Phytochemistry 71 (2010) 548558

Contents lists available at ScienceDirect

Phytochemistry
journal homepage: www.elsevier.com/locate/phytochem

Cytosolic APx knockdown indicates an ambiguous redox responses in rice

Slvia B. Rosa a,b, Andria Caverzan a,b, Felipe K. Teixeira e, Fernanda Lazzarotto b, Joaquim A.G. Silveira c, Srgio Luiz Ferreira-Silva c, Joo Abreu-Neto b, Rogrio Margis a,d, Mrcia Margis-Pinheiro a,b,*
a

Centro de Biotecnologia, Universidade Federal do Rio Grande do Sul, Brazil Departamento de Gentica, Universidade Federal do Rio Grande do Sul, Brazil c Departamento de Bioqumica e Biologia Molecular, Universidade Federal do Cear, Brazil d Departamento de Bioqumica, Universidade Federal do Rio Grande do Sul, Brazil e CNRS UMR8186, Dpartement de Biologie, Ecole Normale Suprieure, 75230 Paris cedex 05, France
b

a r t i c l e

i n f o

a b s t r a c t
Ascorbate peroxidases (APX, EC 1.1.11.1) are class I heme-peroxidases, which catalyze the conversion of H2O2 into H2O, using ascorbate as a specic electron donor. Previously, the presence of eight Apx genes was identied in the nuclear genome of rice (Oryza sativa), encoding isoforms that are located in different sub-cellular compartments. Herein, the generation of rice transgenic plants silenced for either both or each one of the cytosolic Apx1 and Apx2 genes was carried out in order to investigate the importance of cytosolic Apx isoforms on plant development and on plant stress responses. Transgenic double Apx1/2-silenced plants exhibited normal development, even though these plants showed a global reduction of Apx activity which strongly impacts the whole antioxidant system regulation. Apx1/2-silenced plants also showed increased H2O2 accumulation under control and stress situations and presented higher tolerance to toxic concentration of aluminum when compared to wild type plants. On the other hand, silencing OsApx1 and OsApx2 genes individually resulted in strong effect on plant development producing semi-dwarf phenotype. These results suggested that the double silencing of cytosolic OsApx genes induced compensatory antioxidant mechanisms in rice while single knockdown of these genes did not, which resulted in the impairing of normal plant development. 2010 Elsevier Ltd. All rights reserved.

Article history: Received 4 June 2009 Received in revised form 11 December 2009 Available online 1 February 2010 Keywords: Oryza sativa Gramineaea Rice Apx Ascorbate peroxidase Antioxidant Redox H2O2 scavenging RNAi

1. Introduction Reactive oxygen species (ROS) are partially reduced oxygen intermediates produced as a consequence of the univalent reduction of molecular oxygen during oxidative metabolism; ROS are then inherent to aerobic life (Scandalios, 2002). ROS are known not only for their hazardous oxidative damage effects but also by their role in modulating gene expression and in systemic signaling (Apel and Hirt, 2004; Mittler, 2002). In plants, the production of ROS is drastically increased in response to biotic and abiotic stresses, disturbing the normal balance of superoxide radicals, hydroxyl radicals and hydrogen peroxide in the intracellular environment. Under the selective pressure of intracellular ROS, aerobic organisms developed antioxidant mechanisms, including enzymes such as superoxide dismutases (SOD), catalases (CAT), ascorbate perox-

Abbreviations: Apx, ascorbate peroxidase; SOD, superoxide dismutase; CAT, catalase; GPx, glutathione peroxidase; TBARS, thiobarbituric acid reactive substances. * Corresponding author. Address: Departamento de Gentica, Universidade Federal do Rio Grande do Sul, Brazil. Tel.: +55 51 3308 9814. E-mail address: marcia.margis@ufrgs.br (M. Margis-Pinheiro). 0031-9422/$ - see front matter 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.phytochem.2010.01.003

idases (APx), and glutathione peroxidases (GPx), and low-molecular weight compounds such as ascorbic acid, glutathione, and tocoferol (Scandalios, 2002). As a central component of the major hydrogen peroxide detoxifying system in plant cells, the ascorbateglutathione cycle, ascorbate peroxidases (APx, EC 1.1.11.1) play an essential role in the control of intracellular ROS levels. APx are class I heme-peroxidases found in green plants and in chloroplastic protists (Passardi et al., 2007) that catalyze the conversion of H2O2 into H2O using ascorbate as a specic electron donor (Asada, 1999). The expression of Apx genes is modulated by several environmental stimuli known to increase ROS production, such as drought, high-intensity light, high temperature, salt stress, as well as pathogen attacks. Previous reports indicate that APx play an important role scavenging ROS that are produced when plants are growing under stressful conditions (Asada, 1999; Mittler, 2002; Shigeoka et al., 2002). Consistent with their importance, APx are encoded by a multigene family in angiosperms; APx isoforms have a distinct sub-cellular localization enabling them to regulate ROS levels in different cellular compartments for either signaling or defense purposes. Soluble isoforms can be found in the cytosol, mitochondria and chloroplast stroma, while membrane-bound isoforms are found

S.B. Rosa et al. / Phytochemistry 71 (2010) 548558

549

in the peroxisomes and chloroplast thylakoids (Teixeira et al., 2004, 2005). Currently, it is well known that ROS metabolism coordination in different sub-cellular compartments is highly complex since ROS, such as H2O2, can diffuse between compartments (Hernandez et al., 2000; Mittler et al., 2004; Mullineaux et al., 2006). Several reports point out that APx isozymes are critical factors against oxidative stress in photosynthetic organisms. Thylakoids membrane-bound APx (tAPx) deciency leads to a reduction in CO2 assimilation and photosynthetic electron transport under moderate light intensity (Danna et al., 2003). On the other hand, overexpression of the tApx gene in either tobacco or in Arabidopsis increased tolerance to oxidative stress produced by the application of methylviologen and by chilling, combined with high-intensity light (Yabuta et al., 2002). In angiosperms, cytosolic APx (cApx) isoforms are strongly modulated by different stresses (Davletova et al., 2005; Fourcroy et al., 2004; Teixeira et al., 2006). In rice, cytosolic Apx genes are up-regulated upon wounding, salicylic acid, ethylene, abscisic acid, H2O2, copper sulfate, and jasmonic acid suggesting that the cytosolic APx isozymes could play a protective role against stressful conditions (Agrawal et al., 2003). Moreover, high temperatures and subsequent chilling affected rice APx activity and cytosolic Apx gene expression, suggesting a role for APx in heat-treatmentmediated protection of rice seedling against chilling injury. In spinach leaves, among all Apx transcripts only the steady-state levels of cytosolic APx increased markedly in response to high-intensity light and methylviolagen treatment (Yoshimura et al., 2000). In addition to the studies focusing on the pattern of Apx gene expression, recent elegant functional studies were carried out in order to assess the functions of the cytosolic isoenzymes in the dicotyledonous plant model Arabidopsis thaliana (Asai et al., 2004; Davletova et al., 2005; Miller et al., 2007; Pnueli et al., 2003; Rizhsky et al., 2002; Rossel et al., 2006). Loss of function of cytosolic Apx1 in A. thaliana resulted in lower photosynthetic rates, slower growth, and delayed owering under normal growth conditions (Pnueli et al., 2003). Under high-intensity light, the chloroplast H2O2-scavenging system was insufcient in face of the higher H2O2 production in Apx1-decient plants, indicating that cytosolic APx might be essential for chloroplast protection during light stress (Davletova et al., 2005; Pnueli et al., 2003). These results illustrate the complexity of ROS metabolism coordination and indicate that cytosolic APx may play a central role in the coordinate response to ROS. In contrast to extensive functional characterization of cytosolic APx in dicotyledonous, a comprehensive physiological analysis of Apx loss of function in crops is generally lacking. Here the focus has been on rice (Oryza sativa L.), a model plant for cereals. Previously, eight Apx genes were identied in the rice genome through in silico analysis: two cytosolic putative isoforms, two putative peroxisomal isoforms and four putative chloroplastic. The sub-cellular localization of rice OsAPx1, OsAPx3 and OsAPx6 isoforms was determined using GFP-fusion proteins in BY-2 tobacco cells. In agreement with the initial prediction, OsAPx1 was localized in the cytosol (data not published) and OsAPx3 was localized in the peroxisomes (Teixeira et al., 2006). On the other hand, the OsAPx6-GFP-fusion protein was found in mitochondria of the BY2 cells, in contrast to the chloroplastic location predicted by sequence analysis. Transcript accumulation analysis performed during plant development and in response to salt stress revealed distinguishable expression proles for each Apx family member (Teixeira et al., 2006). To address the functional role of the OsAPx isoforms, transgenic rice plants silenced for different Apx-encoding genes by RNAi strategy were generated. This study reports the effects of the silencing of rice Apx1 and/or Apx2 genes on plant growth and stress responses. Transgenic plants single silenced for Apx1 and Apx2

