DOI: 10.1002/cbic.

201100228

Efficient Suppression of Gene Expression by Targeting 5-UTR-Based RNA Quadruplexes with Bisquinolinium Compounds
Kangkan Halder,[a] Eric Largy,[b] Martin Benzler,[a] Marie-Paule Teulade-Fichou,*[b] and Jrg S. Hartig*[a]
G-quadruplexes are well-characterized, four-stranded conformations comprised of stacked arrangements of guanine nucleobase tetrads, stabilized by Hoogsteen hydrogen bonding and centrally coordinated cations. The stable formation of quadruplexes has been studied for both DNA and RNA sequences.[1] Many such sequences were characterized in the promoter regions of proto-oncogenes like c-MYC, c-MYB, BCL2, KRAS and cKIT,[2] often coinciding with[3] or in near vicinity to[4] a transcription factor binding site, and hence potentially acting as cis-regulatory elements of transcription. Moreover, they have been reported to exclude nucleosome occupied regions,[5] which could also have regulatory significance. Together, these studies encouraged the design and synthesis of quadruplex-specific small molecules for telomerase inhibition and regulation of transcription.[6] Indeed, various small molecules have been shown to interact and stabilize DNA quadruplexes, in vitro,[7] and are thus suspected to interfere with DNA-related processes, in vivo.[8] In particular, interference of quadruplex binding molecules with telomeric functions and transcription of oncogenes has been investigated.[9] However, it is likely that the probability of formation, folding kinetics, life-time, and thermodynamic stability of quadruplex structures are highly dependent on the local primary sequence (such as number and length of guanosine runs as well as loop lengths and compositions) but also on the nucleic acid backbone (DNA vs. RNA) and the native status of the nucleic acid (single-stranded vs. double-stranded). There is currently a large body of in vitro data concerning the influence of these structural features on quadruplex formation and stability.[10] For instance, the formation of a DNA quadruplex in the presence of the complementary strand is expected to be transient due to the thermodynamically favored duplex state.[11] Hence, DNA quadruplexes are expected to occur with a higher probability during processes that require duplex strand separation, such as at replication forks, transcription bubbles, and also at the telomeric single-stranded overhang. In contrast, due to their single-stranded appearance RNA sequences are prone to form thermodynamically stable higherorder structures, such as hairpins and quadruplexes. Although most studies are concerned with DNA quadruplex functions, the interest in four-stranded RNA sequences is in[a] Dr. K. Halder, M. Benzler, Prof. Dr. J. S. Hartig Department of Chemistry, University of Konstanz 78457 Konstanz (Germany) E-mail: joerg.hartig@uni-konstanz.de [b] E. Largy, Prof. Dr. M.-P. Teulade-Fichou Institut Curie Centre de Recherche, CNRS-UMR 176 Universit Paris XI, 91405 Orsay (France) Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/cbic.201100228.

