Journal of Invertebrate Pathology 93 (2006) 6770 www.elsevier.

com/locate/yjipa

Short Communication

Honeybee viruses in Uruguay

Karina Antnez a,, Bruno DAlessandro a, Eduardo Corbella b, Gustavo Ramallo b, Pablo Zunino a
a

Laboratorio de Microbiologa, Instituto de Investigaciones Biolgicas Clemente Estable, Avenida Italia 3318, CP 11600 Montevideo, Uruguay b Apicultura, Instituto Nacional de Investigacin Agropecuaria, Colonia, Uruguay Received 29 December 2005; accepted 25 May 2006 Available online 14 July 2006

Abstract Mortality of honeybees is a serious problem that beekeepers have to face periodically in Uruguay and worldwide. The presence of RNA viruses, in addition to other pathogens may be one of its possible causes. In this work, we detected Chronic bee paralysis virus, Acute bee paralysis virus, Black queen cell virus, Sacbrood virus and Deformed wing virus in samples of Uruguayan honeybees with or without Varroa destructor and Nosema apis. The detection of viruses in diVerent provinces, simultaneous co-infection of colonies by several viruses and the fact that 96% of the samples were infected with one or more virus, indicates they are widely spread in the region. 2006 Elsevier Inc. All rights reserved.
Keywords: Honeybees; Chronic bee paralysis virus; Acute bee paralysis virus; Black queen cell virus; Sacbrood virus; Deformed wing virus; Kashmir virus; RT-PCR; Varroa destructor; Nosema apis

Mortality of honeybees (Apis mellifera) is one of the most serious problems that beekeepers have to face periodically worldwide. There are probably several factors that may play a role in this process such as the presence of Varroa destructor and Nosema apis, etiological agents of Varroosis and Nosemosis respectively, or exposure to insecticides or pesticides used in agriculture (Suchail et al., 2004). It has also been suggested that episodes of mortality are related to the presence of RNA viruses. More that eighteen viruses that aVect honeybees have been described including Chronic bee paralysis virus (CBPV), Acute bee paralysis virus (ABPV), Black queen cell virus (BQCV), Sacbrood virus (SBV), Deformed wing virus (DWV), and Kashmir virus (KBV) (Ball and Bailey, 1991). Only CBPV, SBV, and DWV would produce clinical signs that can be clearly identiWable by beekeepers. CBPV causes a disease characterized by trembling, Xightless and sometimes black individuals crawling at the hive entrance, larvae aVected with SBV fail to pupate and ecdysial Xuid accumulates beneath their skin
*

Corresponding author. Fax: +598 2 4875548. E-mail address: karina@iibce.edu.uy (K. Antnez).

forming a sac and DWV can cause wing deformity. However, according to diVerent authors, viruses can persist in a latent state in apparently healthy colonies (Allen and Ball, 1996; Bailey, 1967). The presence of diVerent viruses and their relation with mortality of bees is a cause of concern that is being studied all over the world (Bakonyi et al., 2002; Benjeddou et al., 2001; Chantawannakul et al., 2006; Chen et al., 2005; Grabensteiner et al., 2001; Hung, 2000; Ribiere et al., 2002; Shen et al., 2005; Stoltz et al., 1995; Tentcheva et al., 2004; Yue and Genersch, 2005). In Uruguay, a country with a population of about 3 million people, there are about 4000 beekeepers more than 400,000 beehives and during the last years honey has become one of the most important agricultural products for export. Recently we reported the presence of CBPV and ABPV in Uruguayan honeybees by reverse transcriptionpolymerase chain reaction (RT-PCR), in samples collected between December 2003 and December 2004. This work was the Wrst report on viruses in South American bees (Antunez et al., 2005). Due to the growing importance of apiculture in our country, and the great loses associated to

0022-2011/$ - see front matter 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.jip.2006.05.009

