson T. Hypomagnesemia and renal magne-
sium wasting in patients receiving cisplatin. Ann Intern Med
1979; 90: 929-931.
9. Hutchison FN, Perez EA, Gandara DR, et al. Renal salt wast-
ing in patients treated with cisplatin. Ann Intern Med 1988;
108: 21-25.
10. Leibbrandt ME, Wolfgang GH, Metz AL, Ozobia AA, Has-
kins JR. Critical subcellular targets of cisplatin and related pla-
tinum analogs in rat renal proximal tubule cells. Kidney Int
1995 Sep; 48(3): 761-70.
11. Gordon JA, Gattone VH. Mitochondrial alteration in cisplatin
-induced renal failure. Am J Phys 1986; 250: 911-998.
12. Liu H, Baliga R. Cytochrome P450 2El null mice provide novel
protection against cisplatin-induced nephrotoxicity and apo-
ptosis. Kidney Int 2003 May; (6395): 1687-96.
13. Megyesi J, Safirstein RL, Price PM. Induction of p21WAFI/
ClPl/SDll in kidney tubule cells affects the course of cisplatin
induced renal failure. J Clin Invest 1998 Feb 15; 101(4): 777-82.
14. Kelsen DP, Alock N, Young LW. Cisplatin nephrotoxicity-cor-
relation with plasma platinum concentrations. Am J Clin On-
col 1985; 8: 77-80.
15. Delay-Yates PT, McBrien DCH. Cisplatin metabolites in pla-
sma, a study of their pharmacokinetics and importance in the
nephrotoxicity and antitumor activity of cisplatin. Biochem
Pharmacol 1984; 33: 3030-3070.
16. Hrushesky WJ, Shimp W, Kennedy BJ. Lack of age-dependent
cisplatin nephrotoxicity. Am J Med 1984; 76: 579-584.
17. Ozols RF, Corden B, Jacob J, et al. High-dose cisplatin in hy-
pertonic saline. Ann Intern Med 1984; l00: 19-24.
18. Devine SM, Vokes EE. Infusional cisplatin and carboplatin:
Recent clinical experience and a review. J Infus Chemother
1991; 1: 2836.
19. Pfeijle CE, Howell SB, Felthouse RD, et al. High-dose cispla-
tin with sodium thiosulfate protection. J Clin Oncol 1985; 3:
237-244.
20. Abe R, Akioyoshi T, Koba F, et al. Two-rout-chemotherapy
using intra-arterial cisplatin and intravenous sodium thiosulfa-
te, its neutralizing agent, for hepatic malignancies. Eur J Can-
cer Clin Oncol 1988; 24: 1671-1674.
21. Markman M, Clearly S, Howell SB. Nephrotoxicity of high-do-
se intracavitary cisplatin with thiosulfate protection. Eur J
Cancer Clin Oncol 1985; 21: 1015-1018.
22. Fountzilas G, Dombros N, Balaskas E, et al. Intraperitoneal
chemotherapy with high-dose cisplatin and 5-Fluorouracil in
patients with advanced ovarian carcinoma. Reg Cancer Treat
1989; 2: 203-209.
23. Castiglione F, Dalla Mola A, Porcile G. Protection of normal
tissues from radiation and cytotoxic therapy: the development
of amifostine. Tumori 1999 Mar-Apr; 85(2): 85-91.
24. Schuchter LM, Hensley ML, Meropol NJ, Winer EP. 2002 up-
date of recommendations for the use of chemotherapy and ra-
diotherapy protectants: Clinical practice guidelines of the A-
merican Society of Clinical Oncology. J Clin Oncol 2002 Jun
15; 20 (12): 2895-903.
OY
25. Heyman SN, Spokes K, Egorin MJ, Epstein FH. Glycine redu-
ces early renal parenchymal uptake of cisplatin. Kidney Int
1993 Jun; 43 (6): 1226-8.
26. Preiss R, Brovtsyn VK, Perevodchikova NF, et al. Effect of
methotrexate and the pharmacokinetics and renal excretion of
cisplatin. Eur J Clin Pharmacol 1988; 34: 139-144.
27. Goren MP, Wright RK, Horowitz ME, et al. Enhancement of
methotrexate nephrotoxicity after cisplatin therapy. Cancer
1986; 58: 2617-2621.
28. Goren MP, Wright RK, Pratt CB, et al. Potential of ifosfamide
neurotoxicity, hematoxicity and tubular nephrotoxicity by prior
CDDP therapy. Cancer Res 1987; 47: 1457-1460.
29. Canetta R, Goodlow J, Smaldone L, et al. Pharmacologic cha-
racteristics of carboplatin: Clinical experience. In: Bunn P Jr,
Canetta R, Ozols R, Rozencweig M. Carboplatine. New York:
W.B. Saunders, 1990: 19-38.
30. Stillwell TJ, Benson RC. Cyclophosphamide induced hemorr-
hagic cystitis. Cancer 1988; 61: 451-457.
31. Brock N, StekarJ, Pohl J, et al. Acrolein, the causative factor
of urotoxic side effects of cyclophosphamide, ifosfamide, tro-
phospharine and sufosfamide. Arzuein Forsch 1979; 29: 659-
661.
32. Bressler RB, Huston DP. Water intoxication following mode-
rate-dose intravenous cyclophosphamide. Arch Intern Med
1985; 145: 548-549.
33. Bode V, Seif SM, Lerine AS. Studies on the antidiuretic effect
of cyclophosphamide; Vasopressin release and sodium excre-
tion. Cancer 1988; 61: 451-457.
34. Klein FA, Smith MIV. Urinary complications of cyclophospha-
mide therapy. Etiology, prevention and management. South
Med J 1983; 76: 1413-1416.
35. Jerkins GR, Noe HN, Hill D. Treatment of complication of cy-
clophosphamide cystitis. J Urol 1988; 139: 923-925.
36. Mohiuddin J, Prentice HG, Scley S, et al. Treatment of cyclo-
phosphamide-induced cystitis with prostaglandin E2. Ann In-
tern Med 1984; 101: 142.
37. Brock N. Uromitexan (mesna)-concept and mode of action.
Beltrage zur Onkologie 1980; 5: 1-11.
38. Hows JM, Mehta A, Ward L, et al. Comparison of MESNA
with forced diuresis to prevent cyclophosphamide-induced he-
morrhagic cystitis in marrow transplantation: A prospective ran-
domized study. Br J Cancer 1984; 50: 753-756.
39. Shepherd JD, Pringle LE, Barnett MJ, et al. MESNA versus
hyperhydration for the prevention of cyclophosphamide-in-
duced hemorrhagic cystitis in bone marrow transplantation. J
Clin Oncol 1991; 9: 2016-2020.
40. Vela-Ojeda J, Tripp-Villanueva F, Sanchez-Cortes E, Ayal
Sanchez M, Garcia-Ruiz-Esparza MA, Rosas-Cabral A, Gon-
zalez-Laven J. Intravesical rhGM-CSF for the treatment of
late onset hemorrhagic cystitis after bone marrow transplan-
tation. Bone Marrow Transplant 1999 Dec; 24(12): 1307-10.
41. Finn G, Denning D. Transient nephrogenic diabetes insipidus
following high-dose cyclophosphamide chemotherapy and au-
tologous bone marrow transplantation. Cancer Treat Rep 1987;
71: 220-221.
42. Patterson WP, Knojasteh A. lfosfamide-induced renal tubular
VII.
defects. Cancer 1988; 63: 649-651.
43. Dubourg L, Michoudet C, Cochat P, Baveral G. Human kid-
ney tubules detoxify chloroacetaldehyde, a presumed nephro-
toxic metabolite of ifosfamide. J Am Soc Nephrol 2001 Aug;
12(8): 1615-23.
44. Goren MP, Wright PK, Horowitz ME, et al. lfosfamide-induc-
ed subclinical tubular nephrotoxicity despite mesna. Cancer
Treat Rep 1987; 71: 127-130.
45. Pratt CB, Meyer WH, Jenkins JJ, et al. lfosfamide Fanconis
syndrome and rickets. J Clin Oncol 1991; 9: 1495-1499.
46. Hande KR, Donehower RC, Chabuer BA. Pharmacology and
pharmacokinetics of high dose methotrexate in man. In: Clini-
cal pharmacology of Antineoplastic drugs. New York: HM Pi-
medo et Elserier/North Holland, 1978.
47. Abefson HT, Fosburg MT, Beardsfey GP, et al. Methotrexate
induced renal impairment: clinical studies and rescue from sy-
stemic toxicity with high-dose leucovorin and thymidine. J Clin
Oncol 1983; 3: 208-216.
48. Meyerowitz RL, Sartiano GP, Cavaff T. Nephrotoxic and cyto-
proliferative effects of streptozotocin. Cancer 1916; 38: 1550-
1555.
49. Sadoff L. Nephrotoxicity of streptozotocin (NSC 85998). Can-
cer chemother Rep 1970; 54: 457-459.
50. Tobin MV, Warenius HM, Morris AJ. Forced diuretics to re-
duce nephrotoxicity of streptozotocin in the treatment of ad-
vanced metastatic insulinoma. Br Med J 1987; 294: 1128, let-
ter.
51. Defaney V, de Petuz Y, Nixon D, et al. Indomethacin in stre-
ptozotocin-induced nephrogenic diabetes insipidus. Am J Kid-
ney Dis 1987; 9: 79-83.
52. Arbus M, Wooffey PV, Chiazze L, et al. Cancer assonated he-
molytic-uremic syndrome: Analysis of 85 cases from a national
registry. J Clin Oncol 1989; 7: 781-789.
53. Liu K, Mittefman A, Sprouf EE, et al. Renal toxicity in man
treated with mitomycin-C. Cancer 1971; 28: 1314-1320.
L-
,
- .
. O
, , . O
-D,
. -
() -
-
Gell Coombs (. 3).
- -
- ,
-
. 4 - .
O
. Gell
485
54. Price TM, Murgo AJ, Keveney JJ, et al. Renal failure and he-
molytic anemia associated mitomycin-C. Cancer 1985; 55: 51-
56.
55. Cutting HO. Inappropriate secretion of and diuretic hormone
secondary to vincristine therapy. Am J Med 1971; 51: 269-271.
56. Kramer RA, Boyd MR, Dees JH. Comparative nephrotoxicity
of MeCCNU and chlorozototicin Functional-Structural corre-
lations in the Fisher 344 rat. Toxicol Appl Pharmacol 1986; 82:
540-550.
57. Slavin RE, Dias MA, Saral R. Cytosine-arabinoside induced
gastrointestinal toxic alteration in sequential chemotherapeu-
tic protocols. A clinical pathological study of 33 patients. Can-
cer 1978; 42: 1747-1759.
58. Guleria AS, Yang JC, Topalian SL, Weber JS, Parkinson DR,
MacFarlane MP, White RL, Steinberg SM, White DE, Ein-
horn JH, et al. Renal disfunction associated with the admini-
stration of high-dose interleukin-2 in 199 consecutive patients
with metastatic melanoma or renal carcinoma. J Clin Oncol
1994 Dec; 12(12): 2714-22.
59. Selby P, Kohn J, Raymond J, Judson J, McElwain T. Nephro-
tic syndrome during treatment with interferone. Br Med J
(Clin Res Ed) 1985 Apr 20; 290(6476): 1180.
60. Yang H, Rosove MH, Figlin RA. Tumor lysis syndrome occur-
ring after the administration of rituximab in lymphoproliferati-
ve disorders: high grade non-Hodgkins lymphoma and chronic
lymphocytic leukemia. Am J Hematol 1999 Dec; 62(4): 247-50.
61. Presant CA, Denes AE, Klein L, et al. Phase I and preliminary
phase II observations of high-dose intermittent 6-Thioguanine.
Cancer Treat Rep 1980; 64: 1109-1113.
62. Perry MC, Hoagland HC, Wagoner RD. Uric acid nephropa-
thy. JAMA 1976; 236: 961-962.
63. Gelbart DR, Weinstein AB, Fajardo LF. Allopurinol induced
nephritis. Ann Intern Med 1977; 86: 197-198.
64. Cohen LFO, Balow JE, Magrath IT, et al. Acute tumor lysis
syndrome. Am J Med 1980; 68: 486-491.
58% 33%
1. /
10% -
.
. -
486 OY

3. Coombs Gell

I O, , , , IgE , ,
, , , , ,

II

III
-
V , , -

4. O -
- (axl), -
, 30% ,
1. L- 9.
12 ,
2. , 10. , (3%). O -
3. , Cremophor,
4. 11. 5- . O
5. 12.
6. - 13.
,
7. 14.
8. -
6, -
10 15
Coombs. 1
- . O -
, , , , -
, , , - . -
, , , - -
, . O ,
, 7. O -
- , . -
2. O -
gE . . -
IgG IgM - -
. Cremofor -
3,4. 10 .
Cremofor (-
- , , , , ),
- .
, 5. -
L-- ,
, scherichia Coli Erwinia chrysanthe- .
mia. - Cremofor
- .
scherichia Coli
Erwinia . - (Taxotere)
-
polysorbate 80.
.
VII. 487

. : , ,
20 mg p.., 12 6
, 1 ,
2 IV, 30 . - . -
: 20 mg IV, 30 14.
1 28,9. - 1027%
: 8 mg -
3 , 24 - .
. - .
- -
(capillary leak syndrome). -


, -
- . O -
. 10 ,
ellie et al , .
33% ,
I. III - . -
14% . - 313% 15. O -
, -
16. , -
, , ..17.
mg . O - ,
. - .

. , - -
- O
. - - (ra-C). ,
gE -
. . -
polysorbate (ween) 80 . O -
Cremophor , . , ,
, , . -
. gE . -
- -
11. - -
, .
60 - -
1 . - , , , , -
, - ( --
- ).
12. 18. -
,

- -.
, , -
. - 20%. --
- -
18%13. , . ,
-
. (hand-foot syndrome), -
488 OY

-. O - , , -
.
- IV .
, 5-FU, - (flare)
. - , ,
-. - -
19. - 22. ,
, -
. . -
- -
. .
- -
, ,
, -
23. O -
. -
.

. O V.
IgE .
. O -
20 . I
.
,
, , , - S (2-mercaptoethane sulpho-
-
nate).
.
IV -
, 5060% -
-
. - .
-
. - . 1% -
-
, -
, -
, (> 40C)
-
, -
-
,
.
24,25. -
, trimetrexate,
-
edatrexate pritrexim, -
26. -
I ,

,
. -
.
-
, , -
, . -
. -
. - -
- . ,
non ,
IgE 21.
. - .
VII. 489

1. . Stevens-Johnson . . Cetuximab.

, -
- , -
, . - . , -
(), - Stevens-Johnson
(, - (. 1) , -
). O - 1 13 -
- ,
-. O III30.
30 2 . O - 50.000/L,
, - -
27. .
Trastuzumab: 2040% - Gemtuzumab, Alemtu-
28. zumab Cetuximab (. 1)
, , , , - Rituximab -
- 31,32.
. -
, .
, - 24%
, - ,
. . -
Rituximab: (50%) - .
, -
, , , , , , .
. 10% - .
, - -
RDS, , -,
, 29. -
. .
- ,
, -
. .
,
B-. .
Rituximab , , -
. , -
490
IV
. -
( ). .
, -
, . , -
POH H
- 50 mg .
,
, . .
1. Dellinger CT, Miale TD. Comparison or anaphylactic rea-
ctions to asparaginase derived from Escherichia Coli and Er-
winia cultures. Cancer 1976; 38: 1843-1846.
2. Evans TE, Tsialis A, Rivera G, et al. Anaphylactoid reactions
to Escherichia Coli and Erwinia asparaginase in children with
leukemia and lymphoma. Cancer 1982; 49: 1378-1383.
3. Khan A, Hil JM. Atopic hypersensitivity to L-asparaginase re-
sistance to immunosuppresion. Int Arch Allergy 1971; 40: 463-
469.
4. Fabry U, Korholz D, Jurgens H, et al. Anaphylaxis to L-aspa-
raginase during treatment for acute lymphoblastic leukaemia
in children. Evidence of a complement-mediated mechanism.
Pediatr Res 1985; 19: 400-408.
5. Beard MEJ, Crowther D, Gallon AG, et al. L-asparaginase in
treatment of acute leukemia and lymphosarcoma. Br Med J
1970; 1: 191-195.
6. Weiss RB, Donehower RC, Wiemik PH, Ohnuma T, Gralla
RJ, Trump DL, Baker JR, Van Echo DA, Vin Hoff DD, Ley-
land-Jones B. Hypersensitivity reactions from Taxol. J Clin
Oncol 1990 Jul; 8(7): 1263-8.
7. Price KS, Castells MC. Taxol Reactions. Allergy Asthma Proc
2002 May-Jun; 23(3): 205-8.
8. Gennari A, Salvadori B, Tognoni A, Conte PF. Rapid intrave-
nous premedication with dexamethasone prevents hypersensi-
tivity reactions to paclitaxel. Ann Oncol 1996 Nov; 7(9): 978-9.
9. Kwon JS, Elit L, Finn M, Hirte H, Mazurka J, Moens F, Trim
K. A comparison of two prophylactic regimens for hypersensi-
tivity reactions to paclitaxel. Gynecol Oncol 2002 Mar; 84(3):
420-5.
10. Kellie SJ, Crist WM, Pui C-H, et al. Hypersensitivity reactions
to epipodophylotoxins in children with acute lymphoblastic
leukemia. Cancer 1991; 67: 1070-1075.
11. Eschalier A, Lavarenee J, Burtin C, Renoux M, Chapuy E,
Rodriguez M. Study of histamine release induced by acute ad-
ministration of antitumor agents in dogs. Cancer Chemother
Pharmacol 1988; 21(3): 246-50.
12. Tester WJ, Cohn JB, Fleekop PD, Rabinowitz MS, Lieberman
JS. Successful rechallenge to etoposide after an acute vasomo-
tor response. J Clin Oncol 1990 Sep; 8(9): 1660-1.
13. Eyre HJ, Quaglina JM, Eltringham JR, et al. Randomized
comparisons of radiotherapy and CCNU versus radiotherapy,
CCNU plus procarbazine for the treatment of malignant glio-
OY
20 mg 12 , 6
mas following surgery. A southwest Oncology Group report. J
Neurooncol 1983; 1: 171-177.
14. Wiess R. Hypersensitivity reactions. Seminars in Oncology
1992; 19 (5): 458-477.
15. Thomas RR, Quinn MG, Schuler B, Grem JL. Hypersensitivi-
ty and idiosyncratic reactions to oxaliplatin. Cancer 2003 May
1; 97(9): 2301-7.
16. Tournigand C, Maindrault-Goebel F, Louvet C, de Gramont
A, Krulik M. Severe anaphylactic reactions to oxaliplatin. Eur
J Cancer 1998 Jul; 34(8): 1297-8.
17. Brandi G, Pantaleo MA, Galli C, Falcone A, Antonuzzo A,
Mordenti P, Di Marco MC, Biasco G. Hypersensitivity rea-
ctions to oxaliplatin. Br J Cancer 2003 Aug 4; 89(3): 477-81.
18. Duane SR, Peterson BA, Hurd DD, et al. Cytarabine induced
hypotension. Proc Am Soc Clin Oncol 1984; 3: 98 (abstr).
19. Herzing RH, Wolj SN, Lazarus HM, et al. High-dose cytosine
arabinoside therapy for refractory leukemia. Blood 1983; 62:
361-369.
20. Sostman HD, Matthay RA, Puttman CE, et al. Methotrexate
induced pneumonitis. Medicine 1976; 55: 371-388.
21. Chanan-Khan A, Szebeni J, Savay S, liebes L, Rafique NM,
Alving CR, Muggia FM. Complement activation following
first exposure to pegylated liposomal doxorubicin: possible ro-
le in hypersensitivity reactions. Ann Oncol 2003 Sep; 14(9):
1430-7.
22. Vogelang NJ. Adriamycin flare. A skin reaction resembling
extravasation. Cancer Treat Rep 1979; 63: 2067-2069.
23. Krutchik AN, Budzar AV, Tashima CK. Cyclophosphamide
induced urticaria. Occurrence in a patient with no cross-sensi-
tivity to chlorambucil. Arch Intern Med 1978; 138: 1725-1726.
24. Carter JJ, McLaughlin ML, Bern MM. Bleomycin-induced fa-
tal hyperpyrexia. Am J Med 1983; 74: 523-525.
25. Ma DDF, sbister JP. Cytotoxic-induced fulminant hyperpyre-
xia. Cancer 1980; 45: 2249-2251.
26. Dinarello CA, Ward SB, Wolff SM. Pyrogenic properties of
bleomycin. Cancer chemotherapy Rep 1973; 57: 393-398.
27. Dillman RO, Hendrix CS. Unique aspects of supportive care
using monoclonal antibodies in cancer treatment. Support can-
cer Ther 2003; 1: 38.
28. Vogel CL, Cobleigh MA, Tripathy D, Gutheil JC, Harris LN,
Fehrenbacher L, Slamon DJ, Murphy M, Novotny WF, Burch-
more M, Shak S, Stewart SJ, Press M. Efficacy and safety of
VII. 491

trastuzumab as a single agent in first line treatment of HER2-
overexpressing metastatic breast cancer. J Clin Oncol 2002
Feb 1; 20(3): 719-26.
29. Plosker GL, Figgitt DP. Rituximab: a review of its use in non
Hodgkins lymphoma and chronic lymphocytic leukemia. Drugs
2003; 63(8): 803-43.
30. DArcy CA, Mannik M. Serum sickness secondary to treat-
ment with the murine-human chimeric antibody IDEC-C2B8
(rituximab). Arthritis Rheum 2001 Jul; 44(7): 1717-8.
31. Sievers EL, Larson RA, Stadtmauer EA, Estey E, Lowenberg
B, Dombret H, Karanes C, Theobald M, Bennet JM, Sherman
ML, Berger MS, Eten CB, Loken MR, van Dongen JJ, Bern-
stein ID, Appelbaum FR. Efficacy and safety of gemtuxumab
ozogamicin in patients with CD-33 positive acute myeloid leu-
kemia in first relapse. J Clin Oncol 2001 Jul 1; 19(13): 3244-54.
32. Keating MJ, Flinn , Jain V, Binet JL, Hillmen P, Byrd J, Albi-
tar M, Brettman L, Santabarbara P, Wacker B, Rai KR. The-
rapeutic role of alemtuzumab (Campath-lH) in patients who
failed fludarabine: results of a large international study. Blood
2002 May 15; 99(10): 3554-61.

OO OO , ,
, ,
. ,
- .
, , - 710
, , 1
- 2 .
(GVHD).
- , -
, , - , -
, , , .
. -
2,3.
I /4.
, , -
5. O . O
(. 2) - -
. -
- .
- 50%, -
. - -
5,6.
2% -

. 50 , -
- 7. -

5. -

CU




-
-D

2. IV

.
492 OY

. 6 -
, - .
, . -

E O EO Addison8.
- ( ) S
(. 3). C .
- . -
.
.
6.
-
, ,
-D, -

-
-D

. 5% 5-

-
(. 4).

, -

. -

3. - 4. 5-
. .
VII. 493

5. - 6. .
.

, -
, 11. , -
. -
. 11. -
, - ,
, 5-, , , - . -
, , , -
, , - .
- (- -
), , -
. - (. 6). -
, , - . O -
ees, uehrcke,
(. 5). . -
- .
, -
A OOI
- O -
. ima- : 1. -
tinib , 2. , 3. , 4.
9. - .
, -
-
. -
.
OY -
- , -
- -
12.
10 . 7 8.
, ,
- -
10. O Beau - -

494 OY

.
7. -
-

13. 8
-D
.


-
.
, -
. , -
, 6- -
8. - -
14. -
.

-D I O

-
-

6%.
,
, -
, . O
, -
, , -
,
(. 8). O

, ,
, -
, -
-
. -
-
7. -
. , CU .

. ,
, -
.
(. 7)

. -
,

,
,
, .
-
,
, -
. - 8. -
, , , - .
VII. 495

-
9.
-
,
11 . -

-


,
-D DMSO - -
. -
,
. O -
, ,
, -, , -
Q, , ,
-15-19.
, -

-
.
, -

DSO --

, ,
9. -
-D, CU20. -
. -
21.
, , -

9.
- -
,
710 - ,
, , , - . -
( ). -
23 - 24 -
. - . -
. 10 mg (IV, )
, - ,
. - -
, - . -
- ,
. - GM-CSF -
.
, - dexrazoxane (1.000 mg , 1.000 mg
(. 9). 500 mg )23. -
DMSO24 -
M 14 -
, -
. - . -
, -
D 18.
. -
496 OY

10. Hickman.

19 (300
IV 2 ml )
,
25.
(15 , 15 -
, 24 ). -
-
, ,
23.
-
,
23 -
,
11.
. O .

.
), -, (-
- ) (. 11).
, - , -
, - , -
. -
,
. - (desquamation).
. , - , ( -
Hickman (. 10) - ) ,
. - 26. --
- -
. ,
,
. 27. O
. -
. ,
, -
YOO -O (35%) -
- GVHD.
(60%), ( - 35 . -
VII. 497

- 11. -
.
,

- . -

-
, - -
.
28.

OI

29,30 -
-
(UV) (. 10). O . -
.
UV
OOH I
tegafur -

31.
,
32. O - . -
--
, , - , -
. 33 (. 11). O 2 -
- -
. - . -
. - , -
- .
UV . - .
, 2 ,
. - 34.
.
O - -
. .
. - -
- - 35.
. -
2 5 - (O) -
UV , ().
O -
10.
36.

.

O A
5- L-2
Tegafur .
-D
-

1 3 -
2 37.
IFN- , -
. -


498 OY

12.

- Stevens-Johnson
/ TEN

Tegafur -D






-

38. , Imatinib me-

sylate, gefinitib cetuximab - 40.
, - -
- ,
39, - -
. - (. 12).

1. Crounse RCr, Van Scott EJ. Changes in scalp hair roots as a
measure of toxicity from cancer chemotherapeutic drugs. J In-
vest Dermatol 1960; 35: 83-90.
2. Ganci L, Servon B. Changes in hair pigmentation associated
with cancer chemotherapy. Cancer Treat Rep 1980; 64: 103.
3. Lonveiro C, Gill PS, Ravick M, et al. Red hair and hypepig-
mentation in a black man after chemotherapy. J Clin Oncol
1987; 5: 1705-1706.
4. Dean JC, Salmon SE, Griffith KS. Prevention of doxorubicin-
induced hair loss with scalp hypothermia. N Engl J Med 1979;
301: 1427-1429.
5. Baker B, Wilson C, Davis A, et al. Busulfanlcyclophoshamide
conditioning for bone marrow transplantation may lead to fai-
lure of hair regrowth. Bone marrow transplant 1991; 7-437.
6. Witman G, Cadman E, Chen M. Misuse of scalp hypothermia.
Cancer Treat Rep 1981; 65: 507-508.
7. Duvic M, Lemak N, Valero V, et al. A randomized trial of mi-
noxidil in chemotherapy induced alopecia. J Am Acad Derma-
tol 1996; 35; 74 8.
8. Harrold BP. Syndrome resembling Addisons disease follow-
ing prolonged treatment with busulfan. Br Med J 1966; 1: 463-
464.
9. Tsao AS, Kantarjan H, Cortes J, OBrien S, Talpaz M. Imati-
nib mesylate causes hypopigmentation in the skin. Cancer 2003
Dec 1; 98(11): 2483-7.
10. James WD, Odom RB. Chemotherapy-induced transverse
white lines in the fingernails. Arch Dermatol 1983; 119: 334-
335.
11. Singh M, Kaur S. Chemotherapy-induced multiple Beans li-
nes. Int J Dermatol 1986; 25: 590-591.
12. Phillips TL, Fu KF. Acute and late effects of multimodal the-
rapy on normal tissues. Cancer 1977; 40: 489-494.
13. DAnglo GJ, Farber S, Maddock CL. Potentiation of x-ray ef-
fect by actinomycin D. Radiology 1959; 73: 175-177.
14. Falkson G, Shulz EJ. Skin changes in patients treated with 5-
fluorouracil. Br J Dermatol 1962; 74: 229-236.
15. Garnick M, Israel M, Khetarpaf V, Luce J. Persistance of an-
thracyclines levels following dermal and subcutaneous adria-
mycin extravasation. Proc Am Assoc Cancer Res 1981; 22: 173.
16. Okano T, Ohnuma T, Efremidis A, Holland JF. Doxorubicin-
induced skin ulcer in the piglet. Cancer Treat Rep 1983; 67:
1075-1078.
17. Desai MH, Teres D. Prevention of doxorubicin-induced skin
ulcers in the rat and pig, with dimethyl sulfoxide CDMSO.
Cancer Treat Rep 1982; 66: 1371-1374.
18. Svingen BA, Powis G, Appel PL, Scott M. Protection against
adriamycin-induced skin necrosis in the rat by dimethyl sulfo-
xide and a-tocoferol. Cancer Res 1981; 41: 3395-3399.
19. Dorr RT, Alberts DS, Stone A. Cold protection and heat en-
hancement of doxorubicin skin toxicity in the mouse. Cancer
Treat Rep 1985; 69: 341-347.
20. Harwood KY, Bachur N. Evaluation of dimethyl sulfoxide and
local cooling as antidotes for doxorubicin extravasation in a
pig model. Oncol Nurs Forum 1987; 14: 39-44.
21. Rentschler R, Wilbur D. Pyridoxine a potential local antidote
for mitomycin-C extravasation. J Surg Oncol 1988; 37: 269-271.
VII. 499

22. Shamseddine AI, Khalil AM, Kibbi AG, et al. Granulocyte
macrophage-colony stimulating factor for treatment of chemo-
therapy extravasation. Eur J Gynecol Oncol 1998; 19: 47981.
23. Langer SW, Sehesed M, Jensen PB, Buter J, Giaccone G. Dex-
razoxane in anthracycline extravasation. J Clin Oncol 2000 Aug;
18(16): 3004.
24. Parashos PS. A rational approach for the management of tissue
extravasation due to antineoplastic drugs. Micro Link 1986; 2:
13-15.
25. Dorr RT. Antidotes to vesicant chemotherapy extravasations.
Blood Rev 1990; 4: 41-60.
26. Dem. Ircay Z, Gurbuz O, Alpdogan T, et al. Chemotherapy in-
duced acral erythema in leukemic patients: a report of 15 ca-
ses. Int J Dermatol 1997; 36: 5938.
27. Hellier I, Bessis D, Sotto A, at al. High-dose methotrexate in-
duced bullous variant of acral erythema. Arch Dermatol 1996;
132: 590 1.
28. Vukelja SJ, Baker WJ, Burris HA, et al. Pyridoxine therapy for
palmar-plantar erythrodysesthesia associated with taxotere. J
Nation Cancer Inst 1993; 85: 1432.
29. Alley E, Green R, Schuchter L. Cutaneous toxicities of cancer
therapy. Curr Opin Oncol 2002 Mar; (1492): 212-6.
30. De Spain JD. Dermatologic toxicity of chemotherapy. Semin
Oncol 1992 Oct; 19(50): 501-7.
31. Fujimoto M, Kikuchi K, Imakado S, Furue M. Photosensitivity
dermatitis induced by flutamide. Br J Dermatol 1996 Sep; 135
(3): 496-7.
32. Guzzo C, Kaidby K. Reccurent recall of sunburn by methotre-
xate. Photodermatol Photoimmunol Photomed 1995 Apr; 11
(2): 55-6.
33. Margolis DJ, Gross PR. Neutrophilic eccrine hidradenitis: a
case report and a review of the literature. Cutis 1991 Sep; 48
(3): 198-200.
34. Bernstein EF, Spielvogel RL, Topolsky DL. Reccurent neutro-
philic hidradenitis. Br Dermatol 1992 Nov; 127(5): 529-33.
35. Brehler R, Reimann S, Bonsmann G, Metze D. Neutrophilic
hidradenitis induced by chemotherapy involves eccrine and a-
pocrine glands. Am J Dermatopathol 1997; 19: 73-78.
36. Hurt MA, Halvorson RD, Petr FC Jr, et al. Eccrine squamous
syringometaplasia. A cutaneous sweat gland reaction in the hi-
stologic spectrum of chemotherapy associated eccrine hidrade-
nitis and neutrophilic eccrine hidradenitis. Arch Dermatol 1990;
126: 73-7.
37. Wolkenstein P, Chosidow O, Wechler J, et al. Cutaneous side
effects associated with IL2 administration for metastatic mela-
noma. J Am Acad Dermatol 1993; 28: 66-70.
38. Gooptu C, Littlewood TJ, Frith P, et al. Paraneoplastic pem-
phigus. An association with fludarabine? Br J Dermatol 2001;
144: 1255-6.
39. Brouard M, Saurat JH. Cutaneus reactions to STI 571 (letter).
N Eng J Med 2001; 345: 618-9.
40. Bunn PA Jr, Franklin W. Epidermal growth factor receptor ex-
pression, signal pathway, and inhibitors in non small cell lung
cancer. Semi Oncol 2002 Oct; 29 (5 Suppl 140): 38-4.

