1. The document describes the development of novel methods for investigating copy number variation at the human salivary amylase locus.
2. Five assays were developed including two paralogue ratio tests, a microsatellite assay, and two novel non-paralogue ratio tests.
3. Analysis of CEPH families using the microsatellite assay revealed a haploid copy number range of 1-6, providing definitive copy numbers to standardize future work.
Original Description:
Development of Novel methods for measuring AMY1 (Salivary amylase) copy copy number in humans.
1. The document describes the development of novel methods for investigating copy number variation at the human salivary amylase locus.
2. Five assays were developed including two paralogue ratio tests, a microsatellite assay, and two novel non-paralogue ratio tests.
3. Analysis of CEPH families using the microsatellite assay revealed a haploid copy number range of 1-6, providing definitive copy numbers to standardize future work.
1. The document describes the development of novel methods for investigating copy number variation at the human salivary amylase locus.
2. Five assays were developed including two paralogue ratio tests, a microsatellite assay, and two novel non-paralogue ratio tests.
3. Analysis of CEPH families using the microsatellite assay revealed a haploid copy number range of 1-6, providing definitive copy numbers to standardize future work.
Development of novel methods for investigating copy number
variation at the human salivary amylase locus
Sugandha Dhar and John AL Armour School of Biology, The University of Nottingham Background: Copy number variations correspond to the changes (>1 kb) in number of copies of DNA sequences in comparison to a reference chromosome. Located on chromosome 1p 21.1 amylase gene exhibits high copy number variation. In humans, there are two forms of amylase -salivary (AMY1) and pancreatic (AMY2) which catalyse carbohydrate digestion but are expressed in different tissues. Previous investigations reveal that in spite of a 96% AMY1- AMY2 sequence similarity , proviral insertions were responsible for conferring AMY1 tissue specificity. Current research suggests that AMY1 is a copy number variable locus exhibiting 2- 14 copies per diploid genome and has been positively correlated with high starch diet by Perry et al. Previously, two Paralogue Ratio Tests (PRTs) have been constructed taking advantage of the exclusive proviral AMY1 insertions . As proviral elements are scattered throughout the genome therefore eliciting exclusive amplification from just test and reference is theoretically questionable. The main focus of this study was to devise an alternative method which would combine the strengths of PRTs and Real time PCR considering the genomic complexities of AMY1 locus.
Aims: 1. Development of a novel ratio based copy number measurement assay 2. Characterization of sequence level variation by resolving the allelic architecture Methods: We have developed five assays to investigate AMY1 structural variation. Out of the five assays, two comprise the paralogue ratio test (PRT), one is a microsatellite. They are run on the AB13130 as triplex systems and used as copy number measuring tests. The other two are novel methods run as duplex and are used as copy number validation Tests.
Chr 12A ForwardPrimer 5'-3' 12A ReversePrimer 3'-5' AMY1(Test) 244 ATCTAGTCCTTTTCTATCAATG CTTGACAGATGTACTTATTTTCT AMY1 (Ref) 249 ATCTAGTCCTTTTCTATCAATG CTTGACAGATGTACTTATTTTCT 5D 244 ATCTAGTCCTTTTCCATCAATG CTTGACAGATGTACTTATTTTAT 1G 244 ATCTAGTCCTTTTTCATCAATG CTTGACAGATGTACTTATTTTCT 1D 246 ATCTAGTCCTTTTCCATCAATG CTTGACAGATATACTTATTTTTT 6A 247 ATCTAGTCCTTTTCCATCAATG TTTGACAGATGTACTTATTTTCT 4B 243 ATCTAGTCCTTTTCCATCAATG TTTGACAGATGTACTTATTTTCT 4E 237 ATCTAGTCCTTTTCCATCAATG CTTGACAGATATACTTAATTTTT 5B 245 ATCTAGTCCTCTTCCATCAATG TTTGACAGATATACTTATTTTTT Precise placement of primers has a dual function ensuring size differences between Test and Reference amplicons for easier separation and creation of mismatches to other locations in the genome Test copy number variable Reference two copy Results: 3. Non Paralogous Ratio Test (nPRT) nPRT makes use of 2 pairs of 40 bp primers (tailed primers) to amplify 2 regions in the genome (Test and reference) which have similar amplification properties.
A. Segregation derived haploid copy numbers We have measured AMY1 copy number in 10 families of CEPH samples which are also part of the Hap Map project. This was using the MS assay and 12A PRT. CEPH segregation data was obtained from the CEPH genotype database V. 10 and linkage analysis on chromosome 1 was performed using the CHROMPIC option of CRIMAP
B. Selection of reference samples Samples were selected from the segregation pattern deduced from the MS assay. The copy number determined by the MS assay was examined for concordance with the rest of the measurement systems.
