Romanian Biotechnological Letters Copyright 2010 University of Bucharest

Vol. 15, No.2, 2010 Printed in Romania. All rights reserved ORIGINAL PAPER

Identification of Owenweeksia honkongenesis as a novel organism for the remediation of pesticide-Fenvalerate

Received for publication, August 27, 2009 Accepted, March 20, 2010 HANSA BORICHA AND M H FULEKAR* *Professor, Environmental Biotechnology, Department of life-Sciences, University of Mumbai, Vidyanagari campus, Mumbai 400098 Corresponding author: mhfulekar@yahoo.com

Abstract
In India pesticides are widely used for plant protection in agriculture environment. The residual pesticide in soil has adverse effects on both terrestrial and aquatic ecosystems. The microbial action in natural environment however degrades the pesticides but the rate of degradation is very slow. The identification of potential organisms for bioremediation of pesticides is important to prevent the toxic effect to the human being through the food chain. Therefore, in the present research study 16S rDNA technique has been employed for the identification of potential organism from the microbial consortium. Microbial consortium was exposed to varying concentrations of fenvalerate viz; 10, 25, 50, 75, and 100 ppm using scale up process technique, and found that only one microbial colony was resistant to higher concentration of fenvalerate. The resistant potential microorganism has been characterized by 16S rDNA technique by sequencing and developing Phylogenetic tree and confirming by BLAST tool. The resistant organism was identified as potential organism for the biodegradation of fenvalerate.

Keywords: Pesticide, Fenvalerate, Bioremediation, 16S rDNA technique, Sequencing, BLAST, Phylogenetic tree.

Introduction
India is the largest producer of pesticide and consumer of chemical pesticide in Asia and uses of pesticide continue to increase till the alternate use of chemical pesticide has been found and used effectively for the plant protection in agriculture environment. The data available (WHO) indicates that 2-3% of chemical pesticide is actually used and rest remains in the soil causes surface run-off leading toxicity to both aquatic and terrestrial biota present in the ecosystem [5]. The microbial action in the terrestrial and aquatic environment causes the natural degradation of the pesticide which might convert parent compounds to intermediates or less toxic compounds. However, the natural bioremediation is a slow process and needs to enhance the biodegradation of contaminants in the environment by the action of the potential microorganisms [4]. The microbial consortium adapted in the environment changes their proteomics and genomics character and becomes versatile for the bioremediation of the compounds. In the present research study of isolation of potential microorganism for pesticide bioremediation, the microbial consortium from the animal waste were assessed and exposed to synthetic pyrethroid, in particular fenvalerate at varying concentration viz; 10 ppm, 25 ppm, 50 ppm, 75 ppm and 100 ppm to find out the potentiality of the microorganisms which could survive at higher concentration. The organism which has resisted at higher concentration has been identified by sequencing, developing phylogenetic tree and with Ribosomal Database Project (RDP-II) homology techniques [1]. The potential organism identified serves as the effective biomass for the bioremediation of fenvalerate. 5104

HANSA BORICHA AND M. H. FULEKAR

Materials and Methods

All chemicals, reagents and solvents used were of HPLC grade purchased from Ranbaxy India ltd. Media used for the inoculation techniques were from Hi-media (India). Before the experiment all the glasswares were cleaned by chromic acid and subsequently washed thoroughly and rinsed with double glass distilled water and dried at 110 0C for about 6 hours. Physico-chemical Parameters and Cultural characteristics Technical grade fenvalerate containing 98% active ingredient was purchased from Rallis India. Cow dung sample was collected and used as source of biomass. The sample was immediately processed on the same day and the physico-chemical parameters were studied as per Standard Methods for the Examination of Water and Waste water, 17th edition, APHA (1989)., Table 1. The microbial enrichment technique was started immediately after the collection of the sample.
Table 1. physico-chemical and biological characters of animal waste (cow dung )

Sr. no 1. 2. 3. 4. 6. 7. 8. 9.