OO OO RAYNAUD
-
1977.
1. 40% -
- , -
, PV (, , )2,3,4.
, . O -
,

, . -
-
, -
, -
, . -
. -
-

.
, -
- 10
. 18 , ,
. -
, - .
- Raynaud -
- .
. O - -
, , -
(. 13). .
500 OY

OOH OO O O
13. -
1973.
, -
Raynaud
Budd-Chiari. -

-
,
CNU Budd-Chiari
. 21%


-
7 40%
.

(O)


5% 50%
CNU 8,9.
, DTIC, -,
, , ,
-
5-
CMF
VD -
Hodgkin, -
11.
(-
), -
L-

(95%), (50%) (20%). -
,
( )
CMF: , , 5-
PEB: , , .
, -
13, -
, C14, -
(-)15,.
- ,
. O - , .. -
-
. - III. -
VIII
. O , -
,
- -
Raynaud, . GVHD,
- , -
. - 12.
, - -
- -
. - . O
. - -
- .
- O
5,6. 50% .

.
VII. 501

. - (DIC).
12, , -
(V, HCV), (- -
), (, ,
B, ), , -
( .
),
, DLCO . -
- .
-
15, - -
, 16 - 24.
17. - -
. -
, -
18.
O - .
19 Defibrotide20. -
on Willebrand. -
VOD, - , -
. .
VOD
. Defibro- OH OOH OO
tide
, -
- 25. O
. 26. -
, 1, (-
, ) S. 215 . -
, -
750%12,21. - . RDS,
, , -
. .
-
OH OOA . -
10%. -
4 12 . 50%
, . T
. - , -
. - -
.
, PV . -
O 27.
-
. O - ,
, - -
, (BCNU),
, , - . O
, , -
, , , - .
23. -
502 OY

, , OO
. -

EI I A
29. -
I
.
(adjuvant) -
, , , - ,
, - 30,31. O
, - -
Raynaud28. .
, Hodgkin,
, ,
.
. , L-, ,
, , .
- -
. 7 . -
-
PV, 1 - .
. 100 32 -
- 28%.
. O - C33.

Raynaud, , CMF
. C S
VIII , -
, L-
. III.

1. Doll DC, Ringenberg QS, Yarbo JW. Vascular toxicity asso-
ciated with antineoplastic agents. J Clin Oncol 1985; 4: 1405-
1417.
2. Vogelzang NJ, Bosl GJ, Johnson K, et al. Raynauds phenom-
enon. A common toxicity after combination chemotherapy for
testicular cancer. Ann Intern Med 1981; 95: 288-292.
3. Fossa SD, Aass N, Kaalhus Q, et al. Long-term survival and
morbidity in patients with metastatic malignant germ cell tu-
mors treated with cisplatin-based combinantion chemothera-
py. Cancer 1986; 58: 2600-2605.
4. Hansen SW, Olsen N. Raynauds phenomenon in patients
treated with cisplatin, vinblastine and bleomycin for germ cell
cancer. Measurement of vasoconstirictor response to cold. J
Clin Oncol 1989; 7: 940-942.
5. Malamet R, Wise RA, Ettinger WH, et al. Nifedipine in the
treatment of Raynauds phenomenon. Evidence for inhibition
of platelet activation. Am J Med 1985; 78: 602-608.
6. Hantel A, Rowinsky EK, Donehower RL. Nifedipine and on-
cologic Raynauds phenomenon. Ann Intern Med 1988; 108:
767 (Letter).
7. Lazarus HM, Gottfried MR, Herzing RH, et al. Veno-occlusi-
ve disease of the liver after high dose mitomycin C therapy
and autologous bone marrow transplantation. Cancer 1982; 49:
1789-1795.
8. Ayash LJ, Hunt M, Antman K, Eder JP, et al. Hepatic veno-
occlusive disease in autologous bone marrow transplantation
of solid tumors and lymphomas. J Clin Oncol 1990 Od: 8(10):
1699-706.
9. McDonald GB, Hinds MS, Clift RA, et al. Veno-occlusive di-
sease of the liver and multiorgan failure after bone marrow
transplantation: a cohort study of 355 patients. Ann Intern
Med Feb 15; 118(4): 255-67.
10. Houghton AN, Shafi N, Rickles FR. Acute hepatic vein throm-
bosis during therapy for Hodgkins disease: a case report. Ca-
ncer 1979 Dec; 44(6): 2324-9.
11. Shulman HM, McDonald GB, Mattheus D, et al. An analysis
of hepatic veno-occlusive disease and centrilobular hepatic de-
generation following bone marrow transplantation. Gastroen-
terology 1980; 79: 1178-1191.
12. McDonald GB, Sharma P, Matthews DE, et al. Veno-occlusi-
ve disease of the liver after bone marrow transplantation: Dia-
gnosis, incidence, and predisposing factors. Hepatology 1984;
4: 116-122.
13. Heikiheimo M, Halila R, Fasth A. Serum procollagen type II
VII.
is an early and sensitive marker for veno-occlusive disease of
the liver in children undergoing bone marrow transplantation.
Blood 1994 May 15; 83(10): 3036-40.
14. Tabbara IA, Ghazal CD, Ghazal HH. Early drop in protein C
and antithrombin III is a predictor for the development of ve-
no-occlusive disease in patients undergoing hematopoietic stem
cell transplantation. J Hematother 1996 Feb; 5(1): 79-84.
15a. Lee JH, Lee KH, Kim S, Lee JS, et al. Plasminogen activator
inhibitor-I is an independed diagnostic marker as well as seve-
rity predictor of hepatic veno-occlusive disease after allogeneic
bone marrow transplantation in adults conditioned with busul-
fan and cyclophosphamide. Br J Haematol 2002 Sep; 118(4):
1087-94.
15b. Attal M, Huguet F, Rubie H, Huynh A, Charlet JP, Payen JL,
Voigt JJ, Brousset P, Selves J, Muller C, et al. Prevention of
veno-occlusive disease after bone marrow transplantation by
continuous infusion of low dose heparin: a prospective rando-
mized trial. Blood 1992 Jun 1; 79(11): 2834-40.
16. Essell JH, Schroeder MT, Harman GS, Thompson JM, et al.
Ursodiol prophylaxis against hepatic complications of alloge-
neic bone marrow transplantation. A randomized, double-blind,
placebo-controlled trial. Ann Intern Med 1998 Jun 15; 128(12
Ptl): 975-81.
17. Goringe AP, Brown S, OCallaghan U, Rees J, Jebb S, Elia M,
Poynton CH. Glutamine and Vit E in the treatment of hepatic
veno-occlusive disease following high-dose chemotherapy. Bo-
ne Marrow Transplant 1998 Apr; 21(8): 829-32.
18. Fisher DC, Vredenburgh JJ, Petros Wp, Hussein A, Berry DA,
Elkodry M, Rubin P, Gilbert CJ, Peters WP. Reduced mortali-
ty following bone marrow transplantation for breast cancer
with addition of peripheral blood progenitor cells is due to a
marked reduction in veno-occlusive disease of the liver. Bone
Marrow Transplant 1998 Jan; 21(2): 117-22.
19. Hagglund H, Ringden O, Ericzon BG, et al. Treatment of
hepatic veno-occlusive disease with recombinant human tissue
plasminogen activator or orthotopic liver transplantation. Trans-
plantation 1996; 62: 1076-1080.
20. Chopra R, Eaton JD, Grassi A, Potter M, Shaw B, Salat C, Fi-
nazzi G, Lacobelli M, Bowyer K, Prentice HG, Barbui T. Defi-
brotide for the treatment of veno-occlusive disease: results of
the European compassionate-use study. Br J Haematol 2000
Dec; 111(4): 1122-9.
OOO O O- .
O O
-
14. -
,
, . 1.
- 2.
, - 4.
, , 5.
, , 6.
, -
503
21. Beschomer WE, Pino J, Boitnott JK, et al. Pathology of the li-
ver with bone marrow transplantation: Effects of busulfan, car-
mustine acute graft-versus-host disease and cytomegalovirus in-
fection. Am J Pathol 1980; 99: 369-386.
22. Gulati SC, Sordillo P, Kempin S, et al. Microangiopathic he-
molytic anemia observed after treatment of epidermoid carci-
noma with mitomycin C and 5-fluorouracil. Cancer 1980; 45:
2252-2257.
23. Lesesne JB, Rothschild N, Erickson B, et al. Cancer associated
hemolytic uremic syndrome. Analysis of 85 cases from a Natio-
nal Registry. J Clin Oncol 1989; 7: 781-789.
24. Hanna Wr, Krauss S, Regester RF, et al. Renal disease after
mitomycin C-therapy. Cancer 1981; 48: 2583-2588.
25. Wagevoorr CA. Pulmonary veno-occlusive disease. Entity or
syndrome. Chest 1976; 69: 82-86.
26. Rose AG. Pulmonary veno-occlusive disease due to bleomycin
therapy for lymphoma. S Afr Med 1983; 64: 636-638.
27. Waldhorn RE, Tson E, Smith EP, et al. Pulmonary veno-oc-
clusive disease associated with microangiopathic hemolytic a-
nemia and chemotherapy of gastric adenocarcinoma. Med Pe-
diatr Oncol 1984; 12: 394-396.
28. Doll DC, List AF, Greco FA, et al. Acute arterial ischemic e-
vents following cisplatin-base combination chemotherapy for
germ cell tumors of the testis. Ann Inter Med 1986; 105: 48-51.
29. Sack GH, Levin J, Bell WR. Trousseaus syndrome and other
manifestations of chronic disseminated coagulopathy in pa-
tients with neoplasms: Clinical, pathophysiologic and thera-
peutic features. Medicine 1977; 56: 1-37.
30. Saphner T, Tormey DC, Grap R. Venons and arterial throm-
bosis in patients who received adjuvant therapy for breast can-
cer. J Clin Oncol 1991; 9: 286-294.
31. Fisher B, Redmond C, Wickerham DL, et al. Doxorubicin-
containing regimens for the treatment of stage II breast can-
cer. J Clin Oncol 1989; 7: 575-582.
32. Zangan M, Anaissie E, Barlogie B, et al. Increased risk of
deep-vein thrombosis in patients with multiple myeloma re-
ceiving thalidomide and chemotherapy. Blood 2001; 98: 1614-5.
33. Zangari M, Saghafifar F, Anaissie E, et al. Activated protein C
resistance in the absence of factor V Leiden mutation is a com-
mon finding in multiple myeloma and is associated with an in-
creased risk of thrombotic complications. Blood Coagul Fibri-
nolysis 2002; 13: 187-92.
3.
7.
504 OY

15.

+ + +/
+/ +
+/
+ +
- +/
-D +/
+ + + +
+ + + +
+ +
+
+/
+/ +
+
+
+
+ +
+
+ +

1%3. -
. - .

- -
. -
.
- Q , -
(. 14) - ( ) -
- .
(. 15). -

O OOO ( )4, -
()5, (-
)6,
(, , )7
( ), ( S-T, ,
, , - -
. - 8-10).

- -
- .
1,2. O , ( ), -
, , ( -
- ), -
. - . , 11 (opreleukin),
, - -
- ,
. - ,
.
VII. 505

-
- 2%28. -
. , -
, , - , -
11. - .
- 5 -
. - . 134
Robben et
, al29 33 -
.
123 - 5 -
, - .
80160 mg/m2. - -
-
- 90%. O
12. .
,
12. 30. -
O -
- Prinzmental28,31. -
, Ca++,
(90120 mg/kg).
, 27,32.
( 69 716 - -
13,14). -
-, .
-D
,
-
15-17.
- ,
- .
, . , -
- -
. - .
- -2
- , 33. -
. (
)
-
, -
- . -
. , , .
- -
, - -
18-20, 21-23, - ,
24,25, 26,21 . -
.
(4,5%),
( 3060). -
. -
506 OY

, CNU , -
, -
-2 (IL-2). , -
> 240 mg/m2, -
41,42.
-
35. E
- 1. : -
- -
, 43.
. - 2. : -
, -
2O2 O, -
, 44,45. -
, -
36-38.
- -
(bound) . - 46.
3. : (< 4 > 70
-. - ) -
- .
. - ,
, -
(.. -) in vitro - , ..47,
. .
4. :
- -
,
- 8-51. -
- , 4.000 ,
, 40. , -
- , -
(.. -
), , -

. - , 34 51-
53.
.
-
-
- .
. - -
2496 54. -
41. ,
. O , -
-
(myofibrillar), 55. -
(sarcotubular dilation) 24 -
, - , -
. - 200300 mg/m2
- . 48-
(crestolisis) , - 96
. O 600800 mg/m2 8001.000
VII. 507

mg/m2 -
, ) .
450 mg/m2 3
56. -
6. : - -
-
- .
43,44. -
- -
26%63.
-

57. O
7. : -
, - : -
, -
58. (450 mg/
- m2) -
- . O
53,58,59. -
, - :
1. -
, -
60,61. -
, -


. -

12% 50% -
- .
. ,
- ,
< 450 mg/m2, - ..,
7% 550 mg/m2, 15% . -
600 mg/m2 3040% 700 mg/m2(43). - ,

1,5% 600 mg/m2 12% , 53% 75%.
1.000 mg/m2. - -
12 , 89%, -
- 41% -
62. - 64.
, , - -
, - -
, - -
. - 65-67. 55
- , -
, , - > 15%
. - 45%.
- 59.
- 2. .
. (
-
508 OY

16.
-

450500 mg/m2 -
0 O 500600 mg/m2.
1 < 5% -
1,5 515% ,
2 1625% -
2,5 2635%

,
3 > 35% -
.
Billingham

150 mg/m2.
2. . -
- , 96
. - .
O rti et al -
, - ,
< 0,2%68. - (
, )
, - 168 mg/m2 -
- , 3
(. 16). 70.
Billingham - 3. .
, -
- , -
.
. - ) .
-
- .
> 240 mg/m2 42. - ,
, 1.100 mg/m2 (74).
-
-
450 mg/m2 0,6. -
50%69,70.
3. . O - 550 mg/m2 -
900 mg/m2 70-80.
. O - ) .
- ,
71. - -
- 81.
72,73. ) .
stealth -
-
. 75.
- K
-
1. . , -
(..
. )82. -
VII. 509

-
, - (dexra-
zoxane) . O
. , - , -
- ,
, ,
. - -
dexrazoxane cardiozoxane (bispipera- 88.
zinedione ICFR-187)83 -
83 -
. dexrazoxane -
(ADR-925)76, 89.
D, , -
, -
77 ( 160 mg/m2. -
1:5, 160 mg/m2
800 mg/m2 . -
). 150 -
5
, 160. mg -
(CAF), -
cardiozoxane (1.000 mg/m2 30 min - 100 mg/m2.
).
,
. -
3% - . -
27% -

CAF 84. - , -
-
, .
85
- , -
. 2002 .
O - 90,91.
dexrazoxane -
, - -D C -
86. . -
dexrazoxane O -

, - .
87.

OO
(O )
-
.
- -
. , -
92.
. O -
-
510 OY

- 5-
- -
100144 mg/kg. . -
,
. - 100. -
,
2 94. O
- Prinzmental.
. - -
- -
. - .
- 5-FU -
, 12,5% -
- . -
, - -
. , - ,
, -
- 318 .
- 1,6%
. 101.
-
4,5%, -
IV xo
. -
, -
. , , , -
- 102. O -
, 95. - ()
-
. - -
5 mg/m2 -
103.
.
-
96,97.
.
-
.

- , -
98.
-
, - 104.
, S- ,
, -
. O - -
- , -
. - .
99. -
. 105.
VII. 511

, 110.
rastuzumab -
, ,
, .
- -
, , rastuzumab 2% 7%110.
106. -
rastuzumab
29% , - ,
5%. - 111.
, -
rastuzumab -
. -
. (COG trial 2198). O -
- -
. . O
, - R2/neu
- . R2/neu
-
107. , -
112. -
rastuzumab (Herceptin) rastuzumab -
rastuzumab - -
, - 113,114. -
- , -
(LVEF)108,109. O -
, - 114.

1. Praga C, Beretta B, Bigo PL, et al. Adriamycin cardiotoxicity.
A survey of 1273 patients. Cancer Treat Rep 1979; 63: 821-
834.
2. Dindogru A, Barcos M, Henderson ES, et al. Electrocardio-
graphic changes following Adriamycin treatment. Med Pediatr
Oncol 1978; 5: 65-71.
3. Weiss RB, Grillo-Lopez AJ, Marsoni S, et al. Amsacrine-asso-
ciated cardiotoxicity. An analysis of 82 cases. J Clin Oncol
1986; 4: 918-928.
4. Dodd HJ, Tatnall FM, Sarkany I. Fast atrial fibrillation in-
duced by treatment of psoriasis with azathioprine. Br Med J
1985; 291: 706.
5. Gasser AB, Tiech M, Brunner KW. Neurologic and cardiac to-
xicity following IV application of methotrexate. Cancer Treat
Rep 1982; 66: 1561-1562.
6. Hartmann DW, Robinson WA, Mangauk A, et al. Unantici-
pated side effects from treatment with high-dose mechloretha-
mine in patients with malignant melanoma. Cancer Treat Rep
1981; 65: 327-382.
7. Buckner CD, Rudolph FH, Fefer A, et al. High-dose cyclo-
phosphamide therapy for malignant disease. Toxicity, tumor
response, and the effects of stored autologous marrow. Cancer
1972; 29: 357-365.
8. Talley RS, OBryan RM, Gutterman JA, Brownlee RW,
McCredie KB. Clinical evaluation of toxic effects of cis-diam-
minedichlor oplatinum (NSC-119875). Phase I clinical study.
Cancer Chemother Rep 1973; 57: 465-471.
9. Hashini LA, Khalyl MF, Salem PA. Supraventricular tachycar-
dia. A probable complication of platinum treatment. Oncology
1984; 41: 174-175.
10. Cannobbio L, Fassio T, Gasparini G, et al. Cardiac arrhyth-
mia: possible complication from treatment with cisplatin. Tu-
mori 1986; 72: 201-204.
11. Posner MR, Cohen GI, Skarin AT. Pericardial disease in pa-
tients with cancer. Am J Med 1981; 71: 407-413.
12. Harrison DT, Sanders LA. Pericarditis in case of early dauno-
rubicin cardiomyopathy. Ann Intern Med 1976; 85: 339-340.
13. Appelbaum F, Strauchen JA, Graw RG, et al. Acute lethal
carditis caused by high-dose combination chemotherapy. A u-
nique clinical and pathological entity. Lancet 1976; 1: 58-62.
14. Trigg ME, Finlay JL, Bozdech M, et al. Fatal cardiac toxicity
in bone marrow transplant patients receiving cytosine arabino-
side, cyclophosphamide and total body irradiation. Cancer 1987;
59: 38-42.
15. Ahmed M, Slayton RE. Report on drug induced pericarditis.
Cancer Treat Rep 1980; 64: 353-355.
512
16. Corder MP, Flanney EP. Possible radiation pericarditis preci-
pitated by actinomycin-D. Oncology 1974; 30: 81-84.
17. Vaickus L, Letendre L. Pericarditis induced by high-dose cyta-
rabine therapy. Arch Intern Med 1984; 144: 1868-1869.
18. Dent RG, McColl I. 5-fluorouracil and angina. Lancet 1975; 1:
347-348.
19. Monk MR, Sanchez JD, Phelps CD, et al. Myocardial ischemia
with fluorouracil and floxuridine therapy. Clin Pharm 1987; 6:
659-671.
20. Burger AJ, Mannino S. 5-fluorouracil-induced coronary vaso-
spasm. Am Heart 1987; 114: 433-436.
21. Mander EM, Lewinski U, Djaldetti M. Vinadistine-induced
myocardial infraction. Cancer 1975; 36: 1979-1982.
22. Somers G, Abramov M, Wittek M, et al. Myocardial infra-
ction: a complication of vincristine treatment. Lancet 1976; 2:
680.
23. Lejonc JL, Vemant JP, Mcquin I, et al. Myocardial infraction
following vinblastine treatment. Lancet 1980; 2: 692.
24. Ricci JA, Goldstein L. Coronary artery disease in the presence
of bleomycin therapy. Cancer Treat Rep 1982; 66: 410.
25. Vogelzang NJ, Frenning DH, Kennedy BJ. Coronary artery di-
sease after treatment with bleomycin and vinblastine. Cancer
Treat Rep 1980; 64: 1159-1160.
26. Ippoliti G, Casirola G, Marini G, et al. Daunorubicin cardioto-
xicity. Lancet 1976; 1: 430.
27. Mancuso L, Marchi S, Canonico A. Dynamic left ventricular
outflow obstruction and myocardial infraction following doxo-
rubicin administration in a woman affected by unsuspected hy-
pertrophic cardiomyopathy. Cancer Treat Rep 1985; 69: 241-
244.
28. Labianca R, Beretta G, Clerisi M, Fraschin P, Luporini G.
Cardiac toxicity of 5-fluorouracil: a study of 1083 patients. Tu-
mori 1982; 68: 505-510.
29. Robben NC, Pippas AW, Moore JO. The syndrome of 5-fluo-
rouracil cardiotoxicity. An elusive cardiopathy. Cancer 1993;
71: 493-509.
30. Liss RH, Chadwick M. Correlation of 5-FU (NSC-l9893) dis-
tribution in rodents with toxicity and chemotherapy in man.
Cancer Chemother Rep 1974; 58: 77.
31. Eskilsson J, Albertsson M, Mercke C. Adverse cardiac effects
during induction chemotherapy treatment with cisplatin and 5-
fluorouracil. Radiother Oncol 1988; 13: 41-46.
32. Freeman NJ, Costanza ME. 5-fluorouracil associated cardioto-
xicity. Cancer 1988; 61: 36-45.
33. Lee RE, Lotze MT, Skibber JM, et al. Cardiorespiratory ef-
fects of immunotherapy with interleukin-2. J Clin Oncol 1989;
7: 7.
34. Legha SS, Keaing M, Picket S, Ajari JA, Ewer M, Bodey GP.
Phase I clinical investigation of hormoharringtonine. Cancer
Treat Rep 1984; 68: 1085-1091.
35. Unverferth DW, Magorien RD, Leier C, et al. Doxorubicin
cardiotherapy. Cancer Treat Rev 1982; 9: 149-164.
36. Meyers CE, Liss RH, lfrim J, et al. The role of lipid peroxida-
tion on cardiac toxicity and tumor response. Science 1977; 197:
165-167.
37. Doroshow JH, Locker GY, Myers CE. Enzymatic defense of
OY
the mouse heart against reactive oxygen metabolites: Altera-
tions produced by doxorubicin. J Clin Invest 1980; 65: 128-135.
38. Myers C, Gianni L, Zwier J, et al. Role of iron in Adriamycin
biochemistry. Fed Proceeding 1986; 45: 2792-2797.
39. Herman EH, Ferrans VJ. Amelioration of chronic anthracycli-
ne cardiotoxicity by ICRF-187 and other compounds. Cancer
Treat Rev 1987; 14: 225-229.
40. Revis NW, Marusic N. Glutathione Peroxidase activity and se-
lenium concentration in the hearts of doxorubicin-treated rab-
bits. J Mol Cell Cardiol 1978; 10: 945-951.
41. Billinghman ME, Mason JW, Bristow MR, et al. Anthracycline
cardiomyopathy monitored by morphologic changes. Cancer
Treat Rep 1978; 62: 865-872.
42. Billingham ME, Bristow MR. Evaluation of anthracycline car-
diotoxicity. Predictive ability and functional correlation of en-
domyocardial biopsy. Cancer Treat Symp 1984; 3: 71-76.
43. Von Hoff DD, Layard MW, Basa P, et al. Risk factors for do-
xorubicin-induced congestive heart failure. Ann Intern Med
1979; 91: 710-717.
44. Minow RA, Benjamin RS, Gottlieb JA. Adriamycin (NSC-
123127) cardiomyopathy. An overview with determination of
risk factors. Cancer Treat Rep 1975; 6: 195-201.
45. Bristow MR, Thompson PD, Martin RP, et al. Early anthracy-
cline cardiotoxicity. Am J Med 1978; 65: 823-832.
46. Billingham ME, Bristow MR, Glatstein E, et al. Adriamycin
cardiotoxicity: Endomyocardial biopsy evidence of enhance-
ment by irradiation. Am J Surg Pathol 1977; 1: 17-23.
47. Ettinghausen SE, Bonow RO, Palmeri ST, et al. Prospective
study of cardiomyopathy induced by adjuvant doxorubicin the-
rapy in patients with soft-tissue sarcomas. Arch Surg 1986; 121:
1445-1451.
48. Weiss AJ, Metter GE, Fletcher WS, et al. Studies on adriamy-
cin using a weekly regimen demonstrating its clinical effective-
ness and lack of cardiac toxicity. Cancer Treat Rep 1976; 60:
813-822.
49. Lefrak EA, Pitha J, Rosenheim S, Gottlieb J. A clinicopatho-
logic analysis of adriamycin cardiotoxicity. Cancer 1973; 32:
302-314.
50. Jones WG. Effective palliation of advanced breast cancer with
weekly low dose epirubicin. Eur J Cancer Clin Oncol 1989; 25:
357-360.
51. Valdivieso M, Burgess MA, Ewer MS, et al. Increased thera-
peutic index of weekly doxorubicin in the therapy of non-small
cell lung cancer. A prospective randomised study. J Clin Oncol
1984; 2: 207-214.
52. Chiebowski RT, Paroly WS, Pugh RP, et al. Adriamycin given
as a weekly schedule without a loading course clinically effecti-
ve with reduced incidence of cardiotoxicity. Cancer Treat Rep
1980; 64: 7.
53. Torti FM, Bristow MR, Howes AE, et al. Reduced cardiotoxi-
city of doxorubicin delivered on a weekly schedule. Ann Intern
Med 1983; 99: 745-749.
54. Benjamin RS, Ewer MS, Mackay B, Ali MK, Legha SS, Valdi-
vieso M. An endomyocardial biopsy study of anthracycline-in-
duced cardiomyopathy: detection, reversibility, and potential
amelioration. Proc of AACR/ASCO 1979; 20: 372.
VII.
55. Legha SS, Benjamin RS, Mackay B, et al. Reduction of doxo-
rubicin cardiotoxicity by prolonged continuous intravenous in-
fusion. Ann Intern Med 1982; 96: 133-139.
56. Benjamin RS, Chawla SP, Ewer MS, et al. Organ directed toxi-
cities of anticancer drugs. In: Hacker MP, Lazos JS, Tritton
TR, eds. Adriamycin cardiac toxicity. An assessment of appro-
aches to cardiac monitoring and cardioprotection. Martinus
Nijhoff Publishers, 1987.
57. Piver MS, Marchetti DL, Parthasarathy KL, et al. Doxorubicin
hydrochloride (Adriamycin) cardiotoxicity evaluated by se-
quential radionuclide angiocardiography. Cancer 1985; 56: 76-
80.
58. Gottdiener JS, Appelbaum FR, Ferrans VJ, et al. Cardiotoxici-
ty associated with high-dose cyclophosphamide therapy. Arch
Intern Med 1981; 141: 758-763.
59. Alexander J, Dainiak N, Berger HJ, et al. Serial assessment of
doxorubicin cardiotoxicity with quantitative radionuclide an-
giocardiography. N Engl J Med 1979; 300: 278-283.
60. Kushner JP, Hanser VL, Hammar SP. Cardiomyopathy after
widely separated course of adriamycin exacerbated by actino-
mycin-D and mithramycin. Cancer 1975; 36: 1577.
61. Buzdar AU, Legha SS, Tashima CR. Adriamycin and mitomy-
cin-C. Possible synergistic cardiotoxicity. Cancer Treat Rep
1978; 62: 1005.
62. Haq MM, Legha SS, Choski J, et al. Doxorubicin-induced
heart failure in adults. Cancer 1985; 56: 1361-1365.
63. Swain SM, Whaley FS, Ewer MS. Congestive heart failure in
patients treated with doxorubicin: a retrospective analysis of
three trials. Cancer 2003 Jun 1; 97(11): 2869-79.
64. Mckillop JH, Bristow MR, Goris ML, et al. Sensitivity and spe-
cificity of radionuclide ejection fractions in doxorubicin cardi-
otoxicity. Am Heart J 1983; 106: 1048-1056.
65. Druck MN, Gulenchyn KY, Eyens WK, et al. Radionuclide
angiography and endomyocardial biopsy in the assessment of
doxorubicin cardiotoxicity. Cancer 1984; 53: 1667-1674.
66. Saini J, Rich MW, Lyss AP. Reversibility of severe left ventri-
cular dysfunction due to doxorubicin cardiotoxicity. Ann In-
tern Med 1987; 106: 814-816.
67. Schwartz R-G, McKenzie WB, Alexander J, et al. Congestive
heart failure and left ventricular dysfunction complicating do-
xorubicin therapy: seven year experience using radionuclide
angiocardiography. Am J Med 1987; 82: 1109-118.
68. Billingham ME, Tazelaar HD. Cardiac biopsy. In: Parmley
WW, Chatterjee K, eds. Cardiology. Vol. 1. Philadelphia: J.B.
Lippincott, 1987; 1-17.
69. Fowles RE, Mason JW. Endomyocardial biopsy. Ann Intern
Med 1982; 97: 885-894.
70. Torti PM, Bristow MM, Lum BL, et al. Cardiotoxicity of epiru-
bicin and doxorubicin. Assessment by endomyocardial biopsy.
Cancer Res 1986; 46: 3722-3727.
71. Auner HW, Tinchon C, Sill H, et al. Serum Troponin T as an
indicator of anthracycline cardiotoxicity in adults. Proc Am Soc
Clin Oncol 2001; 20: 389a.
72. Lipshultz SE, Rifai N, Sallan SE, Lipsitz SR, Dalton V, Sacks
DB, Ottlinger ME. Predictive value of cardiac troponin T in
pediatric patients at risk for myocardial injury. Circulation
513
1997 Oct 21; 96(8): 2641-8.
73. Herman EH, Zhang J, Lipshultz SE, et al. Correlation bet-
ween serum levels of cardiac troponin-T and the severity of the
chronic cardiomyopathy induced by doxorubicin. J Clin Oncol
1999; 17: 2237-43.
74. Cersoslmo RJ, Hong WK. Epirubicin: a review of the pharma-
cology, clinical activity, and adverse effects of an adriamycin
analogue. J Clin Oncol 1986; 4: 425-439.
75. OBrien ME, Wigler N, Inbar M, Rosso R, Grischke E, San-
toro A, Catane R, Kieback DG, Tomczak P, Ackland SP, Or-
landi F, Mellars L, Alland L, Tendler C. Reduced cardiotoxici-
ty and comparable efficacy in a phase III trial of pegylated li-
posomal doxorubicin HCL (CAELYX/DOXIL) versus con-
ventional doxorubicin for first line treatment of metastatic
breast cancer. Ann Oncol 2004 Mar; 15(3): 440-9.
76. Schroeder PE, Hasinoff BB. The doxorubicin-cardioprotective
drug dexrazoxane undergoes metabolism in the rat to its metal
ion chelating form ADR-925. Cancer Chemother Pharmacol
2002; 50: 509-13.
77. Seifert CF, Nesser ME, Thompson DF. Dexrazoxane in the
prevention of doxorubicin-induced cardiotoxicity. Ann Phar-
macother 1994 Sep; 28(9): 1063-72.
78. Jain KK, Casper ES, Geller NL, et al. A prospective randomiz-
ed comparison of epirubicin and doxorubicin in patients with
advanced breast cancer. J Clin Oncol 1985; 3: 818-826.
79. Dardir MD, Ferrans VJ, Mikhael YS, et al. Cardiac morpholo-
gy and functional changes induced by epirubicin chemothera-
py. J Clin Oncol 1989; 7: 947-958.
80. Bonadonna G, Gianni L, Santoro A, et al. Drugs ten years la-
ter: Epirubicin. Ann Oncol 1993; 4: 359-369.
81. Villani F, Galimbert M, Comazzi R, et al. Evaluation of car-
diac toxicity of idarubicin (4-demethoxydaunorubicin). Eur J
Clin Oncol 1989; 25: 13-18.
82. Myers CE, McGuire WP, Liss RH, et al. Adriamycin: The role
of lipid, peroxidation in cardiac toxicity and tumor response.
Science 1977; 197: 165-167.
83. Herman EH, Ferrans VJ. Examination of the potential long-
lasting protective effect of ICRF-187 against anthracycline-in-
duced chronic cardiomyopathy. Cancer Treat Rev 1990; 17:
155-160.
84. Speyer JL, Green MD, Zeleninch-Jacquotte A, et al. ICRF-
187 permits longer treatment with doxorubicin in women with
breast cancer. J Clin Oncol 1992; 10: 117-127.
85. Swain SM, Vici P. The current and future role of dexrazoxane
as a cardioprotectant in anthracycline treatment: expert panel
review. J Cancer Res Clin Oncol 2004 Jan; 130(1): 1-7. Epub
2003 Oct 17.
86. Schuchter LM, Hensley ML, Meropol NJ, Winer EP. 2002 up-
date of recommendations for the use of chemotherapy and ra-
diotherapy protectants: clinical practice guidelines of the A-
merican Society of Clinical Oncology. J Clin Oncol 2002 Jun
15; 20(12): 2895-903.
87. Lipshulz SE, Rifai N, Dalton VM, Levy DA, Silverman LB,
Lipsitz SR, Colan SD, Asselin BL, Barr RD, Clavell LA, Hur-
witz CA, Moghrabi A, Samson Y, Schorin MA, Gelber RD,
Sallan SE. The effect of dexrazoxane on myocardial injury in
514
doxorubicin-treated children with acute lymphoblastic leuke-
mia. N Engl J Med 2004; 351: 145-53.
88. Posner LE, Ducart G, Goldberg J, et al. Mitoxantrone: An
overview of safety and toxicity. Invest New Drugs 1985; 3: 123-
132.
89. Henderson JC, Allegra JC, Woodcock T, et al. Randomized
clinical trial comparing mitoxantrone with doxorubicin in pre-
viously treated patients with breast cancer. J Clin Oncol 1989;
7: 560-571.
90. White DA, Schwartzberg LS, Kris MG, et al. Acute chest pain
syndrome during bleomycin infusions. Cancer 1987; 59: 1582-
1585.
91. Edwards GS. Long term treatment with cisdichlorodiamminer
-platinum-vinblastin-bleomycin: Possible association with seve-
re coronary artery disease. Cancer Treat Rep 1979; 63: 551-
552.
92. Applebaum FR, Strauchen JA, Graw RG Jr, et al. Acute lethal
carditis caused by high-dose combination chemotherapy. A u-
nique clinical and pathological entity. Lancet 1976; 1: 58-62.
93. Gottdiener JS, Applebaum FR, Ferrans VJ, et al. Cardiotoxici-
ty associated with high-dose cyclophosphamide therapy. Arch
Intern Med 1981; 141: 758-763.
94. Mills BA, Roberts RW. Cyclophosphamide induced cardiomy-
opathy. A report of two cases and review of the English litera-
ture. Cancer 1979; 43: 2223-2226.
95. Herman EH, Mharte RM, Warardekar VS, et al. Comparison
of the cardiovascular action of NSC-109, 724 (ifosfamide) and
cyclophosphamide. Toxicol Appl Pharmacol 1978; 23: 178-190.
96. Kandylis K, Vasilomanolakis M, Tsoussis F, Efremidis AP. Ifo-
sfamide cardiotoxicity in humans. Cancer Chemoth Pharmacol
1989; 24(6): 395-3.
97. Einhorn LH. VP-16 plus ifosfamide plus cisplatin as salvage
therapy in refractory testicular cancer. Cancer Chemother Phar-
macol 1986; 18 (suppl 2): 545-550.
98. Weinberger A, Pinkas J, Sandbank U, et al. Endocardiac fibro-
sis following busulfan treatment. JAMA 1975; 231(abstract):
495.
99. Tomirotti M, Rinudi R, Pulci S, et al. Ischemic cardiopathy
from cis-diaminedichloroplatinum. Tumori 1984; 70: 235-236.
100. Pottage A, Holt S, Ludgate S, et al. Fluorouracil cardiotoxici-
ty. Br Med J 1978; 112: 547.
101. Labianca R, Beretta G, Clerid M, et la. Cardiac toxicity of 5-
fluorouracil: A study of 1083 patients. Tumori 1982; 68: 505-510.
102. Vorobio J DA. Cardiotoxicity of 5-fluorouracil. S Atr Med
OH OO (-
), )
- ,
- . , ) -
, - ,
- -
- ) ,
, - . -
) , -
OY
1982; 61: 634-635.
103. Frickhofen N, Beck FJ, Jung B, Fuhr HG, Andrasch H, Sig-
mund M. Capecitabine can induce acute coronary syndrome
similar to 5-fluorouracil. Ann Oncol 2002 May; 13(5): 797-801.
104. Hirvomen HE, Salmi TT, Heinomen E, et al. Vincristine treat-
ment of acute lymphoblastic leukemia induces transient auto-
nomic cardioneuropathy. Cancer 1989; 64: 801-805.
105. Schechter JP, Jones SE. Myocardial infraction in a 27 year old
woman. Possible complication of treatment with VP-16 medi-
astinal irradiation of both. Cancer Chemother Rep 1979; 59:
887-888.
106. Rowinsky EK, McGuire WP, Guamieri T, et al. Cardiac dis-
turbances during the administration of taxol. J Clin Oncol
1991; 9: 1704-1712.
107. Giordano SH, Booser DJ, Murray JL, Ibrahim NK, Rahman
ZU, Valero V, Theriault RL, Rosales MF, Rivera E, Frye D,
Ewer M, Ordonez NG, Buzdar AU, Hortobagyi GN. A de-
tailed evaluation of cardiac toxicity: a phase II study of doxo-
rubicin and one- or three-hour-infusion paclitaxel in patients
with metastatic breast cancer. Clin Cancer Res 2002 Nov;
8(11): 3360-8.
108. Perez EA, Rodeheffer R. Clinical cardiac tolerability of tras-
tuzumab. J Clin Oncol 2004 Jan 15; 22(2): 322-9.
109. Keefe DL. Trastuzumab-associated cardiotoxicity. Cancer 2002
Oct 1; 95(7): 1592-600.
110. Seidman A, Hudis C, Pierri MK, Shak S, Paton V, Ashby M,
Murphy M, Stewart SJ, Keefe D. Cardiac dysfunction in the
trastuzumab clinical trials experience. J Clin Oncol 2002 Mar
1; 20(5): 1215-21.
111. Perez EA, Suman VJ, Davidson NE, et al. Effect of doxorubi-
cin plus cyclophosphamide on left ventricular ejection fra-
ction in the NCCTG Intergroup adjuvant trial. Proc Am Soc
Clin Oncol 2003; 22: 19a.
112. Lee KF, Simon H, Chen H, Bates B, Hung MC, Hauser C.
Requirement for neuregulin receptor erbB2 in neural and
cardiac development. Nature 1995 Nov 23; 378(6555): 394-8.
113. Klein PM, Dybdal N. Trastuzumab and cardiac dysfunction:
update on preclinical studies. Semin Oncol 2003 Oct; 30(5
Suppl 16): 49-53.
114. Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Ba-
jamonde A, Felming T, Eiermann W, Wolter J, Pegram M,
Baselga J, Norton L. Use of chemotherapy plus a monoclonal
antibody against HER2 for metastatic breast cancer that over-
expresses HER2. N Engl J Med 2001; 15: 783-792.
VII. 515