68

K. Antnez et al. / Journal of Invertebrate Pathology 93 (2006) 6770

bees mortality suVered every year by unknown reasons, we decided to continue the survey on the presence of honeybees viruses as a possible cause. In this work, we report the presence of CBPV, ABPV, BQCV, SBV, and DWV in Uruguayan honeybees in a new survey carried out during 2005. Fifty two worker honeybee samples from diVerent provinces of Uruguay [Colonia and Soriano (west) Lavalleja, Maldonado and Treinta y tres (east)] were used in this study. Honeybees were collected from May 2005 to December 2005, and most of them were associated with mortality episodes that have periodically aVected the country in recent years. Sub-samples were sent refrigerated to the Laboratory of Microbiology, IIBCE (Montevideo, Uruguay) for the analysis of viruses, and to the Laboratory of Apiculture, INIA (Colonia, Uruguay) for the analysis of N. apis and V. destructor. The sources and symptoms corresponding to each sample are shown in Table 1. For the analysis of viruses, 1012 honeybees were randomly selected from each colony sample and placed in sterile plastic bags using sterile forceps and 10 ml of phosphate-buVered saline (PBS) was added. Bees were crushed for 2 min at high speed in a Stomacher 80 Lab Blender (Seward, London, UK) and the resultant homogenate was Wrst centrifuged at 1500g for 10 min. The supernatant was recovered and centrifuged again at 12,000g for 15 min and 140 l of the Wnal supernatant was used for viral RNA extraction. RNA was extracted using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturers instructions. Reverse transcription of RNA and ampliWcation of cDNA were performed using a continuous RT-PCR method one-step RT-PCR kit (Qiagen), according to the manufacturers recommendations. Primers used to amplify the diVerent viruses are shown in Table 2. PCR was performed in a Wnal volume of 50 l containing 10 l of 5 buVer, 2 l of dNTP mix (containing 10 mM of each dNTP), 1.5 l of a stock solution of 20 M of each primer, 2 l of enzyme mix, and 10 l of template RNA. Negative RT-PCR controls were carried out excluding nucleic acids from the reaction. The RT-PCR program included a reverse transcription stage at 50 C for 30 min, followed by an initial PCR activation step at 95 C for 15 min. This was followed by 40 cycles of 94 C for 1 min, 55 C for 1 min, and 72 C for 1 min, and a Wnal extension step at 72 C for 10 min. The reaction was performed using a T1 Biometra Thermocycler and products were visualized by electrophoresis in 0.8% (w/v) agarose gels stained with ethidium bromide (Sambrook et al., 1989). For the analysis of V. destructor 300 bees collected from unsealed brood combs were suspended in alcohol to provoke the separation of the mites from the bees, and the bees were separated with a sieve. Mites were counted and the percentage of infection per sample was determined (OIE, 2004a). For the analysis of N. apis 10 bees were Wxed in 4% formol in order to prevent them from decomposing. The abdomens of the bees were separated, macerated in 5 ml of water

