Available online at www.sciencedirect.

com

Theriogenology 69 (2008) 340348 www.theriojournal.com

A caprine chimera produced by injection of embryonic germ cells into a blastocyst

W. Jia, W. Yang, A. Lei, Z. Gao, C. Yang, J. Hua, W. Huang, X. Ma, H. Wang *, Z. Dou *
Stem Cell Research Institute, College of Animal Medicine, Northwest A&F University, Yangling, Shaanxi 712100, China Received 1 July 2007; accepted 2 August 2007

Abstract This report details a chimeric goat derived by injecting caprine embryonic germ (EG) cells into a host blastocyst. The EG cells, isolated from the primordial genital ridge of white Guanzhong goat fetuses (2842 days of pregnancy), had alkaline phosphatase activity and several stem cell markers, including SSEA-1, c-kit, and Nanog. Ten to 20 EG cells were microinjected into the blastocoelic cavity of a host blastocyst collected from a black goat following natural service. Twenty-nine injected blastocysts were transferred into nine white surrogate goats. One of the recipients maintained pregnancy to term and gave birth to three kids: one male, one female, and a dead, malformed fetus of undetermined gender; all three fetuses were black, but the female and the malformed fetus each had a large white spot on their head. Based on PCR and microsatellite DNA assay, the female and the malformed fetus were monozygotic twins and chimeras. Microsatellite assay on various tissues from the dead fetus (including skin, blood, liver, placenta, lung, heart, spleen, muscle, and brain), revealed that these tissues and organs were chimeric and contained cells derived from EG cells. In conclusion, caprine EG cells differentiated into all three germ layers in vivo. # 2008 Elsevier Inc. All rights reserved.
Keywords: EG cells; Chimera; Microsatellite DNA; SRY; Goat

1. Introduction Both embryonic stem (ES) cells and embryonic germ (EG) cells have self-renewal and pluripotency [14]. Laboratory-based criteria to assess the pluripotent nature of ES or EG cells derived from human or animals include the capability to: (1) differentiate into all cell types in vitro; (2) form teratoma in immunedecient mice; (3) integrate into all fetal tissues when reintroduced into an embryo [5,6]. In that regard, one

* Corresponding authors. Tel.: +86 29 87080069; fax: +86 29 87080068. E-mail addresses: hhwang101@163.com (H. Wang), douzhongying@china.com (Z. Dou). 0093-691X/$ see front matter # 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2007.08.037

test of pluripotency was to inject ES or EG cells from a donor animal into the blastocoelic cavity of recipient blastocysts; the combination embryo was transferred into the uterus of a pseudo-pregnant female, and the progeny was a chimera. In mice, EG cells were derived from cultured primordial germ cells (PGCs) isolated from embryos 8.012.5 days post-coitum, in the presence of leukemia inhibitory factor, basic broblast growth factor, and stem cell factor [7]. However, EG cells from domestic animals (e.g. goats) were difcult to isolate and preserve, due to spontaneous differentiation at early stages of passage [8 10]. Caprine ES cells were isolated and cultured in vitro for a prolonged interval [11], but there have been no further reports regarding the establishment of a caprine EG cell line. Although chimeras derived from embryonic

W. Jia et al. / Theriogenology 69 (2008) 340348 Table 1 Isolation of PGCs from caprine fetuses Goat 1 2 3 4 5 6 7
a

341

Fetus 1 2a 2b 3 4 5 6 7a 7b

Gestational age (days) 28 35 35 35 42 35 35 37 37

Fetus length (cm) 1.2 1.7 1.8 2.1 4.5 2.4 2.0 2.6 2.8

EG cells EGC#1 EGC#2 EGC#3 EGC#4 EGC#5 EGC#6 EGC#7 EGC#8 EGC#9

Passage no. a P3 P3 P12 P12 P0 P10 P8 P10 P9

The last passage of EG cells that were cultured in medium.