genes exhibited strong alterations on their development. On the other hand, transgenic double Apx1/2-silenced plants exhibited normal development and enhanced tolerance to a toxic concentration of aluminum.

2. Results 2.1. Drought stress and exogenous H2O2 treatment induced the expression of soluble Apx isoforms encoding genes Previously, Northern-blot analyses showed specic expression patterns for each member of the Apx family according to the developmental stage and in response to salt stress (Teixeira et al., 2006). To broaden the understanding of how Apx gene family responds to abiotic stress, the expression of Apx genes was analyzed by qRTPCR after submitting 30-day-old plants to drought stress for up to 15 days (Fig. 1A). The analysis showed that OsApx1, OsApx2, OsApx5, OsApx6 and OsApx7 were up-regulated in response to this condition, while OsApx8 was down-regulated. The peroxisomal

Fig. 1. Expression analysis of the OsApx genes in response to drought (A) and exogenous H2O2 treatment (B). Plants were submitted to 6- and 15-day drought conditions (A). Seedlings were incubated 2, 4, or 8 h in MS medium supplemented with 10 lM H2O2 (B). Each bar represents the mean of three replicates of four biological samples, with the standard deviation also indicated. Relative expression of each APx locus was normalized by the average value obtained for control plants after 6 days (Cnt 6d) or by the values obtained for control plants 2 h after the beginning of the H2O2 treatment (control 2 h) in (A) and (B), respectively. Each treatment that promotes a statistically different expression of individual APx loci was assigned with a specic letter (ad). Groups without letters indicate that there are no statistical differences among their expression.

550

S.B. Rosa et al. / Phytochemistry 71 (2010) 548558

OsApx3 was not affected, while OsApx4 was weakly, but signicantly, down-regulated by the treatment. Abiotic stresses such as drought and salinity induce the increase of ROS levels in plant cells. In order to verify how H2O2 modulates the OsApx gene family expression, seedlings were treated with exogenous 10 lM H2O2 and mRNA accumulation was measured by qRT-PCR (Fig. 1B). The results indicated that, like in response to drought stress, both cytosolic OsApx genes were highly modulated by H2O2. In addition, OsApx5, OsApx6 and OsApx7 expressions were also signicantly induced by this treatment. It is remarkable that Apx genes encoding soluble enzymes had their expression induced by drought and H2O2 while genes encoding membranebound isoforms (peroxisomal OsApx3 and OsApx4) were not highly affected by either stress conditions with the exception of OsApx4 that presented just a minor variation. The expression of thylakoid OsApx8 was not affected by exogenous H2O2 but was reduced by drought stress. 2.2. Double silenced OsApx1/OsApx2 transgenic rice showed global reduction of Apx activity and normal development To determine the functional role of cytosolic OsApx genes, both OsApx1 and OsApx2 were silenced using inverse repeat (IR) constructs transcribing dsRNA (hairpin). It was previously reported that a stretch of at least 21-nt long region with perfect match between the hairpin constructs and the target gene is necessary for triggering gene silencing (Eamens et al., 2008). In rice, the nucleotide sequence of Apx genes is very well conserved. Identities among the family members varied from 72% up to 82%, and genes encoding proteins located in the same sub-cellular compartment share long, identical, and contiguous sequence stretches (up to 49 base-long). We took advantage of this similarity to design an IR construct transcribing dsRNA for a 250 bp fragment from a specic region of the OsApx2 gene, which shares 82% identity with the homologous region of OsApx1. In this particular region, OsApx1 and OsApx2 sequences share several adjacent stretches (up to 26 base-long) with no mismatches (Table 1). When compared to other member of the OsApx gene family, the same region does not present more than 62% sequence identity or 14 base-long perfect match regions. Since RNA interference is triggered by 21-nt long sRNA with no (or a few) mismatches to their target mRNAs, it is very likely that our RNAiApx1/2 hairpin construction specically targets both cytosolic Apx genes. Rice plants were transformed with the RNAiApx1/2 construct and 23 independent transgenic lines carrying the hairpin construct were identied and analyzed (Apx1/2s plants). Although no major visibly altered phenotype was observed between transgenic and control plants grown under optimal conditions (Fig. 2G), qRT-PCR analysis showed that the expression of both cytosolic OsApx genes was strongly reduced in all Apx1/2s transgenic plants compared to the non-transformed (NT) plants of same age and grown in the same conditions (Fig. 2H). Nine independent transgenic plants were analyzed and the efcient reduction of OsApx1 and OsApx2 mRNAs accumulation was observed in all of them. To investigate whether the other OsApx genes could be differently modulated in the transgenic plants, we analyzed by qRTPCR the transcript levels of OsApx1 to OsApx8. The expression of