using a mortar and pestle, Wltered through two layers of muslin, and centrifuged for 6 min at 800g. Three drops of the suspension were placed on a haemocytometer (blood cell counting chamber) and examined microscopically at 400 magniWcation, under bright-Weld or phase-contrast optics (OIE, 2004b). The results are presented as presence or absence of spores. In 52 samples that were initially analyzed for the presence of ABPV, CBPV, and BQCV, 47% resulted positive for CBPV, 9% resulted positive for ABPV and 91% resulted positive for BQCV. This was the Wrst case of BQCV detection in South America. Due to these striking results we decided to include the search for the presence of three more viruses in this study. Therefore, in the last 20 samples (3352, Table 1) the presence of SBV, DWV, and KBV was also analyzed. (It was not possible to analyze the presence of SBV, DWV, and KBV in the Wrst 32 samples due to the short lifetime of RNA) SBV and DWV were detected in all of these samples (100%), while no KBV expected bands were observed. This is the Wrst record of SBV and DWV in South America. Although the presence of SBV is easily distinguished by clinical symptoms, these symptoms were not observed in the analyzed colonies, indicating that the virus was present in a unapparent or latent state. However, there have been a few reports about suspected cases of symptoms presumptively associated to SBV in the country (Jorge Harriet, personal communication). In the 20 last samples, 15 were co-infected by BQCV, SBV, and DWV; one was co-infected with CBPV, BQCV, SBV, and DWV and four samples were co-infected with ABPV, BQCV, SBV, and DWV. Negative controls (without nucleic acids) did not show any band. The results of RTPCR are shown in Table 1. Identity of the amplicons was conWrmed by sequencing (Accession No. AY763287 for CBPV, AY763414 for ABPV, DQ364631 for DWV, DQ364630 for SBV, and DQ364629 for BQCV). It is important to notice that although many hives were co-infected by several viruses it does not mean that these viruses are co-infecting the same bee, since we analyzed composed samples of 1012 bees. However, co-infection of ABPV and KBV or KBV, SBV, and BQCV in the same bee has been previously reported (Anderson and Gibbs, 1988; Evans, 2001). Almost all the samples from colonies that presented bee mortality were infected with at least one virus (BQCV) or co-infected with more than one. However these viruses were also detected in colonies without symptoms. The detection of several viruses in honeybees from di Verent and distant locations, and the fact that most of the samples were infected (96%) at least with one virus (15%) or more than one (81%), suggests that they are widely spread in the country. Comparing our results with the survey carried out during 2004, we could appreciate that the percentage of infection with both paralysis virus diminished from 61 to 47% for CBPV and 50 to 9% for ABPV (Antunez et al., 2005).

K. Antnez et al. / Journal of Invertebrate Pathology 93 (2006) 6770 Table 1 Analysis of the presence of CBPV, ABPV, BQCV, SBV, DWV, and KBV in honeybees from Uruguay, by RT-PCR Province 1b 2b 3b 4b 5b 6b 7b 8b 9b 10b 11b 12b 13b 14b 15b 16b 17b 18a 19a 20a 21a 22a 23a 24a 25a 26a 27a 28a 29a 30a 31a 32a 33b 34b 35b 36b 37a 38a 39a 40a 41a 42a 43a 44a 45a 46a 47a 48a 49a 50b 51b 52b Lavalleja Lavalleja Lavalleja Lavalleja Maldonado Maldonado Maldonado Maldonado Treina y Tres Soriano Soriano Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Colonia Maldonado Maldonado Maldonado Date May-05 May-05 May-05 May-05 May-05 May-05 May-05 May-05 June-05 June-05 June-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 July-05 November-05 November-05 November-05 November-05 November-05 November-05 November-05 November-05 November-05 November-05 November-05 November-05 November-05 November-05 October-05 October-05 October-05 December-05 December-05 December-05 ABPV 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 1 0 0 0 CBPV 1 0 0 0 0 0 0 0 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 BQCV 1 1 1 1 1 1 1 0 1 1 1 0 1 1 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 SBV nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 DWV nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 KBV nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Symptoms No symptoms Mortality No symptoms No symptoms Mortality Mortality Mortality Mortality Mortality Mortality Mortality Mortality Mortality Mortality Mortality Mortality Mortality No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms Mortality Mortality Mortality No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms No symptoms Mortality Mortality Mortality V. destructor (%) 6 nd 30 8.8 nd nd 0.1 nd 6 4.3 2 11 18 13.6 16.3 34.8 22.9 25.6 17.6 7.8 12.7 7.2 12.3 4.6 7.1 9.8 10.1 10.9 10.7 11.3 4 nd 1.2 6.8 4.4 0 1.6 1.7 3.7 1.4 1.2 2.4 2.3 2.4 1.3 1.6 5.7 6.4 2.9 nd nd nd

69

N. apis nd + nd nd nd + nd nd + + + + + nd + + + + + + + + + + + nd nd nd

nd, not determined. a Samples formed by a pool of bees, from three diVerent colonies of the same apiary. b Samples from individual colonies.