cells have been reported in a variety of animals, including mice [1215], rats [16], rabbits [17], sheep [18], cattle [19], and pigs [2022], chimeras derived from EG cells have only been reported in mice [23,24] and pigs [25,26], but not in goats. To determine if caprine EG cells have the pluripotency to generate all three germ layers and form chimeras when injected into host blastocysts, we isolated EG cells from goat fetuses and injected these cells into host blastocysts. 2. Materials and methods 2.1. Materials and animals The sources of materials were: Dulbeccos modied Eagles medium (DMEM) and knockout serum replacement (KSR; Gibco, Life Technologies, Grand Island, NY, USA); nonessential amino acids, b-mercaptoethanol, and L-glutamine (Invitrogen Corp., Carlsbad, CA, USA); dNTPs (Takara. Bio Inc., Otsu, Japan); cDNA II kit (Ambion Europe Ltd., Huntingdon, Cambridgeshire, UK); recombinant murine leukemia inhibitory factor (LIF), human recombinant basic broblast growth factor (bFGF), stem cell factor (SCF), and antibodies against SSEA-1 and c-kit (Chemicon International Inc., Temecula, CA, USA); pregnant mare serum gonadotropin (PMSG) and prostaglandin (PGF2a; Ningbo Hormone Co., Ningbo, Zhejiang, China). Unless otherwise indicated, all other chemicals were purchased from the Sigma chemical company (St. Louis, MO, USA). Local black goats were used to produce host blastocysts, whereas white Guanzhong goats were used as a source of EG cells and to serve as surrogates. The coat color of the local breed was completely black; however, when these goats were crossed with a white Guanzhong goat, the coat color of the resulting kids was brown (no black hair nor white spots).

2.2. Isolation and culture of goat embryonic germ cells To isolate PGCs, nine fetuses were collected from seven white Guanzhong dairy goat fetuses at 2842 days of pregnancy (Table 1). The gonadal ridge tissue was removed, washed three times with PBS plus 0.02% ethylenediaminetetraacetic acid (EDTA), dissected manually, and incubated for 30 min at 38.5 8C in a cell dissociation solution containing 0.25% collagenase IV. The cell suspension was ltered through sterile gauze (100 mesh, 149 mm) and washed in PBS once, then pelleted by centrifugation at 1000 g for 5 min. The suspension of cell mixture of gonadal tissue was cocultured with goat embryonic broblasts (GEF) that had been inactivated with mitomycin C treatment on gelatincoated culture dishes. After 1012 days of growth, EGlike cell colonies with 100200 cells were formed and then subcultured by picking up individual colonies and seeding on 35 mm culture dish; this subculture was considered the rst passage of EG cells. Although goat EG cells can grow well with both GEF and mouse embryonic broblast (MEF), we routinely used MEF as the feeder cells to culture goat EG cells, since it was easier to use. For the immunohistochemistry assay, MEF and EG cells were cultured on cover slides that were laid on a culture plate. The culture medium was DMEM supplemented with 15% KSR, 1000 IU/mL LIF, 10 ng/ mL bFGF, 10 ng/mL SCF, 0.1 mM nonessential amino acids, 0.1 mM b-mercaptoethanol, 2 mM L-glutamine, 100 IU/mL penicillin, and 0.1 mg/mL streptomycin. The above three factors, LIF, bFGF and SCF, were always added in media as supplements, even when typical EG colonies were formed. The isolated EG cells were cryopreserved in liquid nitrogen by a method similar to that used for MEF cells. Briey, 5 105 cells collected from cultural plates were pelleted in a 10 mL centrifuge tube, and