AC AB CD AD BD BC 8 7 11 6 4 9 1 2 3 2 2 2 2 1 2 3+2 2+2 3 2 1 1 2 1 1 2+2 2 2 Haplotype B Haplotype B Haplotype B Haplotype D Haplotype D Haplotype D Haplotype A Haplotype A Haplotype A Haplotype C Haplotype C Haplotype C 261 265 265 269 269 269 272 272 A B 269 272 272 276 C D 269 265 265 269 269 269 272 272 A 269 272 272 276 C D 269 265 265 269 269 269 272 272 A 269 272 272 276 C D 269 265 265 261 265 265 B 261 265 265 B Sample Copies (MS) Ratio 12A PRT Ratio 1H PRT Ratio nPRTb Ratio nPRTc 1416_01 1416_11 1416_12 (Father) (Grandfather) (Grandmother) 8 8 8 7.5 7.7 7.9 8.8 9.2 9.4 9.0 10.7 8.4 5.9 6.6 5.2 C. Distribution of measured values
0 2 4 6 8 10 12 14 0 . 7 5
0 . 7 7
0 . 7 9
0 . 8 1
0 . 8 3
0 . 8 5
0 . 8 7
0 . 8 9
0 . 9 1
0 . 9 3
0 . 9 5
0 . 9 7
0 . 9 9
1 . 0 1
1 . 0 3
1 . 0 5
1 . 0 7
1 . 0 9
1 . 1 1
1 . 1 3
1 . 1 5
1 . 1 7
1 . 1 9
1 . 2 1
1 . 2 3
1 . 2 5
1 . 2 7
1 . 2 9
1 . 3 1
1 . 3 3
1 . 3 5
1 . 3 7
1 . 3 9
M o r e
F r e q u e n c y
Value relative to predicted Figure 1: Structural arrangement of AMY1 locus illustrating 8Kb proviral insertions conferring AMY1 tissue specificity. Sequence identity extends beyond 28Kb for the three AMY1 copies. 1. Paralogue ratio test (PRT) Figure 2: PRT takes advantage of paralogous in the genome thereby only one pair of carefully designed primers amplify different sized test and reference amplicons. Figure 3: nPRT eliminates disadvantages of PRT by not relying of paralogous sequences and solves the problems inherent in multiplex PCR. The products generated from the initial 5 cycles are extended by the externally added synthetic primers, one of which is fluorescently labelled which aids in capillary electrophoresis as seen in the trace. Figure 5: The presence of variably sized microsatellite marker within the AMY1 repeat block ensured the development of the MS assay. This microsatellite profiles suggest that this marker is transmitted through generations as seen in CEPH family 1416. A strong correlation was observed between 12A and MS assay. Table 1: Five fold determination of copy number as measured by five independent systems. The DNA samples used two independent sources of origin i.e. HapMap and CEPH Conclusions: A. A novel ratio based assay, Non PRT was developed and successfully used in predicting the AMY1 copy number. B. Segregation analysis in families using the MS assay determined definitive copy numbers which will be used as calibrator standards for future work. C. The MS assay is a robust method to measure AMY1 CNV which substantiates previous evidence. D. As opposed to 2-14 copies, a diploid copy number of 2-16 was observed for HapMap Japanese and a haploid copy number of 1-6 was observed for CEPH families.
Figure 6:Frequency distribution of the ratio of ratios deduced from the MS assay representing the deviation from the expected value for 182 ratios. 90% of the ratios lie within 85% to 115% of the expected value highlighting the accuracy of the assay. Acknowledgements: We would like to thank the University of Nottingham and the International office for funding Sugandhas PhD. Special vote of thanks to Dr Jess tyson for her encouragement and also to the past and present members of C10 Lab. References: 1. Redon et al. (2006) Nature, 444, 444-454 2. Zabel, et al. (1983) PNAS, 80(22), 6932-6936 3. Nishide et al. (1986) Gene, 41, 299-304 4.Perry et al. (2007) Nature Genetics, 39, 1256-1260 5. Ting et al. (1992) Genes & Development, 6, 1457-1465 6. Walker et al. (2009). Genomics, 93, 98-103.
MS CN 12A Ratio 7.22 8.30 11.75 6.31 4.33 9.05 Father Mother Child Child Child Child CEPH family 1416 CEPH collection. 2 1 3 + + 6 copies Triplex system Duplex system 1H Test (chr.1) 1H Reference (chr. 1) 12A Reference (chr. 12) 12A Test (chr. 1) MS assay (chr. 1) Test 1 (chr. 1) Reference 1 and 2 (chr. 11) Test 2 (chr. 1) 1 2 4 5 3 6 2. Microsatellite Assay (MS assay) This assay involves the amplification of microsatellite which vary in their length or number and is spatially contained within the AMY1 ERV thus producing allelic ratios specific to AMY1 copy number.
D. Non conformity between previous published reports and the MS assay.
Our microsatellite measurement assay do not conform with the copy number deduced by Perry et al. This non conformity amounts to approximately one to two integer copies more as measured by our measurement systems. Figure 4: Capillary trace of NA18999 predicting a copy number of six instead of five as predicted by Perry et al. MS assay 1+2+3+2= 2+2+2+1= 2+3+2+2+2= 3+2+1= 1+2+1= 1+2+2+2+2= = systems Measurement 2 pairs of gene specific primers, but if used for too many cycles amplification differences are exacerbated.
So used tailed primers
Quartet of tailed primers used at low concentration, low annealing temperature for 5 cycles.
Addition of primers matching the tails
Test Reference Test chr. 1 Reference chr. 1 Test chr. 1 Reference chr. 12 Microsatellite chr. 1 Test chr. 1 Reference chr. 11 Reference chr. 11 Test chr. 1