creasing. For instance, human telomeres have been found to be transcribed into approximately 1009000 nucleotide telomeric repeat-containing RNAs (termed TERRA)[12] and are predicted to form RNA quadruplexes, in vivo;[13] this suggests a role for these molecules in telomere regulation and maintenance. Moreover, recent studies have employed computational searches for G-quadruplex forming sequences in human mRNAs and found a higher predominance in 5-UTRs than statistically expected, indicating a possible regulatory function for these motifs.[14] We have presented strong evidence for RNA quadruplex formation in Escherichia coli by showing that translation initiation gets inhibited if folding interferes with the accessibility of the ribosome binding site.[15] Similar inhibitory effects were demonstrated for natural 5-UTR-based RNA quadruplexes in mammalian cell culture for the expression of some genes.[14a, 16] In addition, we introduced various symmetric RNA quadruplexes into the 5-UTR of a reporter gene, and found that the level of suppression is proportional to the thermodynamic stability of the quadruplex motif.[17] Since the loop length and number of G-rich stretches are important factors determining the stability of quadruplex motifs, we systematically varied these parameters in order to demonstrate that the extent of inhibition of gene expression correlated with the thermodynamic stability of the four-stranded motifs. When we investigated naturally occurring 5-UTR quadruplexes from NRAS, CHST2, MAPK2 and PCGF2 genes in our setup, the suppressive effect of these sequences could be approximated by comparison to the symmetric sequences of similar architectures.[17] Since the studied series of symmetric quadruplexes proved to produce very predictable and reliable effects, we chose these constructs in order to evaluate the possibility to further stabilize quadruplex formation by addition of quadruplex-binding compounds. Since most reported quadruplex binders stabilize the four-stranded fold (mostly determined for DNA quadruplexes), a further enhancement of the suppressive effects on gene expression could be expected upon application of such substances. We investigated three bisquinolinium compounds displaying either a pyridine dicarboxamide core, namely 360A (also called PDC for pyridine dicarboxamide) or a phenanthrolinedicarboxamide core, namely PhenDC3 and PhenDC6, two isomers differing by the orientation of the attached quinoline moiety (Figure 1 A). This set of compounds has been selected on the basis of previous studies that have demonstrated their efficacy to bind and stabilize DNA quadruplexes, and their potential to perturb the expression of targeted DNA quadruplex-forming sequences.[18] In addition, these compounds exhibit high selectivity for DNA quadruplexes compared to duplex DNA.[7c, 19] This binding preference is attributed to the bent shape of the

ChemBioChem 2011, 12, 1663 1668

 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

1663