342

W. Jia et al. / Theriogenology 69 (2008) 340348

resuspended in 1 mL of cryo-storage solution containing DMEM with 20% fetal bovine serum and 10% dimethyl sulfoxide. Cells were then transferred to a storage tube (2 mL) and stored in liquid nitrogen. To reuse the cryopreserved cells, a tube of cells was removed from liquid nitrogen and immediately transferred to a 37 8C water bath to incubate for 12 min. The thawed cells were subsequently cultured in the 60 mm plate with MEF feeder cells. 2.3. Immunohistochemistry and cellular assay To characterize the origin of the isolated cells, we determined several stem cell specic markers. To conrm the presence of alkaline phosphotase (AP), EG cells grown on a cover slide were xed with 4% paraformaldehyde for 20 min, washed 10 min with PBS for three times, and stained with 200 mg/mL of naphthol AS-MX phosphate and 1 mg/mL of Fast Red TR in 0.1 mM Tris buffer (pH 8.2) for 15 min at room temperature. To detect cell surface markers, cells xed with 4% paraformaldehyde were incubated with 3% H2O2 for 5 min, and blocking solution for 15 min; antibodies against SSEA-1 (1:100) and c-kit (1:50) were incubated separately with cells for 12 h at 4 8C. The secondary goat anti-mouse IgG antibody and chromogen solutions (3,3-diaminobenzidine; DAB), were applied according to the manufacturers instructions (Beijing ZhongShan Golden Bridge, Beijing, China). Positive cells were detected by red/brown staining and the control was only incubated with secondary antibody, followed by staining. In the karyotype assay, EG cells at the stage of exponential growth were treated with 0.1 mg/mL colcemid for 2 h, and then spread and dried on the glass slide. The karyotype was determined by microscopic examination after conventional Giemsa staining. 2.4. RT-PCR reaction An RT-PCR was done to detect the Nanog gene that is specically expressed in ES cells. The EG cells were lysed by incubation at 75 8C for 10 min with cell lysate buffer. Genomic DNA was degraded by incubation with DNAase I for 15 min at 37 8C; 0.5 mg of total RNA was used to synthesize cDNA by MLV reverse transcriptase and random hexamers using cDNA II kit in 10 mL reaction volume. We subsequently used 5 mL of the reverse transcription products in the subsequent PCR to amplify the Nanog gene. The PCR were conducted in a total volume of 25 mL at 35 cycles of 94 8C for 30 s, 55 8C for 30 s, and 72 8C for 80 s; PCR products were

separated on 1.0% agarose gel with ethidium bromide. Reverse transcriptase negative controls were included to monitor genomic contamination. Primers based on goat Nanog gene (AY786437) were synthesized to amplify the 819 bp cDNA fragment. The sequence of primers was F-Nanog: 50 ATGCCTGAAGAAAGTTACGC, and R-Nanog: 50 AGGCTGTATGTTGAGAGGGT. 2.5. Generation of chimera The EG cells were cultured for three or four passages and incubated for 30 min in 0.05% trypsin and 0.02% EDTA. After neutralization by culture medium, cells formed small clusters (which contained 1020 cells). By using a microinjector (Leica, DM IRB, Wetzlar, Germany) with a protocol similar to that described by Schoonjans [17], an EG cell cluster was delivered into a blastocyst that was isolated from a naturally mated black goat and cultured for 7 days in vitro (Fig. 1A). The injected blastocysts were incubated in a CO2 incubator for 30 min, and then immediately transferred into white recipient goats on Day 6 (estrus = Day 0). To synchronize estrus, recipient goats were given an intravaginal progestagen-impregnated sponge (Ova-Gest; Bioniche Australasia, Armidale, NSW, Australia) for 10 days; goats were injected with 200 IU PMSG 7 days after sponge insertion, followed by 0.2 mg PGF2a 24 and 12 h, respectively, before sponge removal. Goats were observed frequently for estrous activity for 48 h (starting 24 h after the second PGF2a treatment). 2.6. Characterization of chimeric kids For characterization of chimeric kids, DNA samples were isolated from EG cells and tissues including blood and skin (from the head) with white hair or with black hair from both male and female kids, and from various tissues (including liver, placenta, lung, heart, spleen, muscle, and brain) from the dead fetus. The DNA samples were also isolated from ear skin of black Dam #1 and Sire #1 of the host blastocyst and surrogate white Dam #2. We used a Ychromosome-specic gene SRY (Z30646) to determine if the injected EG cells had differentiated into various tissues and organs. To detect this gene, two pairs of primers were synthesized according to a published sequence [27]. The primer sequences were:  SRY, forward: 50 ATGAATAGAACGGTGCAATCG 30  SRY, reverse: 50 GAAGAGGTTTTCCCAAAGGC30  Aml-X, forward: 50 CAGTAGCTCCAGCTCCAG CT30  Aml-X, reverse: 50 GTGCATCCCTTCATTGGC30