the majority of these genes was reduced in response to the silencing of OsApx1 and OsApx2 (Fig. 2I). Interestingly, only the mitochondrial OsApx6 was not affected by silencing of both cytosolic Apx genes. While OsApx3 and OsApx5 mRNAs were almost not detected in the analyzed tissues, the expression of the peroxisomal OsApx4 and the chloroplastic OsApx7 and OsApx8 expressions were reduced by 2070% (Fig. 2C, F and I). 2.3. Silencing of OsApx1 or OsApx2 impairs plant development In order to understand how individual cytosolic Apx genes may affect the plant response to the abiotic stress, we have analyzed the effect of the single silencing of each Apx gene in comparison to the double knockdown in transgenic rice plants. OsApx1 silencing was carried out with a 309 bp fragment of the corresponding gene which shares 15% identity with the homologous region of OsApx2 (RNAiApx1 construction). The silencing of OsApx2 (RNAiApx2) was obtained with a 225 bp fragment of the gene, which shares 53% identity with the OsApx1 (Table 1). When compared to other members of the OsApx gene family, these regions did not present more than 37% sequence identity or eight base-long perfect match regions. Rice plants were genetically transformed using either the RNAiApx1 or RNAiApx2 constructs. Four independent transgenic lines carrying the RNAiApx1 (Apx1s plants) and four lines carrying RNAiApx2 hairpin construct (Apx2s plants) were obtained and analyzed. For all independent transgenic lines, a strong altered phenotype was observed when comparing transgenic to control plants grown under optimal growth conditions (Fig. 2A and D). The reduction of OsApx1 and OsApx2 expression was conrmed by qRT-PCR (Fig. 2B and E, respectively). The comparisons were always performed in relation to the gene expression in non-transformed plants at the same age and growing in the same conditions side by side. Silencing of OsApx1 produced a signicant reduction of mRNA accumulation of OsApx4, OsApx5 and OsApx8 (Fig. 2C) while silencing of OsApx2 reduced OsApx1 and OsApx7 expression (Fig. 2F). Biochemical analysis carried out using transgenic Apx1s and Apx2s plant lines indicated a slight reduction in total APx activity in both transgenic plants (Fig. 3A). The reduction of total APx activity was smaller in Apx1s than in Apx2s, with a negative correlation with the increase of H2O2 (Fig. 3B). In both Apx1s and Apx2s plants, total superoxide dismutase (SOD) activity was increased, but total catalase (CAT) activity was reduced (Fig. 3C and D, respectively), suggesting that the antioxidant metabolism was disturbed in those transgenic plants. 2.4. Double suppression of OsApx1 and OsApx2 enhances H2O2 steadystate levels and CAT, AOX and SOD activities To understand which mechanism is involved in the maintenance of the homeostasis of Apx1/2s plants, biochemical analyses were performed in order to measure the impact of double knockdown of OsApx1 and OsApx2 on the antioxidant metabolism in control and under stressful growth conditions in 4-weeks-old rice plants. Total APx enzyme activity was reduced by 40% in the transgenic Apx1/2s lines compared to non-transformed plants (Fig. 4A). Thus, the results show that, in transgenic plants, both OsApx1 and

Table 1 Similarity among the sequence of the hairpin construction and the rice eight Apx genes. RNAi constructs Apx1s (309 nt) Apx2s (225 nt) Apx1/2s (250 nt) Apx1 100% (309 nt) 53% (20 nt) 82% (26 nt) Apx2 15% (20 nt) 100% (225 nt) 100% (250 nt) Apx3 8% (9 nt) 35% (6 nt) 61% (9 nt) Apx4 9% (6 nt) 37% (8 nt) 60% (14 nt) Apx5 6% (7 nt) 29% (7 nt) 55% (9 nt) Apx6 4% (5 nt) 18% (4 nt) 57% (8 nt) Apx7 6% (5 nt) 27% (7 nt) 62% (9%) Apx8 7% (6 nt) 22% (8 nt) 58% (12 nt)

The number of contiguous stretches nucleotides shared between each rice Apx gene and the target sequence of the hairpin construct are indicated in parenthesis.

S.B. Rosa et al. / Phytochemistry 71 (2010) 548558

551

Fig. 2. Characterization of Apx1s (AC), Apx2s (DF) and Apx1/2s (GI), silenced plants for cytosolic OsApx1 and OsApx2 genes. (A) Non-transformed (NT) and two independent lines of Apx1s plants (silenced for OsApx1) grown under controlled conditions. (B) Quantitative determination of OsApx1 mRNA in leaves of non-transformed (NT) and silenced plants grown under control conditions. Transcript level of OsApx1 present in non-transformed plants was used to normalize transcript accumulation in silenced plants (D) non-transformed (NT) and one line of Apx2s plants (silenced for OsApx2) grown under controlled conditions. (E) Quantitative determination of OsApx2 mRNA in leaves of NT and silenced plants (average of three independent Apx2s lines 5 and 11) grown under control conditions. Transcript level of OsApx2 present in nontransformed plants was used to normalize transcript accumulation in silenced plants (G) non-transformed (NT) and two independent lines of Apx1/2s plants (Apx1/2s-5 and Apx1/2s-10) grown under controlled conditions. H) Quantitative determination of OsApx1 and OsApx2 mRNA accumulation in leaves of non-transformed (NT) and silenced plants (Apx1/2s lines 5, 10 and 11) grown under control conditions. Transcript level of OsApx1 and OsApx2 present in NT plants was used to normalize transcript accumulation in silenced plants. Values represent the means of three independent sample pools of four plants. (C, F, and I) Expression analyses of all OsApx genes in Apx1s, Apx2s Apx1/2s plants (light gray, dark gray and black bars, respectively) in comparison with the expression observed in non-transformed plants NT (white bars). Quantitative relative determination of mRNAs was plotted in a log10 scale and shows the mean of the three lines of each transgenic plants normalized by the OsApx1 transcript accumulation found in NT. Values represent the mean SD (N = 3). Vertical black bars correspond to 10 cm.

OsApx2 mRNAs were efciently targeted by the hairpin construct, drastically reducing OsApx1 and OsApx2 mRNA accumulation and reducing total leaf APx activity levels. We also analyzed changes in the total SOD, CAT, and ascorbate oxidase (AOX) enzyme activities. All these enzymatic activities were increased in transgenic plants compared to NT (Figs. 4BD, respectively). TBARS measurements were performed in leaf extracts as an indicator of lipid oxidation. Transgenic plants presented lower levels of lipid oxidation when compared to NT plants (Fig. 4E), suggesting that the higher levels of SOD, CAT and AOX activities could prevent lipid oxidation in transgenic plants under control conditions. The H2O2 steady-state level was enhanced in transgenic plants in comparison to NT plants (Fig. 4F). Transgenic plants also showed a higher content of the reduced form of AsA than NT plants. However, the total content of AsA (reduced plus oxidized) was higher in non-transformed lines than in transgenic plants

(Fig. 4G). The higher content of reduced form of AsA resulted in a superior AsA redox state in transgenic plants (Fig. 4H). 2.5. Response of double silenced OsApx1/OsApx2 transgenic rice to abiotic stress Because silenced Apx1/2s plants presented the same phenotype of non-transformed plants when growing in control conditions, both transgenic and non-transgenic plants were submitted to stressful conditions such as drought, salt, cold and aluminum treatment to verify whether the double knockdown of OsApx1 and OsApx2 rendered the plants less tolerant to these conditions. These stresses induce the increase of the expression of cytosolic Apx genes in rice (Teixeira et al., 2006) (present study, Figs. 1 and 5B). Non-transformed and silenced plants were equally visually affected by the drought, cold and salt stresses (data not shown)

552

S.B. Rosa et al. / Phytochemistry 71 (2010) 548558

Fig. 3. Effect of single silencing of cytosolic OsApx genes on the activity of ascorbate peroxidase-Apx (A), content of H2O2 (B), activities of superoxide dismutase-SOD (C), and catalase-CAT (D). Determinations were performed in leaves of seedlings of transgenic rice Apx1s (light grey bars), Apx2s (dark grey bars) and non-transformed (NT) plants (white bars) grown under control conditions. Values represent the mean SD (N = 3).

