Dokuz Eylul University Computer Engineering Dept.

Automata and Formal Languages Assignment-1

Note: Assignments will be delivered on Tuesday (15.03.2011) for Tuesday group and on Thursday (17.03.2011) for Thursday group at the beginning of the lesson. QUESTIONS 1) Consider a combination lock such as is used for locking a bicycle, a locker, or a safe (Figure 2.1). For simplicity assume that our lock has only two positions {1,2}. Let the combination that releases the catch be at least a full clockwise turn ending with 1 (at the notch), followed by a half counterclockwise turn to 2, followed by a full clockwise turn to 2. If the dial is turned after the catch is released, the catch will be engaged again. We will regard the manipulation of the lock consisting of clockwise and counterclockwise rotations of the dial through 180 degrees. This will help us standardize the actions. Identify and construct an FSA modelling the combination lock described above.

Figure 2.1. A Combination Lock 2) Prokaryotic Gene Finding: Protein-coding genes consist of stretches of codons that begin with a start codon and end in a stop codon. A codon is a triplet consisting of A,C, G or T (the alphabet of DNA) which codes for a specific amino acid. For example (the codon) GCA codes for Alanine) and CTG codes for Leucine. Prokaryotic genes consist of single, continuous open-reading frames (ORF), therefore gene finding in Prokaryotic cell structures can be simplified into a search for ORFs. Once an ORF is identified, its translation into the corresponding amino acid sequence (protein) is easy, by simply writing each triplet from ORF with the corresponding amino acid (tables of which are available). Open Reading Frame (ORF): Given a sequence, s, from the alphabet {A,C,G,T}, we define an ORF as any subsequence whose length L (assume L >= 9), is a multiple of 3, starting with the start codon ATG, ending in any of the three stop codons {TAA, TAG, TGA}, with no stop codons in the middle. Internal start codons are allowed. For example the sequence GTATTATTATGAAGGGCCCTTCTATAGTATGATTGAAT contains an ORF of length 24 nt; GTATTATT.ATG.AAG.GGC.CCT.TCT.ATA.GTA.TGA.TTGAAT Construct an FSA which accepts any ORF.