W. Jia et al. / Theriogenology 69 (2008) 340348

343

2.6.1. Microsatellite assay Ten microsatellite markers, including BMS1004, BMS1290, BM203, BMS875, BMS574, SR-CRSP1, SR-CRSP5, SR-CRSP24, OarAE101, and OarFCB11 were selected to characterize the chimerism of the newborn kids. The PCR were conducted with 20 ng DNA template isolated from skin and blood samples, with 32 cycles of 94 8C for 30 s, 55 8C for 30 s, and 72 8C for 45 s. The amplied DNA fragments were separated on 15% polyacrylamide gel and visualized by silver staining. 3. Results 3.1. Derivation and characterization of goat EG cell lines The PGCs isolated from fetal gonads were round or oval, and had a large nucleus and a high nucleus-toplasma ratio. When subcultured on feeder layers for 35 days, PGCs started to form clusters with morphology typical of ES cells (Fig. 2A). We isolated eight EG-like cells from nine fetuses; it was easier to successfully isolate EG cells from fetal gonads at 3537 days, compared to those at 28 or 42 days. Two isolated EG cells, EGC#3 and EGC#9, had a normal male karyotype and were used for blastocyst injections (Table 1). The isolated EG cells were cultured up to 12 passages without loss of AP activity (Fig. 2B). The EG cell colonies also had positive staining for SSEA-1 and c-kit (Fig. 2C and D). At passage 12, the proportion of isolated EG cells in the entire culture was low, due to spontaneous differentiation. However, the remaining EG cells still had AP activity and were positive for SSEA-1 and c-kit. To determine if the EG cells contained the ES cell-specic transcription factor, RTPCR was done to monitor Nanog mRNA expression; both PGCs and EG cells expressed the Nanog gene (Fig. 3). Based on all of these assessments, the isolated cells were EG cells and had stem cell features. 3.2. Production of chimera The 116 bp fragment of Y-chromosome-specic gene SRY and 300 bp fragment of internal control gene Aml-X (AF215887) were amplied by PCR, performed in 20 mL of reaction mixture that contained 20 ng DNA, 200 mM of dNTP, 1.5 mM MgCl2, 10 pmol of forward and reverse primers, 0.4 U Taq DNA polymerase, and carried out for 36 cycles of 94 8C for 30 s, 58 8C for 30 s, and 72 8C for 45 s. The PCR products were separated by 12% polyacrylamide gel electrophoresis and visualized by silver staining. Twenty-nine injected blastocysts, of which ten used cryopreserved EG cells, were implanted in nine white surrogate goats. One surrogate goat, Dam #2, maintained pregnancy to full term, and gave birth to three kids, including a dead malformed fetus of undetermined gender with three legs and failure of the abdominal wall to close Table 2. One kid, a black male, was designated GB1 and the other, a black female with a large white spot on her forehead (Fig. 1B), was designated GBW1.

Fig. 1. Blastocyst injection and chimeric goats. The blastocyst from the black female host was injected with approximately 1020 EG cells from a white male goat fetus; injected blastocysts were transferred into a white recipient goat. (A) EG cells were injected into the blastocyst; (B) two kids a few minutes after birth; (C) dead, malformed fetus (gender unknown; all three fetuses were littermates). The arrows indicated the white hair in both the female kid and the dead fetus (they were chimeras).

344

W. Jia et al. / Theriogenology 69 (2008) 340348

Fig. 2. Isolation and characterization of goat EG cells. The isolated goat EG cells formed a colony with typical morphology of pluripotent stem cells (A: 200); the EG cell colony was positive for alkaline phosphatase activity (B: 200), SSEA-1 (C: 200), and c-kit (D: 400).