indicating that double knockdown of OsApx1 and OsApx2 genes did not compromise further the tolerance of rice plants to these treatments. To analyze the effect of silencing of cytosolic OsApx genes in response to aluminum treatment, T1 rice seedlings from three independent transgenic lines (lines 5, 10 and 11) were grown in the presence of 20 ppm aluminum. Transgenic silenced seedlings were visually healthier than non-transformed plants exposed to 20 ppm Al (Fig. 5A). The transcript accumulation levels of all OsApx genes, except OsApx6, were signicantly increased after an 8-h treatment in 5-day-old-non-transformed plants (Fig. 5B). In contrast, double OsApx1 and OsApx2 silenced plants specically induced the transcript accumulation of only the peroxisomal OsApx3 and OsApx4 and chloroplastic OsApx8 genes. In order to verify the impact of aluminum treatment in the antioxidant system of mature plants, transgenic and non-transgenic 4months-old plants were submitted to 40 ppm of aluminum for 2 weeks (Fig. 6). In this experiment, Apx1/2s plants and non-transformed plants were not distinctly visually affected by the treatment. APx activity was increased in both non-transformed and in transgenic plants, in response to aluminum. However, non-transformed plants reached levels approximately 50% higher than in silenced plants (Fig. 6A). SOD activity was induced in both nontransgenic and silenced plants (Fig. 6B) with higher SOD activity in NT plants than in Apx1/2s plants. Catalase activity, which is higher in transgenic plants, did not respond to the treatment in both plants (Fig. 6C). In both, the content of the reduced form of AsA increased in response to aluminum; however, in silenced plants, these values were signicantly higher (Fig. 6D). TBARS increased in both control and silenced plants exposed to aluminum (Fig. 6E). In general the glutathione content was higher in nontransformed plants whether in control or treated conditions (data not shown). Finally, there was a signicant Al-induced increment

of the hydrogen peroxide level in both non-transformed and silenced plants (Fig. 6F). In contrast to the results obtained in the determinations performed in leaves of 4-week-old OsApx1/2s transgenic rice, in the determinations carried out with the 4months-old plants the TBARS and H2O2 contents did not differed between transgenic and non-transgenic.

3. Discussion A number of recent analyses of A. thaliana Apx single knockout mutants indicated an incontestable link between the control of ROS intracellular levels and many physiological processes, ranging from plant development to response to biotic and abiotic stress (Davletova et al., 2005; Locato et al., 2008; Lu et al., 2007; Miller et al., 2007; Pnueli et al., 2003; Rizhsky et al., 2002; Rossel et al., 2006). Understanding how antioxidant metabolism is regulated in plant cells is challenging since these enzymes have substrates that also function as signal molecules and are represented by several isoforms targeted to different intracellular compartments. In rice, the eight members of Apx gene family appear to play different roles during plant development and in response to abiotic stress (Teixeira et al., 2006). To increase the data related to the expression pattern of the eight member of rice Apx gene family, we have tested their response to drought and to exogenous H2O2 treatment. Generally, upon all stress conditions tested, drought, H2O2 and aluminum treatment, rice Apx genes presented a signicant but weak induction. These responses contrast to Arabidopsis, whose cytosolic stressinducible Apx2 was up-regulated more than 20-fold upon heat shock, about ten fold by high light and also after drought stress, and nally about 20-fold in response to H2O2 treatment (Panchuk et al., 2002; Rossel et al., 2006; Volkov et al., 2006). Compared to

S.B. Rosa et al. / Phytochemistry 71 (2010) 548558

553

Fig. 4. Effect of double silencing cytosolic OsApx genes on the activity of ascorbate peroxidase-APx (A), superoxide dismutase-SOD (B) catalase-CAT (C), ascorbate oxidase-AO (D), content of TBARS (E), H2O2 (F) total AsA (G) and the AsA redox state (H), calculated as percentage of the ratio between the reduced form of AsA and total AsA. Determinations were performed in leaves of 4-week-old transgenic rice Apx1/2s (black bars) and non-transformed (NT) plants (white bars) grown under control conditions. Values represent the mean SD (N = 3). Different letters (ac) at the top of the error bars indicate statistically different means (P < 0.05).

Apx induction veried in Arabidopsis, rice Apx were only weakly induced by abiotic stresses. The results reported here thus agree with our previous work (Menezes-Benavente et al., 2004; Teixeira et al., 2006) as well as those obtained by other groups: Hong et al. (2007) reported that Apx8 mRNA level was increased by two to three times in rice roots after NaCl treatment, while other

Apx genes were unaffected by this treatment (Hong et al., 2007). In addition, Sato et al. (2001) showed that Apx1 (Apxa) increased 1.8-fold after 1 h of heat stress. Taken together these results indicate that the weak increasing of rice Apx mRNA in response to abiotic stress may be functionally signicant and contribute for the antioxidant responses.

554

S.B. Rosa et al. / Phytochemistry 71 (2010) 548558

Fig. 5. Enhanced tolerance to aluminum of Apx1/2s plants in relation to the non-transformed plants (NT). (A) Seedlings were grown on a hydroponics medium supplemented with 20 ppm aluminum. Experiments were performed with T1 progeny of three independent Apx1/2s lines (Apx1/2s-5, Apx1/2s-10 and Apx1/2s-11) and NT plants. (B) Effect of the exposure to 20 ppm aluminum on the expression of OsApx genes in NT plants (NT + Al, light grey bars) and silenced plants (Apx1/2s + Al, dark grey bars). Plants maintained under growth control conditions (NT and Apx1/2s) were used as control (white and black bars, respectively). The normalization of all genes was made using the relative transcript level of OsApx1 in NT plants. Values represent the mean SD (N = 3). Vertical black bars correspond to 10 cm.

In order to understand the role of the cytosolic isoforms of APx in rice antioxidant metabolism, transgenic lines were produced to singly and doubly silence the cytosolic OsApx1 and OsApx2 encoding genes. The expression of the majority of the Apx-encoding genes was reduced in response to double silencing of OsApx1 and OsApx2 (Fig. 2I). However, when expression analysis was performed on young T1 of the RNAi1/2s plants (5-days old), no alteration was observed for the Apx genes which were not targeted by the RNAi construct (Fig. 5B). Together, these results indicate that misexpression of OsApx genes in mature transgenic plants may be caused by disruption of the OsAPX1 and OsAPX2 function rather than off-target of the RNAi construct. Enzymatic activity measurements showed that total leaf APx activity in all silenced plants was reduced, with a stronger reduction (40%) in double silenced plants (Figs. 3A and 4A), indicating that the post-transcriptional silencing of those genes had a significant effect on the total leaf APx activity. However, the double silencing of OsApx1 and OsApx2 did not produce any visible phenotype, suggesting that a compensatory H2O2-scavenging mechanism may be activated in response to the double knockdown of both cApx genes. In fact, CAT and SOD activities were signicantly enhanced in Apx1/2s transgenic plants (Figs. 4B and 4C), indicating that silencing of cytosolic Apx genes represents a stressful situation for the plant. The results thus suggest that cytosolic APxs play a control role in stress perception, modulating expression of other members of the antioxidant system, rather than scavenging by itself a signicant quantity of stress-induced H2O2. Ascorbate (AsA) and TBARS are good markers of the oxidative stress suffered by plants. The higher levels of H2O2 (Fig. 4F), and of the reduced form of ascorbate (Fig. 4H), correlated with the reduced level of APx activity in Apx1/2s plants (Fig. 4A). The reduced level of TBARS (Fig. 4E) in these transgenic plants as compared to non-transformed plants, indicates that under control conditions double silenced plants can support a higher level of H2O2 without oxidative penalty. The effect of the OsApx genes knockdown on the activity of other antioxidant enzymes has been described in other plants. Tobacco plants with suppressed Apx1 expression also contained elevated levels of transcripts corresponding to CuZnSOD, catalase

