Scribd Logo
Upload

Welcome to Scribd!

  • 18 views

    DNA Sequencing Techniques

    Uploaded by

    Ravi Indra
    Shotgun sequencing involves breaking DNA into random fragments that are then sequenced and reassembled like a jigsaw puzzle to reconstruct the original DNA sequence. The process is repeated with multiple shotgun sequences that can then be aligned and merged to generate a consensus sequence. Automated DNA sequencing techniques like pyrosequencing have made it possible to sequence DNA faster and more efficiently.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as DOCX, PDF, TXT or read online from Scribd
    Flag for inappropriate content

    You might also like

    DNA Sequencing Techniques

    Uploaded by

    Ravi Indra
    18 views2 pages
    Shotgun sequencing involves breaking DNA into random fragments that are then sequenced and reassembled like a jigsaw puzzle to reconstruct the original DNA sequence. The process is repeated with multiple shotgun sequences that can then be aligned and merged to generate a consensus sequence. Automated DNA sequencing techniques like pyrosequencing have made it possible to sequence DNA faster and more efficiently.

    Original Description:

    Copyright

    © Attribution Non-Commercial (BY-NC)

    Available Formats

    DOCX, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    Report this Document
    Shotgun sequencing involves breaking DNA into random fragments that are then sequenced and reassembled like a jigsaw puzzle to reconstruct the original DNA sequence. The process is repeated with multiple shotgun sequences that can then be aligned and merged to generate a consensus sequence. Automated DNA sequencing techniques like pyrosequencing have made it possible to sequence DNA faster and more efficiently.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as DOCX, PDF, TXT or read online from Scribd
    Flag for inappropriate content
    Download as docx, pdf, or txt
    18 views2 pages

    DNA Sequencing Techniques

    Uploaded by

    Ravi Indra
    Shotgun sequencing involves breaking DNA into random fragments that are then sequenced and reassembled like a jigsaw puzzle to reconstruct the original DNA sequence. The process is repeated with multiple shotgun sequences that can then be aligned and merged to generate a consensus sequence. Automated DNA sequencing techniques like pyrosequencing have made it possible to sequence DNA faster and more efficiently.

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as DOCX, PDF, TXT or read online from Scribd
    Flag for inappropriate content
    Download as docx, pdf, or txt
    of 2

    DNA sequencing techniques pyrosequencing

    Shotgun Sequencing
    Strand First Shotgun Sequence Second Shotgun Sequence Reconstruc tion Sequence AGCATGCTGCAGTCATGCT-------------------------TAGGCTA

    AGCATG-------------------------CTGCAGTCATGCTTAGGCTA AGCATGCTGCAGTCATGCTTAGGCT A

    Automated DNA sequencing

    You might also like