4G3U2, and 4G3U3 RNA sequences exhibited a positive peak near 265 nm and a negative peak at around 242 nm (Figure 1 BD); these are characteristic CD features of a parallel G-quadruplex conformation.[21] The all-parallel strand topologies of 4G3U, 4G3U2 and 4G3U3 were preserved in the presence of equimolar concentrations of bisquinolinium derivatives (Figure 1 BD), while the compounds themselves lacked any CD signatures at the investigated wavelengths (see the Supporting Information). Additionally, the guanosine-rich control sequences con4G3U, con4G3U2 and con4G3U3, which should Figure 1. Bisquinolinium compounds stabilize RNA quadruplexes. A) Bisquinolinium compounds used in this not be able to form quadruplex study. B)D) Normalized and buffer-subtracted CD spectra, and E)G) melting curves of 5 mm 4G3U, 4G3U2, and structures, neither showed any 4G3U3, in the absence (black) or presence of equimolar 360A (red), PhenDC3 (green) or PhenDC6 (blue). All CD characteristic CD signal, nor spectra (BD) show a ~ 265 nm maximum and ~ 242 nm minimum, which are characteristic of a parallel-stranded G-quadruplex conformation. In the CD melting experiments (EG), stabilization of the quadruplex structure is obwere they induced upon addiserved for all three bisquinolinium compounds. tion of the bisquinolinium series (see the Supporting Informamolecules both in the pyridine and phenanthroline series that tion). relies on internal H bonds between the NH amide group and Next, we investigated the thermodynamic stability of the the ring nitrogen(s). The shape, size, as well as the strong elecquadruplexbisquinolinium complexes by thermal denaturatron-acceptor characteristics of both PhenDC compounds and tion measurements by CD spectroscopy at 265 nm (Figure 1 E 360A are thus expected to contribute to optimized pp stackG). The melting temperature (T1/2) values calculated from these ing interactions with the external G tetrads. The pyridine derivdenaturation curves revealed increased T1/2 ranging from 5.1 ative 360A, and more recently the two isomeric phenanthroline 17.1 8C at a 1:1 RNA quadruplex/ligand ratio compared to the derivatives, have already been used in several cell culture studT1/2 values of RNA quadruplexes alone (Table 2). The highest ies.[18c, 20] In the present study we show for the first time that stabilizing effect on the tested quadruplex sequences was found for 360A. In general, in case of the most stable sequence compounds can specifically bind to and stabilize RNA quadru4G3U (T1/2 = 62.7 8C, at 1 mm KCl) the melting curve in the presplexes, in vivo. The addition of bisquinolinium derivatives to ence of the ligand is shifted towards higher temperatures commammalian cell cultures drastically down-regulates expression pared to 4G3U2 and 4G3U3. Although much larger increases in of reporter genes that harbor 5-UTR RNA quadruplexes. T1/2 values have been reported earlier with human telomeric In order to evaluate whether DNA quadruplex-binding comDNA quadruplexes for 360A, PhenDC3 and PhenDC6 (Table S1 pounds are suited for targeting RNA quadruplexes, we first investigated binding to a series of RNA sequences. CD spectroscopy has been used to investigate the formation and structures of various RNA quadruplexes and respective guanosineTable 2. Compound-induced thermodynamic stability of RNA quadrurich control sequences (Table 1). The CD spectra of 4G3U, plexes.[a]
Ligand Table 1. RNA sequences used in CD and FID measurements. The prefix con refers to three G to U mutations for disruption of quadruplex formation. Sequence name 4G3U con4G3U 4G3U2 con4G3U2 4G3U3 con4G3U3 RNA sequence (5!3) GGGUGGGUGGGUGGG GGGUGUGUGUGUGUG GGGUUGGGUUGGGUUGGG GGGUUGUGUUGUGUUGUG GGGUUUGGGUUUGGGUUUGGG GGGUUUGUGUUUGUGUUUGUG 4G3U 360A PhenDC3 PhenDC6 62.7 0.3 79.8 1.4 (17.1)[c] 74.4 0.2 (11.7)[c] 69.9 0.2 (7.2)[c] T1/2 [8C][b] 4G3U2 59.6 0.2 71.0 0.4 (11.4)[c] 64.7 0.2 (5.1)[c] 69.1 0.2 (9.5)[c] 4G3U3 47.3 0.1 n.d.[d] 54.9 0.2 (7.6)[c] 55.4 0.1 (8.1)[c]