and glutathione reductase suggesting the existence of a compensatory mechanism induced by reduction of the expression of Apx genes (Rizhsky et al., 2002). In addition, other groups have already shown that accumulated ROS might evoke up-regulation of other antioxidative systems (Davletova et al., 2005; Ishikawa et al., 2005; Pnueli et al., 2003). On the other hand, Arabidopsis plants with Apx1 deciency did not exhibit altered transcript levels of catalase, CuZnSOD or glutathione reductase (Pnueli et al., 2003). Taken together, contrasting responses to the reduced expression of cytosolic Apx genes in different plant species could establish specic models of global responses to oxidative challenge in different plant lineages. Most intriguingly, silencing of only one gene encoding cytosolic APx impairs normal development in rice, suggesting that the trigger of the compensatory antioxidative system depends on the complex balance between expressions of both cytosolic Apx genes. In the Apx2s plants, the expression of OsApx1 was also reduced, but with a lesser extension than reduction of its expression in the Apx1/2s plants. Apparently the rate between the expression of both genes in Apx1s and Apx2s is far from equilibrium, while in the Apx1/2s plants the expression of both cytosolic Apx genes was affected in the same way. These results reinforce the idea that the equilibrium between the expression of both OsApx1 and OsApx2 may be essential for the normal development of rice plants. Apx1/2s plants have not shown any reduction in tolerance to abiotic stress, such as salt, cold and drought. In contrast, silenced plants seem to be more tolerant to aluminum than non-transformed plants. This is an unexpected result, since it is known that cytosolic Apx genes are induced in response to salt (Menezes-Benavente et al., 2004), aluminum (Sharma and Dubey, 2007) and drought stresses (Fig. 1A). The modulation of cytosolic Apx expression gene regulation in response to abiotic stress suggests that cytosolic APx activity is fundamental to scavenge the excess of H2O2 induced by the stress. The expected result was that the double knockdown of the cytosolic genes would produce severe consequences for plant development and stress responses. However, under normal conditions, the double silencing of cytosolic Apx genes produced only mild modication in the intracellular level of H2O2 that does not produce any phenotypic alteration but was sufcient to increase SOD and CAT activity (Fig. 4B and C). In this

S.B. Rosa et al. / Phytochemistry 71 (2010) 548558

555

Fig. 6. Biochemical characterization of Apx1/2s plants under aluminum stress. Effect of the cytosolic OsApx genes silencing on the plants response to aluminum treatment in relation to their activities of APx (A), SOD (B), CAT (C), and their AsA content (D), TBARS (E), and H2O2 (F) contents. Determinations were performed in transgenic rice Apx1/2s (black and dark gray bars) and non-transformed (NT) plants (white and light gray bars) of 4-months-old plants grown under 40 ppm aluminum for 2 weeks. Values represent the mean SD (N = 3). Different letters (ad) at the top of the error bars indicate statistically different means (P < 0.05).

case, changes in SOD and CAT activity could contribute to the redox adjustment, rendering these plants more tolerant to a range of environmental stresses. It seems likely that the mild increases in the cellular H2O2 levels were sufcient to mimic a stress situation and instruct the cell toward acclimation to aluminum (Fig. 5A). A similar acclimation effect was already observed in dicotyledonous plants, where the marginal increases in the cellular ROS levels were sufcient to mimic a pseudostress situation and impart acclimation to heat and salinity (Ishikawa et al., 2005). Likewise Funatsuki et al. (2003) found that the tolerance to chilling in soybean is associated with the lack of a cytosolic Apx gene. The transgenic double Apx silenced plants also showed a higher level of ascorbate oxidase (AO) activity (Fig. 4D). AO is a cell wall-

localized enzyme that catalyses oxidation of ascorbate to the unstable radical monodehydroascorbate (MDHA), which rapidly disproportionates to yield dehydroascorbate (DHA) and AsA, with the concomitant reduction of molecular oxygen to water, and thus contributes to the regulation of the AsA redox state. The enzyme may be involved in plant defense by modifying the ascorbate level and thus redox state in the apoplast (Fotopoulos et al., 2006). The pool of reduced ascorbate in the apoplast results from the balance between inputs from newly synthesized AsA transported from the cytosol and losses associated with enzymatic metabolism and oxidation by cell wall-localized AO (Smirnoff, 2000). The increase of AO activity could be understood as a response to elevation of H2O2 levels as result of lack of cytosolic APx activity. The cells

556

S.B. Rosa et al. / Phytochemistry 71 (2010) 548558

could perceive this as the plant was submitted to an environmental stress, and thus activated the AO to equilibrate the apoplastic redox status. Sanmartin et al. (2007) demonstrated that modulation of AO activity occurs by sudden changes in apoplastic redox state in response to abiotic or biotic cues.

4. Concluding remarks The response to the double silencing of cytosolic Apx genes in rice contrasted with the effect of disruption of the single OsApx1 or OsApx2 genes, which affects normal development. However, the reason for the contrasting results observed in single and double silenced plants is still not clear. In contrast to the Apx1/2s plants, single silenced plants presented lower reduction of global APx activity, especially Apx1s plants, which presented stronger altered phenotype than Apx2s plants. Apx1s showed an important increasing of H2O2 content, in agreement with the higher level of SOD and lower level of CAT activities in these plants compared to NT plants (Fig. 3BD). An indication that the slight reduction of APx activity in single knockdown plants was not sufcient to induce the activation of the compensatory antioxidant mechanisms, but by contrast was enough to disturb the redox equilibrium in these plants. This could suggest that partial or complete suppression of cytosolic Apx genes activates multiple antioxidative systems. These results indicate that for the characterization of Apx gene family, systematic and detailed analyses of mutants are required so that a more complete understanding of the interactions of plant antioxidant metabolism can be made. Further analyses must be carried out in order to identify the stress-related genes that are activated in the transgenic plants Apx1/2s in response to the reduced activity of cytosolic APx, and also the signal(s) responsible for that activation. As already demonstrated for dicotyledonous plants, there is a complex regulatory mode within the ROS network in plants. The functional analysis of genes belonging to this network in an important monocot, such as rice, can establish aspects unique to this group of plants and/or help understand the highly complex stress response process of plants in general.