-
17. -
2. -
DNA (
. )
3.
BCNU
-

.

, ,
. 4 -

-


.
4.

-

. -
-
- . -
-2 -

C
5.
.

-,
18. .



-TNF-, -TNF-, -
TNF- IL-

1,

6,7.

,
(. 17). , 8.
-
. , -
, 18. , -

O O OH -
A . -
O - -
,
, .
. -
-
. . -
,
- CXCR4 CCR79.
1. -
- OOOOA H
. O ,
, - ,
516 OY

. - -
, - , -
.
. - ,
- .

. -
-
- -
, , - .
, , - vn -
, - . -
10. - , -
, 450 -
- , > 10%18. -
(UIP) ( ), 450 ,
- 35%19. -
, . ,
-
- ( -
, ) O2 -
11,12. (. 19).
-
A H
,
. - , -
, - 1030%
. (<200 )20,21.
. -


13. - ( 1 mg/kg/-
- ). ,
. o -
, , -
, , 22. -
14,15. -
50% -
, -
23.

-
16.


, -
-
17.
- 19. -

. - > 70
, - > 450
(total lung capa- Hodgkins
city), 1 sec (forc- /
ed vital capacity) F1O2

(diffusing capacity for carbon monoxide)
.
VII. 517

39 - -
19. - 36.
-
.
() -
- . -
.
24-29. - -
,
, (-TNF ), - -
( ), (- 37.
), . -
,
C -
- , -
, (ARDS) 10%38.
.
3% 36%30. - -
,
- ARDS ,
. -
. 39.
-
. -
, - -
31. -
24 , - 40.
-
. . 9001.200
, - mg/m2 20%, -
32, - 3050% 1.500
- mg/m2 (41). -
. - BCNU -
- , 660750 mg/m2,
50% ARDS. , -
. , -
, .
30
mg/m2(33).
. - . -
612 - 450 mg/m2
, 300 mg/m2 42. O
. 9
12 -
- 43.
. (
- ARDS)
34. 2 .

- ,
35.
518 OY

. O -
, .
, 2 13 -
Wegener, - 50.
. 1 6 -
- , , . -
ARDS , - / -
44. .
51.
-
, ( )
, . -
. .
UIP
: ) (
. ) DLCO ). ,
. -
, - 51. -
45. ) - .
() 46. - (DAD), BOOP .
. -
( ).
O -
- . -
- TGF- -
47. - -
- .
. O - , 50120 mg/kg
- 4 ,
-
, 52. , -
3 . 6 -
48. - -
. - 53.
, -
.

-
. , -
1% .
. -
-
10 . , - , - -
, . , n54.
, - -
49. - -
. ,
.
-
- < 1%. -
. O - . -
VII. 519

. 10% -
. - 58. -
ARDS - ,
- 10%.
.
-
, . -
(30350 mg/m2).
9% 55. - -
,
, - , -
, 20% -
- 59. -
. O .
56. .
,
, ,
1 - , V
.
-
- 60,61. -
- -
5 g/m2 2 6 - 59.
-
, ,
, 56,57. all-trans
221 -
. ,
(ARDS) , , , -
16% - , -
6 . -
3 g/m2.
10 . .
, -

1. Lazo JS, Merrill WW, Pham ET, Lynch TJ, McCallister JD,
Ingbar DH. Bleomycin hydrolase activity in pulmonary cells. J
Pharmacol Exp Ther 1984 Dec; 231(3): 583-8.
2. Lazo JS, Humphreys CJ. Lack of metabolism as the biochemi-
cal basis of bleomycin induced pulmonary toxicity. Proc Natl
Aca Sci USA 1983; 3064-3068.
3. Harrison JH Jr, Hoyt DG, Lazo JS. Acute pulmonary toxicity
of bleomycin: DNA scission and matrix protein mRNA levels
in bleomycin-sensitive and resistant strains of mice. Mol Phar-
macol 1989 Aug; 36(2): 231-8.
4. Adamson , Bowden DH. The pathogenesis of bleomycin-
induced pulmonary fibrosis in mice. Am J Pathol 1974; 77:
185-198.
5. Schrier DJ, Phan SH, Ward . Cellular sensitivity to collagen
in bleomycin-treated rats. J Immunol 1982; 129: 2156-2159.
6. Piguet PF, Vesin C, Grau GE, Thompson RC. Interleukin 1
receptor antagonist prevents or cures pulmonary fibrosis eli-
cited in mice by bleomycin or silica. Cytokine 1993 Jan; 5(1):
57-61.
7. Ortiz LA, Lasky J, Hamilton RF Jr, Holian A, Hoyle GW,
Banks W, Banks W, Peschon JJ, Brody AR, Lungarella G,
Friedman M. Expression of TNF receptors in bleomycin-in-
duced lung injury in mice. Exp Lung Res 1998 Nov-Dec; 24(6):
721-43.
8. Denholm EM, Phan SH. Bleomycin binding sites on alveolar
macrophages. J Leukoc Biol 1990 Dec; 48(6): 519-23.
9. Hashimoto N, Jin H, Liu T, Chensue SW, Phan SH. Bone
marrow-derived progenitor cells in pulmonary fibrosis. J Clin
Invest 2004 Jan; 113(2): 243-52.
10. Smith GJW. The histopathology of pulmonary reactions to
drugs. Clin Chest Med 1990; 11: 95.
520
11. Holoyer , Luna , McKay , et al. Bleomycin hypersensi-
tivity pneumonitis. Ann ntern Med 1978; 88: 47.
12. White DA, Kris MG, Stover DE. Bronchoalveolar lavage cell
population in bleomycin-induced pulmonary toxicity. Thorax
1987; 42: 551.
13. White DA, Schwartzberg L, Kris MG, et al. Acute chest pain
during bleomycin infusions. Cancer 1987; 59: 1582.
14. Walden , MitcheII-Heggs PF, Coppin C, et al. Preurisy
and methotrexate treatment. Br J Med 1977; 2: 867.
15. Orwoll ES, Kiessling , Patterson R. Interstitial pneumonia
from mitomycin. Ann Intern Med 1978; 89: 352.
16. Weiss RB, Poster DS, Penta JS. The nitrozoureas and pulmo-
nary toxicity. Cancer Treat Rev 1981; 8: 11.
17. Rubin , Casarett GW. Clinical Radiation Pathology. Phila-
delphia: WB Saunders, 1968.
18. Blum RH, Carter SK, Agre . clinical review of bleomycin,
a new antineoplastic agent. Cancer 1973; 31: 903.
19. Jules-Elysee , White DA. Bleomycin-induced pulmonary to-
xicity. Clin Chest Med 1990; 11: 1.
20. Schein PS, De Vita VT, Hubbard S, et al. Bleomycin, adriamy-
cin, cyclophosphamide, vincristine and prednisone (BACOP)
combinatin chemotherapy in the treatment of advanced dif-
fuse histiocytic lymphoma. nn Intern Med 1976; 85: 417-422.
21. Bauer , Skarin , Balikian JP, Garnick , Rosenthal
DS, Canellos GP. Pulmonary complications associated with
combination chemotherapy programs containing bleomycin.
Am J Med 1983; 74: 557.
22. Sostman HD, Matthay RA, Putnam CE. Cytotoxic drug-induc-
ed lung disease. Am J Med 1977; 62: 608.
23. White DA, Stover DE. Severe bleomycin-induced pneumoni-
tis: Clinical features and response to corticosteroids. Chest
1984; 86: 723.
24. Sostman HD, Matthay RA, Putnam CE, Smith CJ. Methotre-
xate-induced pneumonitis. Medicine 1976; 55: 371.
25. Mark GJ, Lehingar-Zadeh , Ragsdale BD. Cyclophosphami-
de pneumonitis. Thorax 1978; 33: 89.
26. Konitis , Aisner J, Sutheiland J, et al. Possible pulmonary
toxicity secondary to vinblastine. Cancer 1982; 50: 2771.
27. Cordonnier C, Vernant JP, Mital , et al. Pulmonary fibrosis
subsequent to high doses of CCNU for chronic leukemia. Can-
cer 1983; 51: 1814.
28. Reznill-Schuller , Smith AC, Thenot JP, et al. Pulmonary
toxicity of the anticancer drug, bis-chloroethyl nitrozurea
(BCNU) in rats. Toxicologist 1984; 4: 29.
29. Podoll LN, Winkler SS. Busulfan lung. Report of two cases
and review of the literature. AJR 1974; 120: 151.
30. Doll DC, Weiss RB, Issell . Mitomycin: Ten years after ap-
proval for marketing. J Clin Oncol 1985; 3: 276-286.
31. Kris Mg, Pablo D, Gralla RJ, Burke MT, Prestifilippo J, Lewin
D. Dyspnea following vinblastine or vindesine administration
in patients receiving mitomycin plus vinca alkaloid combination
therapy. Cancer Treat Rep 1984 Jul-Aug; 68(7-8): 1029-31.
32. Rivera MP, Kris Mg, Gralla RJ, White DA. Syndrome of acute
dyspnea related to combined mitomycin plus vinca alkaloid
chemotherapy. Am J Clin Oncol 1995 Jun; 18(3): 245-50.
33. Verweij J, van Zanten T, Souren T, Golding T, Pinedo HM.
OY
Prospective study on the dose relationship of mitomycin C-in-
duced interstitial pneumonitis. Cancer 1987 Aug 15; 60 (4):
756-61.
34. Sheldon R, Slaughter D. syndrome of microangiopathic he-
molytic anemia renal impairment and pulmonary edema in che-
motherapy treated patients with adenocarcinoma. Cancer 1986;
58: 1428-1436.
35. Chang AY, Knebler JP, Pandya KJ, et al. Pulmonary toxicity
induced by mitomycin C is highly responsive to glucocorticoids.
Cancer 1986; 57: 2285-2290.
36. Spain RC. The case for mitomycin in non-small cell lung can-
cer. Oncology 1993 Apr; 50 Suppl 1: 35-50.
37. Horton LW, Chappell AG, Powel DEB. Diffuse interstitial
pulmonary fibrosis complicating Hodgkins disease. Br J Dis
Chest 1977; 71: 44-48.
38. Johnson RE, Brereton HD, Kent CH. Total therapy for
small cell carcinoma of the lung. Ann Thorac Surg 1978; 25:
510-515.
39. Maurer , Modeas C, Goutson , et al. Adult respiratory dis-
tress syndrome after combined modality chemotherapy and ra-
diation therapy in limited small cell lung cancer. Proc Am Soc
Clin Oncol 1990; 9 (abstr): 229.
40. Arrick , Nathan CF. Glutathione metabolism as a determi-
nant of therapeutic efficacy. review. Cancer Res 1984; 44:
4224-4232.
41. Phillips GL, Fay JW, Herzig GP, et al. Intensive 1,3-bis (2-
chloroethyl)-1-nitrosourea (BCNU) NSC 436650 and cryopre-
served autologous marrow transplantation for refractory can-
cer. Cancer 1983; 52: 1792-1802.
42. Schmitz N, Diehl V. Carmustine and the lungs. Lancet 1997
Jun 14; 349(9067): 1712-3.
43. ODriscoll BR, Hasleton PS, Taylor , et al. Active lung fi-
brosis up to 17 years after chemotherapy with carmustine
(BCNU) in childhood. Engl J Med 1990; 323: 378-383.
44. Selker RG, Jacobs SA, Moore PB, et al. -1,3-Bis (2-chloroe-
thyl-1)-1-nitrosourea (BCNU) induced pulmonary fibrosis. Neu-
rosurgery 1980; 7: 560-565.
45. Alessandrino EP, Bernascini P, Colombo A, Caldera D, Marti-
nelli G, Vitulo P, Malcovati L, Nascimbene C, Varettoni M,
Volpini E, Klersy C, Bernasconi C. Pulmonary toxicity follow-
ing carmustine-based preparative regimens and autologous pe-
ripheral blood progenitor cell transplantation in hematological
malignancies. Bone marrow Tranplant 2000 Feb; 25(3); 309-
13.
46. McGaughey DS, Nikcevich DA, Long GD, Vredenburgh JJ,
Rizzieri D, Smith CA, Broadwater G, Loftis JS, Mc Donald C,
Morris AK, Folz RF, Chao NF. Inhaled steroids as prophylaxis
for delayed pulmonary toxicity syndrome in breast cancer pa-
tients undergoing high-dose chemotherapy and autologous
stem cell transplantation. Biol Blood Marrow Tranplant 2001;
7(5): 274-8.
47. Oliner , Schwartz R, Rubio F, et al. Interstitial pulmonary fi-
brosis following busulfan therapy. Am J Med 1961; 31: 134-139.
48. Hankins DG, Sanders S, McDonald , et al. Pulmonary toxi-
city recurring after six weeks course of busulfan therapy and
after subsequent therapy with uracil mustard. Chest 1978; 73:
VII. 521

415-416.
49. Crestani B, Jaccard A, Israel-Biet D, Couderc LJ, Frija J,
Clauvel JP. Chlorambucil-associated pneumonitis. Chest 1994
Feb; 105(2): 634-6.
50. Karim FW , Ayash RE, Allan C, et al. Pulmonary fibrosis
after prolonged treatment with low dose cyclophosphamide.
Oncology 1983; 40: 174-176.
51. Malik SW, Myers JL, DeRemee RA, Specks U. Lung toxicity
associated with cyclophoshamide use. Two distinct patterns.
Am J Respir Crit Care Med 1996 Dec; 154(6 Pt 1): 1851-6.
52. Slavin RE, Millan JE, Mullins GM. Pathology of high-dose in-
termittent cyclophosphamide therapy. Human Pathol 1975; 6:
693-709.
53. Moormeier JA, Williams SF, Kaminer LS. High-dose tri-Alky-
lator chemotherapy with autologous stem cell rescue in patients
with refractory malignancies. J Natl Cancer Inst 1990; 82: 29-
34.
54. Bedrossian CWM, Miller WG, Luna . Methotrexate-in-
duced diffuse interstitial pulmonary fibrosis. South Med 1979;
72: 313-318.
55. Urban C, Nirenberg , Caparros , et al. Chemical pleuritis as
the cause of acute chest pain following high-dose methotrexate
treatment. Cancer 1983; 51: 34-37.
56. Filip DJ, Logue GL, Harle TS, et al. Pulmonary and hepatic
complications of methotrexate therapy of psoriasis. JAMA
1971; 216: 881-882.
57. Slavin RE, Dias , Saral L. Cytosine arabinoside induced
gastrointestinal toxic alterations in sequential chemotherapeu-
tic protocols. clinical Pathologic study of 13 patients. Cancer
1978; 42: 1747-1759.
58. Smith WJ, Scharling ES, Capizzi RC, et al. Pulmonary infiltra-
tes associated with high-dose cytosine arabinoside during leu-
kemia induction therapy. Proc Am Soc Clin Oncol 1988; 7
(abstr): 186.
59. Stemmer SM, Cagnoni PJ, Shpall EJ, Bearman SI, Matthes S,
Dufton C, Day T, Taffs S, Hami L, Martinez C, Purdy MH,
Arron J, Jones RB. High-dose paclitaxel, cyclophosphamide,
and cisplatin with autologous hemopoietic progenitor-cell sup-
port: a phase I trial. J Clin Oncol 1996 May; 14(5): 1463-72.
60. Goldberg HL, Vannice SB. Pneumonitis related to treatment
with paclitaxel. J Clin Oncol 1995 Feb; 13(2): 534-5.
61. Fujimori K, Yokohama A, Kurita Y, Uno K, Saijo N. Paclita-
xel-induced cell-mediated hypersensitivity pneumonitis. Dia-
gnosis using leukocyte migration test, BAL and trasbronchial
lung biopsy. Oncology 1998 Jul-Aug; 55(4): 340-4.

OOH OO
, -
- -
(. 20). -

, -
, .
, -
, , -
, .. ,
CD34+ -
, ,
,
. - , , , -
- (. 21).
, - ,
-
. O - .
,
, - -
, .

20. - 21.

,

522 OY

I O , -
O - ,
. 5.000
,
. -
4. -
. -
-
. - .
-
6285%1,2. - , -
.
- C, -
- X.
, 3. L- -
,
16 6.

1. Humphries JE, Hess CE, Stewart FM. Acute promyelocytic
leukaemia: Impact of hemorrhagic complications on response
to induction chemotherapy and survival. South Med J 1990;
83: 1157-1161.
2. Goldberg , Ginsburg D, Mayer RJ, et al. Is heparins ad-
ministration necessary during induction chemotherapy for pa-
tients with acute promyelocytic leukaemia? Blood 1987; 69:
187-191.
3. Levine , Gent , Hirsch J, et al. The thrombogenic effects
of anticancer drug therapy in women with stage breast can-
cer. Engl J Med 1988; 318: 404-407.
4. Edwards RC, Klaus , Matthews , et al. Heparin abolishes
the chemotherapy induced increase in plasma fibrinopeptide
levels. Am J Med 1990; 89: 25-28.
5. Ruiz , Masugan J, Estalles , et al. The influence of che-
motherapy on plasma coagulation and fibrinolytic systems in
lung cancer patients. Cancer 1989; 63: 643-648.
6. Ott , Ramsay NKC, Priest JR, et al. Sequelae of thrombotic
or hemorrhagic complications following L-asparaginase thera-
py for childhood lymphoblastic leukemia. Am J Pediatr He-
matol Oncol 1988; 10: 191-195.

OO O , BCNU . -
O O OO

, .
22.

1969 -
5. -
, -
, - ,
, , - .
1-4. 1
- .
. - 2
- , -
. 8 . -
. - -
16 mg /
, 4 . O
VII. 523

22.

,
, ,
O , , ,
, ,
,

,

- ,
5- O , ,
, ,
, , , ,
O ,
, ,

, , -
- .
. BCNU ,
, -
6. .

- -
7. 515 -
- .

24 .
8. O
,
, , -
, , - . -
, , - 25% -
, - 7.
. -
. -
, , -
O . O
. BCNU,
CCNU meCCNU
.
, , -
9. 5-
- 5-FU -
- , -
10. BCNU - ,
12,13. -
, - , -
, - . O CMF (, -
11. - , )
524 OY

, 13.
. .


14 -
. 5-FU -
-
. 20 mg -
18 ,
- -
- . -
, - 3040 mg -
. ,
, , - . O
, 15. 80 gr
120160 gr 19
-
, , -
.
-
-
. O
.
. O -
.
. O
-
-


,
.
. -
-
D -
16.
.

-
. -
.
17. O - -
,
52%20. O -
7n . .
.
. , -
. -
4 . . -
- , -
, , -, -

. O , -
, -
.

1. Ostrow S, Hahn D, Wiernik, et al. Ophthalmologic toxicity and ophthalmologic toxicity after treatment with cis-dichloro-
after cis-dichlorodiammino platinum therapy. Cancer Treat diamino platinum . J Cancer Res Clin Oncol 1980; 96: 219-
Rep 1978; 62: 1591-1593. 221.
2. Becher R, Schutt , Osieka R, et al. Peripheral neuropathy 3. Wafsh TJ, Cfark AW, Parhard IM, et al. Neurotoxic effects of
VII. 525

cisplatin therapy. Arch Neurol 1982; 39: 719-720.
4. Bosl GJ, Lage , Frafey , et al. Vinblastine, bleomycin
and cis-diamminedichloro platinum in the treatment of advan-
ced testicular carcinoma. Am J Med 1980; 68: 492-496.
5. Podos SM, Caneffos GP. Lens changes in chronic granulocytic
leukemia. Am J Ophthalmol 1969; 68: 500-504.
6. amming , Apple D, Goldberg . Histopathology and ultra-
structure of busulfan-induced cataracts. Graefes Arch Clin
xp Opthalmol 1976; 200: 139-147.
7. FraunJefder FT, eyer SM. Ocular toxicity of antineoplastic
agents. Am Acad Ophthalmol 1983; 90: 1-3.
8. Kend G, Sirkin SR, Thomas PRM, et al. Blurring of vision.
previously undescribed complication of cyclophosphamide the-
rapy. Cancer 1979; 44: 69-71.
9. McLennan R, Tayfor HR. Optic neuroretinitis in association
with BCNU and procarbazine therapy. Med Pediatr Oncol
1978; 4: 43-48.
10. Louie AC, Turrisi AT, Mugia FM, et al. Letter to the editor.
Med Pediatr Oncol 1978; 5 (Letter): 245-247.
11. Shingfeton BJ, Bienfang DC, Afbert DM, et al. Ocular toxicity
associated with-high dose carmustine. Arch Ophthalmol 1982;
100: 1766-1772.
12. Hamersley J, Luce JK, Florentz TR, et al. Excessive lacrima-
tion from fluorouracil treatment. JAMA 1973; 225: 747-748.
13. Bonadonna G, Brusamolino E, Valagussa P, et al. Combina-
tion chemotherapy as an adjuvant treatment in operable breast
cancer. Engl J Med 1976; 294: 405-410.
14. Straus DJ, Mansolf FA, Ellerby RA, et al. Cicatricial ectropion
secondary to 5-Fluorouracil therapy. Med Pediatr Oncol 1977;
3: 15-19.
15. Hopen CR, Mondino BJ, Johnson BL, et al. Corneal toxicity
with systemic cytarabine. Am J Ophthalmol 1981; 91: 500-504.
16. Ritch PS, Hansen RM, Hener DK. Ocular toxicity from high
dose cytosine arabinoside. Cancer 1983; 51: 430-432.
17. Albert DM, Wong VG, Henderson ES. Ocular complications
of vincristine therapy. Arch Ophthalmol 1967; 78: 709-713.
18. Ashford AR, Doney J, Tiwari RP, et al. Reversible ocular toxi-
city related t tamoxifen therapy. Cancer 1988; 61: 33-35.
19. Kaiser-Kupfer MJ, Lippman . Tamoxifen retinopathy. Can-
cer Treat Rep 1978; 62: 315-320.
20. Hoover DL, Smith LEH, Turner SJ, et al. Ophthalmic evalua-
tion of survivors of acute lymphoblastic leukemia. Ophthalmo-
logy 1988; 95: 151-155.