The malformed fetus (GBW2) also had white hair that covered a much larger area of the head than that in GBW1 (Fig. 1C). Although we had implanted only two injected blastocysts into Dam #2, that she gave birth to three kids (in conjunction with other evidence), we inferred that both female kid GBW1 and malformed fetus GBW2 were monozygotic twins. 3.3. Molecular analysis of newborn kids To determine if the newborn kids were chimeras, the SRY gene was analyzed by PCR. The Aml-X gene (X amelogenin) co-amplied in PCR assay was used as an internal control to detect the X-chromosome marker. We injected EG cells from a white male goat into the blastocyst of a black goat; if the injected blastocysts developed to form a fetus, the chimera was expected to retain two features, white hair and SRY gene positive, especially in a female offspring. Kid GBW1 not only had white hair (Fig. 1B), it also had the SRY gene, even

Fig. 3. The RT-PCR reaction analysis of Nanog gene in isolated EG cells. The RT-PCR reactions were done with Nanog gene primers and the primary culture of goat PGCs (column 1) or EG cells in passages 3 or 4 (column 2). Column 3 was the negative control and M was the 1500 bp DNA ladder.

W. Jia et al. / Theriogenology 69 (2008) 340348 Table 2 Caprine chimeras produced by microinjection of EG cells into blastocysts Blastocysts injected EGC#3 Cryo-EGC#3 b EGC#9a
a b c a

345

Recipients 4 2 3

Term pregnancies 1 0 0

Kids 3 0 0

Chimeras 2c 0 0

7 10 12

EGC#3 was at passage 4 and EGC#9 was at passage 3. EGC#3 were cryopreserved in liquid nitrogen, thawed and used. One of the chimeras was a dead, malformed fetus.

though it was a female goat (Fig. 4, column 3). The dead fetus (GBW2) also had white hair on its head and the SRY gene; therefore, both GBW1 and GBW2 were chimeric goats (Fig. 4, column 2). To further characterize the degree of chimerism, 10 microsatellite markers were analyzed on DNA samples isolated from GB1, GBW1, and GBW2, the parents of the host blastocyst (Dam #1 and Sire #1) as well as EG cells and Dam #2. Among the ten markers, there were three markers (BMS574, BMS875, and BMS1004) that demonstrated the variation between chimera and normal goats. The microsatellite assay (Fig. 5a) was based on marker BMS574; both GBW1 and GBW2 had an identical DNA pattern, which was signicantly different from the pattern in GB1. On the gel, there were two groups of DNA bands in GBW1 and GBW2. One group of bands in the 200 bp area consisted of the combined bands from both EG cells and parent goat DNA. The second group of bands in the 300 bp area had two bands, one from the EG cell and the other from Sire #1; however, the bands in the second group were not present in samples from Dam #1 and Dam #2. Additionally, GB1 had a similar DNA pattern to that of Sire #1, but completely different from that of the EG cells, indicating that GB1 was not a chimera (Fig. 5a). Blood samples from GB1 and GBW1 were also analyzed by marker BMS574; these samples had DNA ngerprinting similar to that from skin samples, suggesting that the EG cells can differentiate into blood cells in a chimeric goat (Fig. 5b).

Based on microsatellite assays, EG cells in GBW1 developed into skin and blood. To determine if EG cells were able to differentiate into other tissues and organs, we collected GBW2 tissues that covered all three germ layers, including skin areas with white and black hair, liver, placenta, lung, heart, spleen, muscle, and brain, and did microsatellite assays with BMS574 marker. All tissues tested had the EG cell signal, indicating that EG cells in the injected blastocyst differentiated into all three germ layers (Fig. 5c). In addition to using BMS574 marker, similar experiments were done with

Fig. 4. The PCR assay for SRY and Aml-X genes. The SRY gene fragment (116 bp) and Aml-X gene fragment (300 bp) were amplied from EG cells (column 1), the malformed fetus (column 2), female kid (column 3), male kid (column 4), Dam #1 (column 5), Sire #1 (column 6), and the negative control (column 7). M was a 100 bp DNA ladder.