aluminum was added into the submerged H2O covering plants pots during 2 weeks. For drought stress, seedlings were grown up to the four-leaf stage on soil supplied with the same volume of H2O. After the period of growth, seedlings were separated into two lots: control and drought stressed. Control lot continued to receive normal supply of H2O. Stressed seedlings were withheld watering for 6 and 15 days. After this period, plant material was collected from both lots of plants. To analyze the response of rice plants to exogenous H2O2 treatment plants were germinated and grown in 1/2 Murashige and Skoog (MS) medium. After 4 weeks of growth, seedlings were transferred to liquid MS supplemented with 10 lM H2O2. Seedlings were incubated 2, 4, or 8 h in MS medium supplemented with H2O2. Control plants were maintained in MS without supplement of H2O2. 5.2. Construct of plant vector and plant transformation Chimeric gene producing mRNA with a hairpin structure (hpRNA) was constructed based on the sequence of OsApx1 (LOC_Os03g17690) and OsApx2 (LOC_Os07g49400) genes. The following primers pairs were used: AAAAAGCAGGCTCCCTACAAGGAG GCCCACCTCA and AGAAAGCTGGGTCCCGCATTTCATACCAACACA (OsApx1RNAi); AAAAAGCAGGCTCCCCAAGTGACAAAGCCCTCAT and AGAAAGCTGGGTCAAGGCGCAAAATACAAATCG (OsApx2RNAi), and CGCCGCCAACGCCGGCCTCGA and CACTCAAACCCATCTGCGCA (OsApx1/2RNAi). PCR products were cloned into the Gateway vector (pANDA) in which hairpin RNA is driven by maize ubiquitin promoter and an intron placed 50 upstream of inverted repeats (Miki and Shimamoto, 2004). Agrobacterium mediated transformation was performed as described previously (Upadhyaya et al., 2000). 5.3. Quantitative real-time PCR (qRT-PCR) Real-time PCR experiments were carried out on cDNAs synthesized from Trizol (Invitrogen) puried total RNA. The cDNAs were obtained by using the Superscript TM II reverse transcriptase system (Invitrogen) and a 24-polyTV primer. After cDNA synthesis, it was diluted 10 up to 100 times in sterile H2O. Subsequent PCR amplications were performed using gene specic primers. Primers were designed to produce DNA fragments ranging from 180 to 250 bp. Primer-pairs to amplify the OsFDH3 gene (LOC_Os02g57040), rice 40S ribosomal protein S27a (LOC_Os01g22490) and OseFa1 gene (LOC_Os03g08020) were used as internal controls, to normalize the amount of mRNA present in each sample. This three genes were conrmed as good house-keeping genes in our experimental conditions, as they presented the highest expression stability, with a Mvalue below 0.05 using the GeNorm software (Vandesompele et al., 2002), when all biological samples where compared under control and stressed conditions. They were also the three most stable genes in a set of ve candidate genes when the NormFinder algorithm was used (Andersen et al., 2004). All expression data analyses were performed after comparative quantication of amplied products by using the 2DDCt method (Livak and Schmittgen, 2001; Schmittgen and Livak, 2008). The efciency of amplication of each qRT-PCR primer-pair were estimated from the slope values of standard curves obtained after a series of cDNA dilution. The efciency of the three housekeeping genes and the eight rice APx genes varied from 94% to 102%. The variation of efciency of amplication among samples for each primer always less than 5%, as estimated by the intra sample amplication analysis using the LinReg software (Ramakers et al., 2003). All qRT-PCR reactions were performed in an Applied

5. Experimental 5.1. Plant material and growth conditions Rice plants (O. sativa) cv. Nipponbare were used in this study. Plants were grown in a growth chamber with supplemental lighting (8-h dark/16-h light; 150 lmol m2 s1) at 28 C or in a greenhouse (sunlight) and submerged in H2O as described previously (Upadhyaya et al., 2000). Seeds were germinated in H2O at 28 C under dark conditions. Four-day-old seedlings were transferred to plastic pots containing Furlanis solution (Furlani and Furlani, 1998) and grown at 28 2 C, 12 h photoperiod. The nutrient composition of Furlanis solution was as follow (48 mg/l NNO 3 ; 12 mg/l NNH4 ; 200 mg/ l Ca; 200 mg/l K; 40.6 mg/l Mg; 8.0 mg/l P; 151 mg/l S; 234 mg/l Cl; 4.85 mg/l Fe; 0.67 mg/l Mn; 0.36 mg/l B; 0.20 mg/l Zn; 0.05 mg/l Cu; 0.11 mg/l Mo). For aluminum treatment, 4-day-old seedlings were grown in nutrient solution supplemented by 20 ppm AlCl3. The pH of the solution was adjusted to 4.0 with 0.1 N HCl. The volume and pH of the nutrient solution were monitored daily and changed each four days. Plant materials were sampled at the times indicated, and immediately frozen at 80 C. The T1 generation of three Apx1/2s lines and control non-transformed plants were used in 20 ppm aluminum stress assays. Adult plants (4-month-old) of Apx1/2s lines 5 and 10 and NT plants with the same age were submitted to 40 ppm of AlCl3. In this experiment,

S.B. Rosa et al. / Phytochemistry 71 (2010) 548558

557

Biosystems 7500 Real-time PCR system using SYBR-green intercalanting-dye uorescence detection. 5.4. Enzymatic extraction Leaf samples (0.5 g FW) were ground to ne powder in presence of liquid N2 in a mortar and pestle and extracted in 3 mL of ice-cold 100 mM K-phosphate buffer pH 6.8 for 5 min, containing 0.1 mM EDTA and 1 mM ascorbate. After ltration through cheesecloth, the homogenate was centrifuged at 4 C at 15,000g for 15 min and the obtained extract was used for determination of the different enzymatic activities. The protein content of crude enzyme extracts was estimated according to Bradford (1976), using BSA as standard. 5.5. Catalase activity Catalase (CAT, EC 1.11.1.6) activity was determined following oxidation of H2O2 at 240 nm. The reaction was started by adding 50 lL of enzymatic extract in a reaction medium (2950 lL) containing 50 mM potassium phosphate buffer pH 7.0 and 20 mM H2O2. The CAT activity was determined by measuring the decrease in absorbance at 240 nm, 30 C, after 60 s (Havir and McHale, 1987). The CAT activity was calculated using the molar extinction coefcient of 36 103 mM1 cm1 (H2O2) and expressed in lmol H2O2 oxidized mg1 protein min1. 5.6. Superoxide dismutase activity Superoxide dismutase (SOD, EC 1.15.1.1) activity was determined by inhibition of blue formazane production by means of the NBT photoreduction. The reaction medium contained 100 lL of the enzymatic extract, 13 mM L-methionine, 75 lM p-nitro blue tetrazolium chloride (NBT), 100 lM EDTA and 20 lM riboavin dissolved in 50 mM potassium phosphate buffer, pH 7.8 in a nal volume of 2 mL. The reaction took place in a chamber under illumination of a 30 W uorescent lamp at 25 C. The reaction was started turning the uorescent lamp on and stopped 5 min later turning it off (van Rossum et al., 1997). The blue formazane produced by NBT photoreduction was measured by the increase in the absorbance at 560 nm. Control reaction mixture had no enzyme extract. The blank solution had the same complete reaction mixture, but it was kept in the dark. One SOD activity unit (AU) was dened as the amount of enzyme required to inhibit 50% of the NBT photoreduction in comparison with tubes lacking the plant extract. The enzymatic activities were expressed in protein basis (AU mg1 protein min1). 5.7. Ascorbate peroxidase activity