OO O O O , -
Y . -
- (.. )
, - 23 ,
- (
. )
- -

, - 1.
, -
. O - 2. -
-
23.

O
- 3.
-
, . ,
40% -
.
, 23. -

( ) -


(-
).
-
,

,
526 OY

24.

Vinca
( )

- B
( )
-D ( )


6-
6-

-
- -
. . ,
, O O
- ,
4-7. - G-CSF (Filgrastim) 14 -
24%
2%13,14. -
,
. - , , ,
- . -
. O - ,
, - -
, (100 mg/m2 2, 22, 42),
, - 90% 15. -
- -
. , , ,
, , -
. , .
, ,
,
, -
8,9 (. 12). 24 -
,
. - -
.
(.. ) -
, , , , -
34 10,11. - , ,
-
12. O , .
,
- . -
. - /
(G-CSF, GM-CSF) ( -
VII. 527

O -


16. -
1214 -
, -
17.

1.000/L, -
. O -

.
12.
-
. . -

.
), (
), gram- gram- 18.
( ) O ,
. . -
, -
. O (Caries).
, (,
), - -
- . -
, . -
. -
57 . -
. - -
23 , -
(. 12). , .
-
( Vincent). O -
. - ,
, .
. - (interdental papillae). O -
WHO -
NCI 0 IV , veilbonella18. -
25.
.
-
-
25. . O -

0
, . -
, , . O -

, ,

(Candida Albicans)19. O
V
-
528 OY

Candida).
, -

. -
, .

-
.
-
-
.
O 18
13. .
24 -

(-
(7 ) (12
), -
14 ).
( ) -

(. 13). -
25-27.
. -
( < 25.000/mm3)
-
,
-
-
. -
, -
-
28.
- : ) ,
- , )
. O - -
, -
, - -
20,21,22. . -
, , - , -
- -
. ,
23.
- .
-
. -

1/3 . .
( -
) -
. - 29 ,
- 30. O
. -

- 31. -
. -
- ,
(Herpes ( )
Simplex Virus-) (Herpes , -
Zoster Virus). 32,33.
1148% ( -
VII. 529

. -
26. -

34, -
35. -
G-CSF , ,
- , ,
36.
, , ,

. , -
, ,
, / ,
Laser -, L-11, Caphosol - FUDR
, TGF-37 -
KGF38 ( , ,
, ,
).
, ,

OOO
- K
-
-

(. 26).
- C -
. . -
-
- 39
C40. E -
. - , -
,
, , , , - . -
, , - , -
. - 41 : )
- , ) -
, , ) , ) -
, . (-
. - ), -
- .
-
- 42.
,

. -
6-
642% 43 ( -
. ). -
16% 44 ( -
- ). ,
. 2 mg/kg.

, - .
Child-Pugh, - 6- -
, -
- 45,46. - -
. ,
530 OY

-
. , , ,
(200 mg/m2 5 ) 25% .
-
47,48.
(3 g/m2 12 16), - -
2275% 49,50. - -
65, 66 67. -
. O - -
- 2640%.
. ,
, , ,
51,52.
- 68. O
-
(> 20 ) . -
53,54. - -
12 - 69.
, -
. , >160 mg/m2
(70). -
55. 25
33%71.
, - ,

56 ( -
> 2 gr). X -
- 72.
. -
, ,
. 5
, 37 Wilms, -
52,57,58. - (60
trimetrexate, edatrexate dichloromethotrexate g/kg) 35 . -
. , -
25% 25% 73.
dichlrme- -
thtrexate - , -
59,60. 74.
O -
,
. -
-- (FUDR) .
14 , - .
50%61,62. -
, - -
FUDR .
- .
63,64. O - 815% 75,
- -
. . -
VII. 531

- ,
, - .
76. - -
, - .
. -
-
. L-
E. Coli. -
v v ,
- ,
. 42% 87% .
5%77. -
- ,
- .
20% 78.

-2 -
(- . -
1014 ) (maximun tolerated dose),
79-81. 20% (> 5 -
6% - )
, 25% - 40%
. .
- , 91,92. O -
82.
- -2, -
- , -693. -
310% -2
, 1.200 mg/m2, .
35%, 1.500 mg/ O (, , ) ,
m2(83,84). - ,
- 12
94-96.
85. , -

(tu-
, - mor necrosis factor TNF)97, -4 -
86. (1.600 -
mg/m2) - (GM-CSF)98.
-
O
87.

, -
- , -
1015% Borison McCarthy99 -
88,89. . -
15 -
, ,
, , ()
shock90. (). ,
-
532 OY

.
4 . -
()
(area postrema) -
n (chemoreceptor trigger ,
zone CTZ)100. CTZ - 5-3
, , - .
, , ,
- ,
. , -
CTZ 5--
- (5-).
, - ,
. (impulses) ..
CTZ , -
. - ,
. -

( ), - .
- 1 (1). -
. -
, 1
, - CTZ 105. O -
. O - apretitant,
, - 1 ,
.
().

. -
(CINV)
( , -
..), : ,
, ( ) .
CTZ, -
. -
- , ..
-
101. - , , -
- , -
( 5-3) ..
, -
102,103. -
5-3, - . O
, :
) .
. -
, -
5-3 , .
) . O
104. -
O (> 100 g ) ,
VII. 533

27.

(60 90%) (30 60%) (10 30%) (<10%)

75 mg < 75 mg < 1 g B
500 mg < 500 mg < 75 mg
> 200 mg > 1g 5250 mg
75 mg < 75 mg ( )
- > 1 gr < 250 mg
> 60 mg < 200 mg ( )
< 60 mg -
> 400 mg
-D 5-

, -
106,107. .
) . -
(delayed emesis)
-
. - -
- 24 .
, .
-
108. - .
5-3 o
-
. 113. O
) . O - -
. - .
- (anticipated emesis)
. -

-
-
, -
. . -
-

.
( ) -

. -

-
27.
) -
-
5-3 109, - . -
5-3110. . -
(be-
O haviour therapy)114.
12
,
. 30 -
, ,
, - . -
, -
111,112. - () .
, O 5-3, -
918 . , , ,
534 OY

- 10-8 48 .
, -
. -
115, -

- . O
. , - -
1 apretitant - 117.
5-3 - -
. -
, - .

. OO

,
. -
118.
OOI
- , ,
, - Golgi . -
- -
-
. O - 12. O
, -
, , , - 46 . -
, . -

(. 14). ,
- 119.
-
. - AO OO
, ,
-
,
116. 2 , -
120.
3

. -

121,122 -
.
2 .
, -
, .. -
-

.
123, -
5-3 -
14. . .
VII. 535

. , -
, 131. -
124. , , -
- , -
. -
- . O Bodey132
. O - 90% -
- -
. -
. , -
, - .
,
. . -
. O -
125 - , -
( ) 4050%
( - .
). -
.
, , , , -
, , -
SN38. -
SN38 . -
, , BCNU, -
Gilbert126 (- ,
). H 133,134,135.
. -
- .
. -
, - , -
IV - , -
. .
127. -
VIP O
, - ,
, - , -
. - , , -, -
, , - -
128, 129 130, - , -
. , , , ,
136,137,138.
O

-
-
. 139. -
- -
, , .
, -
. ( )

- ,
536 OY

, .
, -
. -
, .
. - .
, 500/L. -
-
, , ,
. O - -
140. -
, (.. Clost. Septicum), -
. - , -
, . -
, , , -
. - , stress
. , -
, - , -
- , , -
. , - , -
. , - , ,
- . O -
, , , , -
. - , , , -
(50100%). - 140,141, -
.
. - -
, - . , -
, 2 -
, - .
, . .

O -
- .
, , -
- OOO O
, . O OO OO
, ,
, gram
. - -
, - -
. (VOD). -
50% . -
-
. (GVHD). -
, ,
- , ,
. - .
, - +30 -
, , ,
. - , -
- . -
VII. 537

, . - 28. GVHD
,
+30 +100
GVHD - +1 22,9 mg/dl
. - +2 35,9 mg/dl
. +3 614,9 mg/dl
+4 15 mg/dl

-
1954 Bras, Jelliffe Stuart, -
1976 . -
-
142,148. . GVHD
- . -
- Kupffer, -
/ , -
154.
v . - ,
149. -
. / , -
, - -
. - -,
- -
. -
(TNF ..).

. 4050%
VOD , - 100 ,
, . (BCNU), 3 4 . -
C - -
/ +1 +4,
150,151. 28.
. -
- -
, - . -
,
. . O
- ,
PGE-1 . - -
- . ,
(rt-PA)152 - . -
153. , , -
- (TG) -
- (O3) .
(GVHD)
GVHD, . / -
GVHD 155.
, .
- GVHD
- O GVHD -
, -
538
. - -
, - . -
. -
, -
. - , ,
+100 , .
+40 +50 1
. .
-
1. Sonis ST, Koplovsky , Mitus J, Rosenthal D, Brand . Re-
lationship of chemotherapy-induced mucositis and bone mar-
row cellularity in hamsters. J Oral Med Oral Path 1990, in
press.
2. Sonis AL, Sonis ST. Oral complications of cancer chemothera-
py in pediatric patients. J Pedodontics 1979; 3: 122-128.
3. Peterson DW, Overhosler CD. Increased morbidity associated
with oral infection in patients with acute leukemia. Oral Surg
1982; 53: 32-36.
4. Beck S. Impact of a systematic oral care protocol n stomatitis
after chemotherapy. Cancer News 1979; 2: 185-189.
5. Hickey AJ, Toth , Lindquist SB. Effect of intravenous hy-
peralimentantion and oral care on the developement of oral
stomatitis during cancer chemotherapy. J Prosthet Dent 1982;
47: 188-193.
6. Sonis S, Kunz . Impact of improved dental services on the
frequency of oral complications of cancer therapy for patients
with nonhead and neck malignancies. Oral Surg Oral Med
Oral Pathol 1988; 65: 19.
7. Banier AR. Nursing management of acute oral complications
in cancer. Natl Cancer Inst Monogr 1990; 9: 123.
8. Dreizen S. Stomatoxic manifestations of cancer chemothera-
py. J Prosthet Dent 1978; 40: 650-655.
9. Dergman OJ. Oral infections and septicaemia in immuno-
compromized patients with hematologic malignancies. J Clin
Microbiol 1988; 26: 2105.
10. Jone WG. Effective palliation of advanced breast cancer with
weekly low dose epirubicin. Eur J Cancer Clin Oncol 1989; 25:
357-360.
11. Volger W, Huguley C, Kerr W. Toxicity and antitumor effect
of divided doses of methotrexate. Arch Intern Med 1965; 115:
285-293.
12. Habesshew , Paul J, Jones R, et al. Epirubicin at two dose le-
vels with prednisolone as treatment for advance breast cancer:
The results of a randomized trial. J Clin Oncol 1991; 9: 295-
304.
13. Fountzilas G, Skarlos D, Pavlidis , et al. High-dose epirubi-
cin as a single agent in the treatment of patients with advanced
breast cancer. Tumori 1991; 77: 232-236.
14. Fountzilas G, Skarlos D, Katsohis C, et al. High-dose epirubi-
cin and r-met-hu G-CSF (Filgrastim) in the treatment of pa-
tients with advanced breast cancer. Med Pediat Onc 1993, in
press.
OY
15. Fountzilas G, Skarlos D, Kosmidis , et al. Definite radiation
and concurrent cisplatin administration in locally advanced
head and neck cancer. Proc of the 4th International Congress
of Anti-cancer Chemotherapy. Paris, 1993: 129.
16. Lockhart , Sonis ST. Alterations in the oral mucosa caused
by chemotherapeutic agents. J Dermatol Surg Oncol 1981; 7:
10-19.
17. Lockhart , Sonis ST. Relationship of oral complications to
peripheral blood leukocyte and platelet counts in patients re-
ceiving cancer chemotherapy. Oral Surg 1979; 48: 21-28.
18. Peterson DE. Pretreatment strategies in infections prevention
in chemotherapy patients. NCI Monogr 1990; 9: 61.
19. Bodey GP. Fungal infections complicating acute leukemia. J
Chronic Dis 1966; 19: 667-687.
20. Carpentieri U, Haggard , Lockhart LH, et al. Clinical ex-
perience in prevention of candidiasis by nystatin in children
with acute lymphocytic leukemia. J Pediatr 1975; 92: 593-595.
21. vie . Clotrimazole treatment for prevention of oral candi-
diasis in patients with acute leukemia undergoing chemothera-
py. Am J Med 1987; 82: 867.
22. izzo . Infectious complications in the child with cancer. J
Pediatr 1981; 98: 513.
23. arrett AP. Evaluation of nystatin in prevention and elimina-
tion of oropharyngeal Candida in immunosuppressed patients.
Oral Surg Oral Med Oral Pathol 1984 Aug; 58(2): 148-51.
24. Sarai R, Burns WH, Prentice HG. Herpes virus infections. Cli-
nical manifestations and therapeutic strategies in immuno-
compromised patients. Clin Heamatol 1984; 13: 645.
25. Sarai R, Burns WH, Laskin OL, Santos GW, Lietman PS. A-
cyclovir prophylaxis of herpes simplex virus infections. Engl
J Med 1981; 305: 63.
26. Wade JC, Newton , McLaren C, Flournoy , Keeney ,
Myers JD. Intravenous acyclovir to treat mucocutaneous her-
pes simplex virus infection after marrow transplantatin.
double blind trial. Ann Intern Med 1982; 97: 265.
27. Wade JC, Day LM, Crowley JJ, Myers JD. Recurrent infe-
ction with herpes simplex virus after marrow transplantation.
Role of specific immune response and acyclovir treatment. J
Intern Dis 1984; 149: 750.
28. Stafford R, Lockhart , Sonis , et al. Hematologic parame-
ters as predictor of oral invlvement in the presentation of a-
cute leukemia. J Oral Med 1982; 37: 38-41.
VII.
29. Mahood DJ, Dose AM, Loprinzi CL, Veeder MH, Athmann
LM, Therneau, Sorensen JM, Gainey DK, Mailliard JA, Gusa
NL, et al. Inhibition of fluorouracil-induced stomatitis by oral
cryotherapy. J Clin Oncol 1991 Mar; 9(3): 449-52.
30. Meloni G, Capria S, Proia A, et al. Ice pops to prevent mel-
phalan induced stomatitis. Lancet 1996; 347: 1691.
31. Loprinzi CL, Cianflone SG, Dose AM, Etzell PS, Burnham
NL, Therneau TM, Hagen L, Gainey DK, Cross M, Athmann
LM, et al. A controlled evaluation of an allopurinol mouth-
wash as prophylaxis against 5-fluorouracil-induced stomatitis.
Cancer 1990 Apr 15; 65(8): 1879-82.
32. Ahmed T, Engelking C, Szalyga J, Helson L, Coombe N, Cook
P, Corbi D, Puccio C, Chun H, Mittelman A. Propantheline
prevention of mucositis from etoposide. Bone marrow Trans-
plant 1993 Aug; 12(2): 131-2.
33. Oblon DJ, Paul SR, Oblon MB, Malik S. Propantheline pro-
tects the oral mucosa after high-dose ifosphamide, carboplatin,
etoposide and autologous stem cell transplantation. Bone Mar-
row Transplant 1997 Dec; 20(11): 961-3.
34. Anderson PM, Schroder G, Skubitz KM. Oral glutamine redu-
ces the duration and severity of stomatitis after cytotoxic can-
cer chemotherapy. Cancer 1998 Oct 1; 83(7): 1433-9.
35. Jebb SA, Osborne RJ, Maughan TS, Mohideen N, Mack P,
Mort D, Shelley MD, Elia M. 5-fluorouracil and follinic acid
induces mucositis: no effect of oral glutamine supplementa-
tion. Br J Cancer 1994 Oct; 70(4): 732-5.
36. Gabrilove JL, Jakubowski A, Scher H, Sternberg C, Wong G,
Grous J, Yagoda A, Fain K, Moore MA, Clarkson B, et al. Ef-
fect of granulocyte colony-stimulating factor on neutropenia
and associated morbidity due to chemotherapy for transitio-
nal-cell carcinoma of the urothelium. N Engl J Med 1988 Jun
2; 318(22): 1414-22.
37. Sonis ST, Van Vugt AG, Brien JP, Muska AD, Bruskin AM,
Rose A, Haley JD. Transforming growth factor-beta 3 mediat-
ed modulation of cell cycling and attenuation of 5-fluorouracil
induced oral mucositis. Oral Oncol 1997 Jan; 33 (1): 47-54.
38. Meropol NJ, Somer RA, Gutheil J, Pelley RJ, Modiano MR,
Rowinsky EK, Rothenberg ML, Redding SW, Serdar CM,
Yao B, Heard R, Rosen LS. Randomized phase I trial of re-
combinant human keratinocyte growth factor plus chemothe-
rapy: potential role as mucosal protectant. J Clin Oncol 2003
Apr 15; 21(8): 1452-8.
39. Liang R, Lau GK, Kwong YL. Chemotherapy and bone mar-
row transplantation for cancer patients who are also chronic
hepatitis B carriers: a review of the problem. J Clin Oncol 1999
Jan; 17(1): 394-8.
40. Zuckerman E, Zuckerman T, Douer D, Qian D, Levine AM.
Liver dysfunction in patients infected with hepatitis C virus un-
dergoing chemotherapy for hematologic malignancies. Cancer
1998 Sep 15; 83(6): 1224-30.
41. Yeo W, Zee B, Zhong S, Chan PK, Wonk WL, Ho WM, Lam
KC, Johnson PJ. Comprehensive analysis of risk factors asso-
ciating with hepatitis B virus (HBV) reactivation in cancer pa-
tients undergoing cytotoxic chemotherapy. Br J Cancer 2004
Apr 5; 90(7): 1306-11.
42. Yeo W, Chan PK, Ho WM, Zee B, Lam KC, Lei KI, Chan AT,
Mok TS, Lee JJ, Leung TW, Zhong S, Johnson PJ. Lamivudi-
539
ne for the prevention of hepatitis B virus reactivation in hepa-
titis B s-antigen seropositive cancer patients undergoing cyto-
toxic chemotherapy. J Clin Oncol 2004 Mar 1; 22(5): 927-34.
43. Einhorn , Davidson . Hepatotoxicity of mercaptopurine.
JAMA 1964; 108: 802.
44. Rind DJ, Foyle LV Jr. 6-mercaptopurine (NSC 755) given in-
termittenly in high-dose: phase study. Cancer Chemother
Rep 1970; 54: 31.
45. DCruz CA, Wimmer RS, Harcke , Huff DS, Naiman JL.
Veno-occlusive disease of the liver in children following che-
motherapy for acute myelotic leukemia. Cancer 1983; 51: 1803.
46. Larrey D, Freneaux , Betson , et al. Peliosis hepatitis induc-
ed by 6-thioguanine administration. Gut 1988; 29: 1265.
47. Wang JJ, Selawry OS, Vietti TJ, Bodey GP. Prolonged infu-
sion of arabionosyl cytosine in childhood leukemia. Cancer 1970;
25: 1.
48. Griffin JD, Spriggs D, Wisch JS, Kufe DW. Treatment of pre-
leukemic syndromes with continuous infusion of low-dose cy-
tosine arabinoside. J Clin Oncol 1985; 3: 982.
49. Herzig RH, Wolff SN, Lazarus , Phillips GL, Karanes C,
Herzig GP. High-dose cytosine arabinoside therapy for refra-
ctory leukemia. Blood 1983; 62: 361.
50. Kantarjlan , Estey , Plunket W, et al. Phase I-II clinical
and pharmacologic studies of high-dose cytosine arabinoside
in refractory leukemia. Am J Med 1986; 81: 387.
51. Hersh , Wong WG, Henderson ES, Freireich EJ. Hepato-
toxic effects of methotrexate. Cancer 1966; 19: 1600.
52. Nesbit , Krivit W, Heyn R, Sharp . Acute and chronic ef-
fects of methotrexate of hepatic, pulmonary and skeletal sy-
stems. Cancer 1976; 37: 1048.
53. Jaffe , Traggis D. Toxicity of high-dose methotrexate (NSC
740) and citrovorum factor (NSC 3590) in osteogenic sarcoma.
Cancer Chemother Rep 1975; 6: 31.
54. Wever BL, Tanyer G, Poplack DG, et al. Transient acute he-
patotoxicity of high-dose methotrexate therapy during child-
hood. NCI Monogr 1987; 5: 207.
55. Hutter R VP, Shipkey FH, Tan CTC. Hepatic fibrosis in chil-
dren with acute leukemia. complication of therapy. Cancer
1960; 13: 288.
56. Sznol , Ohnuma , Holland JF. Hepatic toxicity of drugs
used for hematologic neoplasia. Semin Liver Dis 1987; 7: 237.
57. Macintosh S, Davidson DL, OBrien RT, Parson . Metho-
trexate hepatotoxicity in children with leukemia. J Pediatr 1977;
90: 1019.
58. Parker D, Bate CM, Crafi W, Graham-Pole J, Malpas JS,
Stansfeld AG. Liver damage in children with acute leukemia
and non-Hodgkin lymphoma on oral maintenance chemothe-
rapy. Cancer Chemother Pharmacol 1980; 4: 121.
59. Shum , Kris MG, Gralla RJ, Burke , Markd LD, Hee-
fan RT. Phase study on 10-ethyl-10-deaza-aminoprotein in
patients with stage and IV non-small cell lung cancer. J
Clin Oncol 1998; 6: 659-662.
60. Hantef , Rowinsky , Noe DA, et al. Clinical and pharma-
cologic reappraisal of dichloromethotrexate. J Natl Cancer
Inst 1988; 89: 1547.
61. ohn D, Stagg RJ, Friedman , et al. randomized trial of
540
continuous intravenous versus hepatic intraarterial floxuridine
in patients with colorectal cancer metastatic to the liver. The
Northern California Oncology Group Trial. J Clin Oncol 1989;
7: 1646.
62. Kemeny , Dafy J, Reichman , Geffer , tet J, Oderman 78. Left RS, Thompson JM, Johnson DB, et al. Phase trial of
. Intrahepatic or systemic infusion of fluorodeoxyuridine in
patients with liver metastates from colorectal carcinoma. A ran-
domized study. Ann Intern Med 1987; 107: 459.
63. Doria MI Jr, Sheppard , Levin , Riddeff RH. Liver patho- 79. Belt RJ, McGregor D, Haas CD, Bhatia PS. Cholestatic jaun-
logy following hepatic arterial infusion chemotherapy. Cancer
1986; 58: 855.
64. Hohn D, Meinick J, Stagg R, et al. Biliary sclerosis in patients
receiving hepatic arterial infusions of floxuridine. J Clin Oncol
1985; 3: 98.
65. Dabich L, Buff FE, Bettran G, et al. Phase II evaluation of a-
clarubicin in refractory adult leukemia. Southwest Oncology
Group study. Cancer Treat Rep 1986; 70: 967.
66. Arfin , Sifver R, Cassifeth , et al. Phase I-II trial of mito-
xantrone in acute leukemia. Cancer Treat Rep 1985; 69: 61.
67. Daghestani , Arfin , Leyfand-Jones , et al. Phase I and
II clinical and pharmacological study of 4-Demethoxydaunoru-
bicin (idarubicin) in adult patients with acute leukemia. Can-
cer Res 1985; 45: 1408.
68. Minow RA, Stern , Cassey JH, Rodriguez V, Luna .
Clinicopathologic correlation of liver damage in patients treat-
ed with 6-mercaptopurine and adriamycin. Cancer 1976; 38:
1524.
69. Wells PG, Boerth RC, Oates JA, Harbinson RD. Toxicologic
enhancement by a combinatin of drugs which deplete hepatic
glutathione: Acetaminophen and doxorubicin (adriamycin). To-
xicol ppl Pharmacol 1980; 54: 197.
70. Von Hoff DD, Howser D, Gromley RA, et al. Phase I study of
methansulfonamide (-[4-9-acridinylamin)-3-methoxyphenyl]-
mAMSA) using a single dose schedule. Cancer Treat Rep 1978;
62: 1241.
71. Arlin . Current status of amsacrine (SA) combination
chemotherapy programm in acute leukemia. Cancer Treat Rep
1983; 67: 967.
72. Shoemaker DD, Gormley , Cysyk RL. illiary excretion of
4-(9-acrirdinylamino) methansulfon-M-amsidide (AMSA) in
rats: Effects of pretreatment with diethymaleate phenobarbi-
tal, and metyrapone. Drug Metab Dispos 1980; 8: 467.
73. Green DM, Norkool , Breslow , Finkienstein JD, DAngio
GJ. Severe hepatic toxicity after treatment with vincristine and
dactinomycin using single-dose or divided dose-schedules.
report of the National Wilms Tumor Study. J Clin Oncol 1990;
8: 1525.
74. Tefft , Mitus , Jaffe . Irradiation of the liver in children:
Acute effects enhanced by concomitant chemotherapeutic ad-
ministration? Am J Roentgenol Rad Therapy & Nuclear Med
1971; 111: 165.
75. ODwer J, King SA, Hoth DF, Suffness , Leyland-Jones .
Homoharringtonine-perspectives of a new natural product. J
Clin Oncol 1986; 4: 1563.
76. Van Echo DA, Wiernik , Aisner J. High-dose VP-16-213
(NSC 141540) for the treatment of patients with previously
OY
treated acute leukemia. Cancer Clin Trials 1980; 3: 325.
77. Amromin GD, Deliman RM, Shanbrom . Liver damage after
chemotherapy for leukemia and lymphoma. Gastroenterology
1962; 42: 401.
high-dose melphalan and autologous bone marrow transplan-
tation for metastatic colon carcinoma. J Clin Oncol 1986; 4:
1586.
dice associated with chlorozotocin. Cancer Treat Rep 1980; 64:
1235.
80. Hoogstraten , Gottlieb JA, Caoili , et al. CCNU (1-[2-chlo-
roethyl-]-3-cyclohexyl-1-nitrosourea) (NSC 9037) in the treat-
ment of cancer. Cancer 1973; 32: 38.
81. Schein PS, OConell MJ, Blom J, et al. Clinical antitumor acti-
vity and toxicity of streptozotocin (NSC 85998). Cancer 1974;
34: 993.
82. Moertel CG, Schutt AJ, Reitemeir RJ, Hahn RG. phase
study of 1-(2-chloroethyl)-3-cyclohexyl-1-nitrosourea (NSC
9037) in the palliative management of advanced gastrointesti-
nal cancer. Cancer Res 1972; 32: 1278.
83. Mcntyre RE, Magidson JG, Austin GE, Gale RP. Fatal veno-
occlusive disease of the liver following high-dose 1,3-bis (2-
chloroethyl)-1-nitrosourea (BCNU) and autologous bone mar-
row transplantation. Am J Clin Pathol 1981; 75: 614.
84. Philips GL, Wolff SN, Fay JW, et al. Intensive 1,3-bis-(2-chlo-
roethyl)-1-nitrosourea (BCNU) monochemotherapy and auto-
logous bone marrow transplantation for malignant glioma. J
Clin Oncol 1986; 4: 639.
85. Kehrer JP. The effect of BCNU (carmustine) of tissue gluta-
thione reductase activity. xicol-Lett 1983; 17: 63.
86. ill JM, Loeb , McLellan A. Clinical studies of platinum co-
ordination cmpounds in the treatment of various malignant
diseases. Cancer Chemother Rep 1975; 59: 647.
87. Shea TC, Flaherty , Elias , et al. phase clinical and
pharmacokinetics study of carboplatin and autologous bone
marrow support. J Clin Oncol 1989; 7: 651.
88. Johnson RO, Metter G, Wilson W, ill G, Krementz . Phase
evaluation of DTIC (NSC 45388) and other studies in malig-
nant melanoma in the Central Oncology Group. Cancer Treat
Rep 1976; 60: 183.
89. Erichsen C, Jonsson . Veno-occlusive liver disease after da-
carbazine therapy (DTIC) for melanoma. J Surg Oncol 1984;
27: 268.
90. Asbury RF, Rosenthal SN, Descalzi , RatcIiffe BL, Arse-
neau JC. Hepatic veno-occlusive disease due to DTIC. Cancer
1980; 45: 2670.
91. Fisher , Keenan , Garra BS, et al. Interleukin-2 induces
profound reversible cholestasis: detailed analysis in treated
cancer patients. J Clin Oncol 1989; 7: 1852.
92. Margolin , Rayner , Hawkins MJ, et al. Interleukin-2
and lymphokine-activated killer cell therapy of solid tumors.
Analysis of toxicity and management guidelines. J Clin Oncol
1989; 7: 486.
93. Heinrich PC, Castelli JV, Andus . Interleukin-6 and the acu-
te phase response. Biochem J 1990; 265: 621.
VII.
94. Sherwin SA, Knost JA, Fein S, et al. multiple-dose phase
trial of recombinant leukocyte interferon in cancer patients.
JAMA 1982; 248: 2461.
95. Hu , Horning SJ. Phase study of recombinant human inter-
feron beta in patients with advanced cancer. J i Resp Mod
1987; 6: 121.
96. Kuzrock R, Quesada JR, alpaz , et al. Phase study of mul-
tiple dose intramuscularly administered recombinant gamma
interfern. J Clin Oncol 1986; 4: 1101.
97. Greaven J, Plager JE, Dupere S, et al. Phase clinical trial of
recombinant-human tumor necrsis factor. Cancer Chemother
Pharmacol 1987; 20: 137.
98. Lieschke GJ, Maher D, Cebon J, et al. Effects of bacterically
synthesized recmbinant-human granulocyte-macrophage c-
lny-stimulating factor in patients with advanced malignancy.
nn Intern Med 1989; -110: 357.
99. Borison HL, McCarthy LE. Neuropharmacology of chemothe-
rapy induced emesis. Drugs 1983; 25: 8-17.
100. Borison HL. Role of the area postrema in vmiting and re-
lated functions. Rev Pharmacol Clin xp 1986; 2 (Suppl): 7-8.
101. Gralla RJ, Braunt J, Squillante , et al. Metoclopramide: I-
nitial clinical studies of high dosage regimens in cisplatin-in-
duced emesis. In: Poster D, ed. The treatment of nausea and
vomiting induced by cancer chemotherapy. New York: Mas-
son Publishing, 1981: 167-176.
102. Fozard JR, Mobarok . Blockade of neuronal tryptamine re-
ceptors by metclpramide. ur J Pharmacol 1978; 49: 109-
112.
103. Ireland SJ, Straughan OW, Tyers . nfluence of 5- up-
take n the apparent 5- antagonist potency of metoclopra-
mide n the rat isolated superior cervival ganglion. Br J Phar-
macol 1987; 90: 151-160.
104. Graffa RJ. Current issues in the management of nausea and
vomiting. nn Oncol 1993; 4 (Suppl 3): 37.
105. Saria A. The tachykinin NK1 receptor in the brain: pharma-
cology and putative functions. Eur J Pharmacol 1999 Jun 30;
375(1-3): 51-60.
106. D Acquisto RW, Tyson LB, Graffa RJ, et al. The influence of
a chronic high alcohol intake one chemotherapy-induced nau-
sea and vomiting. Proc Am Soc Clin Oncol 1986; 5: 257.
107. Suffivan JR, Leyden MJ, Beff R. Decreased cisplatin induced
nausea and vomiting with alcohol ingestion. Engl J Med
1983; 309: 796.
108. Kris MG, Tyson LB, Graffa RJ, et al. Extrapyrimidal rea-
ctions with high-dose metoclopramide. Engl J Med 1983;
309: 433.
109. Tremblay PB, Kaiser R, Sezer O, Rosler N, Schelenz C, Pos-
singer K, Roots I, Brockmoller J. Variations in the 5-hydroxy-
tryptamine type 3B receptor gene as predictors of the efficacy
of antiemetic treatment in cancer patients. J Clin Oncol 2003
Jun 1; 21(11): 2147-55.
110. Kaiser R, Sezer O, Papies A, Bauer S, Scelenz C, Tremblay
PB, Possinger K, Roots I, Brockmoller J. Patient-tailored an-
tiemetic treatment with 5-hydroxy-tryptamine type 3 receptor
antagonists according to cytochrome P-450 2D6 genotypes. J
Clin Oncol 2002 Jun 15; 20(12): 2805-11.
541
111. Fetting JH, Grochow LB, Fofstein MF, et al. The course of
nausea and vomiting after high-dose cyclophosphamide. Can-
cer Treat Rep 1982; 66: 1487-1493.
112. Martin , Diaz Rubio , Sanchez , et al. The natural course
of emesis after carboplatin treatment. Acta Oncologica 1990;
29: 593-596.
113. Kris MG, Graffa RJ, Clark RA, et al. Incidence, course and
severity of delayed nausea and vomiting following the admini-
stration of high-dose cisplatin. J Clin Oncol 1985; 3: 1379-1384.
114. Morrow GR, Morreff C. Behavioral treatment for the antici-
patory nausea and vomiting induced by cancer chemotherapy.
Engl J Med 1982; 307: 1476-1480.
115. Eisenberg P, Figueroa-Vadillo J, Zamora R, Charu V, Had-
jenberg J, Cartmell A, Macciocchi A, Grunberg S. Improved
prevention of moderately emetogenic chemotherapy-induced
nausea and vomiting with palosentron, a pharmacologically
novel 5-HT3 receptor antagonist: results of a phase III, single
dose trial versus dolasentron. Cancer 2003 Dec 1; 98(11):
2473-82.
116. Bfeyer W. The clinical pharmacology of methotrexate. Can-
cer 1978; 41: 36-51.
117. Kennedy BJ, Theofogides . The role of 5-flurouracil in ma-
lignant disease. nn ntern Med 1961; 55: 719-730.
118. Wurth , Musacchifa XJ. Mechlorethamine effects of inte-
stinal absorption in vitro and n cell proliferation. J Physiol
1973; 225: 73-80.
119. Shaw , Spector , Ladman AJ. Effects of cancer, radio-
therapy and cytotoxic drugs on intestinal structure and fun-
ction. Cancer Treat Rev 1979; 6: 141-151.
120. Weiss H, Walker M, Wiernik P. Neurotoxicity of commonly
used antineoplastic agents. Engl J Med 1974; 219: 75-81,
127-133.
121. Holland JF, Scharlan C, Gailani S, et al. Vincristine treatment
of advanced cancer. cooperative study of 392 cases. Cancer
Res 1973; 33: 1258-1264.
122. Sandler SG, Tobin W, Henderson ES. Vincristine induced
neuropathy. clinical study of fifty leukemia patients. Neuro-
logy 1969; 19: 367-374.
123. Singhal S, Mehta J, Desikan R, Ayers D, Robertson P, Eddle-
mon P, Munshi N, Anaissie E, Wilson C, Dhodapkar M, Zed-
dis J, Barlogie B. Antitumor activity of thalidomide in refra-
ctory multiple myeloma. N Engl J Med 1999 Nov 18; 341(21);
1565-71.
124. Sherkock . Effect of cancer treatment of nutrition and ga-
strointestinal function. Clin Bull 1979; 9: 136-145.
125. Hecht JR. Gastrointestinal toxicity of irinotecan. Oncology
(Huntinght) 1998 Aug; 12(8 suppl 6): 72-8.
126. Wasserman E, Myara A, Lokiec F, Golgwasser F, Trivin F,
Mahjoubi F, Misset JL, Cvitkovic E. Severe CPT-11 toxicity in
patients with Gilberts syndrome: two case reports. Ann On-
col 1997 Oct; 8(10): 1049-51.
127. Lamberts SW, van der Lely AJ, de Herder WW, Hofland LJ.
Octreotide. N Engl J Med 1996 Jan 25; 334(4): 246-54.
128. Govindarajan R, Heaton KM, Broadwater R, Zeitlin A, Lang
NP, Hauer-Jensen M. Effect of thalidomide on gastrointesti-
nal toxic effects of irinotecan. Lancet 2000 Aug 12; 356(9229):
542
566-7.
129. Savarese D, Al Zoubi A, Boucher J. Glutamine for irinotecan
diarrhea. J Clin Oncol 2000 Jan; 18(2): 450-1.
130. Kehrer DF, Sparreboom A, Verweij J, de Bruijn P, Nierop
CA, van de Schraaf, Ruijrok EJ, de Jonge MJ. Modulation of
irinotecan-induced diarrhea by cotreatment with neomycin in
cancer patients. Clin Cancer Res 2001 May; 7(5): 1136-41.
131. Evas , Golstein MJ, Sherlock . Candida infections of the
gastrointestinal tract. Medicine 1972; 51: 367-379.
132. Bodey GPL. Fungal infections complicating acute leukemia. J
Chronic Dis 1966; 19: 667-687.
133. Donaldson SS, Castro JR, Wilbur JR, et al. Rhabdomyosarco-
ma of head and neck in children: Combination treatment by
surgery, irradiation and chemotherapy. Cancer 1973; 31: 26-
35.
134. Donaldson SS, Jundt S, Ricour C, et al. Radiation enteritis in
children: retrospective review, clinicopathologic correlation
and dietary management. Cancer 1975; 35: 1167-1178.
135. Donaldson SS, Lenon RA. Alteration of nutritional status.
The impact of chemotherapy and radiation therapy. Cancer
1978; 43: 2036-2052.
136. Mallory , Kern F. Drug induced pancreatitis. clinical re-
view. Gastroenterology 1980; 78: 813-819.
137. Newman CE, Ellis DJ. Pancreatitis during combination che-
motherapy. Clin Oncol 1979; 5: 83-89.
138. Purkett J , Butler WM, acfarland JA. Pancreatitis an com-
bination chemotherapy. nn Intern Med 1982; 97: 453.
139. Yeung , Haidak DJ, Brown JA, Anderson D. Metastasis
induces acute pancreatitis in small cell bronchogenic carcino-
ma. Arch ntern Med 1978; 139: 552.
140. Shivshandker , Chu DZ, Stroehlein JR, Nelson RS. Gastro-
intestinal hemrrhage in the cancer patients. Gastrointest En-
dosc 1983; 29: 273.
141. Zinner MJ, Zuidema GD, Smith PL, Miguosa . The preven-
tion of upper gastrointestinal tract bleeding in patients in an
intensive care unit. Surg Gynecol Obstet 1981; 153: 214.
142. Jeliffe DB, Bras G, Mukherjec KL. Veno-occlusive disease of
the liver and indian childhood cirrhosis. Arch Dis Child 1957;
32: 369-385.
143. Wood WG, Dehner LP, Nesbit . Fatal veno-occlusive di-
sease of the liver following high-dose chemotherapy, irradia-
tin and bone marrow transplantation. Ann J Med 1980; 68:
OOO , -
- . -
- , -
. ,
. - -
, , ,
- , .. (. 29).
, - -
,
- -
OY
285-290.
144. Asvury RF, Rosenthal SN, Descalzi . Hepatic veno-occlu-
sive disease due to DTIC. Cancer 1980; 45: 2670-2674.
145. Lazarus , Cottfuied MR, Herzig RH, et al. Veno-occlusi-
ve disease of the liver after high-dose mitomycin-c therapy and
autologous bone marrw transplantation. Cancer 1982; 49:
1789-1795.
146. McDonald GB, Sharma , Matthews D, et al. The clinical
course of 53 patients with veno-occlusive disease of the liver
after marrow transplantation. Transplantation 1985; 39: 603-
608.
147. Ayash LF, Hunt , Antman , et al. Hepatic veno-occlusive
disease in autologous bone marrw transplantation of solid
tummors and lymphomas. J Clin Oncol 1990; 8: 1699-1706.
148. Griner , Elhadawi , Packman C. Veno-occlusive disease of
the liver after chemotherapy of acute leukemia: a report of
two cases. nn Intern Med 1976; 85: 578-582.
149. Shulman , McDonald GB, Matthews DE, et al. n analy-
sis of hepatic veno-occlusive disease and centrilobular hepatic
degeneration following bone marrow transplantation. Gastro-
enterology 1980; 79: 1178-1191.
150. Phillips GL, Fay JW, Herzig GP, et al. Intensive 1,3-Bis (2-
chloroethyl)-1-nitrosourea (BCNU), NSC 4366650 and cryo-
preserved autologous marrow transplantation for refractory
cancer: a phase I-II study. Cancer 1983; 52: 1792-1802.
151. Lazarus H, Gottfried MR, Herzing RH, et al. Veno-occlusive
disease of the liver after high-dose mitomycin-c therapy and
autologous bone marrow transplantation. Cancer 1982; 49:
1789-1795.
152. Baglin , Harper , Marcus RE. Veno-occlusive disease of
the liver complicating. successfully treated with recom-
binant tissue plasminogen activator (rt-PA). Bone Marrow
Transplant 1990; 5: 439-441.
153. Teicher , Grawford JM, Holden SA, et al. Glutathione mo-
noetheyl can selectively protect liver from high-dose BCNU
or cyclophosphamide. Cancer 1988; 62: 1275-1281.
154. McDonald GB, Schulman , Sullivan , Spencer GD.
Intestinal and hepatic complications of human bone marrow
transplantation. Gastroenterology 1986; 90: 460-447.
155. Martin J, Schoch G, Fisher L, et al. retrospective analysis
of therapy for acute graft versus-host disease: initial treat-
ment. Blood 1990; 76: 1464-1472.
VII. 543