[a] CD melting experiments with or without bisquinolinium compounds were used to determine the melting temperatures of RNA quadruplexes, T1/2 (molecule+RNA G4) and T1/2 (RNA G4), respectively. The induced stability due to ligand interaction was determined as the increase in melting temperatures (DT1/2 [8C]), as shown in parentheses. [b] T1/2 SD, [c] DT1/2 [8C] = T1/ 2 (ligand+RNA G4)T1/2 (RNA G4), [d] not determined.

1664

www.chembiochem.org

 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

ChemBioChem 2011, 12, 1663 1668

in the Supporting Information and ref. [20d]), the present CD T1/2 values cannot be compared directly since the compound/ DNA ratio was 5:1 instead of the equimolar ratio used here. In addition, the K + concentration was 100 mm, while in the present study we have used 1 mm K + . The lower compound and salt concentrations were used primarily due to high intrinsic stability of the investigated RNA quadruplexes as described earlier.[17] In particular the 4G3U sequence only partially denatures even at 10 mm KCl (T1/2 > 95 8C); this necessitates a further reduction of the salt concentration to 1 mm in order to quantify the stabilizing effect of the bisquinolinium compounds. Because of the mentioned limitations of the thermal denaturation measurements, we next conducted a G-quadruplex specific fluorescent intercalator displacement (G4-FID) assay in order to gain further insight into the interaction of the four bisquinolinium compounds with the targeted RNA quadruplexes. Briefly, the G4-FID assay is a semiquantitative assay based on the competitive displacement of the well-known on/off fluorescent probe thiazole orange (TO) from a quadruplex matrix.[19] Since TO is virtually nonfluorescent in its unbound form and strongly fluorescent when bound to DNA, titration of the quadruplexTO complex with putative quadruplex binders induces a concentration-dependent decrease in fluorescence resulting from displacement of TO from the quadruplex. TO does not show a strong binding preference for various forms of DNA[22] but is known to bind to quadruplexes with high affinity. However, substantial differences in quantum yield and stoichiometry can be observed depending on the structure of the quadruplex matrix.[23] It is thus necessary to characterize the interaction of TO with novel quadruplex motifs before a FID titration utilizing a quadruplex binder is carried out. A strong fluorescence enhancement of TO is observed upon binding to the three investigated RNA quadruplexes from approximately 50-fold for 4G3U and 4G3U2 to about 300-fold for 4G3U3 (the resulting titration curves are shown in Figure S3 A in the Supporting Information). In the three cases the curves could be fitted with a 1:1 stoichiometric model allowing the deduction of association constant (KA) values of 4.5(0.4) 105 and 5.7(0.3) 105 m1, for 4G3U and 4G3U2, respectively, whilst a significantly higher value was found for 4G3U3 KA = 2.3(0.4) 106 m1. Utilizing 0.25 mm RNA and 0.5 mm TO, displacement reactions were next performed by addition of bisquinolinium derivatives to the TOquadruplex RNA complex and the fluorescence decrease of TO was plotted against ligand concentration (Figure S3 BD in the Supporting Information). A very rapid displacement of the probe was observed for ligands 360A, PhenDC3, and PhenDC6, with saturation already occurring at a twofold excess of the bisquinolinium ligand (0.5 mm) with respect to the RNA concentration (0.25 mm). This behavior was observed for all three tested RNA sequences. The concentration of ligand required to displace half of the TO from the RNA quadruplex motif, termed DC50, was determined. Very low DC50 values ranging from 100 to 180 nm were found in all cases, reflecting very high affinity of the three compounds to the RNA quadruplexes studied (Table 3). On the basis of the DC50
ChemBioChem 2011, 12, 1663 1668

Table 3. Affinity of bisquinoliniumRNA quadruplex interactions. Ligand RNA sequence DC50 [mm] 360A 4G3U 4G3U2 4G3U3 4G3U 4G3U2 4G3U3 4G3U 4G3U2 4G3U3 0.12 0.14 0.18 0.13 0.12 0.16 0.11 0.10 0.18 Affinity[a] KA [m1] 9.6 107 1.5 108 n.d.[b] 9.4 108 9.8 108 n.d.[b] 2.0 108 2.6 108 n.d.[b]

PhenDC3

PhenDC6 [a] The DC50 quinolinium mined from see ref. [19];

values and equilibrium association constants (KA) of the bisderivatives for the studied RNA quadruplexes were deterFID plots. For details of determining affinity from FID plots [b] not determined.

values, the FID assay allows affinity ranking in a series of binders with regard to a given DNA or RNA structure. However, a direct comparison of DC50 obtained with different sequences and structures is invalid if TO shows significantly different affinities to the compared nucleic acids. For this reason, the values previously obtained for telomeric DNA with the same set of compounds are not comparable as TO was shown to bind the telomeric quadruplex with a higher affinity (KA : 3 106 m1 [7c]). On the same line, the DC50 values obtained with the 4G3U and 4G3U2 sequences can be compared whereas the value obtained with 4G3U3 might be underestimated due to the tighter binding of the fluorescent probe. In addition, the moderate affinity of TO for the two RNA sequences 4G3U, 4G3U2 enables the direct determination of binding constants since, in this particular case, the equilibrium corresponding to the competitive displacement of the probe can be neglected as described by Boger et al.[24] Exceptionally high affinity constants in the 107108 m1 range were determined for the three compounds (Table 3). Thus, the FID assay demonstrates high affinities of 360A and the two PhenDC isomers; this is consistent with the CD-melting experiments.

Table 4. RNA quadruplexes in 5-UTRs of a reporter gene. Construct name[a] wt 4G3U 4G3U2 4G3U3 5G3U 5G3U2 5G3U3 6G3U 6G3U2 6G3U3
[b]

Sequence (5!3) ACUAUAGGCUAGCCACCAUGGCU (GGGU)3GGG (GGGUU)3GGG (GGGUUU)3GGG GGGU(GGGU)3GGG GGGUU(GGGUU)3GGG GGGUUU(GGGUUU)3GGG GGGUGGGU(GGGU)3GGG GGGUUGGGUU(GGGUU)3GGG GGGUUUGGGUUU(GGGUUU)3GGG

[a] The number (4, 5, or 6) in the prefix of the construct name represents the total number of GGG repeats in the RNA sequence. The construct names are further prefixed with con to represent G-rich, nonquadruplex control sequences with the underlined G residues mutated to U. [b] RNAquadruplex forming sequences were inserted 11 bp upstream () of the start codon (AUG) of the wild-type (wt) reporter gene (hRluc).