Fe2+ complexed with 2,20 bipirydyl, giving a pink color. The leaf samples (0.1 g FW) were homogenized in cold 6% trichloroacetic acid (TCA) (w/v), and the homogenate was centrifuged at 12,000g (4 C) for 20 min and the supernatant was immediately used for reduced ascorbate (AsAred) determination. The total AsA (AsAred + AsAoxi) was measured after a complete reduction of the oxidized fraction by reaction of the samples with dithiothreitol (DTT) in excess (10 mM). Subsequently, the remaining DTT was removed by 0.5% (m/v) N-ethylmaleimide and the AsAoxi was calculated as the difference between total AsA and AsAred. The absorbance of the pink complex formed was read at 525 nm and the AsA concentrations were calculated from a standard curve obtained with ascorbic acid (Sigma-Aldrich). 5.9. Hydrogen peroxide assay H2O2 content was assayed according to Gay et al. (1999) and adapted by Cheeseman (2006), using the FOX method based in the reaction of the hydroperoxides with the ferric-xylenol orange. Fresh leaf samples (0.25 g FW) were ground to a ne powder in liquid N2. Next, they were homogenized in 100 mM potassium phosphate buffer, pH 6.4, containing 5 mM KCN for 5 min. The homogenate was ltered through two layers of cheesecloth and then centrifuged at 4 C at 12,000g for 15 min and the supernatant was immediately used for H2O2 determination. W Leaf extract (100 lL) was added to reaction medium (900 lL) containing 100 lM FeSO4, 250 lM (NH4)2SO4, 100 lM xylenol orange and 99 mM sorbitol. The mixture was incubated for 30 min, 25 C and the reading performed at 560 nm. The H2O2 concentration was obtained by a standard curve using H2O2 (Sigma-Aldrich) and expressed as lmol H2O2 g1 FW. 5.10. Lipid peroxidation (TBARS) The level of lipid peroxidation was determined in terms of TBARS (Thiobarbituric acid reactive substances) concentration as described in Cakmak and Horst (1991), with minor modications. Samples (0.25 g) were homogenized in 3 mL of 1.0% (w/v) TCA at 4 C. The homogenate was centrifuged at 20,000g at 4 C for 15 min and the supernatant (0.5 mL) obtained was added to 3 mL of 0.5% (v/v) TBA in 20% TCA. The mixture was incubated at 95 C in a shaking water bath for 50 min, and the reaction stopped by cooling the tubes in ice-cold-water bath. Then, the samples were centrifuged at 9000g, 10 min, and the absorbance of the supernatant read at 532 nm. The value for non-specic absorption at 660 nm was subtracted. The concentration of TBARS was calculated using the absorption coefcient of 155 mM1 cm1 (Cakmak and Horst, 1991). 5.11. Statistical analysis

Ascorbate peroxidase (APx, EC.1.11.1.11) activity was measured following the AsA oxidation by the decrease in absorbance at 290 nm according to Nakano and Asada (1981). The reaction mixture (3 mL) contained: 0.5 mM AsA and 0.1 mM EDTA dissolved in 100 mM K-phosphate buffer, pH 7.0 and 100 lL of the enzyme extract. The reaction was started by adding of 30 mM H2O2 (200 lL). The enzyme activity was measured by the decrease in absorbance at 290 nm, 30 C, after 60 s. The activity was calculated using the molar extinction coefcient of 2.8 mM1 cm1 and expressed as lmol AsA mg1 protein min1. 5.8. Ascorbate assay Ascorbate content was assayed according to Kampfenkel et al. (1995). The assay is based on the reduction of Fe3+ to Fe2+ by reduced ascorbate (AsAred) and the spectrophotometric detection of

Data represent mean standard error of mean (SEM). Statistical analysis was performed by ANOVA followed by Duncans post hoc, using the statistical program, SPSS 15.0 for Windows (www.spss.com). The values were considered statically different when p < 0.05. Acknowledgments We thank Dr. Joe Polacco and Ms. Marly MacFarlane for critical reading of the manuscript. The authors thank Silvia Richter and Rafael Arenhart for their technical assistance. This work was supported by the International Centre for Genetic Engineering and Biotechnology (CRP/06/003), UNESCO, Coordenao de Aperfeioamento de Pessoal de Nvel Superior (CAPES), Fundao de apoio a Pesquisa do Rio Grande do Sul (FAPERGS), and the Brazilian

558

S.B. Rosa et al. / Phytochemistry 71 (2010) 548558 Menezes-Benavente, L., Teixeira, F.K., Kamei, C.L.A., Margis-Pinheiro, M., 2004. Salt stress induces altered expression of genes encoding antioxidant enzymes in seedlings of a Brazilian indica rice (Oryza sativa L.). Plant Sci. 166, 323331. Miki, D., Shimamoto, K., 2004. Simple RNAi vectors for stable and transient suppression of gene function in rice. Plant Cell Physiol. 45, 490495. Miller, G., Suzuki, N., Rizhsky, L., Hegie, A., Koussevitzky, S., Mittler, R., 2007. Double mutants decient in cytosolic and thylakoid ascorbate peroxidase reveal a complex mode of interaction between reactive oxygen species, plant development, and response to abiotic stresses. Plant Physiol. 144, 17771785. Mittler, R., 2002. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7, 405410. Mittler, R., Vanderauwera, S., Gollery, M., Van Breusegem, F., 2004. Reactive oxygen gene network of plants. Trends Plant Sci. 9, 490498. Mullineaux, P.M., Karpinski, S., Baker, N.R., 2006. Spatial dependence for hydrogen peroxide-directed signaling in light-stressed plants. Plant Physiol. 141, 346 350. Nakano, Y., Asada, K., 1981. Hydrogen peroxide is scavenged by ascorbate specic peroxidase in spinach chloroplasts. Plant Cell Physiol. 22, 867880. Panchuk, I.I., Volkov, R.A., Schof, F., 2002. Heat stress- and heat shock transcription factor-dependent expression and activity of ascorbate peroxidase in arabidopsis. Plant Physiol. 129, 838853. Passardi, F., Bakalovic, N., Teixeira, F.K., Margis-Pinheiro, M., Penel, C., Dunand, C., 2007. Prokaryotic origins of the non-animal peroxidase superfamily and organelle-mediated transmission to eukaryotes. Genomics 89, 567579. Pnueli, L., Liang, H., Rozenberg, M., Mittler, R., 2003. Growth suppression, altered stomatal responses, and augmented induction of heat shock proteins in cytosolic ascorbate peroxidase (Apx1)-decient Arabidopsis plants. Plant J. 34, 185201. Ramakers, C., Ruijter, J.M., Deprez, R.H., Moorman, A.F., 2003. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 339, 6266. Rizhsky, L., Hallak-Herr, E., Van Breusegem, F., Rachmilevitch, S., Barr, J.E., Rodermel, S., Inze, D., Mittler, R., 2002. Double antisense plants lacking ascorbate peroxidase and catalase are less sensitive to oxidative stress than single antisense plants lacking ascorbate peroxidase or catalase. Plant J. 32, 329342. Rossel, J.B., Walter, P.B., Hendrickson, L., Chow, W.S., Poole, A., Mullineaux, P.M., Pogson, B.J., 2006. A mutation affecting ascorbate peroxidase 2 gene expression reveals a link between responses to high light and drought tolerance. Plant Cell Environ. 29, 269281. Sanmartin, M., Pateraki, I., Chatzopoulou, F., Kanellis, A., 2007. Differential expression of the ascorbate oxidase multigene family during fruit development and in response to stress. Planta 225, 873885. Sato, Y., Murakami, T., Funatsuki, H., Matsuba, S., Saruyama, H., Tanida, M., 2001. Heat shock-mediated APX gene expression and protection against chilling injury in rice seedlings. J. Exp. Bot. 52, 145151. Scandalios, J.G., 2002. The rise of ROS. Trends Biochem. Sci. 27, 483486. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 11011108. Sharma, P., Dubey, R.S., 2007. Involvement of oxidative stress and role of antioxidative defense system in growing rice seedlings exposed to toxic concentrations of aluminum. Plant Cell Rep. 26, 20272038. Shigeoka, S., Ishikawa, T., Tamoi, M., Miyagawa, Y., Takeda, T., Yabuta, Y., Yoshimura, K., 2002. Regulation and function of ascorbate peroxidase isoenzymes. J. Exp. Bot. 53, 13051319. Smirnoff, N., 2000. Ascorbic acid: metabolism and functions of a multi-facetted molecule. Curr. Opin. Plant Biol. 3, 229235. Teixeira, F.K., Menezes-Benavente, L., Galvao, V.C., Margis-Pinheiro, M., 2005. Multigene families encode the major enzymes of antioxidant metabolism in Eucalyptus grandis L.. Genet. Mol. Biol. 28, 529538. Teixeira, F.K., Menezes-Benavente, L., Galvao, V.C., Margis, R., Margis-Pinheiro, M., 2006. Rice ascorbate peroxidase gene family encodes functionally diverse isoforms localized in different subcellular compartments. Planta 224, 300314. Teixeira, F.K., Menezes-Benavente, L., Margis, R., Margis-Pinheiro, M., 2004. Analysis of the molecular evolutionary history of the ascorbate peroxidase gene family: inferences from the rice genome. J. Mol. Evol. 59, 761770. Upadhyaya, N.M., Surin, B., Ramm, K., Gaudron, J., Schunmann, P.H.D., Taylor, W., Waterhouse, P.M., Wang, M.B., 2000. Agrobacterium-mediated transformation of Australian rice cultivars Jarrah and Amaroo using modied promoters and selectable markers. Aust. J. Plant Physiol. 27, 201210. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, research0034.1-0034.11. Volkov, R.A., Panchuk, I.I., Mullineaux, P.M., Schf, F., 2006. Heat stress-induced H(2)O(2) is required for effective expression of heat shock genes in Arabidopsis. Plant Mol. Biol. 61, 733746. van Rossum, M., Alberda, M., van der Plas, L.H.W., 1997. Role of oxidative damage in tulip bulb scale micropropagation. Plant Sci. 130, 207216. Yabuta, Y., Motoki, T., Yoshimura, K., Takeda, T., Ishikawa, T., Shigeoka, S., 2002. Thylakoid membrane-bound ascorbate peroxidase is a limiting factor of antioxidative systems under photo-oxidative stress. Plant J. 32, 915925. Yoshimura, K., Yabuta, Y., Ishikawa, T., Shigeoka, S., 2000. Expression of spinach ascorbate peroxidase isoenzymes in response to oxidative stresses. Plant Physiol. 123, 223233.