Physico-Chemical Parameters of Cowdung Parameter Results pH 7.3 Temperature 280C Moisture Alkalinity/100gm 1.12 meq Cation Exchange capacity/100g % Organic carbon 0.37 COD 230 mg/L BOD 9 mg/L

Development of consortia and screening of isolate The cow dung sample (slurry) was inoculated into flask containing basal medium with fenvalerate as the only carbon source. Sterile FTW medium contained (in g L-1), K2HPO4, 0.225; KH2PO4, 0.225; (NH4)2SO4, 0.225; MgSO47H2O, 0.05; CaCO3, 0.005; and FeCl24H2O, 0.005., [7], blended with 1 mL of the Focht trace element solution (in mg L-1): MnSO4H2O, 169; ZnSO47H2O, 288; CuSO45H2O, 250; NiSO46H2O, 26; CoSO4, 28; and Na2MoO42H2O, 24, pH of minimal medium was adjusted at 7.2 [3]. After five transfers into enrichment media with increasing concentration of fenvalerate viz; 10 ppm, 25 ppm, 50 ppm 75 ppm and 100 ppm, the consortia was isolated and identified and screened for their ability to degrade fenvalerate in basal medium by incubating the shake flasks inoculated with enriched consortia (cfu/ ml) on a rotary shaker (120 rpm) at 280C. Developed consortia were plated on basal agar medium containing 50 ppm fenvalerate as the sole carbon source. Visually distinct colonies were picked up, purified and identified. The total microbial consortium was then used as the inoculums to further identify the potential microorganism for the degradation of fenvalerate. At the higher concentration (100 ppm) only one organism was found to survive. The organism was separated purified and identified by 16S rDNA technique. Molecular characterization of fenvalerate-degrading bacteria The morphology and Gram staining of the isolates was carried out by standard methods [9]. Genomic DNA was isolated by the Sambrook method [10] and amplified with 16S rDNA primers by designing the primer for the consensus region of the bacteria. PCR fragment was then cloned into the pDrivecloning vector [10], transformed into Escherichia coli DH5 [6] and sequenced. The PCR amplification was performed using ABI 2720 model Romanian Biotechnological Letters, Vol. 15, No. 2, 2010 5105

Identification of Owenweeksia honkongenesis as a novel organism for the remediation of pesticide-Fenvalerate

programmed as follows: Initial denaturation for 5 min at 940C, denaturation for 30 sec at 940C, annealing at 550C for 30 sec and extension at 720C for 2 min, final extension 720C for 15 mins and number of cycles 35. Biochemical and Microbial Characteristics Cells possess carotenoid pigments with maximum absorption at 470 nm and two shoulder peaks around 448 nm and 501 nm. Physiological and biochemical properties are listed in Table 4. The cultural characteristics are given in Table 3.
Table 2. Microbes present in animal waste (cow dung) Sr. No 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. Microbial characteristics of Cowdung Genus Observation Fecal Streptococcus sp Present Alcaligens sp. Present Bacillus sp. Present B. stearothermophilus and B.cereus Present Cellulomonas sp. Present Streptococcus sp. Present Sarcina sp. Present Serratia sp. Present Nocardia sp. Present Mucor sp. Present Rhizopus Stolonifer Present Aspergillus sp. Present Penicillium sp. Present

Table 3. Colony characters of Fenvalerate degrading organism. Sr. No 1. 2. 3. 4. 5. 6. 7. 9. 10. Characteristics Size Shape Color Margin Surface Elevation Opacity Consistency Grams Nature Observation 1mm-2mm Circular Pale Entire Glistening Low convex Translucent Butyrous Gram negative coccobacili

Table 4. Biochemical characteristics Sr. no. 1 2 3 4 5 6 7 8 9 10 Tests ONPG Lysine decarboxylase Ornithine Decarboxylase Urease Phenylalanine deamination Nitrate reduction H2S production Alkaline phosphatase Catalase Oxidase Results + + + +

Result and Discussion

The synthetic pyrethroid fenvalerate (cyano (3-phenoxyphenyl)methyl-4-chloro-alpha(1-methylethyl)-benzene acetate) an insecticide of moderate mammalian toxicity [2], is being 5106 Romanian Biotechnological Letters, Vol. 15, No. 2, 2010

HANSA BORICHA AND M. H. FULEKAR

found widely used for the plant protection in agriculture environment [11]. The residual pesticides in the soil come in contact with moisture-water and subjected to surface runoff causing the pollution in the environment. The ecosystem is getting affected due to the presence of residual pesticides in the environment. Therefore, the biodegradation of the pesticides for the protection of the environment is of prime importance. The microorganisms play a vital role to degrade the pesticide and convert the pest to less toxic and environmental friendly compounds. Therefore, animal waste has been used as biomass and assessed for the presence of different microbial consortium. The physico-chemical and biological characteristics studied in animal waste indicates pH (7.3), temperature (28 0C), alkalinity (1.12 meq), organic carbon (0.37), and DO (10 mg), BOD (9 mg/L), COD (230 mg/L). This provides favorable condition for the growth and proliferation of microorganisms. Besides, the value presented in Fig. 1indicates the higher concentration of macro and micro nutrients.