, -
29.
- .

, :
1.
.
2. -


-
.
3. , -
, -

.
4. -
(. 30). , -
- ,
-
- , .
: O
1. . -
- G0
.
,
.
2. O - . -
- -
, - -
. ,
3. - 1.

30.

1. 4. O 6. O

-



- -

7.
()
()
- ( )

2. 5.
-


3.
-

544 OY

H OA 10 11 -
- 12.
- 13. O
.
-
, . 14,
- 15. -

, , - , , ,
, . -
(tingling)
. . ,
. .
, -
, - ,
. -
- -
(300600 .
mg/m2) -
. O , Lhermitte,
-
(demylination)2, 16. -
. -
3, - .
. - -
, - , -
30100%, 57%2,13. - 1030 -
- , , -
400 mg/m2, - -
4. .
,
. . -
, -
. (
. )17.
5, ,
- . -
. - > 1.000 mg Lhermitte
, 18.
, , -
, , -
, ACTH Org 27666,7, .
8 -L-9. - 8590% 19.
,
100300 mg/m2 , - ,
. 12% ---
1620% .
, -
88% . O (> 130 mg/m2)
Crti , . O
. , -
-- 20. -
VII. 545

-
21. - .
-
780850 mg/m2. 25. -
3/4 22. -
- , , -
.
56 mg
- . O -
. - -
1520 mg . - ,
-
, 26.
13 . -
, -
, , .. -
. - (leptomeningeal carcinomatosis).
-

.
27.
, , , O
. -
, -
, - .
, - ,
.
(axonal transport). -
,
. O , -
, .
(- 28-30.
, )
- , -
- , , -,
. . -
23. -
- ,
, , . -
. -
- -
, . - ,
-
, - 31.
, ,
- , -
, Charcot-Marie-Tooth -
24. ( .. ),
-
. -
. , , -
546 OY

, - , Lambert-Eaton, -
. - .. -
60% -
250 mg/m2, . -
10%32. ,
39.
. O ,
. - OI OA
, -
. - -
33 - , 34
, - 72 . -
. ,
34. - , , ,
. - 40. 540% -
- . -
. , - . -
, -
, - .
-. - . ,
- , , , , ,
. , ,
. - . -
.
- 41. , -
.
Suramin . -
, , -
. - 42, -
10% 35. - .
: - -
Guillain-Barre - .
.
9% O OA
36. 1970
- -
37 ( ), - ,
( ), - -
( 30% - ,
)38 , ( ).
, -
OA , , , ,
7% , . -
- -
. , , -
, . O - , ,
- 43.
-
, - (disseminated necrotizing leuko-
. encephalopathy).
, , ,
VII. 547

(gliosis) -
44. - 16 -
2-- .
. -
- -
, - -
- DPD
, , - -
- 50,51.
- -
.
- . -
, , -
. - - 647% -
15% , - 38 -
. . -
, , , - -
, . - . -
-
. v45-46. -, --
- 48.
-
- - OI OA
. O -
- . -
. , -
(), . -
- 15
, - 40% . -
. -
O - .
-
, . -
, , , -
,
, . -
. O - -
, ( )
-
. . -
-
OY O YOO , , , -
- - .
, , , -
-47.
- . -
-
. (DPD),
, , , ,
31,48, 8090% 52,53.
49.
548 OY

. - -
1030% - . , -
, - , -
, , , , -
. .
2 , -
13 . , , ,
, , , , , - .
, - - , -
, . , 58,
-
- . -2
. (capillary leak
- syndrome)
. O - ,
, , - .
,
, , YOO OO E -
OH OO
54. -
. (inappropriate antidiuretic hormone secretion
- SADH) -
, - . -
-
. - ,
. O -
. -
55.
- , -

-
. -
56.
- 412

. , - 20 59,60.
, 61.
, -
-
.
- .
-
4355% , -
57. - 62,63.

1. Kaplan RS, Wiernick . Neurotoxicity of antineoplastic drugs.
Semin Oncol 1982; 9: 103-130.
2. Thompson SW, Davis LE, Kornfeld , et al. Cisplatin neuro-
pathy: Clinical electrophysiologic, morphologic and toxicolo-
gic studies. Cancer 1984; 54: 1269-1275.
3. MacDonald DR. Neurologic complications of chemotherapy.
Neurol Clin 1991 Nov; 9(4): 955-67.
4. Van der Hoop RG, van der Burg ME, ten Bokkel Huinick
WW, van Houwelingen C, Neijt JP. Incidence of neuropathy
in 395 patients with ovarian cancer treated with or without cis-
VII.
platin. Cancer 1990 Oct 15; 66(8): 1697-702.
5. Siegal T, Haim N. Cisplatin-induced peripheral neuropathy.
Frequent off-therapy deterioration, demyelinating syndromes
and muscle cramps. Cancer 1990 Sep 15; 66(6): 1117-23.
6. Mollman JE, Glover DJ, Hogan WM, Furman RE. Cisplatin
neuropathy. Risk factors, prognosis, and protection by WR2721.
Cancer 1988; 61: 2192-2195.
7. Gerrusen van der op R, Vecht CJ, van de Burg MEL, et al.
Prevention of cisplatin neurotoxicity with an ACTh analogue
in patients with ovarian cancer. Engl J Med 1990; 322: 89-94.
8. Leonetti C, Biroccio A, Gabllini C, Scarsella M, Maresca V,
Flori E, Bove L, Pace A, Stoppacciaro A, Zupi G, Cognetti F,
Picardo M. Alphatocopherol against cisplatin-induced toxici-
ty without interfering with antitumor efficacy. Int J cancer 2003
Mar 20; 104(2): 243-50.
9. Pisano C, Pratesi G, Laccabue D, Zunino F, Lo Giudice P,
Bellucci A, Pacifici L, Camerini B, Cavaletti G. Paclitaxel and
cisplatin induced neurotoxicity: a possible role of acetyl-L-car-
nitine. Clin Cancer Res 2003 Nov 15; 9(15): 5756-67.
10. Feghali JG, Liu W, Van De Water TR. L-n-acetylcysteine pro-
tection against cisplatin-induced auditory neuronal and hair
cell toxicity. Laryngoscope 2001 Jul; 111(7): 1147-55.
11. Kalkanis JG, Whitworth C, Rybak LP. Vitamin E reduces cis-
platin ototoxicity. Laryngoscope 2004 Mar; 114(3): 538-42.
12. Reser D, Rho M, Dewan D, Herbst L, Li G, Stupak H, Zur K,
Romaine J, Frenz D, Kopke R, Arezzo J, Van Der Water T. L-
and D-methionine provide equivalent long term protection
against CDDP-induced ototoxicity in vivo, with partial in vitro
and in vivo retention of antineoplastic activity. Neurotoxicity
1999 Oct; 20(5): 731-48.
13. Lippman AJ, Helson C, Helson L, et al. Clinical trials of cis-
platin. Cancer Chemother Rep 1973; 57: 191-200.
14. Feum LG, Wallace S, Stewart DJ, et al. Intracarotid infusion
of cisdiaminodichloroplatinum in the treatment of recurrent
mallignant brain tumors. Cancer 1984; 54: 794-799.
15. Miller DF, Bay JW, Lederman RJ, et al. Ocular and orbital
toxicity following intracarotid injection of BCNU and cisplati-
num for malignant gliomas. Ophthalmology 1985; 92: 402-406.
16. Walther PJ, Rossitch , Bullard DE. The development of
Lhermittes sign during cisplatin chemotherapy. Cancer 1987;
60: 2170-2172.
17. Heinzlef O, Lotz JP, Roullet E. Severe neuropathy after high-
dose carboplatin in three patients receiving multidrug chemo-
therapy. J Neurol Neurosurg Psychiatry 1998 May; 64(5): 667-9.
18. Taieb S, Trillet-Lenoir V, Rambaud L, Descos L, Freyer G.
Lhermittes sign and urinary retention; a typical presentation
of oxaliplatine neurotoxicity in four patients. Cancer 2002 May
1; 94(9): 2434-40.
19. Gamelin E, Gamelin L, Bossi L, Quasthoff S. Clinical and mo-
lecular basis of oxaliplatin neurotoxicity: Current management
and development of preventive measures. Seminar Oncol 2002
Oct; 29 (5 Suppl 15): 21-33.
20. Wilson RH, Lehky T, Thomas RR, Quinn MG, Floeter MG,
Grem JL. Acute oxaliplatin-induced peripheral nerve hyperex-
citability. J Clin Oncol 2002 Apr 1; 20(7): 1767-74.
21. Cescinu S, Catalano S, Cordella L, Labianca R, Giordani P,
549
Baldelli AM, Beretta GD, Ubiali E, Catalano G. Neuroprote-
ctive effect of reduced glutathione on oxaliplatin-based che-
motherapy in advanced colorectal cancer: a randomized, dou-
ble blind, placebo controlled trial. J Clin Oncol 2002 Aug 15;
20(16): 3478-83.
22. Cassidy J, Misset JL. Oxaliplatin-related side effects: characte-
ristics and management. Semin Oncol 2002 Oct; 29 (5 Suppl
15): 11-20.
23. Garewal HS, Dalton WS. Metoclopramide in vincristine-in-
duced ileus. Cancer Treat Rep 1985; 69: 1309-1312.
24. Slyter , Liwnicz , Herrick , et al. Fatal myeloencephalo-
pathy caused by intrathecal vincristine. Neurology 1980; 30:
867-871.
25. Holland JF, Schariau C, Gailani S, et al. Vincristine treatment
of advanced cancer. cooperative study of 392 patients. Can-
cer Res 1973; 33: 1258-1264.
26. Sandler SG, Tobin W, Henderson ES. Vincristine-induced
neuropathy. Neurology 1969; 19: 367-374.
27. Jackson DV, Wells , Atkins JN, et al. Amelioration of vin-
cristine neurotoxicity by glutamic acid. Am J Med 1988; 84:
1016-1022.
28. Gasey EG, Jelliffe , LeQuesne , Millett YC. Vincristine
neuropathy clinical and electrophysiological observations. Brain
1973; 96: 69-86.
29. Weiss HD, Walker MD, Wietnik PH. Neurotoxicity of com-
monly used antineoplastic agents. New Engl J Med 1974; 291:
75-81.
30. Owellen RJ, Hartke CA, Dickerson RM, Hains F. Inhibition
of tubulin-microtubule polymerization by drugs of the vinca
alkalodi class. Cancer Res 1976; 36: 1499-1502.
31. Weiss HD, Walker MD, Wiernik PH. Neurotoxicity of com-
monly used antineoplastic agents (parts I and II). New Engl J
Med 1974; 291: 75-81.
32. Markman M, Kennedy A, Webster K, Kulp B, Peterson G, Be-
linson J. Neurotoxicity associated with a regimen of carbopla-
tin (AUC 5-6) and paclitaxel (175 mg/m2 over 3 hours) em-
ployed in the treatment of gynaecologic malignancies. J Can-
cer Res Clin Oncol 2001 Jan; 127(1): 55-8.
33. Freiligh RJ, Balmaceda C, Seidman AD, Rubin M, DeAngelis
LM. Motor neuropathy due to docetaxel and paclitaxel. Neu-
rology 1996 Jul; 17(1): 115-8.
34. Perry JR, Warner E. Transient encephalopathy after paclitaxel
(Taxol) infusion. Neurology 1996 Jun; 46(6): 1596-9.
35. La Rocca RV, Meer J, Gilliat RW, Stein CA, Cassidy J, Myers
CE, Dalakas MC. Suramin induced polyneuropathy. Neurolo-
gy 1990 Jun; 40(6): 954-60.
36. Hussain M, Fisher El, Petrylak DP, OConnor J, Wood DP,
Small EJ, Eisenberger MA, Crawford ED. Androgen depriva-
tion and four courses of fixed schedule suramin treatment in
patients with newly diagnosed metastatic prostate cancer: A
Southwest Oncology Group Study. J Clin Oncol 2000 Mar;
18(5): 1043-9.
37. Chaudhry V, Cornblath DR, Corse A, Freimer M, Simmons-
OBrien E, Vogelsang G. Thalidomide-induced neuropathy.
Neurology 2002 Dec 24; 59(12): 1872-5.
38. Richardson PG, Barlogie B, Benerson J, et al. A phase 2 study
550
of bortezomib in relapsed, refractory myeloma. N Engl J Med
2003; 348: 2609-17.
39. Young DF, Posner JB. Nervous system toxicity of the chemo-
therapeutic agents. In: Vinken J, Bruyn GW, eds. Handbook
of clinical neurology. New York: North Holland, 1980: 91-129.
40. Bleyer W, Drake JC, Chabner . Neurotoxicity and ele-
vated cerebrospianal-fluid methotrexate concentration in me-
ningeal leukemia. Engl J Med 1973; 289: 770-773.
41. Cagliano RG, Costanzi JJ. Paraplegia following intrathecal me-
thotrexate. Cancer 1976; 37: 1663-1668.
42. Koh S, Nelson MD Jr, Kovanlikaya A, Chen LS. Anterior lum-
bosacral radiculopathy after intrathecal methotrexate treatment.
Pediatr Neurol 1999 Aug; 21(2): 576-8.
43. Bleyer W, Griffin TW. White matter necrosis, mineralizing
microangiopathy and intellectual abilities in survivors of child-
hood leukemia. In: Gilbert , Kagan AR, eds. Radiation da-
mage to the nervous system. delayed therapeutic hazard.
New York: Raven Press, 1980: 155-174.
44. Rubinstein LJ, Herman , Long TF, Wibur JR. Disseminat-
ed necrotizing leukoncephalopathy. complication of treated
central nervous system. Cancer 1975; 35: 291.
45. Pectasides D, Barbounis V, Athanassiou , Mariatos . Cere-
brovascular accidents following hormonochemotherapy in can-
cer patients. Am J Clin Oncol 1992; 15 (2): 168-173.
46. Pectasides D, Barbounis V, Alevizakos , Athanassiou .
Transient cerebral dysfunction after treatment with moderate-
ly high-dose methotrexate. Annals of Oncology 1991; 2 (10):
769.
47. Nand S, Messmore HL, Patel R. Neurotoxicity associated with
systemic high-dose cytosine arabinoside. J Clin Oncol 1986; 4:
571-575.
48. Riehf JB, Brown WJ. Acute cerebellar syndrome secondary to
5-FU therapy. Neurology 1964; 14: 961-967.
49. Moertal CG, Reitemeier RJ, Bolton CF, Shorter RG. Cerebel-
lar ataxia associated with fluorinated pyrimide therapy. Cancer
Chemother Rep 1964; 41: 14-18.
50. Diasio RB, Beavers TL, Carpenter JT. Familial deficiency of
dihydropyrimidine dehydrogenase. Biochemical basis for fami-
lial pyrimidinemia and severe 5-fluorouracil-induced toxicity. J
Clin Invest 1988; 81: 4751.
51. Moore DH, Fowler WCJr, Crumpler LS. 5-Fluorouracil neu-
OO OI .
OA , -
OI OA , -
, -
. -
-
, , , -
, , ..
Hodgkin, , -
311-3. O -
- ,
OY
rotoxicity. Gynecol Oncol 1990; 36: 152-154.
52. Takimoto CH, Lu ZH, Zhang R, Liang MD, Larson LV, Can-
tilena LR, Grem JL, Allegra CJ, Diasio RB, Chu E. Severe
neurotoxicity following 5-fluorouracil-based chemotherapy in
a patient with dihydropirimidine dehydrogenase deficiency. Clin
Cancer Res 1996 Mar; 2(3): 477-81.
53. , , , ,
.
-
5-. 2001; 80(5): 446-
450.
54. Tuxen , Hansen SW. Neurotoxicity secondary to antineo-
plastic drugs. Cancer Treat Rev 1994; 20: 191-214.
55. Vassal G, Deroussent , Hartmann O, et al. Dose dependent
neurotoxicity, of high-dose busulfan in children: clinical and
pharmacological study. Cancer Res 1990; 50: 6203-6207.
56. Wolff SN, Herzig RH, Fay JW, et al. Thiotepa with autologous
bone marrow transplantation: Phase I studies. Semin Oncol
1990; 17 (Suppl. 3): 2-6.
57. Singhal S, Metha J, Desikan R, Ayers D, Roberson P, Eddle-
mon P, Munshi N, Anaissie E, Wilson C, Dhodapkar M, Zed-
dis J, Barlogie B. Antitumor activity of thalidomide in refra-
ctory myeloma. N Engl J Med 1999 Nov 18; 341(21): 1565-71.
58. Rohatiner AZ, Prior PF, Burton AC, Smith AT, Balkwill FR,
Lister TA. Central nervous system toxicity of interferon. Br J
Cancer 1983 Mar; 47(3): 419-22.
59. De Fronzo RA, Braine , Colvin O, et al. Water intoxica-
tion in man after cyclophosphamide therapy. nn Intern Med
1973; 178: 861-869.
60. Steele , Serpick , Block JB. Antidiuretic response to cy-
clophosphamide in man. J Pharm xp Ther 1973; 185: 245-
253.
61. Green , Mircken BL. Prevention of cyclophosphamide-in-
duced antidiuresis by furosemide infusion. Clin Pharmacol Ther
1981; 29: 634.
62. Robertson GL, Bhoopalam , Zelkowitz LJ. Vincristine neu-
rotoxicity and abnormal secretion of antidiuretic hormone.
Arch ntern Med 1973; 132: 717-720.
63. Stuart MJ, Cuaso C, Miller , Oski FA. Syndrome of recur-
rent increased secretion of antidiuretic hormone following mul-
tiple doses of vincristine. Blood 1975; 45: 315-320.
VII. 551

Spitz
31. -
19486. O -
, -

o


.

, -
.
-
, - 400 mg -
, ,
400 mg,
( ) - 7. -
. , -
, -
OE OI
, 6
O H A
10 g8. 18 gr -
O .
. O - 1973 Sherins De Vita9 -

- .
, - CVP O -
FSH LH. - .
-

. ,
(germinal deple- .
tion), 32 -
, . -
Ser-
toli. -
, - 32. -
-
v
.
-
-
+
4. , + +
12 . + +
- + +
. + +
+ ;
Leydig,
# ;
, - # ;
, - - # ;
- # ;
LH. O



, ;
, - ; ;
5.
(+) , (#) , () , (;)
-
552 OY

, , , - .
, , - O Peckham . -
- 23 -
, , , 1
25%.
, .
- .
> 400 mg/m2 -
. 19. Charing Cross20
O O (, , POMB / ACE (, , , -
), , , -D, -
Hodgkin, ) 1272 49%
80% .
10-12. O - , ,
VD (, , , -
) -
O Hodg- ,
kin - Sertoli Leydig.
, . -
13 FSH, 5 -
35% ABVD, , LH
, 100%, O - -
. , . o
O . FSH , LH
,
- 19739. FSH -
,
Hodgkin14. , , -
Hodgkin FSH -
. FSH -
2030%
15. inhibin Sertoli 21.
-
, - Leydig, LH-RH L
. Einhorn16 69 , -
, , (V , L , -
). . O
96% . L
23 , ,
- -
. - Leydig.
40 25
8 . 46% - 40 46% -
FSH, 75% L 75% -
. - .
17. 16-17.

, I OI H-
- H
. 77% -
17% 18.
VII. 553

, >3540 28,29.
- -
, - -
. .
-
196022 -
. - FSH, L (2)
- .
-
, - OE OI A
, - -
. -
, , , -
. - , -
33 .
. -
v
, -

23. 1971 -
- ,
,
24. . -
- -
- -
- . O -
(> 40), - -
- ,
, 25. FSH LH 30.
- . O
Henle et al31 n -
26. 25 -
O -
, - 2 . 70%
4050% 80% -
27. - . Au-
- bier32
< 25 , -
. ,

33. - ,


,
Leydig.
-


.



K-
-



. -
554 OY

-
33,34, - .
1
> 80% - 42 -
35 ,
, -
. . -
44,
- . 9 -
. , 50% -
- Hodgkin, Holmes Holmes45 -
- . -
36. O Byrne et al37 - 46,
2.000 - .
. - ,
,
, -
, . - , -
- .
,
. O OH A O
OI
OO A AO I ,
-
- . O -
38. -
- ,
- -
. O - , .. VD
(< 25 ), 39. Hodgkin.
.
OI O -
O OOO ,
- -
, - .
. - -
, - .
, Hodgkin -
. -
, .
. . -
- , -
. 40,41 20
- 106 /ml 50%. -
- ,
-
, .
16. Blatt 1980 Chapman , 2
198242,43 .
-
, .
VII. 555

.
- , -
.
, , - , -
n -
- ,
- 48.
. , LH-RH -
-
, -
n- .
, - ,
. - , -
- 49,50.
47. , - -
- -
. -
, , -
.