V. destructor was detected in 98% of the samples, but the percentage of infection varied from 0.1 to 35%, and N. apis was detected in 43% of the samples (Table 1). Both pathogens were detected in samples that presented bee mortality but also in samples from colonies without symptoms, and colonies that presented bee mortality not always were infected with these pathogens.

Statistical analysis was performed to evaluate the correlation between the presence of the diVerent virus, V. destructor, N. apis and occurrence of symptoms. Each set of data was summarized in contingency tables and analyzed using chi square and Yates corrected chi square test. No statistical correlation was observed between the mentioned variables. However, we found that many of the colonies

70

K. Antnez et al. / Journal of Invertebrate Pathology 93 (2006) 6770

Table 2 Primers used for the detection of CBPV, ABPV, BQCV, SBV, DWV, and KBV Primer CBPV1 CBPV2 ABPV1 ABPV2 BQCV1 BQCV2 SBV1 SBV2 DWV1 DWV2 KBV1 KBV2 Sequence (53) AGTTGTCATGGTAACAGGATACGAG TCTAATCTTAGCACGAAAGCCGAG TTATGTGTCCAGAGACTGTATCCA GCTCCTATTGCTCGGTTTTTCGGT TGGTCAGCTCCCACTACCTTAAACI GCAACAAGAAGAAACGTAAACCACI GGATGAAAGGAAATTACCAG CCACTAGGTGATCCACACT TTTGCAAGATGCTGTATGTGG GTCGTGCAGCTCGATAGGAT GATGAACGTCGACCTATTGAA TGTGGGTTGGCTATGAGTTCA Length (bp) 455 900 700 426 395 393 AmpliWcation target Viral capsid gene RNA polymerase gene Structural polyprotein gene Polyprotein gene Gene for polyprotein RNA polymerase gene Reference Ribiere et al. (2002) Ribiere et al. (2002) Benjeddou et al. (2001) Benjeddou et al. (2001) Benjeddou et al. (2001) Benjeddou et al. (2001) Tentcheva et al. (2005) Tentcheva et al. (2005) Tentcheva et al. (2004) Tentcheva et al. (2004) Stoltz et al. (1995) Stoltz et al. (1995)

that at the time of the study did not show any symptoms, eventually died. These Wndings make necessary to carry out a time series follow up to evaluate the behavior of the diVerent pathogens and their relation with mortality episodes. In summary, this is the Wrst record of the presence of BQCV, SBV, and DWV in Uruguay and South America that follows the detection of CBPV and ABPV previously reported. The detection of viruses in diVerent geographic areas, the high rate of infection (96%) and the coexistence of more than one virus in the same colony (81%), suggests that they are widely spread in the country. The presence of viruses could be associated to mortality of honeybees in Uruguay. Other possible causes like V. destructor or N. apis could also play a role in the genesis of this problem although we could no detect a signiWcant correlation between these factors. Acknowledgment This work was supported by the Instituto Nacional de Investigacin Agropecuaria (INIA, Uruguay). References
Allen, M.F., Ball, B.V., 1996. The incidence and world distribution of honey bee viruses. Bee World 77, 141162. Anderson, D.L., Gibbs, A.J., 1988. Inapparent virus infections and their interactions in pupae of the honey bee (Apis mellifera Linnaeus) in Australia. J. Gen. Virol. 69, 16171625. Antunez, K., DAlessandro, B., Corbella, E., Zunino, P., 2005. Detection of chronic bee paralysis virus and acute bee paralysis virus in Uruguayan honeybees. J. Invertebr. Pathol. 90, 6972. Bailey, L., 1967. The incidence of virus disease in honey bee. Ann. Appl. Biol. 60, 4348. Ball, B.V., Bailey, L., 1991. Virus of honey bees. In: Adams, J.R., Bonami, J.R. (Eds.), Atlas of Invertebrate Viruses. CRC Press, Boca Raton, USA, pp. 525551. Bakonyi, T., Grabensteiner, E., Kolodziejek, J., Rusvai, M., Topolska, G., Ritter, W., Nowtony, N., 2002. Phylogenetic analysis of acute bee paralysis virus strains. Appl. Environ. Microb. 68, 64466450. Benjeddou, M., Leat, N., Allsopp, M., Davison, S., 2001. Detection of acute bee paralysis virus and black queen cell virus from honeybees by reverse transcriptase PCR. Appl. Environ. Microbiol. 67, 23842387.