180 160 140 120 100 80 60 40

Fig.1 Macro and micro nutrients in the animal waste (cow dung) in mg/L

Fig. 2. Total microbial count of cow dung

Romanian Biotechnological Letters, Vol. 15, No. 2, 2010

5107

Identification of Owenweeksia honkongenesis as a novel organism for the remediation of pesticide-Fenvalerate

Fig.3 Phylogenetic tree

These macro/micro nutrients support the metabolism of the microorganisms for the growth and multiplication in biomass. The microbial characteristics reveals the presence of Pseudomonas sp., Actinomycetes sp., Enterobactericeae sp., Cellulomonas sp., Fungi, Flavobacterium sp., Streptococcus sp., Salmonella sp., Shigella sp., Bacillus sp., etc. (Table 3). The microbial consortium assessed was subjected to exposure to synthetic pyrethroid fenvalerate at varying concentration viz; 10 ppm, 25 ppm, 50 ppm 75 ppm and 100 ppm in minimal salt medium using scale up process technique and found that only one microbe survived at the higher concentration. The microbial monocolony was sequenced using 16S rDNA sequencing and Phylogenetic tree has been drawn, further bioinformatics tool has been employed for the identification of the organism. The database used for establishing the closest genetic neighbors in this study consisted of 800,159 16S rRNA sequences available in the RDP-II project (release number 10.0) [1]. For creating the phylogenetic tree, Bootstrapping algorithm for statistical re-sampling was used and the bootstrap value that align with a particular phylogenetic topology appear on the nodes of each of the Phylogenetic tree. In the 16S rRNA gene sequencing based microbe identification protocol, the depth up to which a test microbe is identified as a direct factor of the availability of rRNA sequence information of similar or identical microbes available in the database used for the study. The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial and Archaeal small-subunit 16S rRNA sequences along with analysis services and a phylogenetically consistent taxonomic framework for these data. The 16S rRNA gene sequence of strain showed 99.15 % similarity to Owenweeksia hongkongensis, The next closest homologue was found to be Alkaliflexus imshenetskii (accession number AJ784993) and Coenonia anatina (accession number Y17612) Information about other close homologue for the microbe can be found from the alignment view Table 5 . The biochemical analysis has also been carried out for the identification of potential organism. Cells contain oxidase, catalase and alkaline phosphatase. The result finding shows that identified organism is Owenweeksia honkongenesis. This organism has been reported as the novel organism for the bioremediation of high-molecular-mass organic matter in sea water [8]. The bioremediation of fenvalerate using Owenweeksia honkongenesis puts as an effective source of biomass for converting 5108 Romanian Biotechnological Letters, Vol. 15, No. 2, 2010

HANSA BORICHA AND M. H. FULEKAR

parent compound to intermediate which on long term acclimatization will convert into nutrient CO2 and biomass.
Table 5. Hit List:
Sample Gene Bank entry AJ784993 Y17612 AB125062 AJ438176 D14025 % Similarity 99.0 99.0 99.15 99.0 99.0 Domain Phylum Class Order Bacteroid ales Flavobact eriales Bacteroid ales Sphingob acteriales Sphingob acteriales Family Genus Species