 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.chembiochem.org

1665

In order to investigate whether the pronounced affinity of the bisquinolinium compounds for RNA quadruplexes can be used for targeting RNA quadruplexes in a cellular context, we treated human embryonic kidney (HEK293) cells transfected with plasmids expressing a luciferase gene harboring different RNA quadruplexes in the 5UTR (Table 4) with the bisquinolinium derivatives. Details of the plasmid construction of the reporter gene (hRluc) with 5-UTR quadruplexes 4G3U, 4G3U2, and 4G3U3, and its corresponding series with five and six G-rich repeats were discussed earlier.[17] Since RNA quadruplexes are invariably parallel-stranded,[25] the described systematic variations used here should be ideally suited to investigate differences in compound binding to motifs of different thermal stability. We have shown earlier that the incorporation of these RNA quadruplexes into the 5-UTR of a reporter gene suppresses translation of the mRNA and that the extent of this effect correlates with the thermodynamic stability of the motif.[17] In order to exclude toxic effects, we first performed cell viFigure 2. Bisquinolinium-dependent and quadruplex-mediated inhibition of gene expression. A)F) Normalized luminescence of luciferase expression of constructs harboring RNA quadruplex (AC) or guanosine-rich control seability assays. As shown in Figquences (DF) after 19 h incubation with 0 (&), 0.1 (&), 1.0 (&) or 10 mm (&) bisquinolinium ligand. Loop composiure S4 in the Supporting Infortions were as follows: A), D) U; B), E) U2 ; C), F) U3. The expression levels depict the cumulative effect of the RNA mation, no toxicity was obquadruplex and bisquinolinium compounds. The error bars represent standard deviations of three independent served with the series of bisquiexperiments. nolinium compounds used in this study. Next, when treated with bisquinolinium compounds, the quadruplex-containing Hence, it can be concluded that the compound-mediated mRNAs 4G3Ux, 5G3Ux, and 6G3Ux (x = 13) all showed reduced decrease in gene expression of the 4G3Ux, 5G3Ux, and 6G3Ux constructs is specific with respect to the formation of a quadluciferase expression compared to untreated cells (Figure 2 A ruplex structure. The construct 6G3U was found to be most efC). Expression decreased systematically with increasing ligand concentrations from 0.110 mm, demonstrating a dose-depenfected by compound addition compared to any other quadrudent effect. On the other hand, similar bisquinolinium treatplex construct, and displayed a cumulated decrease in gene ment of the guanosine-rich control sequences con4G3Ux, expression of 97 % at 10 mm concentration compared to the untreated con6G3U sample (Figure 2 A). This sequence also con5G3Ux, and con6G3Ux (x = 13) exhibited very little or no effect on expression (Figure 2 DF). In addition we included a showed the most drastic effect on gene expression in the abbisquinolinium control compound 8979A in the in vivo experisence of compounds, resulting from the highest stability ments, which has been reported to lack affinity for quadruplex amongst all RNA quadruplexes examined.[17] The expression [18b] sequences. levels reported in Figure 2 AC are the cumulative suppressive As shown in Figure S5 in the Supporting Inforeffects of both quadruplex insertion and targeting with the mation, no decrease of reporter gene expression was observed bisquinolinium compounds. In order to visualize the effect of when cells were grown in the presence of 8979A. bisquinolinium derivatives alone, we normalized the expression

