Professional Documents
Culture Documents
PCR Cloning Kit: Helixclone
PCR Cloning Kit: Helixclone
PCR Cloning Kit: Helixclone
www.nanohelix.net
Contents
1. Kit Contents
1) 2) 3) Product Types of HelixCloneTM PCR Cloning Kit HelixCloneTM PCR Cloning Kit Reagents Contents of Competent Cell 3 3 3
2. Methods
1) 2) 3) 4) Introduction Preparation of PCR Product Setting up the Cloning Reaction - Procedure General Guidelines of Transformation - Chemical Transformation Method - Electroporation Method Analysis of Transformants Map of pHelix vector Control Reaction Factors Affecting Cloning Efficiency Ordering Information
4 4 4 5 6 7 7 7 8 9 10 11 12
5) 6) 7) 8) 9)
www.nanohelix.net
Co ontents
20 rx 20 rx
HCK-T HCK-B
Volume
20 l
6x Reaction Buffer M13 F( 47) P i F(-47) Primer M13 R(-48) Primer Control Insert DNA (720 bp) Distilled water
Primer sequence
Primer
M13 F(-47) primer M13 R(-48) primer
Sequence (53)
CGCCAGGGTTTTCCCAGTCACGA AGCGGATAACAATTTCACACAGGA
Components
Chemically competent cell 10 pg/l in TE buffer (pH8 0) (pH8.0)
Volume
50 l x 21 ea 50 l
Kit Contents t
1. Kit Contents
2. Method 2 M th d
1) Introduction
HelixCloneTM PCR Cloning Kit provides a fast and efficient one-step cloning strategy f di t i for direct insertion of 3A blunt-end l i t t ti f 3A-overhang or bl t d PCR h products into a plasmid vector without ligase. The pHelix vector is a linearlized DNA bound with topoisomerase I at 3-end of each strand. The pHelix vector contains a lethal gene (ccdB) fused to the C-terminus of the lacZ-ccdB gene fusion permitting growth of only positive recombinants upon transformation into E. coli. On the other hand, cells that contain non-recombinant vector are killed upon plating. So this vector allows direct selection of recombinants recombinants. LacZ fragment and insertion of a PCR product disrupts expression of fragment,
PCR Reaction
Template DNA (10 ~ 100 ng) 10x PCR reaction buffer Each 10 mM dNTP Mix Forward Primer (10 pmoles/l) Reverse Primer (10 pmoles/l) DNA polymerase (2.5 unit/l) Distilled water Final reaction volume 1 l 5 l 1 l 1 l 1 l 0.5 l 40.5 l 50 l
Introduction
Me ethod
Cloning
Procedure
1. Mix the PCR products with the components of HelixCloneTM PCR Cloning Kit according to the following table.
Components
PCR product 6x Reaction Buffer Dilute Reaction Buffer pHelix TA or Blunt vector Distilled water Chemically competent cell Electrocompetent cell
0.5 ~ 4 l 1 l
0.5 ~ 4 l
2. 2 Mix well and incubate at room temperature (23 ~ 25) for 5 ~ 20 minutes minutes. Note
The prolonged incubation up to 20 minutes will produce more colonies (transformants). For the cloning of PCR product above 1 kb size, we recommend to incubate the reaction for 20 ~ 30 min min.
Chloramphenicol resistant gene (720 bp) amplified with Taq DNA polymerase was used as control insert. Ligation mix (6 l) was used to transform E. coli DH5 cells. Transformation efficiency of DH5 : 1.0 X 108 colonies/ g pUC19 DNA.
Procedure
Transformat tion
5) Analyzing transformants
Colonies or the isolated plasmid DNAs can be analyzed by following methods.
Sequencing analysis
You may sequence the isolated plasmid DNA to confirm the correct clone. M13 F(-47) and M13 R(-48) primers can be used for the sequencing analysis of your insert DNA.
Long-term storage of transformants If you want to store the correct clone for a long time, you may prepare glycerol stock.
1) Streak the positive transformant on LB agar plate containing ampicillin (50 ~ 100 g/ml) and/or kanamycin (50 g/ml) and incubate overnight at 37. 2) Inoculate a single colony in 1 ~ 2 ml of LB broth containing ampicillin (50 ~ 100 g/ml) and/or kanamycin (50 g/ml). 3) Incubate overnight at 37 with shaking (200 rpm). 4) Mix well the 0.85 ml of culture with 0.15 ml of sterile glycerol in a cryotube. 5) Store at -80.