1. Robaire , Hales BF. Effects of paternal exposure to antican-
cer drugs on pregnancy outcome. An animal model. In: Mulvi-
hill JJ, Sherins RJ, eds. Reproductive Consequences of Cancer
and Cancer Therapy. New York: Roven Press, 1988.
2. Schilsky RJ, Lewis BJ, Sherins RJ, et al. Gonadal dysfunction
in patients receiving chemotherapy for cancer. Ann Intern Med
1980; 93: 109.
3. Sieber SM, Adamson RH. Toxicity of antineoplastic agents in
man. Chromosomal aberrations, antifertility effects, congeni-
tal malformations, and carcinogenic-potential. Adv Cancer Res
1975; 12: 57.
4. Meistrich ML. Relationship between spermatogonial stem cell
survival and testis function after cytotoxic chemotherapy. Br J
Cancer Suppl 1986; 7: 89-101.
5. Quershi MJA, Goldsmith HJ, Pennington HJ, et al. Cyclopho-
sphamide therapy and sterility. Lancet 1972; 2: 1290.
6. Spitz S. The histological effects of nitrogen mustards on hu-
man tumors and tissues. Cancer 1948; 1: 383-398.
7. Richter , Calamera JC, Morgengeld MD, et al. Effect on
chlorambucil on spermatogenesis in the human with malignant
lymphoma. Cancer 1970; 25: 1026.
8. Fairly KF, Barrie JU, Johnson W. Sterility and testicular atro-
phy related to cyclophosphamide therapy. Lancet 1972; 1: 568.
9. Sherins RJ, De Vita VT, Jr. Effect of drug treatment for lym-
phoma on male reproductive capacity. Annals of Internal Me-
dicine 1973; 79: 216-220.
10. Waxman JHX, Terry , Wrigley PFM, et al. Gonadal fun-
ction in Hodgkins disease. Long-term follow up of chemothe-
rapy. Br Med J 1982; 285: 1612.
11. Whitehead , Shalet SM, Blackledge G, et al. The effects of
Hodgkins disease and combination chemotherapy on gonadal
function in the adult male. Cancer 1982; 49: 418.
12. Charak BS, Gupta R, Mandrekar , et al. Testicular dysfun-
ction after cyclophosphamide -vincristine -procarbazine -pred-
nisolone chemotherapy for advanced Hodgkins disease.
long-term follow up study. Cancer 1990; 65: 1903.
13. Vivani S, Santoro , Ragri G, et al. Gonadal toxicity after
combination chemotherapy for Hodgkins disease: Comparati-
ve results of O vs ABVD. Eur J Cancer Clin Oncol 1985;
2: 601.
14. Rueffer U, Breuer K, Josting A, et al. Male gonadal dysfun-
ction in patients with Hodgkins disease prior to treatment.
Ann Oncol 2001; 12: 1307-11.
15. Redman JR, Bajorunas DR, Goldstein MC, Evenson DP,
Gralla RJ, Lacher MJ, Koziner B, Lee BJ, Straus DJ, Clarkson
BD, et al. Semen cryopreservation and artificial insemination
for Hodgkins disease. J Clin Oncol 1987 Feb; 5(2): 233-8.
16. Drasga RE, Einhorn LH, Williams SD, et al. Fertility after
chemotherapy for testicular cancer. Journal of Clinical Onco-
logy 1983; 1 (3): 179-183.
17. Johnson DH, Hainsworth JD, Linde RB, et al. Testicular fun-
ction following combination chemotherapy with cisplatin, vin-
blastine and bleomycin. Medical and Pediatric Oncology 1984;
12: 233-238.
18. Dragsa RE, Einhorn LH, Williams SD, et al. Fertility after
chemotherapy for testicular cancer. J Clin Oncol 1983; 1: 179-
83.
19. Pont J, Albrecht W. Fertility after chemotherapy for testicular
germ cell cancer. Fertil Steril 1997 Jul; (1): 1-5.
20. , , Rustin G, . -
.
1988; 53: 651-656.
21. Anawalt BD, Bebb RA, Matsumoto AM, Groome NP, Illing-
worth PJ, McNeilly AS, Bremmer WJ. Serum inhibin B levels
556
reflect Sertoli cell function in normal men and men with testi-
cular dysfunction. J Clin Endocrinol Metab 1996 Sep; 81(9):
3341-5.
22. Belohorsky , Siracky J, Sandor L, et al. Comments on the de-
velopment of amenorrhea caused by myleran in cases of chro-
nic myelosis. Neoplasma 1960; 4: 397-402.
23. Warne GL, Fairly , Hoobbs JB, et al. Cyclophosphamide-
induced ovarian failure. Engl J Med 1973; 289: 1159.
24. Sobrihno LG, Levine RA, DeConti RC, et al. Amenorrhea in
patients with Hodgkins disease treated with antineoplastic
agents. Am J Obstet Gynecol 1971; 109: 135.
25. Fisher , Sherman , Rockette , et al. L-phenylananine mu-
stard in the management of premenopausal patients with pri-
mary breast cancer. Cancer 1979; 44: 847.
26. Chapman RM, Sutcliff SB, Malpas JS. Cytotoxic-induced ova-
rian failure in women with Hodgkins disease. JAMA 1979;
241: 1880-1881.
27. Horning SJ, Hoppe RT, Kaplan HS, et al. Female reproducti-
ve potentiale after treatment for Hodgkins disease. Engl J
Med 1982; 304: 1378.
28. Schilsky RL, Sherins RJ, Hubbard SM, et al. Long-term follow
up of ovarian function in women treated with O chemo-
therapy for Hodgkins disease. Am J Med 1981; 71: 552.
29. Whitehead , Shalet SM, Blackledge G, et al. The effect of
combinantion chemotherapy on ovarian function in women
treated for Hodgkins disease. Cancer 1983; 52: 988.
30. Whitehead , Shalet SM, Morris-Jones , et al. Gonadal
function after combination disease in childhood. Arch Dis
Child 1981; 47: 287.
31. Henle TW, Burbige , Shepard BR. Chemotherapy and its
effects n testicular morphology in children. Urology 1984;
131: 1142-1144.
32. Aubier F, Flamant F, Branmer R, et al. Male gnadal function
after chemotherapy for solid tumors in children. J Clin Oncol
1989; 7: 304-309.
33. Chiu J, Drummond . Long-term follow up of cyclophos-
phamide therapy in frequent relapsing minimal lesion nephro-
tic syndrome. J Pediatr 1974; 84: 825.
34. De Grot GW, Faiman C, Winter JSD. Cyclophosphamide and
the prepubertal gonad: negative report. J Pediatr 1974; 84:
123-125.
35. Siris EJ, Leventhal BG, Vaitukaitis JL. Effects of childhood
leukemia and chemotherapy n puberty and reproductive fun-
ction in girls. Engl J Med 1976; 294: 1143.
OY
36. Nikosia SV, Mauts-Ridley , Meadows . Gonadal effects of
cancer therapy in girls. Cancer 1985; 55: 2364-2372.
37. Burne J, Mulvihill JJ, Myers . Effects of treatment n ferti-
lity in long-term survivors of childhood or adolescent cancer.
Engl J Med 1987; 313: 1315-1321.
38. Chatterjee R, Goldstone AH. Gonadal damage and effects on
fertility in adult patients with haematological malignancy un-
dergoing stem cell transplantation. Bone Marrow Transplant
1996 Jan; 17(1): 5-11.
39. Grigg AP, McLachlan R, Zaja J, Szer J. Reproductive status in
long-term bone marrow transplant survivors receiving busul-
fan-cyclophosphamide (120 mg/kg). Bone Marrow Transplant
2000 Nov; 26(10): 1089-95.
40. Li FP, Fine W, Jaffe , et al. Offspring of patients treated for
cancer in childhood. J Natl Cancer Inst 1979; 62: 1193-1197.
41. Rustin GJS, Botth , Dent J, et al. Pregnancy after cytotoxic
chemotherapy for gestational trophoblastic tumours. British
Medical Journal 1984; 1284: 103-106.
42. Blatt J, Julvihill JJ, Jiegler JL, et al. Pregnancy out-come fol-
lowing cancer chemotherapy. American Journal 1980; 69: 828-
832.
43. Chapman R. Effect of cytotoxic therapy n sexuality and go-
nad function. Seminars in Oncology 1982; 9,1: 84-89.
44. Senturia YD, Peckham CS, Peckham MJ. Children fathered by
men treated for testicular cancer. Lancet 1985: 766-769.
45. Holmes GE, Holmes FF. Pregnancy outcome of patients treat-
ed not Hodgkins disease. Cancer 1978; 41: 1317-1322.
46. McKeen , Mulvihill JJ, Rosner F, et al. Pregnant outcome
in Hodgkins disease. Lancet 1979: 590.
47. Radford JA, Lieberman BA, Brison DR, Smith AR, Critch-
clow JD, Russell SA, Watson AJ, Clayton JA, Harris M, Gos-
den RG, Shalet SM. Orthotopic reimplantation of cryopre-
served ovarian cortical strips after high-dose chemotherapy for
Hodgkins lymphoma. Lancet 2001 Apr 14; 357(9263): 1172-5.
48. Glode LM, Robinson J, Gould SF. Protection from cyclophos-
phamide-induced testicular damage with an analogue of gona-
dotrophin releasing hormone. Lancet 1981; 1: 1132-1134.
49. Johnson DH, Linda R, Hainsworth JD. Effect of luteinizing,
hormone releasing hormone agonist given during combination
chemotherapy n post therapy fertility in male patients with
lymphoma. Preliminary observations. Blood 1985; 65: 832-836.
50. Chapman RM, Sutcliffe SB. Protection of ovarian function by
oral contracaptives in women receiving chemotherapy for
Hodgkins disease. Blood 1981; 58: 849-851.

. .

( de novo)
- . -
- -
. - ,
- -
, -
- ,
.
- . -
, (, multidrug resistance
MDR).
. O
, de novo -
. -
- .
, Hodgkin, O
Hodgkins ,
. O
, , . -

, , -
, -
-
,
--

(. 1). O
. -
,
, ,
-

, .
-
, 1.
. 1. 2.
-

. - O

-

, , -
, -
- DNA
.

557
558 OY

O O -
,
, .
, , -
, , -
.
, - .
-

, -
. 10.000
,
100.000 ,
-
. -
, DNA
-
, (. 1).
,
. O
O
.
- , -
, -
. - .
, , -
, -
. , .
, - ,
1,2. -
- , -
- -
Hodgkins - . -
2.
- , -
. .
,
, -
-. , 3-6.

DNA


-

1. .
VII. 559

- 9,10.
. O-
- O
. -
-
, DNA11,12.
- , -
3,5,6. -
- -
DNA.
, - DNA
-
. O - 13,14.

, . -

O OO
. ,
-
DNA, -
. , -
DNA15.
, -
. -DNA
- -
, -
, ()16.
- O -
.
.
-
-
, -17-20.
. - -
- ,
6-, ,
-, 5-. - ,
, . -
- -
. (p53, p21, bax, bcl-2)
-
-, 21-23.
-
. OOOO O OO
- -
, CPT-11 (), -
- -
, .
CPT-11 SN-387,8. -
- - -
560 OY

, GST
- .
. -
, . Na+--
-
. , Na+--
. - .
,
GSH-x, ATP-
DNA. MRP131-37.
- GSH GST -
,
- , , ,
24. .
-
, , -
, 25-30.
BSO,
O -
(. 2).

. OO O
()
O OO
-
- .
- 1970
.
- (.. -
/ -S- (GSH /GST). ), -
GSH -

, (.. , -
. ). o-
- , 1976 Juliano Ling -

De novo



BCNU

GSH


GSH




( GSTs)

Na+
MRP (GSH-x)

2. (GSH/GST).
VII. 561

170- ABC (ATP-

kd 38. binding cassette) (. 3). -
- 4/11
-
. - (MHC), -
(CFTR),
, (SUR)
(.. - ItpgpA, -
)39. - -
40,41. -
, - ,
. - ,
.
- P-gp -
P-gp (Permeability glycoprotein P-gp) - -
- 7,
, MRP (MDR-related protein (MDR 1, MDR 2/3) (mdr 1,
MRP). mdr 2, mdr 3)42,43. -
P-gp
. -
,
- , -
. Golgi44. O
MDR 1 -
- , MDR 2/3 -
- .
. MDR 1 -
. MDR 1
O O , , , -
O -gp , , , -
H P-gp 1976 , -
- -
38. P-gp ,
170-kDa - 45-47. P-gp

1 2 3 4 5 6 7 8 9 10 11 12

A B A
B
ATP ATP
site site

S S



2

COOH
D1 NBD2

3. -.
562 OY

2. O P-gp

- -
. -


mRNA
Vinca 58. O -
P-gp 50%59,60.
C
OOO O
-D O P-gp

Ethidium Bromide H P-gp
() -
2 . -

P-gp
, ,
, - C,
61.
, 46. -
P-gp -
-
-
P-gp (.. ), -
1990. -
-
-
(. 2).
, -
MDR 1
62.
(O),
O P-gp , -
() -
, , -
. P-gp -
,
-
P-gp -
P-gp48,49 (. 2). - , -
- .
P-gp P-gp
50-51. .
P-gp ( , - O P-gp,
, - , , (PSC 833)
, , Wilms) - (VX-710), -
, - . O -
PSC 833, -
52,53. -
1020 . -
P-gp -
P-gp PSC 833
. - 20%
63,64. -
- P-gp
-
. - 65,66.
(, , - -
), (.. ), -
(.. ) - .
(PSC 833) 54-57.
VII. 563

, 3. O MRP
(34) P450,
-
.


P-gp, , MRP 1. - Vinca

, - O

- -

, LTC4
P- GSH
gp, 67,68.
O
MDR 181. MRP -
-
, , , -
, -
, -
-
82,83, -
69. O
MRP P-gp84,85. MRP,
P450
P-gp, -
P-gp, -
ABC,
70,71. -

- 81. MRP

. O- (Multispe-
P-gp cific Organic Anion Transporter MOAT),
- MRP 1 MRP 2, MRP
(XR 9576), (LY 35979), - 3, MRP 4, MRP 586. MRP 1 -
(R 101933) O-09372-76. -
O XR 9576 87. O
P-gp. P-gp RP 1
, -
. XR 9576 ,
48 ,
, -
, 77,78. - MRP1 (. 3). MRP 1
, - -
, . , P-gp88. H
XR 9576 - MRP 1
73-76. .
, --
O O 4 (LTC4) -
MRP 1, 2, ,
, ,
P-gp -
. MRP - 89,90.
,
H69 79,80. MRP 1 (
16p13.1 - ), -
190- MRP 1. H RP 1
kDa, -
, -
. MRP 1 15%
564 OY

, - . -
87. - LRP
MRP 1 P-gp MRP 1
, P-gp , ,
91. , ,
mRNA MRP 106.
, , ,
, , . O
92,93. - LRP -
, , , - , P-gp MRP45. O
. O - LRP
MRP - P-
. O MRP - gp MRP (, ),
(O, O, ) -
( )94- , , -
96. MRP
107. LRP
-
, - , ,
96-98. O O108,109.
-

(5%
C 60% ),
- 110.
. -
MHC1, O
99,100. - O
(tap-1 tap-
O O OOO-
2) -

. tap-1
tap-2 tap - O DNA -
, -
101. - DNA.
. DNA , -
DNA
O 111. O -
O LRP DNA, -
(Lung-Resistance Protein) , -
- DNA. -
, - :
. - DNA,
ABC - -
DNA.
. , ,
LRP (17q21 3q
P-gp. H LRP )
102,103. . -
S, - -
, - -
- 25. O
104,105. , -
- , ,
VII. 565

(, ), - -
(mAMSA), (), -DNA.
(-), - -
(, ), -
(-). - -,
-
.
DNA-- -DNA,
(cleavable complex). H - .
- , - -
DNA, - .
, DNA
. O O
30 -
-
. .
O -
(P-gp, MRP) -
. -
. O
- - -
(, -
), - : -
- (), 5-
. (5-Fu) - (Ara-C).
- H MTX -
,
. , -
, .
. - -
- - . O
- (RFC),
. - 113, -
- , -

- - . -
- 26,27,112.
- - , -
. (DHFR). DHFR
- - ,
28. - -

G2/M , DNA113-115.
-
S .
-I
. O .
-, -
, - RFC -
. O - .
- RFC
566 OY

. , -
DHFR S .
- dCK -
2030% -
O 116. 125. -
DHFR, -
- Ara-C.
, -
O
117. -

-
- -
118. -
5- (5-Fu) -
- , P-gp MRP.
, -
. > 50% - .
. T
- ,
- .
(S) 5- -
FdUMP. 5-Fu , - -. -
5-FUTP 5-FdUTP, - - - -
RNA DNA 20 .
DNA. vinca (, ) -
5-Fu - - -
. - -
TS FdUMP
, . O -
-

119. TS -
-, -
dUMP dTMP. -

5-Fu FdUMP
,
, -,
, - .
. -
5-Fu. -
- (P-
TS TS gp, MRP),
120-122. .
Ara-C -
-
. - .
123.
-
Ara-CTP, .
DNA , -
DNA - -
DNA . 126-128.
Ara-C S -
, DNA124. O -
Ara-C -
O-
VII. 567

. O - -DNA
, - . -
DNA (-CG, -G)
. ,
- DNA
ERCC1 ERCC4 -
130-132.
+/+ ATP-, -
MRP 2. - O O-
- OO
-
DNA ,
. -
-S-. . -
, - , -
-S-, ,
129. , -
- 21,133-135. ,

, ,
rNTP, DNA
, (, )
(SV40-Tag,
HPV-E6, Adeno-E1a, ATM ( DNA)
Adeno-E7, HBx)

p53 p53

Pag,
MRP

-
-
p53

(.. RPA, XPB, Topo I, XPD)

MDM2 p21 GADD45 Bax Bcl-2 CD95 TSP

PCNA

DNA

DNA
CDKs
pRb
-pRb/E2F
() E2F
()

4. - p53.
568 OY

, - p53 P-gp137
(. 4). p53 -
G2/M -
G1, , - , -
. , , -
. . -
- p53, -

. , - 138. , -
-
, p53. -
p53 ,
- -.
.
, p53
.
-
p53
. -
- p53 -
- -
- -
G1/S G2/M, - in vitro.
22.
p53
, , , - . O -
, ,
DNA 129, -
136 (. 4). ,
p53 -
, - in vitro
,
p53 50% . .
p53, - -
,
- .
p53 -
- , -
p53 . , ,
p53 ,
MDR 1 - -
. .