1666

www.chembiochem.org

 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

ChemBioChem 2011, 12, 1663 1668

levels in reactions containing compounds to the respective experiment in the absence of the bisquinolinium derivatives. By doing so, the quadruplex effect is no longer visible and the influence of the bisquinoliniums on the different sequences can be compared (Figure S6 in the Supporting Information). The 6G3U expression still appeared to be most effected compared to any other quadruplex constructs. Notably, a decrease of 86 % in 6G3U expression was observed when treated with 10 mm PhenDC3 compared to the untreated sample. In general, the bisquinolonium compounds are found to act more potently on more stable quadruplexes. Although structural reasons for this behavior cannot be excluded, the more drastically the quadruplex influences gene expression alone, an even more pronounced effect upon addition of the quadruplex binders was observed (Figure 2 and Figure S6 in the Supporting Information). For the most unstable quadruplex within the series (4G3U3), with PhenDC3 and 360A even a slight increase of expression was observed. When we first reported the influence of the designed quadruplexes in 5-UTRs we quantified the mRNA levels in order to investigate whether insertion of the quadruplexes into the mRNA effected parameters such as transcription or mRNA stability, and found that the mRNA levels are identical irrespective of the presence of a quadruplex sequence.[17] We again performed semiquantitative PCR in order to investigate whether the addition of the bisquinolinium derivatives acts by changing mRNA levels. We found that the relative abundance of the reporter gene (hRluc) mRNA was identical in the absence and presence of the tested ligands; this is consistent in the different constructs 4G3U, con4G3U, and wild type (wt; Figure 3). The determination was carried out at the highest biquinolinium concentrations (10 mm) used and confirms that the addition of the compounds did not alter mRNA levels. In summary, in the present study utilizing CD and fluorescent intercalator displacement experiments we show that the investigated bisquinolinium compounds bind to and stabilize RNA quadruplex structures. Compounds known to bind DNA quadruplexes tightly and selectively were found to bind fourstranded RNA motifs with similar affinities. When human cells

expressing a reporter gene under control of a 5-UTR-based RNA quadruplex were treated, very pronounced effects on gene expression were observed. Importantly, similar sequences that are unable to form quadruplexes showed no or only marginal effects, strongly suggesting a structure-specific interaction. Moreover, this study confirms the previous hypothesis that inhibition of mRNA translation is correlated with the stability of 5-UTR-based RNA quadruplexes. During the course of the present study, two related studies were reported wherein 5-UTR RNA quadruplexes were targeted by similar compounds[26] or a quinolino dicarboxamide derivative.[27] However, both studies employed a combination of in vitro transcription/ translation protocols utilizing cell extracts. Although a suppressive effect on gene expression was found in both studies, the present work is the first report of small molecules for targeting RNA quadruplexes in cellular experiments. The observed effects are drastic and correlate with the stability of the targeted quadruplexes. The latter finding could prove useful for potential therapeutic applications since it can be employed for specifically targeting sites containing especially stable quadruplex motifs.