BI 3

Bacteria Bacteria Bacteria Bacteria Bacteria

Bacteroidetes Actinobacteria Bacteroidetes Bacteroidetes Bacteroidetes

Bacteroidetes Flavobacteria Bacteroidetes

Sphingobacteria Sphingobacteria

Rikenellaceae
Flavobacteriaceae Cryomorphaceae

Alkaliflexus Coenonia Owenweeksia Sphingobacterium Sphingobacterium

imshenetskii anatina hongkongensis faecium multivorum

Sphingobacteri aceae Sphingobacteri aceae

Table 5. Distance Matrix

1 BI375 2 AB123755 3 AB122734 4 AB122761 5 AB122752 6 AJ391822

1 0.000 0.993 0.914 0.904 0.907 0.078

2 0.993 0.000 0.251 0.231 0.238 0.992

3 0.914 0.251 0.000 0.041 0.045 0.916

4 0.904 0.231 0.041 0.000 0.026 0.907

5 0.907 0.238 0.045 0.026 0.000 0.910

6 0.078 0.992 0.916 0.907 0.910 0.000

Table 5. Sequence BI 3

>BI03R GTAAGGCCTTTCGTGCATCAGCGTCAATACCAGCTTAGTGAGCTGCCTTCGCAAT CGGAGTTCTAAGACATATCTATGCATTTCACCGCTACTTG TCTTATTCCGCCCACTTCAAATGGATTCAAGCCCATCAGTATCAAAGGCACTGCG ATGGTTGAGCCACCGTATTTCACCCCTGACTTAATAGGCC GCCTACGCACCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATT ACCGCGGCTGCTGGCACGGAGTTAGCCGATCCTTATTCTT CCAGTACATTCAGCTAAATACACGTATTTAGGTTTATTCCTGGACAAAAGCAGTT TACAACCCATAGGGCAGTCATCCTGCACGCGGCATGGCTG GTTCAGGCTTCCGCCCATTGACCAATATTCCTTACTGCTGCCTCCCGTAGGAGTCT GGTCCGTGTCTCAGTACCAGTGTGGGGGGATTCTCCTCT CAGAGCCCCTAGACATCGTCGCCTTGGTAAGCCGTTACCCTACCAACTAGCTAAT GTCACGCGAGCCCATCTCTATCCTATAAATATTTTATCAA CCGAACATGCCAACTGTTGATGTTATGCGGTGTTAATCTCTCTTTTCGAGAGGCTA TCCCCCTGATAGAGGAGGTTGCTCACGCGTTACGCACCC GTGCGCCACTCTCACATCTTCGAGCAAGCTCTCGATGGATCCCGTCCGACTTGCAT GTATTAGGCCTGCCGCTAGCGGTCATCCTGAGCAGAATC AAAACATAAA

Conclusion
On the basis of all characteristics viz; phenotypic and genotypic characteristics, biochemicals and phylogenetic position, the strain fen represents a novel species of a new genus, Owenweeksia hongkongensis gen. nov., sp. nov., of the family Cryomorphaceae in the phylum Bacteroidetes. This organism has been reported as the novel organism for the bioremediation of highmolecular-mass organic matter in sea water [8]. Romanian Biotechnological Letters, Vol. 15, No. 2, 2010 5109

Identification of Owenweeksia honkongenesis as a novel organism for the remediation of pesticide-Fenvalerate

Acknowledgement
Authors are thankful to University Grants Commission (UGC), Government of India for granting the Research Fellowship to the first author- Ms. Hansa Boricha.

References
1. COLE J. R., CHAIL B., FARRIA R. J., WANG Q.,. KULAM S. A, et.al (2005). The Ribosomal Database Project (RDP-II):Sequences and tools for high-throughput rRNA analysis. Nucleic Acids Research, Vol. 33, Database issue Oxford University Press. 2. Extoxnet, (1996): Extensive Toxicology Network, Pesticide Information Profiles, www.extoxnet.orst.edu
3. FOCHT, D.D. (1994). Microbiological procedures for biodegradation research. p. 407426. In R.W. Weaver et al. (ed.) Methods of soil analysis. Part 2. SSSA Book Ser. 5. SSSA, Madison, WI.

4. FULEKAR M H (2005a). Bioremediation Technologies for Environment. Indian Journal of Environ. Protection. 25(4): 358 364. 5. FULEKAR M H (2005b). Environmental Biotechnology. Oxford and IBH Publishing House, New Delhi, India. 6. HANAHAN (1983) D. Hanahan, Studies on transformation of Escherichia coli with plasmids, Journal of Molecular Biology 166 (1983), pp. 557580.
7. HERMAN, D.C., and W.T. FRANKENBERGER Jr. (1999). Bacterial reduction of perchlorate and nitrate in water. J. Environ. Qual. 28:10181024.

8. KEN LAU W. K., CONNIE Y. M., JIAMPING REN, et al., (2005). Owenweeksia hongkongensis gen. nov., sp. nov., a novel marine bacterium of the phylum Bacteroidetes., Int J Syst Evol Microbiol 55 (2005), 1051-1057. 9. PELCZAR and REID (1965)., PELCZAR M and REID R Jr., Microbiology (second ed), McGraw-Hill, New York. 10. SAMBROOK et al., and MANIATIS T., (1989) Molecular Cloning: A Laboratory Manual (second ed), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 11. U.S. Environmental Protection Agency and California Department of Pesticide Regulation, (2005): Pesticide Product databases.

5110

Romanian Biotechnological Letters, Vol. 15, No. 2, 2010