1. Bonadonna G, Valagussa P. Dose-response effect of adjuvant
chemotherapy in breast cancer. N Engl J Med 1981; 304(1):
10-15.
2. Savarese DM, Hsieh C, Stewart FM. Clinical impact of che-
motherapy dose escalation in patients with hematologic mali-
gnancies and solid tumors. J Clin Oncol 1997; 15(8): 2981-
2995.
3. Dixon KH, Lanpher BC, Chiu J, Kelley K, Cowan KH. A no-
vel cDNA restores reduced folate carrier activity and metho-
trexate sensitivity to transport deficient cells. J Biol Chem
1994; 269(1): 17-20.
4. Gottesman MM, Pastan I. Biochemistry of multidrug resistan-
ce mediated by the multidrug transporter. Ann Rev Biochem
1993; 62: 385-427.
5. Hill BT, Bailey BD, White JC, Goldman ID. Characteristics of
transport of 4-amino antifolates and folate compounds by two
VII.
lines of L5178Y lymphoblasts, one with impaired transport of
methotrexate. Cancer Res 1979; 39(7 Pt 1): 2440-2446.
6. Sirotnak FM, Moccio DM, Kelleher LE, Goutas LJ. Relative
frequency and kinetic properties of transport-defective pheno-
types among methotrexate-resistant L1210 clonal cell lines de-
rived in vivo. Cancer Res 1981; 41(11 Pt 1): 4447-4452.
7. Haaz MC, Rivory LP, Riche C, Robert J. The transformation
of irinotecan (CPT-11) to its active metabolite SN-38 by hu-
man liver microsomes. Differential hydrolysis for the lactone
and carboxylate forms. Naunyn Schmiedebergs Arch Pharma-
col 1997; 356(2): 257-262.
8. Kanzawa F, Sugimoto Y, Minato K, Kasahara K, Bungo M,
Nakagawa K, et al. Establishment of a camptothecin analogue
(CPT-11)-resistant cell line of human non-small cell lung can-
cer: characterization and mechanism of resistance. Cancer Res
1990; 50(18): 5919-5924.
9. Hunt SW, III, Hoffee PA. Amplification of adenosine deami-
nase gene sequences in deoxycoformycin-resistant rat hepato-
ma cells. J Biol Chem 1983; 258(21): 13185-13192.
10. Steuart CD, Burke PJ. Cytidine deaminase and the develop-
ment of resistance to arabinosyl cytosine. Nat New Biol 1971;
233(38): 109-110.
11. Brookes P, Lawley PD. Evidence for the action of alkylating
agents on deoxyribonucleic acid. Exp Cell Res 1963; 24 (Suppl):
9-4.
12. Kohn KW, Spears CL, Doty P. Inter-strand crosslinking of
DNA by nitrogen mustard. J Mol Biol 1966; 19(2): 266-288.
13. Reed E. Platinum-DNA adduct, nucleotide excision repair and
platinum based anti-cancer chemotherapy. Cancer Treat Rev
1998; 24(5): 331-344.
14. Ewig RA, Kohn KW. DNA damage and repair in mouse leu-
kemia L1210 cells treated with nitrogen mustard, 1,3-bis(2-
chloroethyl)-1-nitrosourea, and other nitrosoureas. Cancer Res
1977; 37(7 Pt 1): 2114-2122.
15. Perez RP. Cellular and molecular determinants of cisplatin re-
sistance. Eur J Cancer 1998; 34(10): 1535-1542.
16. Barry MA, Behnke CA, Eastman A. Activation of programm-
ed cell death (apoptosis) by cisplatin, other anticancer drugs,
toxins and hyperthermia. Biochem Pharmacol 1990; 40(10):
2353-2362.
17. Lowe SW, Ruley HE, Jacks T, Housman DE. p53-dependent
apoptosis modulates the cytotoxicity of anticancer agents. Cell
1993; 74(6): 957-967.
18. Reed JC. Bcl-2 family proteins: regulators of apoptosis and
chemoresistance in hematologic malignancies. Semin Hematol
1997; 34(4 Suppl 5): 9-19.
19. Schmitt CA, Lowe SW. Apoptosis and therapy. J Pathol 1999;
187(1): 127-137.
20. Zunino F, Perego P, Pilotti S, Pratesi G, Supino R, Arcamone
F. Role of apoptotic response in cellular resistance to cytotoxic
agents. Pharmacol Ther 1997; 76(1-3): 177-185.
21. Wyllie AH, Kerr JF, Currie AR. Cell death: the significance of
apoptosis. Int Rev Cytol 1980; 68: 251-306.
22. Lane DP. p53 and human cancers. Br Med Bull 1994; 50(3):
582-599.
23. Chiou SK, Rao L, White E. Bcl-2 blocks p53-dependent apo-
569
ptosis. Mol Cell Biol 1994; 14(4): 2556-2563.
24. Flintoff WF, Essani K. Methotrexate-resistant Chinese ham-
ster ovary cells contain a dihydrofolate reductase with an alter-
ed affinity for methotrexate. Biochemistry 1980; 19(18): 4321-
4327.
25. Hwang J, Hwong CL. Cellular regulation of mammalian DNA
topoisomerases. Adv Pharmacol 1994; 29A: 167-189.
26. Kapoor R, Slade DL, Fujimori A, Pommier Y, Harker WG.
Altered topoisomerase I expression in two subclones of human
CEM leukemia selected for resistance to camptothecin. Oncol
Res 1995; 7(2): 83-95.
27. Potmesil M, Hsiang YH, Liu LF, Bank B, Grossberg H, Kir-
schenbaum S, et al. Resistance of human leukemic and normal
lymphocytes to drug-induced DNA cleavage and low levels of
DNA topoisomerase II. Cancer Res 1988; 48(12): 3537-3543.
28. Sullivan DM, Latham MD, Ross WE. Proliferation-dependent
topoisomerase II content as a determinant of antineoplastic
drug action in human, mouse, and Chinese hamster ovary cells.
Cancer Res 1987; 47(15): 3973-3979.
29. Beck WT, Danks MK, Wolverton JS, Chen M, Granzen B,
Kim R, et al. Resistance of mammalian tumor cells to inhibi-
tors of DNA topoisomerase II. Adv Pharmacol 1994; 29B: 145-
169.
30. Ritke MK, Murray NR, Allan WP, Fields AP, Yalowich JC.
Hypophosphorylation of topoisomerase II in etoposide (VP-
16)-resistant human leukemia K562 cells associated with re-
duced levels of beta II protein kinase C. Mol Pharmacol 1995;
48(5): 798-805.
31. Lash LH, Jones DP. Renal glutathione transport. Characteri-
stics of the sodium-dependent system in the basal-lateral mem-
brane. J Biol Chem 1984; 259(23): 14508-14514.
32. Hinchman CA, Truong AT, Ballatori N. Hepatic uptake of in-
tact glutathione S-conjugate, inhibition by organic anions, and
sinusoidal catabolism. Am J Physiol 1993; 265(3 Pt 1): G547-
G554.
33. Loe DW, Stewart RK, Massey TE, Deeley RG, Cole SP. ATP-
dependent transport of aflatoxin B1 and its glutathione conju-
gates by the product of the multidrug resistance protein (MRP)
gene. Mol Pharmacol 1997; 51(6): 1034-1041.
34. Gupta V, Jani JP, Jacobs S, Levitt M, Fields L, Awasthi S, et
al. Activity of melphalan in combination with the glutathione
transferase inhibitor sulfasalazine. Cancer Chemother Phar-
macol 1995; 36(1): 13-19.
35. Prezioso JA, Fitzgerald GB, Wick MM. Melanoma cytotoxicity
of buthionine sulfoximine (BSO) alone and in combination with
3,4-dihydroxybenzylamine and melphalan. J Invest Dermatol
1992; 99(3): 289-293.
36. ODwyer PJ, LaCreta F, Nash S, Tinsley PW, Schilder R,
Clapper ML, et al. Phase I study of thiotepa in combination
with the glutathione transferase inhibitor ethacrynic acid. Can-
cer Res 1991; 51(22): 6059-6065.
37. Lyttle MH, Hocker MD, Hui HC, Caldwell CG, Aaron DT,
Engqvist-Goldstein A, et al. Isozyme-specific glutathione-S-
transferase inhibitors: design and synthesis. J Med Chem 1994;
37(1): 189-194.
38. Juliano RL, Ling V. A surface glycoprotein modulating drug
570
permeability in Chinese hamster ovary cell mutants. Biochem
Biophys Acta 1976; 455(1): 152-162.
39. Sirotnak FM, Moccio DM, Young CW. Increased accumula-
tion of methotrexate by murine tumor cells in vitro in the pre-
sence of probenecid which is mediated by a preferential inhibi-
tion of efflux. Cancer Res 1981; 41(3): 966-970.
40. Aguilar-Bryan L, Nichols CG, Wechsler SW, Clement JP,
Boyd AE, III, Gonzalez G, et al. Cloning of the beta cell high-
affinity sulfonylurea receptor: a regulator of insulin secretion.
Science 1995; 268(5209): 423-426.
41. Papadopoulou B, Roy G, Dey S, Rosen BP, Ouellette M. Con-
tribution of the Leishmania P-glycoprotein-related gene ItpgpA
to oxyanion resistance. J Biol Chem 1994; 269(16): 11980-11986.
42. Ling V. Multidrug resistance: molecular mechanisms and clini-
cal relevance. Cancer Chemother Pharmacol 1997; 40 Suppl:
S3-S8.
43. Chen CJ, Chin JE, Ueda K, Clark DP, Pastan I, Gottesman
MM, et al. Internal duplication and homology with bacterial
transport proteins in the mdr1 (P-glycoprotein) gene from mul-
tidrug-resistant human cells. Cell 1986; 47(3): 381-389.
44. Willingham MC, Richert ND, Cornwell MM, Tsuruo T, Ha-
mada H, Gottesman MM, et al. Immunocytochemical localiza-
tion of P170 at the plasma membrane of multidrug-resistant
human cells. J Histochem Cytochem 1987; 35(12): 1451-1456.
45. Cordon-Cardo C, OBrien JP, Boccia J, Casals D, Bertino JR,
Melamed MR. Expression of the multidrug resistance gene
product (P-glycoprotein) in human normal and tumor tissues.
J Histochem Cytochem 1990; 38(9): 1277-1287.
46. Cordon-Cardo C, OBrien JP, Casals D, Rittman-Grauer L,
Biedler JL, Melamed MR, et al. Multidrug-resistance gene (P-
glycoprotein) is expressed by endothelial cells at blood-brain
barrier sites. Proc Natl Acad Sci USA 1989; 86(2): 695-698.
47. Fojo AT, Ueda K, Slamon DJ, Poplack DG, Gottesman MM,
Pastan I. Expression of a multidrug-resistance gene in human
tumors and tissues. Proc Natl Acad Sci USA 1987; 84(1): 265-
269.
48. Bosch I, Croop J. P-glycoprotein multidrug resistance and can-
cer. Biochem Biophys Acta 1996; 1288(2): F37-F54.
49. Goldstein LJ, Galski H, Fojo A, Willingham M, Lai SL, Gaz-
dar A, et al. Expression of a multidrug resistance gene in hu-
man cancers. J Natl Cancer Inst 1989; 81(2): 116-124.
50. Chan HS, Thorner PS, Haddad G, Ling V. Immunohistoche-
mical detection of P-glycoprotein: prognostic correlation in soft
tissue sarcoma of childhood. J Clin Oncol 1990; 8(4): 689-704.
51. Chan HS, Haddad G, Thorner PS, DeBoer G, Lin YP, Ondru-
sek N, et al. P-glycoprotein expression as a predictor of the
outcome of therapy for neuroblastoma. N Engl J Med 1991;
325(23): 1608-1614.
52. Lai SL, Goldstein LJ, Gottesman MM, Pastan I, Tsai CM,
Johnson BE, et al. MDR1 gene expression in lung cancer. J
Natl Cancer Inst 1989; 81(15): 1144-1150.
53. Savaraj N, Wu CJ, Xu R, Lampidis T, Lai S, Donnelly E, et al.
Multidrug-resistant gene expression in small-cell lung cancer.
Am J Clin Oncol 1997; 20(4): 398-403.
54. Dalton WS, Crowley JJ, Salmon SS, Grogan TM, Laufman
LR, Weiss GR, et al. A phase III randomized study of oral ve-
OY
rapamil as a chemosensitizer to reverse drug resistance in pa-
tients with refractory myeloma. A Southwest Oncology Group
study. Cancer 1995; 75(3): 815-820.
55. Naito M, Tsuruo T. New multidrug-resistance-reversing drugs,
MS-209 and SDZ PSC 833. Cancer Chemother Pharmacol 1997;
40 Suppl: S20-S24.
56. Shrivastava P, Hanibuchi M, Yano S, Parajuli P, Tsuruo T, So-
ne S. Circumvention of multidrug resistance by a quinoline de-
rivative, MS-209, in multidrug-resistant human small-cell lung
cancer cells and its synergistic interaction with cyclosporin A
or verapamil. Cancer Chemother Pharmacol 1998; 42(6): 483-
490.
57. Smith AJ, Mayer U, Schinkel AH, Borst P. Availability of
PSC833, a substrate and inhibitor of P-glycoproteins, in va-
rious concentrations of serum. J Natl Cancer Inst 1998; 90(15):
1161-1166.
58. Wagner RW. The state of the art in antisense research. Nat
Med 1995; 1(11): 1116-1118.
59. Cucco C, Calabretta B. In vitro and in vivo reversal of multi-
drug resistance in a human leukemia-resistant cell line by mdr1
antisense oligodeoxynucleotides. Cancer Res 1996; 56(19): 4332-
4337.
60. Hanchett LA, Baker RM, Dolnick BJ. Subclonal heterogeneity
of the multidrug resistance phenotype in a cell line expressing
antisense MDR1 RNA. Somat Cell Mol Genet 1994; 20(6):
463-480.
61. Ferry DR, Traunecker H, Kerr DJ. Clinical trials of P-glyco-
protein reversal in solid tumours. Eur J Cancer 1996; 32A(6):
1070-1081.
62. Chan HS, DeBoer G, Thiessen JJ, Budning A, Kingston JE,
OBrien JM, et al. Combining cyclosporin with chemotherapy
controls intraocular retinoblastoma without requiring radia-
tion. Clin Cancer Res 1996; 2(9): 1499-1508.
63. Coley HM, Verrill MW, Gregson SE, Odell DE, Fisher C, Jud-
son IR. Incidence of P-glycoprotein overexpression and multi-
drug resistance (MDR) reversal in adult soft tissue sarcoma.
Eur J Cancer 2000; 36(7): 881-888.
64. Coley HM, Sargent JM, Williamson CJ, Titley J, Scheper RJ,
Gregson SE, et al. Assessment of the classical MDR phenoty-
pe in epithelial ovarian carcinoma using primary cultures: a
feasibility study. Anticancer Res 2002; 22(1A): 69-74.
65. Chico I, Kang MH, Bergan R, Abraham J, Bakke S, Meadows
B, et al. Phase I study of infusional paclitaxel in combination
with the P-glycoprotein antagonist PSC 833. J Clin Oncol
2001; 19(3): 832-842.
66. Advani R, Saba HI, Tallman MS, Rowe JM, Wiernik PH, Ra-
mek J, et al. Treatment of refractory and relapsed acute mye-
logenous leukemia with combination chemotherapy plus the
multidrug resistance modulator PSC 833 (Valspodar). Blood
1999; 93(3): 787-795.
67. Gottesman MM, Fojo T, Bates SE. Multidrug resistance in
cancer: role of ATP-dependent transporters. Nat Rev Cancer
2002; 2(1): 48-58.
68. Fischer V, Rodriguez-Gascon A, Heitz F, Tynes R, Hauck C,
Cohen D, et al. The multidrug resistance modulator valspodar
(PSC 833) is metabolized by human cytochrome P450 3A. Im-
plications for drug-drug interactions and pharmacological acti-
VII.
vity of the main metabolite. Drug Metab Dispos 1998; 26(8):
802-811.
69. Krishna R, Mayer LD. Multidrug resistance (MDR) in cancer.
Mechanisms, reversal using modulators of MDR and the role
of MDR modulators in influencing the pharmacokinetics of
anticancer drugs. Eur J Pharm Sci 2000; 11(4): 265-283.
70. Mistry P, Stewart AJ, Dangerfield W, Okiji S, Liddle C, Bootle
D, et al. In vitro and in vivo reversal of P-glycoprotein-mediat-
ed multidrug resistance by a novel potent modulator, XR9576.
Cancer Res 2001; 61(2): 749-758.
71. Dantzig AH, Shepard RL, Cao J, Law KL, Ehlhardt WJ,
Baughman TM, et al. Reversal of P-glycoprotein-mediated mul-
tidrug resistance by a potent cyclopropyldibenzosuberane mo-
dulator, LY335979. Cancer Res 1996; 56(18): 4171-4179.
72. Dantzig AH, Shepard RL, Law KL, Tabas L, Pratt S, Gillespie
JS, et al. Selectivity of the multidrug resistance modulator,
LY335979, for P-glycoprotein and effect on cytochrome P-450
activities. J Pharmacol Exp Ther 1999; 290(2): 854-862.
73. Roe M, Folkes A, Ashworth P, Brumwell J, Chima L, Hunjan
S, et al. Reversal of P-glycoprotein mediated multidrug resi-
stance by novel anthranilamide derivatives. Bioorg Med Chem
Lett 1999; 9(4): 595-600.
74. Starling JJ, Shepard RL, Cao J, Law KL, Norman BH, Kroin
JS, et al. Pharmacological characterization of LY335979: a po-
tent cyclopropyldibenzosuberane modulator of P-glycoprotein.
Adv Enzyme Regul 1997; 37: 335-347.
75. van Zuylen L, Nooter K, Sparreboom A, Verweij J. Develop-
ment of multidrug-resistance convertors: sense or nonsense?
Invest New Drugs 2000; 18(3): 205-220.
76. Newman MJ, Rodarte JC, Benbatoul KD, Romano SJ, Zhang
C, Krane S, et al. Discovery and characterization of OC144-
093, a novel inhibitor of P-glycoprotein-mediated multidrug
resistance. Cancer Res 2000; 60(11): 2964-2972.
77. Abraham J, Edgerly M, Wilson R. A phase I study of the novel
P-glycoprotein (Pgp) antagonist, XR9576 in combination with
vinorelbine. Proc Am Soc Clin Oncol 2001; 20: 287.
78. Fracasso PM, Westervelt P, Fears CL, Rosen DM, Zuhowski
EG, Cazenave LA, et al. Phase I study of paclitaxel in combi-
nation with a multidrug resistance modulator, PSC 833 (Vals-
podar), in refractory malignancies. J Clin Oncol 2000; 18(5):
1124-1134.
79. Cole SP, Bhardwaj G, Gerlach JH, Mackie JE, Grant CE,
Almquist KC, et al. Overexpression of a transporter gene in a
multidrug-resistant human lung cancer cell line. Science 1992;
258(5088): 1650-1654.
80. Mirski SE, Gerlach JH, Cole SP. Multidrug resistance in a hu-
man small cell lung cancer cell line selected in adriamycin.
Cancer Res 1987; 47(10): 2594-2598.
81. Cole SP, Sparks KE, Fraser K, Loe DW, Grant CE, Wilson
GM, et al. Pharmacological characterization of multidrug resi-
stant MRP-transfected human tumor cells. Cancer Res 1994;
54(22): 5902-5910.
82. Barrand MA, Heppell-Parton AC, Wright KA, Rabbitts PH,
Twentyman PR. A 190-kilodalton protein overexpressed in
non-P-glycoprotein-containing multidrug-resistant cells and its
relationship to the MRP gene. J Natl Cancer Inst 1994; 86(2):
110-117.
571
83. Tasaki Y, Nakagawa M, Ogata J, Kiue A, Tanimura H, Ku-
wano M, et al. Reversal by a dihydropyridine derivative of non-
P-glycoprotein-mediated multidrug resistance in etoposide-
resistant human prostatic cancer cell line. J Urol 1995; 154(3):
1210-1216.
84. Hasegawa S, Abe T, Naito S, Kotoh S, Kumazawa J, Hipfner
DR, et al. Expression of multidrug resistance-associated pro-
tein (MRP), MDR1 and DNA topoisomerase II in human
multidrug-resistant bladder cancer cell lines. Br J Cancer 1995;
71(5): 907-913.
85. Slapak CA, Mizunuma N, Kufe DW. Expression of the multi-
drug resistance associated protein and P-glycoprotein in doxo-
rubicin-selected human myeloid leukemia cells. Blood 1994;
84(9): 3113-3121.
86. Kool M, de Haas M, Scheffer GL, Scheper RJ, van Eijk MJ,
Juijn JA, et al. Analysis of expression of cMOAT (MRP2),
MRP3, MRP4, and MRP5, homologues of the multidrug resi-
stance-associated protein gene (MRP1), in human cancer cell
lines. Cancer Res 1997; 57(16): 3537-3547.
87. Breuninger LM, Paul S, Gaughan K, Miki T, Chan A, Aaron-
son SA, et al. Expression of multidrug resistance-associated
protein in NIH/3T3 cells confers multidrug resistance associat-
ed with increased drug efflux and altered intracellular drug di-
stribution. Cancer Res 1995; 55(22): 5342-5347.
88. Zaman GJ, Flens MJ, van Leusden MR, de Haas M, Mulder
HS, Lankelma J, et al. The human multidrug resistance-asso-
ciated protein MRP is a plasma membrane drug-efflux pump.
Proc Natl Acad Sci USA 1994; 91(19): 8822-8826.
89. Evers R, Cnubben NH, Wijnholds J, van Deemter L, van Bla-
deren PJ, Borst P. Transport of glutathione prostaglandin A
conjugates by the multidrug resistance protein 1. FEBS Lett
1997; 419(1): 112-116.
90. Zaman GJ, Cnubben NH, van Bladeren PJ, Evers R, Borst P.
Transport of the glutathione conjugate of ethacrynic acid by
the human multidrug resistance protein MRP. FEBS Lett 1996;
391(1-2): 126-130.
91. Keppler D, Leier I, Jedlitschky G. Transport of glutathione
conjugates and glucuronides by the multidrug resistance pro-
teins MRP1 and MRP2. Biol Chem 1997; 378(8): 787-791.
92. Kruh GD, Gaughan KT, Godwin A, Chan A. Expression pat-
tern of MRP in human tissues and adult solid tumor cell lines.
J Natl Cancer Inst 1995; 87(16): 1256-1258.
93. Zaman GJ, Versantvoort CH, Smit JJ, Eijdems EW, de Haas
M, Smith AJ, et al. Analysis of the expression of MRP, the
gene for a new putative transmembrane drug transporter, in
human multidrug resistant lung cancer cell lines. Cancer Res
1993; 53(8): 1747-1750.
94. Willman CL. The prognostic significance of the expression and
function of multidrug resistance transporter proteins in acute
myeloid leukemia: studies of the Southwest Oncology Group
Leukemia Research Program. Semin Hematol 1997; 34(4 Suppl
5): 25-33.
95. Broxterman HJ, Giaccone G, Lankelma J. Multidrug resistan-
ce proteins and other drug transport-related resistance to na-
tural product agents. Curr Opin Oncol 1995; 7(6): 532-540.
96. Berger W, Hauptmann E, Elbling L, Vetterlein M, Kokoschka
EM, Micksche M. Possible role of the multidrug resistance-as-
572
sociated protein (MRP) in chemoresistance of human melano-
ma cells. Int J Cancer 1997; 71(1): 108-115.
97. Norris MD, Bordow SB, Marshall GM, Haber PS, Cohn SL,
Haber M. Expression of the gene for multidrug-resistance-as-
sociated protein and outcome in patients with neuroblastoma.
N Engl J Med 1996; 334(4): 231-238.
98. Zhou DC, Zittoun R, Marie JP. Expression of multidrug resi-
stance-associated protein (MRP) and multidrug resistance
(MDR1) genes in acute myeloid leukemia. Leukemia 1995; 9
(10): 1661-1666.
99. Elliott T. How does TAP associate with MHC class I molecu-
les? Immunol Today 1997; 18(8): 375-379.
100. Neefjes JJ, Momburg F, Hammerling GJ. Selective and ATP-
dependent translocation of peptides by the MHC-encoded
transporter. Science 1993; 261(5122): 769-771.
101. Izquierdo MA, Neefjes JJ, Mathari AE, Flens MJ, Scheffer
GL, Scheper RJ. Overexpression of the ABC transporter TAP
in multidrug-resistant human cancer cell lines. Br J Cancer
1996; 74(12): 1961-1967.
102. Scheffner M, Werness BA, Huibregtse JM, Levine AJ, How-
ley PM. The E6 oncoprotein encoded by human papillomavi-
rus types 16 and 18 promotes the degradation of p53. Cell
1990; 63(6): 1129-1136.
103. Scheper RJ, Broxterman HJ, Scheffer GL, Kaaijk P, Dalton
WS, van Heijningen TH, et al. Overexpression of a M(r) 110,000
vesicular protein in non-P-glycoprotein-mediated multidrug
resistance. Cancer Res 1993; 53(7): 1475-1479.
104. Chugani DC, Kedersha NL, Rome LH. Vault immunofluore-
scence in the brain: new insights regarding the origin of mi-
croglia. J Neurosci 1991; 11(1):256-268.
105. Chugani DC, Rome LH, Kedersha NL. Evidence that vault ri-
bonucleoprotein particles localize to the nuclear pore com-
plex. J Cell Sci 1993; 106 (Pt 1):23-29.
106. Izquierdo MA, Scheffer GL, Flens MJ, Giaccone G, Broxter-
man HJ, Meijer CJ, et al. Broad distribution of the multidrug
resistance-related vault lung resistance protein in normal hu-
man tissues and tumors. Am J Pathol 1996; 148(3): 877-887.
107. Izquierdo MA, Shoemaker RH, Flens MJ, Scheffer GL, Wu
L, Prather TR, et al. Overlapping phenotypes of multidrug re-
sistance among panels of human cancer-cell lines. Int J Can-
cer 1996; 65(2): 230-237.
108. Izquierdo MA, van der Zee AG, Vermorken JB, van der Valk
P, Belien JA, Giaccone G, et al. Drug resistance-associated
marker Lrp for prediction of response to chemotherapy and
prognoses in advanced ovarian carcinoma. J Natl Cancer Inst
1995; 87(16): 1230-1237.
109. den Boer ML, Pieters R, Kazemier KM, Rottier MM, Zwaan
CM, Kaspers GJ, et al. Relationship between major vault pro-
tein/lung resistance protein, multidrug resistance-associated
protein, P-glycoprotein expression, and drug resistance in child-
hood leukemia. Blood 1998; 91(6): 2092-2098.
110. Dingemans AM, Ark-Otte J, van der Valk P, Apolinario RM,
Scheper RJ, Postmus PE, et al. Expression of the human ma-
jor vault protein LRP in human lung cancer samples and nor-
mal lung tissues. Ann Oncol 1996; 7(6): 625-630.
111. Wang JC. DNA topoisomerases: why so many? J Biol Chem
OY
1991; 266(11): 6659-6662.
112. Kaufmann SH, McLaughlin SJ, Kastan MB, Liu LF, Karp JE,
Burke PJ. Topoisomerase II levels during granulocytic matu-
ration in vitro and in vivo. Cancer Res 1991; 51(13): 3534-3543.
113. Henderson GB, Tsuji JM, Kumar HP. Transport of folate
compounds by leukemic cells. Evidence for a single influx car-
rier for methotrexate, 5-methyltetrahydrofolate, and folate in
CCRF-CEM human lymphoblasts. Biochem Pharmacol 1987;
36(18): 3007-3014.
114. Moscow JA, Gong M, He R, Sgagias MK, Dixon KH, Anzick
SL, et al. Isolation of a gene encoding a human reduced folate
carrier (RFC1) and analysis of its expression in transport-de-
ficient, methotrexate-resistant human breast cancer cells. Can-
cer Res 1995; 55(17): 3790-3794.
115. Wong SC, Proefke SA, Bhushan A, Matherly LH. Isolation of
human cDNAs that restore methotrexate sensitivity and re-
duced folate carrier activity in methotrexate transport-defecti-
ve Chinese hamster ovary cells. J Biol Chem 1995; 270(29):
17468-17475.
116. Matherly LH, Taub JW, Ravindranath Y, Proefke SA, Wong
SC, Gimotty P, et al. Elevated dihydrofolate reductase and
impaired methotrexate transport as elements in methotrexate
resistance in childhood acute lymphoblastic leukemia. Blood
1995; 85(2): 500-509.
117. Schweitzer BI, Dicker AP, Bertino JR. Dihydrofolate redu-
ctase as a therapeutic target. FASEB J 1990; 4(8): 2441-2452.
118. Rhee MS, Wang Y, Nair MG, Galivan J. Acquisition of resi-
stance to antifolates caused by enhanced gamma-glutamyl hy-
drolase activity. Cancer Res 1993; 53(10 Suppl): 2227-2230.
119. Peters GJ, van der Wilt CL, van Groeningen CJ, Smid K,
Meijer S, Pinedo HM. Thymidylate synthase inhibition after
administration of fluorouracil with or without leucovorin in
colon cancer patients: implications for treatment with fluo-
rouracil. J Clin Oncol 1994; 12(10): 2035-2042.
120. van der Wilt CL, Pinedo HM, de Jong M, Peters GJ. Effect of
folate diastereoisomers on the binding of 5-fluoro-2-deoxyu-
ridine-5-monophosphate to thymidylate synthase. Biochem
Pharmacol 1993; 45(5): 1177-1179.
121. Bapat AR, Zarow C, Danenberg PV. Human leukemic cells
resistant to 5-fluoro-2-deoxyuridine contain a thymidylate syn-
thetase with lower affinity for nucleotides. J Biol Chem 1983;
258(7): 4130-4136.
122. Jenh CH, Geyer PK, Baskin F, Johnson LF. Thymidylate syn-
thase gene amplification in fluorodeoxyuridine-resistant mou-
se cell lines. Mol Pharmacol 1985; 28(1): 80-85.
123. Capizzi RL, Yang JL, Rathmell JP, White JC, Cheng E,
Cheng YC, et al. Dose-related pharmacologic effects of high-
dose ara-C and its self-potentiation. Semin Oncol 1985; 12(2
Suppl 3): 65-74.
124. Drenthe-Schonk AM, Holdrinet RS, van Egmond J, Wessels
JM, Haanen C. Cytokinetic changes after cytosine arabinosi-
de in acute non-lymphocyte leukemia. Leuk Res 1981; 5(1):
89-96.
125. Flasshove M, Strumberg D, Ayscue L, Mitchell BS, Tirier C,
Heit W, et al. Structural analysis of the deoxycytidine kinase
gene in patients with acute myeloid leukemia and resistance
to cytosine arabinoside. Leukemia 1994; 8(5):780-785.
VII.
126. Horwitz SB, Cohen D, Rao S, Ringel I, Shen HJ, Yang CP.
Taxol: mechanisms of action and resistance. J Natl Cancer
Inst Monogr 1993;(15): 55-61.
127. Kavallaris M, Kuo DY, Burkhart CA, Regl DL, Norris MD,
Haber M, et al. Taxol-resistant epithelial ovarian tumors are
associated with altered expression of specific beta-tubulin iso-
types. J Clin Invest 1997; 100(5): 1282-1293.
128. Cabral F, Barlow SB. Mechanisms by which mammalian cells
acquire resistance to drugs that affect microtubule assembly.
FASEB J 1989; 3(5): 1593-1599.
129. Meijer C, de Vries EG, Dam WA, Wilkinson MH, Hollema
H, Hoekstra HJ, et al. Immunocytochemical analysis of cisp-
latin-induced platinum-DNA adducts with double-fluorescen-
ce video microscopy. Br J Cancer 1997; 76(3): 290-298.
130. Crul M, Schellens JH, Beijnen JH, Maliepaard M. Cisplatin
resistance and DNA repair. Cancer Treat Rev 1997; 23(5-6):
341-366.
131. Ferry KV, Hamilton TC, Johnson SW. Increased nucleotide
excision repair in cisplatin-resistant ovarian cancer cells: role
of ERCC1-XPF. Biochem Pharmacol 2000; 60(9): 1305-1313.
132. van der Zee AG, Hollema HH, de Bruijn HW, Willemse PH,
Boonstra H, Mulder NH, et al. Cell biological markers of
573
drug resistance in ovarian carcinoma. Gynecol Oncol 1995;
58(2): 165-178.
133. Dive C, Hickman JA. Drug-target interactions: only the first
step in the commitment to a programmed cell death? Br J
Cancer 1991; 64(1): 192-196.
134. Fisher DE. Apoptosis in cancer therapy: crossing the thres-
hold. Cell 1994; 78(4): 539-542.
135. Kerr JF, Wyllie AH, Currie AR. Apoptosis: a basic biological
phenomenon with wide-ranging implications in tissue kine-
tics. Br J Cancer 1972; 26(4): 239-257.
136. Greenblatt MS, Bennett WP, Hollstein M, Harris CC. Muta-
tions in the p53 tumor suppressor gene: clues to cancer etiolo-
gy and molecular pathogenesis. Cancer Res 1994; 54(18): 4855-
4878.
137. Eliopoulos AG, Kerr DJ, Herod J, Hodgkins L, Krajewski S,
Reed JC, et al. The control of apoptosis and drug resistance
in ovarian cancer: influence of p53 and Bcl-2. Oncogene 1995;
11(7): 1217-1228.
138. Chin KV, Ueda K, Pastan I, Gottesman MM. Modulation of
activity of the promoter of the human MDR1 gene by Ras
and p53. Science 1992; 255(5043): 459-462.


. . , .

O . -
, -
, .

I I OOO I
O.
OOTHTA

-
. . -

, . -

. -
- (. 1):
1980, . -
.
, , -
(threshold)



.
, -
-
-
-

.
.


-
:
.
1. ( )

.
2. ()

, -
. mg/m2 /.
3. -


()
.
4. (
)

(IV, p.o., V ,
..). 1. . : -
, : , :
O - , : .

575
576 OY

- -
( ( , ,
, , ). ).
,
: ,
1. - ,
, . -
. -
- -
- ,
- , -
. -
. , ,
2. .
, -- O -
, Coldman Gol-
. - die1
. -
. -
3. , - -
, .
:
. 1.
.
- 2. -
. .
, 3.
, .
- 4. -
, .
, (. 2). O
.
- -
, - -

100
2. -

75
(
(%)

) in vitro -
()
50
() . -


25
,
v

v ,
10 .

.
1

VII. 577

. - in vitro in i -
, - . -
, ,
. - 1960 1970 -
- , -
(.. - .
, ..). - ( ) ,
, -
, Skipper, Schabel, Griswold ..
, - -
.
, , -
, - -
, -
, ,
. -

, -
- . -
x ,
. ,

- ,
- -
: . x -
1. O - 2, -
- ,
. 1,
2. .
-
- :
, - 1.
- ,
. , -
, - -
, -
.

1.

,
-
.
1.
3. 2.
3.
- 4. (2 3)
. 5. (1 3)*
6. (1 3 / 2 3)
O
* -
- ,
-
-

-
578 OY

. O von Hoff et al4

2. - ,

, -
. .
3. - ,
- . -
,
- -
. 14 ,
- -
. O
-
.
, - . -
- -
. .

, -
.


. -

, -
-
, -
, - .
G0 -
. -
- . -
3,
P-
(.. 20%) - -
(.. 50%) - -
. -
. in vitro -
-
-
. .
-
, - ,
. . -
- oshida (-
, , -S--
, )
- , -
. - , -
-
. - .

( P-
- ) . O -
, - 5,6
3. -
VII. 579

, ). -
- -
. .

-
. - ,
- - -
- .
. -
. -
-
. O Behrens et al7 - 6070 mg/m2 3 . -

. 5060%. -
. -
. 3040 mg/m2 3 -

30% .
810 -
. - , > 120 mg/m2 34 -
.
. 85%9.
- -
8 : . O Bronchud et al10
1. 125
mg/m2 2 rG-CSF. -
- -
. (4 4 15
2. - ), . -
- Ferguson et al11
. 100 mg/m2 2 ( -
3. - ) rG-CSF.
, - (89% 33% -
- ),
. .
4. , - -
, . -
, . -
. Foungilas et al12
O O I 110 mg/m2
O 2 rG-CSF
- > 90%
- .
, (64% 14% )
- -
. - . O -
-
-
, .
, , -
(.. , .
580 OY

- -
- , AUC, -
. - -
, , -
, (. 3). -
, AUC 57 mg/ml min
- 450
. 600 mg/m2.
AUC > 57 mg/ml min,
.
. - -

. - , ,
mg/m2, . O
.
: -
. -
- 100 mg/m2
. 300 mg/m2 6 , -
(area under the curve AUC) - 1,82 14,
15. II
. AUC ,
, - ,
- .
( -
) . - O O
O

( AUC = - , -
/ GFR + 25),
mg/m2. -
O Jordrell et al13
Bristol-Squibb Co - . , , -
. -
-
-
.
100 16,
(%)

17,18.
80
,
60 ,
(
40
) -
20
.
23 45 67 89 1011 1213 1415
AUC (mg/ml min) O O

3.
(AUC)
.
VII. 581

. ) -
, .. -
, , - .
. -
( , -
) . O Bonadona
Valagussa19 .
2. -
(CMF). -

- .
- O -
( ) -
. 5 - .
77%, 56% 48%
, O
> 85%, 6585% < 65% . - O
20 O , Hryniuk
- ,
, - -
. - 30,31.
- O -
OPP Hodgkin21, - ,
CHOP22 LNH-8423 - : ) -
dgkis .. ,

) -
. - . -
, ()
.
O - mg/m2 /-
.
-
( -
) , -
- ( 2).
.

O Hodgkin24,25,26,27 .
- -
28,29. ,
. . :
O - 1. -
-
mg/m2 /,
.
. 2.
- -
: ,
1. .
( - 3.
582 OY

2.

1. : 60 mg/m2 3 20 mg/m2 /.
2. : 100 mg/m2 2 50 mg/m2 /. 50/20 = 2,5

3. -

1. :
600 mg/m2, . 1 200 mg/m2 /.
45 mg/m2, . 2 15 mg/m2 /.
45 mg/m2, . 1 8 300 mg/m2 /.
2. :
1.200 mg/m2, . 1 400 mg/m2 /. 400/200 = 2
45 mg/m2, . 1 8 30 mg/m2 /. 30/15 = 2
3 450 mg/m2, . 1 8 300 mg/m2 /. 300/300 = 1

() : (2 + 2 + 1) / 3 = 1,66

, ,


. O - (. 4). , -
(
3). 33 50
- . -
- -
, , - CHAP (, -
. - , )32 -
.
.
- 33,34. -
, 78
0 -
35.
-
. CMF, -
CAF, (
, - ) -
- 36, -
1, CMF
. I37,
Hryniuk, -
- 30.
, - -
,
, ,
VII. 583

A B
100
(%)
80

60

40

20

0,2 0,4 0,6 0,8 1 1,2 0,2 0,4 0,6 0,8 1 1,2

4. ()
() ,
Hryniuk.

.
( )
30,31.
-
. Klasa et al38 - .
-
- -
39.
,
. -
- 22 Hodgkins -
. 40. -
-
- 0,
- , -
- , -
1 . -
, ( -
-
. -
- ),
. , - .
O ,
. -
. -
34. -
CHAP -
, - .
. :
1.
16 mg/m2 /. ,
- -
- . -
584 OY

-
- , -
- .
, - 3. -
, -
. -
2. ( )

. .
- 4. O

. - , -
- .
5.
. , .

. . ,
3. ,
,

Hodgkins - . -

. ,
, , -
OO OO
.
( - O -
, ) -
-
. - , -
, .
-
- O (O)
.
-
O. O
. O , -
. -
. 45 mg/m2
1. O - 3 .
- . -
. - -
- , 30 mg/m2 3 .
- 45 mg/m2 3 . -
(72% vs 59%)
Hryniuk (1987) - ,
, 41.
- -
-
. . -
2. - -
. - -
VII. 585

4. - (Ara-C)

A
Ara-C (mg/m2) DNR* (mg/m2) (%)

Preisler et al43 427 100 7 . vs 45 3 . 53

100 10 . 45 3 . 57
Dillman et al44 326 100 7 . vs 45 3 . 58
200 7 . 45 3 . 58
Schiller et al45 101 200 7 . vs 60 3 . 71
1.000 6 . 60 3 . 74
Weick et al46 200 7 .** vs 45 3 . 55
4.000 6 .** 45 3 . 59

* DNR: , ** < 45

5. O - (Ara-C)*

Ara-C (mg/m2) ** (%)*** (%)***

100 5 . vs 21 31
400 5 . vs 25 35
3.000 2 1, 3 5 . 39 46

* 596 , ** < 60 , *** 2

-
42. . -
- -
12 g/m2 - - -
7 . . -
- -
596 , -
( 36 g/m2) . O - 41. -
- 5,
- - . -
- - -
(. 4) - ,
. , - . -
700 mg/m2 7 18 g/m2 6 ( -
, - ) ,
. - < 60 . -
-
46. - -
, - O.
-
- dgkins ()
O. -
O,
-
586 OY

6. -
Hodgkins

Carde et al48 141 CHVmp vs

CHVmp+VB (80% vs 50%) -
5
Longo et al49 193 Pro-MACE-MOPP vs
Pro-MACE-Cyta ,
BOM
Montserrat et al50 134 CHOP vs
Pro-MACE-Cyta
BOM
Cooper et al51 CHOP vs
MACOP-B
Gordon et al52 325 CHOP vs
m-BACOD
Fisher et al53 899 CHOP vs ,
m-BACOD vs
Pro-MACE-Cyta
BOM vs MACOP-B
Sertoli et al54 221 Pro-MACE-MOPP -
, 3

. , - -
1970 1980, ,
(CHOP, BACOD, COMLA),
(m-BACOD, COP-BLAM, Pro-MACE- CHOP.
MOPP) (pro-MACE-Cyta BOM, MA- , -
COP-B, COP-BLAM ). ,
- -
- . -
. - , ,
-
. -
Hryniuk 39,40.
- ( -
, -
- ), -
39,40.
O -

- .
. 7
(. 6), 2
, 5 - O -
- -
, , -
. -

VII. 587

7. . -

Samson et al55 114 ( - 15 mg/m2 5 . vs VBL, Bleo

) 120 mg/m2 VBL, Bleo (63% vs 43%)
Ozols et al56 52 ( ) 20 mg/m2 5 . vs VBL, Bleo
40 mg/m2 5 . VBL, Bleo
VP 16 (88% vs 67%),

Nichols et al57 153 ( ) 100 mg/m2 vs VP 16
200 mg/m2 VP 16 (73% vs 68%),

VBL: , Bleo: , VP 16:

. - -
, - , .
, 3
(. 7), -
- 100%
. 55,56 -
- .
- -
. , - -
( - -
) . .
85
.
O -
,
. - -
,
120 mg/m2 ( (. 8). 58 -
, 100 mg/m2) -
75 mg/m2 ( 25% , -
). 56 - , .
- , ,
- .
, . Mc Guire et al59, -
- ,
. -
-
, ( ), -

. .
57 - , ,
. - . -
( ) 60 -
. ,
-
588 OY

8.

Ngan et al58 50 ( CP 60 mg/m2** vs -

) CP 120 mg/m2 (60% vs 30% 3 )
Kay et al60 190 ( CP 50 mg/m2*** ( 6) vs
) CP 100 mg/m2 ( 6)
Mc Guire et al59 485 ( CP 50 mg/m2
) C 500 mg/m2 ( 6) vs
CP 100 mg/m2
C 1.000 mg/m2 ( 4)
Bolis et al61 372 CP 75 mg/m2*** . ( 6) -
vs CP 50 mg/m2 . ( 9) > 2 cm (25% vs 22%).
(39,5% vs 59%)
< 2 cm -

Colombo et al62 306 CP 75 mg/m2 3 . ( 6)
vs CP 50 mg/m2 . ( 9)

CP: , C: , * , 3 , ** C 600 mg/m2

, *** C 750 mg/m2

. -
.
. -
-
. -
- > 2 cm
. . -

Mc Guire et al. -
. O Bolis et a161 .
-
(2,5
) -
,
2 cm, 63,64 -
- , -
2 cm. ,
(. 9).
. , .
, 6 -
. - -
(
, - )
. - (. 10). 65 -
-
62, . FAC (, , -
- ) -
. , .
-
VII. 589

9.

Garmo-Pereira et al63 48 D 35 mg/m2 3 . ( 6)

D 70 mg/m2 3 . ( 8) (24% vs 58%)

Tannock et al64 133 C 30 mg/m2
M 20 mg/m2 (11 vs 30%)
F 300 mg/m2 vs
CMF

D: , C: , M: , F:

10. -

Hortobagyi et al65 59 F 500 mg/m2

D 50 mg/m2
C 500 mg/m2 vs
F 2.500 mg/m2
D 100 mg/m2
C 1.800 mg/m2
Ebbs et al66 62 D 20 mg/m2 /.
D 40 mg/m2 /.
Habeshaw et al67 209 E 50 mg/m2 2 . ( 16)
vs E 100 mg/m2 3 . ( 8) (41% vs 21%), -


Focan et al168 141 E 50 mg/m2 . 1* vs
E 50 mg/m2 . 1 8 ( 3 .) (69% vs 41%)
,
The French Epirubicin 412 E 50 mg/m2 . vs
Study Group69 E 50 mg/m2** vs .
E 75 mg/m2**


Basthold et al70 261 40 mg/m2 vs
E 60 mg/m2 vs (21% vs
E 90 mg/m2 vs 25,5% vs 47,2% vs 35,4%) 90 mg/m2
E 135 mg/m2

F: , D: , C: , :
* C 500 mg/m2 F 500 mg/m2. 3 , **
F 500 mg/m2 C 500 mg/m2 . 3

- -
-
. - .
66 -
. - . -
67,68
590 OY

,
- .
.
. -
69
.
- ,
70 - ,
50 mg/m2 135 mg/m2 3 - , -
. - . O ,
( 40 mg/m2 90 mg/m2) ,
, - . -
.
71 (CALGB)
- II -
. , -
- . -
- CAF (. 11).
- -
CMF -
, . -
, - ( 50%) -
. -
, .
, ( 72, , -
- -
), -
. , -
, -
.
, - , -
, , - -
- -

11.