Fig. 5. Microsatellite assays with BMS574 marker; PCR products were separated with a 15% polyacrylamide gel. (a) DNA from skin tissue or EG cells was used for the assay; (b) assay of blood samples from two newborn kids; (c) assay of nine tissues from the malformed dead fetus. M, 100 bp DNA marker; FL, Dam #1; ML, Sire #1; EG, embryonic germ cell; RP, Recipient Dam #2; GB1, male kid; GBW1, female kid; GBW2, malformed dead fetus; WS, skin from white hair area; LV, liver; BS, skin from black hair area; CL, placenta; LG, lung; HT, heart; SP, spleen; MS, muscle; BR, brain.

346

W. Jia et al. / Theriogenology 69 (2008) 340348

Fig. 6. Microsatellite assays of DNA samples, isolated from skin of littermate goat kids, conducted with markers BMS875 (a) and BMS1004 (b). PCR products were separated on a 15% polyacrylamide gel. GB1, newborn male kid; GBW1, newborn female kid; GBW2, malformed dead fetus.

markers BMS875 and BMS1004. Both GBW1 and GBW2 had identical DNA bands (Fig. 6a and b) which were completely different from that of GB1. In summary, we concluded that GB1 was a normal kid without heterozygosis, and GBW1 and GBW2 were chimeric kids and monozygotic twins. 4. Discussion The EG cell lines were derived from cultured PGCs in media containing LIF, FGF2, and SCF. Compared with isolation of embryonic cells from the inner cell mass (ICM) of embryos, the advantage of using PGCs to

purify stem cells was that an aborted fetus was easier to obtain [28]. However, the primary PGCs were difcult to subculture and passage; cell-to-cell bonds among PGCs were tighter than those of embryonic cells derived from the ICM [7]. To isolate goat PGCs, antibodies against SSEA-1 and EMA-1 were applied on a ow cytometer to collect marker-specic PGCs [10]. In the early 1980s, Felice et al. established three approaches to isolate murine PGCs, including collagenase treatment and mechanical procedures, with or without prior EDTA treatment [23]. To improve isolation efciency, we incubated genital ridge segments with 0.02% EDTA for 20 min, and then incubated them with 0.25% collagenase IV for 2530 min. Using this approach, PGCs were isolated and continually cultured in vitro for up to 12 passages. The EG cells derived from PGCs of Guanzhong goats had embryonic stem cell features and could differentiate into multiple cell types [32]. The proliferation and differentiation of goat EG cells have been reported previously, although the focus was mainly on the isolation of goat PGCs and culture of EG cells [710]. Lee et al. reported that the AP-positive PGCs were isolated from a Day 25 goat fetus; these isolated EG cells were only maintained for four passages in culture medium [7,9]. Until now, only Tillmanns group reported that goat ES cells could be cultured for prolonged intervals in vitro [11]. There was no previous report describing a chimeric goat with EG cells. In our study, we not only successfully isolated and cultured goat PGCs, but also puried EG cells up to 12 passages and document their pluripotency, demonstrating that they could differentiate into three germ layers in vivo. However, it is difcult to construct a goat EG cell line; we still face the difculty of culturing isolated EG cells for prolonged intervals without spontaneous differentiation. Ten microsatellite markers were used to determine whether the progeny were chimeras; however, only three markers, BMS574, BMS875, and BMS1004, detected differences among EG cells, the parents, and the newborn kids. Similar observations were reported in pig chimeras that were created by delivering porcine EG cells into recipient blastocysts [25,26]. On marker BMS574 assays, GBW1 had chimeric skin and blood that the only tissues were tested, whereas in GBW2, all nine tissues and organs tested were chimeric. Therefore, these EG cells were capable of differentiating into three germ layers without affecting tissue functions; GBW1 was healthy at birth and has already lived 11 months. In contrast, Shim et al. reported that stated that in a porcine chimera, chimerism only occurred in blood, brain, pancreas and muscle, but not in heart, spleen, liver, or