Chantawannakul, P., Ward, L., Boonham, N., Brown, M., 2006. A scientiWc note on the detection of honeybee viruses using real-time PCR (TaqMan) in Varroa mites collected from a Thai honeybee (Apis mellifera) apiary. J. Invertebr. Pathol. 91, 6973. Chen, Y.P., Higgins, J.A., Feldlaufer, M.F., 2005. Quantitative real-time reverse transcription-PCR analysis of deformed wing virus infection in the honeybee (Apis mellifera L.). Appl. Environ. Microbiol. 71, 436441. Evans, J., 2001. Genetic evidence for coinfection of honey bees by Acute bee paralysis virus and Kashmir bee viruses. J. Inverebr. Pathol. 78, 189193. Grabensteiner, E., Ritter, W., Carter, M.J., Davison, S., Pechhacker, H., Kolodziejek, J., Boecking, O., Derakhshifar, I., Moosbeckhofer, R., Licek, E., Nowotny, N., 2001. Sacbrood virus of the honeybee (Apis mellifera): rapid identiWcation and phylogenetic analysis using reverse transcription-PCR. Clin. Diagn. Lab. Immunol. 8, 93104. Hung, A.C.F., 2000. PCR detection of Kashmir bee virus in honey bee excreta. J. Apicult. Res. 39, 103106. OYce International of Epizooties, 2004a. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals of the International OYce of Epizooties. Chapter 2.9.5. OYce International Epizooties, 2004b. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals of the International OYce of Epizooties, Chapter 2.9.4. Ribiere, M., Tribolout, C., Mathieu, L., Aurieres, C., Faucon, J.P., Pepin, M., 2002. Molecular diagnosis of chronic bee paralysis virus infection. Apidologie 33, 339351. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Shen, M., Cui, L., Ostiguy, N., Cox-Foster, D., 2005. Intricate transmission routes and interactions between picorna-like viruses (Kashmir bee virus and Sacbrood virus) with the honeybee host and the parasitic varroa mite. J. Gen. Virol. 86, 22812289. Stoltz, D., Shen, X.R., Boggis, C., Sisson, G., 1995. Molecular diagnosis of Kashmir bee virus infection. J. Apicult. Res. 34, 153160. Suchail, S., Debrauwer, L., Belzunces, L.P., 2004. Metabolism of imidacloprid in Apis mellifera. Pest. Manag. Sci. 60, 291296. Tentcheva, D., Gauthier, L., Jouve, S., Canabady-Rochelle, L., Dainat, B., Cousserans, F., Colin, M.E., Ball, B.V., Bergoin, M., 2004. Polymerase chain reaction detection of deformed wing virus (DWV) in Apis mellifera L., and Varroa destructor. Apidologie 35, 431439. Tentcheva, D., Gauthier, L., Zappulla, N., Dainat, B., Cousserans, F., Colin, M.E., Bergoin, M., 2005. Prevalence and seasonal variations of six bee viruses in Apis mellifera L., and Varroa destructor. App Environ Microbiol 70, 71857191. Yue, C., Genersch, E., 2005. RT-PCR analysis of deformed wing virus in honeybees (Apis mellifera) and mites (Varroa destructor). J. Gen. Virol. 86, 34193424.