Wood et al71 1.562 C 200 mg/m2, . 1 -

D 20 mg/m2, . 1 ( -
F 200 mg/m2, . 1 8 4 . ( 6) 3 ).
vs
4 . ( 6) vs
C 600 mg/m2, . 1
D 60 mg/m2, . 1
F 600 mg/m2, . 1 8 4 . ( 4)
Dimitrof et al72 2.238 C 600 mg/m2 ( 4) vs
C 1.200 mg/m2 ( 2) vs C
C 1.200 mg/m2 ( 4)
( D 60 mg/m2.
3 )

C: , D: , F:
VII. 591

, -
, . 74
. , ,
,
.
-
, CAV (, -
, ) (. 13). 75
. - , -
, -
. - , .
76
(. 12). 73 - -
.
.
-
, , (.
. 14). O Wolff et al77 -
- -

12. -
.

Cohen et al73 32 CCNU 50 mg/m2 M

M 10 mg/m2
C 500 mg/m2 vs
CCNU 100 mg/m2*
M 12 mg/m2
C 1.000 mg/m2
ODonnel et al74 26 C 750 mg/m2** -
mCCNU 75 mg/m2 vs (57% vs 21%),
C 2.000 mg/m2
mCCNU 100 mg/m2

CCNU: , : , C: , mCCNU:
* 2 , ** 2 mg

13.
. CAV

Figuereto et al75 103 D 50 mg/m2

C 1.000 mg/m2 vs
D 60 mg/m2
C 1.5002.000 mg/m2
Johnson et al76 298 ( ) D 40 mg/m2 vs
C 120 mg**
D 70 mg

D: , C: , V:
* 3 , ** 3 6
592 OY

14. /

Wolf et al77 79 ( ) VP 16 100 mg/m2 3 vs

VP 16 200 mg/m2 3 vs
VP 16 300 mg/m2 3
Arriagada et al79 105 ( ) CP 80 mg/m2, . 1
C 225 mg/m2 4 . vs (67% vs 54%),
CP 100 mg/m2, . 1**
C 300 mg/m2 4 .
Ihde et al78 90 ( ) CP 80 mg/m2, . 1
VP 16 80 mg/m2, . 13 vs
CP 27 mg/m2, . 15**
VP 16 80 mg/m2, . 15

VP 16: , CP:
* 3 , ** 6 .
40 mg/m2 3 VP 16 75 mg/m2 3, *** H 2 4 -

,
. Ihde .
et al78 - 2. , -
,
. , . -
-
- .
. -
46% .
. - 3. O -
- . -
. -
( 2535%) -
6 - ,

- . -
.
- ,
. - -
,
-
. . -
, -
OH OI OA ,
OOE .
-
: OO O
1. - O
. , -
-
,
VII. 593

, . -
30. - -

- . -
. - 86.
. - . O Twelves et al87 -

- -
- . 88
, - FEC
. - (, , ) -
, - 4 25% -
. 24- . -
-
, -
( ). -
- .

-
80. -
- 34
. - . -
, , . -
.
. -
- x (403 -
, , ) 89. -
24 -
81. II - , , 3 -
p.o. .
( 21 ) 4
8 CMF. -
- 4 2 CMF -
82,83. 84 . -
. -
p.o. 21 -
, , - ( 10 )
3 4 -
V. .
-
35 .
IV.
- -
90,91.
- -
. - , -
-
, .
. - . -
85 - -

594 OY

( NTATIKOOIHH TH XHMEIOEPAEIA ME
)90. - THN YOTHPIH AIMOOIHTIKN AYHTIKN
, , - APAONTN (AA)
92. -
93,94 .
-
-
(-
34 ) . -
- . -
.
-
. 20% 100% 9,10,11,12.

O -
OO O . O ,
E OOOI OTEEMATO -
IOOIKOY APAONTE TOY OKOY . , -


, -

,
. ,

-
97.
-
(-
-.
), -
95 -
. -
,
-
-
, , (
. (3 gr/m2 3 .) ) -
(400 mg/m2 5 .) - -
- 98. -
, , -
- .
. -
, -
-
( CAF), .
-
, c-erbB296. EAEPAEIA ME AYTOOH METAMOXEYH
( 50%) c- MYEOY TN OTN YOTHPIH ME POO-
erbB2 NIKA KYTTAPA EPIEPIKOY AIMATO
.
(<50%) -
- 45 -
. . -
O .
, -
- . , -
, ,
- , -
.
VII. 595

. - 4 108.
. -

.
, - .
,
:
. , -
, , -HCG
, > 1.000 U/l 103.
, -
, -
- Hodgkin109,110, 2 -
. -
, Hodgkin99, Hodgkins 111.
100, 101, ,
-
102. , - . -
, - , ,
- , ECOG PS, LDH -
, -
. - 111.
-
. - I
- -
.
- . O -
- ,
, . -
. - , in vitro -
- , -
-
, , -
103. , -
, .
2

(82% -
71%, p = 0,0184) 104. - . -
- -
105. (20100%) .

. -
- -
.
5 - , -
, -
25%106,107. , - .
, -
3 - -
VIP / VeIP - .
596
1. Coldman AJ, Goldie JH. Impact of dose-intensive chemothe-
rapy n the development of permanent drug resistance. Semin
Oncol 1987; 14 (Suppl 4): 29-33.
2. Skipper . Dose-intensity versus total dose of chemotherapy.
n experimental basis. Important Adv Oncol 1990: 43-64.
3. Bruce WR, Meeker BE, Valeriote FA. Comparison of the sen-
sitivity of normal hemopoietic and transplanted lymphoma co-
lony-forming cells to chemotherapeutic agents administered in
vivo. J Natl Can Inst 1996; 37: 233-45.
4. Von Hoff DD, Clark GM, Weiss GR, et al. Use of in vitro
dose response effects to select antineoplastics for high-dose or
regional administration regimens. J Clin Oncol 1986; 4: 1827-
34.
5. McGown , Ward , Fox BW. Comparative study of the
uptake of daunorubicin in sensitive and resistant 388 cell li-
nes by flow cytometry and brochemical extraction procedures.
Cancer Chemother Pharmacol 1983; 11: 113-6.
6. McGown , Fox BW. proposed mechanism of resistance
t cyclophosphamide and phosphoramide mustard in a oshi-
da cell line in vitro. Cancer Chemother Pharmacol 1986; 17:
223-6.
7. Behrens BG, Hamilton TC, Masuda , et al. Characterization
of a cisdiamine dichloro-platinum () resistant human ovarian
cancer cell line and its use in evaluation of platinum analo-
gues. Cancer Res 1987; 47: 414-8.
8. Gurney , Dodwell D, Thatcher , Tattersal . Escalat-
ing drug delivery in cancer chemotherapy. review of consepts
and practice, Part 1. nn Oncol 1993; 4: 23-34.
9. Jones RB, Holland JF, Bhardwaj S, et al. phase I- study of
intensive-dose adriamycin for advanced breast cancer. J Clin
Oncol 1987; 5: 172-177.
10. Bronchud , Howell , Crowther D, et al. The use of granu-
locyte colony-stimulating factor t increase the intensity of
treatment with advanced breast and ovarian cancer. Br J Can-
cer 1989; 60: 121-25.
11. Ferguson JE, Dodwell DJ, Seymour -, et al. High-dose,
dose-intensive chemotherapy with doxorubicin and cyclophos-
phamide for the treatment of advanced breast cancer. Br J
Cancer 1993; 67: 825-9.
12. Fountzilas G, Scarlos D, Giannakakis , et al. Intensive che-
motherapy with high-dose epirubicin every two weeks and pro-
phylactic administration of filgastim in advanced breast cancer.
Eur J Cancer 1994; 30: 965-9.
13. Jordrell DI, Egorin MJ, Canetta RM, et al. Relationship bet-
ween carboplatin exposure and tumor response and toxicity in
patients with ovarian cancer. J Clin Oncol 1992; 10: 520-28.
14. Lund , Hansen , Hansen O, et al. High-dose platinum
consisting of combined carboplatin and cisplatin in previously
untreated ovarian cancer patients with residual disease. J Clin
Oncol 1989; 7: 1469-73.
15. Piccart MJ, Nogaret JM, Marcelis L, et al. Cisplatin combinent
with carboplatin: a new way n intensification of platinum do-
se in the treatment of advansed ovarian cancer. Belgian study
group for ovarian carcinoma. J Natl Cancer Inst 1990; 82: 703- 7.
OY
16. Barker G, Wiltshaw . Use of high-dose cisdichloro-diamine
platinum (II) (NSC-119875) following failure on previous che-
motherapy for advanced carcinoma of the ovary. Br J Obstet
Gynecol 1981; 88: 1192-9.
17. Markman , Rothman R, Hakes , et al. Second line plati-
num therapy in patients with ovarian cancer previously treated
with cisplatin. J Clin Oncol 1991; 9: 389-93.
18. Ozols R, Corden , Jacob J, et al. High-dose cisplatinum in hy-
pertonic saline. Ann Intern Med 1984; 100: 19-24.
19. Bonadona G, Valagussa . Dose-response effect of adjuvant
chemotherapy in breast cancer. Engl J Med 1981; 304: 1015.
20. Ang , Buzdar AU, Smith TL, et al. Analysis of dose-intensi-
ty in doxorubicin-containing adjuvant chemotherapy in stage II
and III breast carcinoma. J Clin Oncol 1989; 7: 1677-84.
21. Green , Dawson , Fell LF, et al. Measurement of drug
dosage intensity in therapy in Hodgkins disease. Brit J
Clin Pharmacol 1980; 9: 511-14.
22. Epelbaum R, Haim , Blen SM, et al. Dose-intensity analysis
for CHOP chemotherapy in diffuse aggresive large cell lym-
phoma. Isr J Med Scie 1988; 24: 533-8.
23. Coffier , Gisselbrecht C, Herbrecht R, et al. LNH-84 regi-
men. multicenter study of intensive chemotherapy in 757 pa-
tients with aggressive malignant lymphoma. J Clin Oncol 1989;
7: 1018-26.
24. Carde , Mackintosh FR, Rosenberg SA. dose and time res-
ponse analysis of the treatment of Hodgkins disease with O
chemotherapy. J Clin Oncol 1983; 1: 146-53.
25. Van Rijswijk RE, Haanen C, Dekker AW, et al. Dose-intensity
of O chemotherapy and survival in Hodgkins disease. J
Clin Oncol 1989; 7: 1776-82.
26. Longo DL, Young RC, Duffey PL, et al. O after two de-
cates (letter). J Clin Oncol 1987; 5: 320-1.
27. Pillai GM, Hagemeister FB, Valasquez WS, et al. Prognostic
factors for stage IV Hodgkins disease treated with O, with
or without bleomycin. Cancer 1985; 55: 691-7.
28. Hoskins J, Ng V, Spinelli JJ, et al. Prognostic variables in pa-
tients with diffuse large cell lymphoma treated with MACOP-B.
J Clin Oncol 199l; 9: 220-6.
29. Kwak LW, Holpern J, Olshen RA, et al. Prognostic significan-
ce of actual dose-intensity in diffuse large-cell lyphoma. Re-
sults of a three-structured survival analysis. J Clin Oncol 1990;
8: 963-77.
30. Hryniuk W. Average relative dose-intensity and the impact on
design of clinical trials. Sem Oncol 1987; 14: 65-74.
31. Hryniuk W, Figueredo , Goodyear . Applications of dose-
intensity to problems of chemotherapy of breast and colorectal
cancer. Sem Oncol 1987; 14 (Suppl 4): 3-11.
32. Greco FA, Julian CG, Richardson RL. Advanced ovarian can-
cer. Brief intensive combination chemotherapy in second book
operation. Obstet Gynecol 1981: 202-205.
33. Levin L, Hryniuk W. Dose-intensity analysis of chemotherapy
regimens in varian carcinoma. J Clin Oncol 1987; 5: 756-67.
34. Levin L, Hryniuk W. The application of dose-intensity to pro-
blems in chemotherapy of ovarian and endometrial cancer.
VII.
Sem Oncol 1987; 14 (suppl 4): 12-19.
35. Levin L, Simon R, Hryniuk W. Importance of multiagent che-
motherapy regimens in ovarian carcinoma. Dose-intensity ana-
lysis. J Natl Cancer Inst 1993; 83: 1732-42.
36. Hryniuk W, Bush . The importance of dose-intensity in che-
motherapy of metastatic breast cancer. J Clin Oncol 1984; 2:
1281-8.
37. Hryniuk W, Levine . Analysis of dose-intensity for adju-
vant chemotherapy trials in stage II breast cancer. J Clin Oncol
1986; 4: 1162-70.
38. Klasa R, Murray , Coldman . Dose-intensity meta-analysis
of chemotherapy in small cell carcinoma of the lung. Proc Am
Soc Clin Oncol 1988; 7: 202.
39. De Vita VT Jr, Hubbard SM, Longo DL. The chemotherapy
of lymphomas. Looking back, moving forward. Cancer Res
1987; 47: 5810-24.
40. Mayer RM, Hryniuk WM, Goodyear MD. The role of dose-in-
tensity in determining outcome in intermediate-grade non-
Hodgkins lymphoma. J Clin Oncol 1991; 9: 339-47.
41. ates JW, Wallace HJ, Ellison RR, et al. Cytosine-arabinoside
(NSC-3878) and daunorubicin (NSC-83142) therapy in acute
non-lymphocytic leukemia. Cancer Chemother Rep 1973; 7:
485-88.
42. Berman . Chemotherapy in acute myelogenous leukemia:
high-dose, higher expectations. J Clin Oncol 1995; 13: 1-4.
43. Pleisler , Davis RB, Kirshner J, et al. Combination of three
remission induction regimens and two postinduction strategies
for the treatment of acute non-lymphocytic leukemia. Can-
cer and Acute Leukemia Group study. Blood 1987; 69: 1441-
49.
44. Dillman RO, Davis RB, Green MR, et al. comparative study
two different doses of cytarabine for acute myeloid leukemia.
phase III trial of Cancer and Acute Leukemia Group .
Blood 1991; 78: 2520-6.
45. Schiller G, Gajewski J, Nimer S, et al. randomized study of
intermediate versus conventional dose cytarabine as intensive
induction for acute myelogenous leukemia. Brit J Haemat 1992;
81: 170-7.
46. Weick J, Kopecky , Appelbaum F, et al. randomized inve-
stigation of high-dose versus standard dose cytosine-arabinosi-
de with daunorubicin in patients with acute myelogenous leu-
kemia. Proc Am Soc Clin Oncol 1992; 11: 261.
47. ayer RJ, Davis RB, Schiffer CA, et al. Intensive postremissin
chemotherapy in adults with acute myeloid leukemia. Engl J
Med 1994; 331: 896-903.
48. Carde , Meerwaldt JH, van Glabbeke , et al. Superiority of
second over first generation chemotherapy in a randomized
trial of stage III-IV intermediate and high-grade non-Hodg-
kins lymphoma (NHL). The 1980-1985 EORTC trial. nn
Oncol 1991; 2: 431-435.
49. Longo DL, De Vita VT Jr, Duffey PL, et al. Superiority of
ProMACE-CytaBOM over ProMACE-MOPP in the treatment
of advanced diffuse aggresive lymphoma. Results of a pros-
pective randomized trial. J Clin Oncol 1991; 9: 25-38.
50. Montserrat , Garcia-Coode J, Vicolas , et al. ProMACE-
CytaBOM vs CHOP in the treatment of unfavorable lympho-
597
mas. randomized trial. Blood 1991; 78 (Suppl 1): 127a.
51. Cooper , Ding JC, Matthews JP, et al. randomized com-
parison of MACOP-B and CHOP in intermediate grade non-
Hodgkins lymphoma. Proc Am Soc Clin Oncol, 1991; 10: 271.
52. Gordon LI, Harrington D, Andersen J, et al. Comparison of a
second-generation combination chemotherapy regimen (m-
BACOD) with a standard regimen (CHOP) for advanced dif-
fuse non-Hodgkins lymphoma. Engl J Med 1992; 327: l342-
39.
53. Fisher RI, Gaynor ER, Dahlberg S, et al. Comparison of a
standard regimen (CHOP) with three intensive chemotherapy
regimens for advanced non-Hodgkins lymphoma. Engl J
Med 1993; 328: 1002-6.
54. Sertoli MR, Santini G, Chiseni I, et al. COP-B versus pro-
MACE-MOPP in the treatment of advanced diffuse non-
Hodgkins lymphoma. Results of a prospective randomized
trial by the non-Hodgkins lymphoma cooperative study group.
J Clin Oncol 1994; 12: 1366-74.
55. Samson , Rivkin SE, Jones SE, et al. Dose-response and
dose-survival advantage for high- versus low-dose cisplatin com-
bined with vinblastine and bleomycin in disseminated testicu-
lar cancer. Cancer 1984; 53: 1029-35.
56. Ozols RF, Ihde DC, Linehan WM, et al. randomized trial of
standard chemotherapy regimen in the treatment of poor pro-
gnosis nonseminomatous germ-cell tunors. J Clin Oncol 1988;
6: 1031-40.
57. Nichols CR, Williams SD, Loeher PJ, et al. Randomized study
of cisplatin dose-intensity in poor-risk germ-cell tumours.
Southeastem Cancer Study Group and Southwest Oncology
Group protocol. J Clin Oncol 1991; 9: 1163-72.
58. Ngan , Choo YC, Cheung , et al. randomized study of
high-dose vs low-dose cisplatin combined with cyclophospha-
mide in the treatment of advanced ovarian cancer. Chemothe-
rapy 1989; 35: 221-27.
59. McGuire WP, Hoskins WJ, Brady MF, et al. Assessment of
dose-intensity therapy in suboptimally debulked ovarian can-
cer. gynecologic oncology group study. J Clin Oncol 1995;
13: 1589-99.
60. Kaye SB, Lewis CR, Paul J, et al. Randomized study of two
doses of cisplatin with cyclophosphamide in epithelial ovarian
cancer. Lancet 340: 329-33.
61. Bolis G, Favalli G, Giardina G, et al. multicenter randomiz-
ed trial comparing weekly platinum (PW) vs cyclophosphami-
de plus platinum (CP) in advanced ovarian cancer (AOC). Proc
Amer Soc Clin Oncol 1994; 13 (abst 820): 259.
62. Colombo , Pitteli MR, Parma G, et al. Cisplatin dose-intensi-
ty in advanced ovarian cancer. randomized study of conven-
tional dose vs dose-intense cisplatin monochemotherapy. Proc
Am Soc Clin Oncol 1993; 12: 255 (abstr).
63. Garmo-Pereira J, Costa FO, Henriques , et al. comparison
of two doses of adriamycin in the primary chemotherapy of
disseminated breast carcinoma. Br J Cancer 1987; 56: 471-3.
64. Tannock IF, Boyd NF, Deboer G, et al. randomized trial of
two dose levels of cyclophosphamide, methotrexate, and fluo-
rouracil chemotherapy, for patients with metastatic breast can-
cer. J Clin Oncol 1988; 6: 1377-87.
598
65. Hortobagyi GN, Bodney GP, Burdrar , et al. Evaluation of
high-dose vs standard FAC chemotherapy for advanced breast
cancer in protected environment units: a prospective randomi-
zed study. J Clin Oncol 1987; 5: 354- 64.
66. Ebbs SR, Saunders JA, Graham , et al. Advanced breast can-
cer, a randomized trial of epirubicin at two different dosages
and two administration systems. Acta Oncol 1989; 28: 887-92.
67. Habeshaw T, Jones R, Stallard S, et al. Epirubicin at two dose
levels with prednisone as treatment for advanced breast can-
cer. Results of a randomized trial. J Clin Oncol 1991; 9: 295-
304.
68. Focan C, Andrien JM, Closon , et al. Prospective rando-
mized trial for evaluation of dose-response relationship in ad-
vanced breast carcinoma treated with epirubicin. J Clin Oncol
1993; 11: 1253-63.
69. The French epirubicin study group. prospective randomized
trial comparing epirubicin monochemotherapy to two fluorou-
racil, cyclophosphamide, and epirubicin regimens differing in
epirubicin dose in advanced breast cancer patients. J Clin On-
col 1991; 9: 305-312.
70. Basthold L, Dalmark , Gjedde S, et al. pirubicin at four dif-
ferent dose levels in metastatic breast cancer. randomized
trial. Proc Am Soc Clin Oncol 1992; 11: 56.
71. Wood WC, Budman DR, Korzum , et al. Dose and dose-
intensity of adjuvant chemotherapy for stage , node positive
breast cancer. Engl J Med 1994; 330: 1253-9.
72. Dimitrof , Anderson S, Fisher , et al. Dose intensification
and increased total dose of adjuvant chemotherapy for breast
cancer (BC): findings from NSABP -22. Proc Am Soc Clin
Oncol 1994; 64: (abst 58).
73. Cohen , Greaven PJ, Fossieck , et al. Intensive chemo-
therapy of small cell bronchogenic carcinoma. Cancer Treat
Rep 1977; 61: 349-54.
74. ODonell MR, Ruckdeschel JC, Baxter D, et al. Intensive in-
duction chemotherapy for small cell anaplastic carcinoma of
the lung. Cancer Treat Rep 1985; 69: 571-5.
75. Figueredo AT, Hryniuk WM, Strautmanis I, et al. Cotrimoxa-
zole prophylaxis during high-dose chemotherapy for small cell
lung cancer. J Clin Oncol 1985; 54: 54-64.
76. Johnson DH, Einhorn LH, Birch D, et al. randomized trial
of high-dose versus conventional dose cyclosphamide, doxoru-
bicine, and vincristine for extensive stage small cell lung can-
cer: a phase III trial of the Southeastern Cancer Study Group.
J Clin Oncol 1987; 5: 1731-8.
77. Wolff SN, Birch R, Sama , et al. Randomized dose-response
evaluation of etoposide in small cell carcinoma of the lung.
Southeastern Cancer Study Group trial. Cancer Treat Rep
1986; 70: 583-7.
78. Ihde DC, Mulshine JL, Kramer BS, et al. Prospective rando-
mized comparison of high-dose and standard dose etoposide
and cisplatin chemotherapy in patients with extensive-stage
small-cell lung cancer. J Clin Oncol 1994; 12: 2022-34.
79. Arriagada R, Le Chevalier , Pignon J-P, et al. Initial chemo-
therapeutic dose and survival in patients with limited small-cell
lung cancer. Engl J Med 1993; 329: 1848-52.
80. Ldkich JJ, Ahlgren JD, Gullo JJ, et al. prospective rando-
OY
mized comparison of continuous infusion fluorouracil with a
conventional bolus schedule in metastatic colorectal carcino-
ma. mid-Atlantic Oncology Program Study. J Clin Oncol
1989; 7: 425-32.
81. Slevin ML, Clark , Joel SP, et al. randomized trial to eva-
luate the effect of schedule on the activity of etoposide in
small-cell lung cancer. J Clin Oncol 1989; 7: 1333-40.
82. Johnson DH, Greco F, Strupp J, et al. Prolonged administra-
tion of oral etoposide in patients with relapsed or refractory
small-cell lung cancer. phase II trial. J Clin Oncol 1990; 8:
1613-7.
83. Murphy , Hainsworth JD, Greco FA, et al. phase II trial
of cisplatin and prolonged administration of oral etoposide in
extensive-stage small-cell lung cancer. Cancer 1992; 69: 370-5.
84. Miller , Herndon JE, Hollis DR, et al. Schedule dependen-
cy of 21-day oral versus 3-day intravenous etoposide in com-
bination with intravenous cisplatin in extensive-stage small-cell
lung cancer: a randomized phase III study of the cancer and
leukemia group . J Clin Oncol 1995; 13: 1871-9.
85. Gundersen S, Kvinsland S, Klepp O, et al. Weekly adriamycin
versus VAC in advanced breast cancer. randomized trial.
Eur J Cancer Clin Oncol 1986; 22: 1431-4.
86. Bielack FM, Erttman R, Winkler , et al. Doxorubicin: effect
of different schedules on toxicity and anti-tumor efficacy. Eur
J Cancer Clin Oncol 1989; 25: 873-82.
87. Twelves CJ, Raminez AJ, Richards , et al. comparison
of response, survival, and quality of life (QOL) using 2 doxoru-
bicin schedules of equal dose-intensity in metastatic breast
cancer. Br J Cancer 1990; 62: 498-9.
88. Blomqvist C, Elomaa L, Rissanen , et al. Influence of treat-
ment schedule on toxicity and efficacy of cyclophosphamide,
epirubicin, and fluorouracil in metastatic breast cancer: a ran-
domized trial comparing weekly and every-4-week administra-
tion. J Clin Oncol 1993; : 467-73.
89. Bonadona G, Zambetti , Valagusa , et al. Sequential vs al-
ternating adjuvant chemotherapy with adriamycin (O) and
CMF. Ten years result in breast cancer with >3 positive no-
des. Proc Am Soc Clin Oncol 1995; 14: 118.
90. Miles DW, Earl , Souhami RL, et al. ntensive weekly che-
motherapy for good prognosis patients with small-cell lung
cancer. J Clin Oncol 1991; 9: 280-5.
91. Murray , Shah , Osoba D, et al. Intensive weekly chemo-
therapy for the treatment of extensive-stage small-cell lung
cancer. J Clin Oncol 1991; 9: 1632-8.
92. Miles DW, Rudd RM, Trask CWL, et al. Received dose-inten-
sity: randomized trial of weekly chemotherapy with and
without granulocyte colony stimulating factor in small-cell lung
cancer. J Clin Oncol 1994; 12: 77-82.
93. Sculier JP, Raesmans , Burea UG, et al. Multiple-drug
weekly chemotherapy versus standard combination regimen in
small-cell lung cancer: phase III randomized study condu-
cted by the European Lung Cancer Working Party. J Clin
Oncol 1993; 11: 1858-65.
94. Souhami RL, Rudd R, Ruiz de Elivta MC, et al. Randomized
trial comparing weekly versus 3-week chemotherapy in small-
cell lung cancer: cancer research campaign trial. J Clin On-
col 1994; 12: 1806-13.
VII.
95. Bloomfield CD, Lawrence D, Arthur DC, et al. Curative im-
pact of intensification with high-dose cytarabine in acute mye-
loid leukemia varies by cytogenetic group. Blood 1994; 84: 11a.
96. Muss , Thor AD, Berry DA, et al. c-erbB2 expression and
response to adjuvant therapy in women with node positive ear-
ly breast cancer. Engl J Med 1994; 330: 1260-6.
97. Fountzilas G, Papadimitriou C, Dafni U, et al. Dose-dense se-
quential chemotherapy with epirubicin and paclitaxel versus
the combination, as first-line chemotherapy, in advanced breast
cancer: a randomized study conducted by the Hellenic Coope-
rative Oncology Group. J Clin Oncol 2001; 19: 2232-39.
98. Citron ML, Berry DA, Cirrincione C, et al. Randomized trial
of dose-dense versus conventionally scheduled and sequential
versus concurrent conbination chemotherapy as postoperative
adjuvant treatment of node-positive primary breast cancer:
first report of Intergroup Trial C9741/Cancer and Leukemia
Group B Trial 9741. J Clin Oncol 2003; 21: 1431-39.
99. Bierman J, Vose JM, Armitage JO. Autologous transplanta-
tion for Hodgkins disease: coming of age? Blood 1994; 83:
1161-4.
100. Aisenberg AC. Coherent view of non-Hodgkins lymphoma. J
Clin Oncol 1995; 13: 2656-75.
101. Eddy DM. High-dose chemotherapy with autologous bone
marrw transplantation the treatment of metastatic breast can-
cer. J Clin Oncol 1993; 10: 557-70.
102. Peters WR, Ross , Vredenburg JJ, et al. High-dose chemo-
therapy and autologous bone marrw support as consolida-
tion after standard-dose adjuvant therapy for high-risk breast
cancer. J Clin Oncol 1993; 11: 1132-43.
103. Jones RH, Vasey PA. Testicular cancer-management of ad-
vanced disease. Lancet Oncology 2003; 4: 738-47.
104. Bokemeyer C, Kollmannsberger C, Meisner C, et al. First-line
599
high-dose chemotherapy compared with standard-dose PEB/
VIP chemotherapy in patients with advanced germ-cell tu-
mors: a multivariate and matched-pair analysis. J Clin Oncol
1999; 17: 3450-56.
105. Chevreau C, Droz J, Pico J, et al. Early intensified chemothe-
rapy with autologous bone marrow transplantation in first line
treatment of poor risk non-seminomatous germ-cell tumours.
Eur J Urol 1993; 23: 213-18.
106. Bhatia S, Abonour R, Porcu P, et al. High-dose chemotherapy
as initial salvage chemotherapy in patients with relapsed testi-
cular cancer. J Clin Oncol 2001; 18: 3346-51.
107. Motzer RJ, Mazumdar M, Sheinfeld J, et al. Sequential dose-
intensive paclitaxel, ifosfamide, carboplatin, and etoposide sa-
vage therapy for germ-cell tumor patients. J Clin Oncol 2000;
18: 1173-1180.
108. Rosti G, Pico J, Wandt H, et al. High-dose chemotherapy
(HDC) in the salvage treatment of patients failing first-line
platinum chemotherapy for advanced germ-cell tumors (GCT);
first results of a prospective randomized trial of the European
Group for Blood and Marrow Transplantation (EBMT): IT-
94 study. Proc ASCO 2002; 21: 716A.
109. Scmitz N, Pfistner B, Sextro M, et al. Aggressive conventional
chemotherapy compared with high-dose chemotherapy with
autologous hemopoietic stem-cell transplantation for relap-
sed chemosensitive Hodgkins disease: A randomized trial.
Lancet 2002; 359: 2065-71.
110. Linch DC, Goldstone AH. High-dose therapy for Hodgkins
disease. Br J Haematol 1999; 107: 685-90.
111. Mokowitz CH. Controversies in the management of relapsed
and primary refractory Hodgkins lymphoma. ASCO 2004; E-
ducational Book: 360-67.
VII
H



B. . M ...................................................................................................... 603

B. . M ...................................................................................................... 641

B. . M ...................................................................................................... 645


. .

OOI O OO , -
. -
(, - , , -
, ), FSH
FSH -
-
. , 37% -
, -
o, -
.
-, SHBG (Sex Hor-
-
mone Binding Globulin),
17- , - (60%) -
, . - , (3%) -

. - . O
- , -
, , - .
. O -
. -
1.
, . -
- . -
. .

(FSH + LH)
LH-RH
()

(ACTH)

1. .

603
604 OY

- . -
. - , -
-
. . -
,
. ,
(LH) v, , ,
- , :
. - ) O -
. .
) O , , -

v. O - .
, , O o -
, - .
, ov-oo -
, -
- -
- , -
, (. 2).
. - oo -
- - . O
-
, - DNA, -
, oov, . O -
- () 80.000 dal-