HelixCloneTM PCR Cloning Kit Handbook
Analyzing
pHelix Blunt
7) Control Reaction
pHelix control reaction
1) Set up pHelix control reaction according to the following table.
Reagent Distilled water 6x Reaction buffer Control insert DNA (20 ng/l) pHelix vector Final volume Vector only 4 l 1 l Vector + Control insert 3 l 1 l 1 l 1 l 6 l
1 l 6 l
2) Incubation at room temperature for 5 ~ 20 min. 3) Transform 3 ~ 6 l of each reaction into competent cell. 4) Spread 100 l of each transformation mix on an LB plate containing ampicillin and/or kanamycin. 5) Incubate overnight at 37.
Analyzing Results A l i R lt
There should be > 100 colonies on the Vector + Control insert plate, and 95% of the colonies should contain the 750 bp insert when analyzed by colony PCR and agarose gel electrophoresis (Figure 3).
10
Transformation Control
- pUC19 DNA is included to check the transformation efficiency. - Transform with 10 pg of the plasmid DNA per 50 l of competent cell protocol). (See transformation protocol) - Just before plating the transformation mix, dilute 10 l of the mix with 90 l of LB broth.
Cell Chemically competent cell Volume to Plate 10 l + 90 l LB broth Transformation Efficiency > 1 x 109 cfu/g pUC19 DNA
Solutions
Be sure to include a final extension step of 7 to 30 minutes during PCR. Longer PCR products will need a longer extension time. HelixCloneTM PCR Cloning kit is optimized to cloning for 2 kb size of DNA. Large PCR products (>3 kb) may necessitate gel extraction. Reduce the amount of PCR Product. Product Smearing, multiple banding, primer-dimer artifacts may necessitate gel extraction.
Large PCR products (>3 kb) or smearing, multiple banding, primer-dimer artifacts affect the cloning efficiency of target DNA. We recommended to purify the PCR products using PureHelixTM Gel Extraction kit (Cat. No. GE50, GE200).
11
Affecting Fa actors
9) Ordering Information
Product
TA cloning kit l i
HelixClone TA Cloning Kit HelixClone TA Cloning Pack 1 [TA Cloning Kit, Competent Cell ] HelixClone TA Cloning Pack 2 [TA Cloning Kit, LOP LB Agar Plate(Amp+, Kan+)] HelixClone TA Cloning Pack 3 [TA Cloning Kit, Competent Cell, LOP LB Agar Plate(Amp+, Kan+)]
Size
Cat. no.
20 rx 20 rx 20 rx 20 rx
20 rx 20 rx 20 rx 20 rx
HCK-B HCP1-B
HCP3-B
Components
HelixClone LOP LB Agar Plate (Amp+, Kan+) HelixClone LOP LB Agar Plate (Amp+, Kan+)
HLOP50 HLOP200
Related Product
Fast-n-Pure Plasmid Kit (Spin column based)
PureHelix Fast-n-Pure Plasmid Kit ver 2.0 PureHelix Fast-n-Pure Plasmid Kit ver 2.0
Size
Cat. no.
FPL50 FPL200
GE50 GE200
PCR50 PCR200
12
Ordering Information
HCP2-B
USA
NanoHelix USA, Inc. (Tel : +1-443-854-7102) 1952 Gallows Rd. Suite 110 Vienna, VA 22182
Korea
Head Office (Tel : +82-42-867-9055) #505 Daejeon Bioventure Town, 1662 Yuseong-Daero, Yuseong-Gu, Daejeon 305-811
International Distributor
Australia Canada China Egypt
: Evolve Life Science Pty Ltd : Omnibiosystems Inc. : Beijing Netlink Co., Ltd. : DELTA Trading & Development SAE
New Zealand : Evolve Life Science Pty Ltd Romania Singapore Taiwan Turkey Thailand UK & Ireland USA
: Redox Lab : Precision Technologies Pte. Ltd. : Gene Research Lab. Co. Ltd : Intron Healthcare Products Company : GIBTHAI CO., LTD : Bioquote Limited : Omnibiosystems Inc.
: Talron Biotech LTD : Global for lab & Scientific supplies CO. LTD : NANO LIFE QUEST SDN. BHD.
www.nanohelix.net
Distributor