W. Jia et al. / Theriogenology 69 (2008) 340348

347

lung [25]. There are many factors affecting the developmental capability of EG cells after they are delivered into a blastocoelic cavity, including viability of the EG cells, the number of cells injected, and the interaction between EG cells and ICM, etc. Soon after EG cells were involved in blood tissue formation, they were also able to proliferate and differentiate into other tissues and organs, as well as obtain immune tolerance [2931]. To further characterize goat chimeras, the SRY gene, a male gender-specic gene, was analyzed by PCR. The experiment was designed so that the injected EG cells contained a Y-chromosome, and if a newborn female kid had an SRY gene, the animal would be a chimera. Both GBW1 and GBW3 retained the SRY gene, similar to that of the injected EG cells. How male cells were chimerically present in the female tissue and whether the XY EG cells can develop into the genital tissue, is yet to be determined. However, we plan to raise GBW1 and to determine if it has normal estrous cycles, ovulation, and fertilization. This study is the rst report of a chimeric goat derived by injecting caprine embryonic germ (EG) cells into a host blastocyst. Furthermore, it was noteworthy that the EG cells differentiated into all three germ layers in vivo. Acknowledgments We thank: Dr Hong Chen for discussion; Jingzhuang Fan and Xiaoliang Han for technical support; Dr Rachel Maier for comments on the manuscript. This work was supported in part by grants from the National High-Tech Research and Development Program of China (2005AA21905) and the Key Program of Shaanxi Province (4130253301). References
[1] Matsui Y, Zsebo K, Hogan BL. Derivation of pluripotential embryonic stem cells from marine primordial germ cells in culture. Cell 1992;70:8417. [2] Tesar PJ. Derivation of germ-line-competent embryonic stem cell lines from preblastocyst mouse embryos. Proc Natl Acad Sci USA 2005;102:823944. [3] Nagy A, Gocza E, Diaz EM, Prideaux VR, Ivanyi E, Markkula M, et al. Embryonic stem cells alone are able to support fetal development in the mouse. Development 1990;110:81521. [4] Wakayama S, Hikichi T, Suetsugu R, Sakaide Y, Bui HT, Mizutani E, et al. Efcient establishment of mouse embryonic stem cell lines from single blastomeres and polar bodies. Stem Cells 2007;25:98693. [5] Martin GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci USA 1981;78:76348.