Acknowledgements
J.S.H. gratefully acknowledges the VolkswagenStiftung for funding a Lichtenberg Professorship; K.H. thanks the Alexander von Humboldt Foundation for a fellowship, E.L. thanks the CNRS and the Institut Curie for a cofunded PhD fellowship. We thank JeanFranois Riou for supplying 8979A. Keywords: gene expression nucleic acids quinoline RNA quadruplexes
[1] a) S. Burge, G. N. Parkinson, P. Hazel, A. K. Todd, S. Neidle, Nucleic Acids Res. 2006, 34, 5402 5415; b) D. J. Patel, A. T. Phan, V. Kuryavyi, Nucleic Acids Res. 2007, 35, 7429 7455. [2] Y. Qin, L. H. Hurley, Biochimie 2008, 90, 1149 1171. [3] J. Eddy, N. Maizels, Nucleic Acids Res. 2008, 36, 1321 1333. [4] A. K. Todd, S. Neidle, Nucleic Acids Res. 2008, 36, 2700 2704. [5] a) K. Halder, R. Halder, S. Chowdhury, Mol. Biosyst. 2009, 5, 1703 1712; b) H. Wong, J. Huppert, Mol. Biosyst. 2009, 5, 1713 1719. [6] a) N. W. Luedtke, Chimia 2009, 63, 134 139; b) J.-H. Tan, L.-Q. Gu, J.-Y. Wu, Mini Rev. Med. Chem. 2008, 8, 1163 1178. [7] a) S. Neidle, Curr. Opin. Struct. Biol. 2009, 19, 239 250; b) A. Arola, R. Vilar, Curr. Top. Med. Chem. 2008, 8, 1405 1415; c) D. Monchaud, C. Allain, H. Bertrand, N. Smargiasso, F. Rosu, V. Gabelica, A. De Cian, J. L. Mergny, M. P. Teulade-Fichou, Biochimie 2008, 90, 1207 1223. [8] H. J. Lipps, D. Rhodes, Trends Cell Biol. 2009, 19, 414 422. [9] a) A. Siddiqui-Jain, C. L. Grand, D. J. Bearss, L. H. Hurley, Proc. Natl. Acad. Sci. USA 2002, 99, 11593 11598; b) T. Ou, Y. Lu, C. Zhang, Z. Huang, X. Wang, J. Tan, Y. Chen, D. Ma, K. Wong, J. Tang, A. Chan, L. Gu, J. Med. Chem. 2007, 50, 1465 1474; c) R. L. Rodriguez, S. Mller, J. A. Yeoman, C. Trentesaux, J.-F. Riou, S. Balasubramanian, J. Am. Chem. Soc. 2008, 130, 15758 15759. [10] a) P. Hazel, J. Huppert, S. Balasubramanian, S. Neidle, J. Am. Chem. Soc. 2004, 126, 16405 16415; b) P. A. Rachwal, T. Brown, K. R. Fox, FEBS Lett. 2007, 581, 1657 1660; c) N. Smargiasso, F. Rosu, W. Hsia, P. Colson, E. S. Baker, M. T. Bowers, E. De Pauw, V. Gabelica, J. Am. Chem. Soc. 2008, 130, 10208 10216. [11] a) N. Kumar, S. Maiti, Nucleic Acids Res. 2008, 36, 5610 5622; b) W. Li, P. Wu, T. Ohmichi, N. Sugimoto, FEBS Lett. 2002, 526, 77 81.

Figure 3. Determination of relative mRNA levels in relation to bisquinolinium treatment. Relative mRNA levels of reporter gene constructs (hRluc) harboring quadruplex and control sequences with (4G3U) or without (con4G3U and wild type (wt)), as determined by cycle threshold (CT) values from real-time PCR assays are shown. Bisquinolinium derivatives were added at 10 mm each. The error bars represent standard deviations of three independent experiments.