National Council of Technological and Scientic Development (CNPq). M. Margis-Pinheiro, and R. Margis were supported by grants from Conselho Nacional de Desenvolvimento Cientco e Tecnolgico, CNPq, Brasil (302684/2005-0 and 303967/2008-0).

References
Agrawal, G.K., Jwa, N.S., Iwahashi, H., Rakwal, R., 2003. Importance of ascorbate peroxidases OsAPX1 and OsAPX2 in the rice pathogen response pathways and growth and reproduction revealed by their transcriptional proling. Gene 322, 93103. Andersen, C.L., Jensen, J.L., Orntoft, T.F., 2004. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, 52455250. Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 55, 373399. Asada, K., 1999. The waterwater cycle in chloroplasts: scavenging of active oxygens and dissipation of excess photons. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 601639. Asai, N., Matsuyama, T., Tamaoki, M., Nakajima, N., Kubo, A., Aono, M., Kato, T., Tabata, S., Shirano, Y., Shibata, D., Hayashi, H., Mullineaux, P.M., Saji, H., 2004. Compensation for lack of a cytosolic ascorbate peroxidase in an Arabidopsis mutant by activation of multiple antioxidative systems. Plant Sci. 166, 1547 1554. Bradford, M.M., 1976. Rapid and sensitive method for quantication of microgram quantities of protein utilizing principle of proteindye binding. Anal. Biochem. 72, 248254. Cakmak, I., Horst, W.J., 1991. Effect of aluminum on lipid-peroxidation, superoxidedismutase, catalase and peroxidase-activities in root-tips of soybean (Glycine max). Physiol. Plant. 83, 463468. Cheeseman, J.M., 2006. Hydrogen peroxide concentrations in leaves under natural conditions. J. Exp. Bot. 57, 24352444. Danna, C.H., Bartoli, C.G., Sacco, F., Ingala, L.R., Santa-Maria, G.E., Guiamet, J.J., Ugalde, R.A., 2003. Thylakoid-bound ascorbate peroxidase mutant exhibits impaired electron transport and photosynthetic activity. Plant Physiol. 132, 21162125. Davletova, S., Rizhsky, L., Liang, H.J., Zhong, S.Q., Oliver, D.J., Coutu, J., Shulaev, V., Schlauch, K., Mittler, R., 2005. Cytosolic ascorbate peroxidase 1 is a central component of the reactive oxygen gene network of Arabidopsis. Plant Cell 17, 268281. Eamens, A., Wang, M.B., Smith, N.A., Waterhouse, P.M., 2008. RNA silencing in plants: yesterday, today, and tomorrow. Plant Physiol. 147, 456468. Fotopoulos, V., Sanmartin, M., Kanellis, A.K., 2006. Effect of ascorbate oxidase overexpression on ascorbate recycling gene expression in response to agents imposing oxidative stress. J. Exp. Bot. 57, 39333943. Fourcroy, P., Vansuyt, G., Kushnir, S., Inze, D., Briat, J.F., 2004. Iron-regulated expression of a cytosolic ascorbate peroxidase encoded by the APX1 gene in Arabidopsis seedlings. Plant Physiol. 134, 605613. Funatsuki, H., Kurosaki, H., Murakami, T., Matsuba, S., Kawaguchi, K., Yumoto, S., Sato, Y., 2003. Deciency of a cytosolic ascorbate peroxidase associated with chilling tolerance in soybean. Theor. Appl. Genet. 106, 494502. Furlani, A.M.C., Furlani, P.R., 1998. Composio e pH de solues nutritivas para estudos siolgicos e de seleo de plantas em condies nutricionais adversas. Technical bulletin Instituto Agronomico de Campinas 121, 134. Gay, C., Collins, J., Gebicki, J.M., 1999. Hydroperoxide assay with the ferric-xylenol orange complex. Anal. Biochem. 273, 149155. Havir, E.A., McHale, N.A., 1987. Biochemical and developmental characterization of multiple forms of catalase in tobacco leaves. Plant Physiol. 84, 450455. Hernandez, J.A., Jimenez, A., Mullineaux, P., Sevilla, F., 2000. Tolerance of pea (Pisum sativum L.) to long-term salt stress is associated with induction of antioxidant defences. Plant Cell Environ. 23, 853862. Hong, C.-Y., Hsu, Y.T., Tsai, Y.-C., Kao, C.H., 2007. Expression of ascorbate peroxidase 8 in roots of rice (Oryza sativa L.) seedlings in response to NaCl. J. Exp. Bot. 58, 32733283. Ishikawa, T., Morimoto, Y., Madhusudhan, R., Sawa, Y., Shibata, H., Yabuta, Y., Nishizawa, A., Shigeoka, S., 2005. Acclimation to diverse environmental stresses caused by a suppression of cytosolic ascorbate peroxidase in tobacco BY-2 cells. Plant Cell Physiol. 46, 12641271. Kampfenkel, K., Vanmontagu, M., Inze, D., 1995. Extraction and determination of ascorbate and dehydroascorbate from plant tissue. Anal. Biochem. 225, 165 167. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402408. Locato, V., Gadaleta, C., De Gara, L., De Pinto, M.C., 2008. Production of reactive species and modulation of antioxidant network in response to heat shock: a critical balance for cell fate. Plant Cell Environ. 31, 16061619. Lu, Z.Q., Liu, D.L., Liu, S.K., 2007. Two rice cytosolic ascorbate peroxidases differentially improve salt tolerance in transgenic Arabidopsis. Plant Cell Rep. 26, 19091917.