[6] Kerr CL, Gearhart JD, Elliott AM, Donovan PJ. Embryonic germ cells: when germ cells become stem cells. Semin Reprod Med 2006;24:30413. [7] Labosky P, Barlow D, Hogan B. Mouse embryonic germ (EG) cell lines: transmission through the germ line and differences in the methylation imprint of insulin-like growth factor 2 receptor (Igf2r) gene compared with embryonic stem (ES) cell lines. Development 1994;120:3197204. [8] Lee CK, Scules N, Newton G, Piedrahita JA. Isolation and initial characterization of primordial germ cell (PGC)-derived from goat, rabbit and rats. Theriogenology 1998;49:388. [9] Lee CK, Moore K, Scales N, Westhusin M, Newton G, Im KS, et al. Isolation and genetic transformation of primordial germ cell (PGC) derived cells from cattle, goats, rabbits and rats. Asian Aus Anim Sci 2000;13:58794. [10] Kuhholzer B, Baguisi A, Overstrom EW. Long-term culture and characterization of goat primordial germ cells. Theriogenology 2000;53:10719. [11] Tillmann SM, Meinecke B. Isolation of ES-like cell lines from bovine and caprine preimplantation embryos. J Anim Breed Genet 1996;113:41321. [12] Evans M, Kaufman M. Establishment in culture of pluripotential cells from mouse embryos. Nature 1981;292:1546. [13] Li XY, Jia Q, Di KQ, Gao SM, Wen XH, Zhou RY, et al. Passage number affects the pluripotency of mouse embryonic stem cells as judged by tetraploid embryo aggregation. Cell Tissue Res 2007;327:60714. [14] Li X, Yu Y, Wei W, Yong J, Yang J, You J, et al. Simple and efcient production of mice derived from embryonic stem cells aggregated with tetraploid embryos. Mol Reprod Dev 2005;71:1548. [15] Lee KH, Chuang CK, Wang HW, Stone L, Chen CH, Tu CF. An alternative simple method for mass production of chimeric embryos by coculturing denuded embryos and embryonic stem cells in Eppendorf vials. Theriogenology 2007;67:22837. [16] Iannaccone P, Taborn G, Garton R, Caplice MD, Brenin DR. Pluripotent embryonic stem cells from the rat are capable of producing chimeras. Dev Biol 1994;163:28892. [17] Schoonjans L, Albright GM, Li JL, Collen D, Moreadith RW. Pluripotential rabbit embryonic stem (ES) cells are capable of forming overt coat color chimeras following injection into blastocysts. Mol Reprod Dev 1996;45:43943. [18] Butler JE, Anderson GB, BonDurant RH, Pashen RL, Penedo MCT. Production of ovine chimeras by inner cell mass transplantation. J Anim Sci 1987;65:31724. [19] Iwasakia S, Campbellb KH, Gallic C, Akiyamad K. Production of live calves derived from embryonic stem-like cells aggregated with tetraploid embryos. Biol Reprod 2000; 62:4705. [20] Onishi A, Takeda K, Komatsu M, Akita T, Kojima T. Production of chimeric pigs and the analysis of chimerism using mitochondrial deoxyribonucleic acid as a cell marker. Biol Reprod 1994;51:106974. [21] Anderson GB, Choi SJ, BonDurant RH. Survival of porcine inner cell masses in culture and after injection into blastocysts. Theriogenology 1994;42:20412. [22] Nagashima H, Giannakis C, Ashman RJ, Nottle MB. Sex differentiation and germ cell production in chimeric pigs produced by inner cell mass injection into blastocysts. Biol Reprod 2004;70:7027. [23] Felice MD, McLaren A. Isolation of mouse primordial germ cells. Exp Cell Res 1982;142:47683.

348

W. Jia et al. / Theriogenology 69 (2008) 340348 [28] Keefer CL, Pant D, Blomberg L, Talbot NC. Challenges and prospects for the establishment of embryonic stem cell lines of domesticated ungulates. Anim Reprod Sci 2007;98:14768. [29] Drexler C, Wagner T. Blood group chimerism. Curr Opin Hematol 2006;13:4849. [30] Wu DC, Byod AS, Wood KJ. Embryonic stem cell transplantation: potential applicability in cell replacement therapy and regenerative medicine. Front Biosci 2007;12:452535. [31] Saburi S, Azuma S, Sato E, Toyoda Y, Tachi C. Developmental fate of single embryonic stem cells microinjected into 8-cellstage mouse embryos. Differentiation 1997;62:111. [32] Yang WF, Ge XG, Hua JL, Shen WZ, Dou ZY. Improved isolation and culture of embryonic germ cells from Guanzhong dairy goat. Agric Sci Chin 2006;5:5507.

[24] Resnick J, Bixler L, Cheng LZ. Long-term proliferation of mouse primordial germ cells in culture. Nature 1992;359:5501. [25] Rui R, Shim H, Moyer AL, Anderson DL, Penedo CT, Rowe JD, et al. Attempts to enhance production of porcine chimeras from embryonic germ cells and preimplantation embryos. Theriogenology 2004;61:122535. [26] Shim H, Gutierrez-Adan A, Chen LR, BonDurant RH, Behboodi E, Anderson GB. Isolation of pluripotent stem cells from cultured porcine primordial germ cells. Biol Reprod 1997;57:1089 95. [27] Phua ACY, Abdullah RB, Mohamed Z. A PCR-based sex determination method for possible application in caprine gender selection by simultaneous amplication of the Sry and Aml-X genes. J Reprod Dev 2003;49:30711.