ChemBioChem 2011, 12, 1663 1668

 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.chembiochem.org

1667

[12] a) C. M. Azzalin, P. Reichenbach, L. Khoriauli, E. Giulotto, J. Lingner, Science 2007, 318, 798 801; b) S. Schoeftner, M. Blasco, Nat. Cell Biol. 2008, 10, 228 236. [13] Y. Xu, Y. Suzuki, K. Ito, M. Komiyama, Proc. Natl. Acad. Sci. USA 2010, 107, 14579 14584. [14] a) J.-D. Beaudoin, J.-P. Perreault, Nucleic Acids Res. 2010, 38, 7022 s7036; b) J. L. Huppert, A. Bugaut, S. Kumari, S. Balasubramanian, Nucleic Acids Res. 2008, 36, 6260 6268. [15] M. Wieland, J. S. Hartig, Chem. Biol. 2007, 14, 757 763. [16] a) S. Kumari, A. Bugaut, J. L. Huppert, S. Balasubramanian, Nat. Chem. Biol. 2007, 3, 218 221; b) A. Arora, M. Dutkiewicz, V. Scaria, M. Hariharan, S. Maiti, J. Kurreck, RNA 2008, 14, 1290 1296; c) M. Morris, S. Basu, Biochemistry 2009, 48, 5313 5319. [17] K. Halder, M. Wieland, J. S. Hartig, Nucleic Acids Res. 2009, 37, 6811 6817. [18] a) A. De Cian, E. Delemos, J. L. Mergny, M. P. Teulade-Fichou, D. Monchaud, J. Am. Chem. Soc. 2007, 129, 1856 1857; b) G. Pennarun, C. Granotier, L. R. Gauthier, D. Gomez, F. Hoffschir, E. Mandine, J. F. Riou, J. L. Mergny, P. Mailliet, F. D. Boussin, Oncogene 2005, 24, 2917 2928; c) C. Granotier, G. Pennarun, L. Riou, F. Hoffschir, L. R. Gauthier, A. De Cian, D. Gomez, E. Mandine, J. F. Riou, J. L. Mergny, P. Mailliet, B. Dutrillaux, F. D. Boussin, Nucleic Acids Res. 2005, 33, 4182 4190; d) A. Henn, A. Joachimi, D. P. Goncalves, D. Monchaud, M. P. Teulade-Fichou, J. K. Sanders, J. S. Hartig, ChemBioChem 2008, 9, 2722 2729. [19] D. Monchaud, C. Allain, M. P. Teulade-Fichou, Bioorg. Med. Chem. Lett. 2006, 16, 4842 4845. [20] a) G. Pennarun, C. Granotier, F. Hoffschir, E. Mandine, D. Biard, L. R. Gauthier, F. D. Boussin, Nucleic Acids Res. 2008, 36, 1741 1754; b) T. Le-

[21]

[22] [23] [24] [25]

[26] [27]

marteleur, D. Gomez, R. Paterski, E. Mandine, P. Mailliet, J. F. Riou, Biochem. Biophys. Res. Commun. 2004, 323, 802 808; c) A. Piazza, J. B. Boule, J. Lopes, K. Mingo, E. Largy, M. P. Teulade-Fichou, A. Nicolas, Nucleic Acids Res. 2010, 38, 4337 4348; d) A. De Cian, J. Gros, A. Guedin, M. Haddi, S. Lyonnais, L. Guittat, J.-F. Riou, C. Trentesaux, B. Sacca, L. Lacroix, P. Alberti, J.-L. Mergny, Nucleic Acids Symp. Ser. 2008, 52, 7 8. a) P. Balagurumoorthy, S. K. Brahmachari, D. Mohanty, M. Bansal, V. Sasisekharan, Nucleic Acids Res. 1992, 20, 4061 4067; b) J. Kypr, I. Kejnovska, D. Renciuk, M. Vorlickova, Nucleic Acids Res. 2009, 37, 1713 1725. J. Nygren, N. Svanvik, M. Kubista, Biopolymers 1998, 46, 39 51. D. Monchaud, C. Allain, M.-P. Teulade-Fichou, Nucleosides Nucleotides Nucleic Acids 2007, 26, 1585 1588. D. L. Boger, B. E. Fink, S. R. Brunette, W. C. Tse, M. P. Hedrick, J. Am. Chem. Soc. 2001, 123, 5878 5891. a) C. F. Tang, R. H. Shafer, J. Am. Chem. Soc. 2006, 128, 5966 5973; b) H. Liu, A. Matsugami, M. Katahira, S. Uesugi, J. Mol. Biol. 2002, 322, 955 970; c) A. Joachimi, A. Benz, J. S. Hartig, Bioorg. Med. Chem. 2009, 17, 6811 6815. D. Gomez, A. Guedin, J.-L. Mergny, B. Salles, J.-F. Riou, M.-P. TeuladeFichou, P. Calsou, Nucleic Acids Res. 2010, 38, 7187 7198. A. Bugaut, R. Rodriguez, S. Kumari, S. T. Hsu, S. Balasubramanian, Org. Biomol. Chem. 2010, 8, 2771 2776.

Received: April 5, 2011 Published online on June 16, 2011

1668

www.chembiochem.org

 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

ChemBioChem 2011, 12, 1663 1668