Plant Physiology and Biochemistry 83 (2014) 26e31

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry

journal homepage: www.elsevier.com/locate/plaphy

Short communication

Water deficit down-regulates miR398 and miR408 in pea

(Pisum sativum L.)

Zivko c a, *, Nemanja Stanisavljevi
Jovanovi c a, Aleksandar Miki
c b, Svetlana Radovi
c c,
Vesna Maksimovi ca
a
University of Belgrade, Institute of Molecular Genetics and Genetic Engineering, Plant Molecular Biology Lab, P.O.Box 23, 11 010 Belgrade, Serbia
b
Institute of Field and Vegetable Crops, Forage Crops Department, Maksima Gorkog 32, 21 000 Novi Sad, Serbia
c
University of Belgrade, Faculty of Biology, Studentski trg 16, 11 000 Belgrade, Serbia

a r t i c l e i n f o a b s t r a c t

Article history: MicroRNAs (miRNAs), recently recognized as important regulator of gene expression at post-
Received 10 June 2014 transcriptional level, have been found to be involved in plant stress responses. The observation that some
Accepted 8 July 2014 miRNAs are up- or down regulated by stress implies that they could play vital roles in plant resistance to
Available online 16 July 2014
abiotic and biotic stress. We investigated the effect of water stress treatment during 10 days on
expression of conserved miRNAs-miR398a/b and miR408 in pea plants. This time frame reflects the
Keywords:
changes as close as possible to the changes where water stress causes visible effects under field con-
microRNAs
dition. It was observed that dehydration strongly down regulates the expression of both miR398a/b and
miR398
miR408
miR408 in pea roots and shoots. The down-regulation of miR398a/b and the up-regulation of potential
Pisum sativum target genes e copper superoxide dismutase, CSD1, highlight the involvement of this miRNA in pea stress
Water deficit response. To the contrary, the mRNA level of cytochrome c oxidase subunit 5 (COX5b) did not change in
roots and shoots of water-stressed plants, compared to control (well) hydrated plants. This suggests that
COX5b is not the target of miR398, or that its expression is regulated by some other mechanism. P1B-
ATPase expression increased during water deficit only in the shoots of pea; in the roots there were no
changes in expression. Our results help to understand the possible role of investigated miRNAs and their
contribution to pea capacity to cope with water deficit.
© 2014 Elsevier Masson SAS. All rights reserved.

1. Introduction abiotic stress condition (Trindade et al., 2010). MicroRNAs (miR-

As sessile organisms, plants are constantly challenged by a wide
range of environmental stresses, such as drought, salinity, low and
high temperature. Drought and salinity together affect more than
10% of arable land, resulting in more than 50% decline in the
average yields of major crops worldwide (Bray et al., 2000). After
sensing water deprivation, plants respond rapidly; molecular
changes take place very shortly after initial signal, including gene
expression as well as metabolic changes resulting in stress toler-
ance (Agarwal et al., 2006).
MicroRNA-mediated post-transcriptional regulation of gene
expression has recently been associated to plant responses to
Abbreviation: COX5b, cytochrome c oxidase subunit 5; CSD1, cytosolic super-
oxide dismutase; DCFH-DA-20 ,70, Dichlorodihydrofluorescein diacetate; DCF,
dichlorofluorescein; DW, dried weight; LNA, Locked Nucleic Acid; MDA, malon-
dialdehide; miRNA, microRNA; ROS, reactive oxygen species; RWC, relative water
content.
* Corresponding author.
 Jovanovi
E-mail address: zjovanovic@imgge.bg.ac.rs (Z. c).
NAs) are a class of small, non-coding regulatory RNA molecules of
20e24 nucleotides, with the important role in the regulation of
gene expression. Jones-Rhoades and Bartel (2004) describe for the
first time that miRNAs play a crucial role in plant stress responses.
They found the expression of miR395 increased during sulfate
starvation, showing that miRNAs can be induced by environmental
stresses. The expression of several miRNA was also found to be
regulated by different stresses and participated in stress adaptation
(Sunkar et al., 2012). Sunkar and Zhu (2004) cloned the first set of
small RNAs from Arabidopsis seedlings exposed to different abiotic
stresses. They also identified several miRNAs up- or down-
regulated by dehydration, salinity, cold or abscisic acid. The
investigation of miRNAs-miR398a/b and miR408 were well carried
out on model legume Medicago truncatula (Trindade et al., 2010;
Wang et al., 2011). Trindade et al. (2010) showed that these miR-
NAs were up-regulated under water stress condition in
M. truncatula. Kantar et al. (2011) also observed such type of up-
regulation of miR408 in barely leaves after dehydration treatment
for 4 h and 8 h. Jia et al. (2009) also showed up-regulation of

http://dx.doi.org/10.1016/j.plaphy.2014.07.008
0981-9428/© 2014 Elsevier Masson SAS. All rights reserved.
  Jovanovic et al. / Plant Physiology and Biochemistry 83 (2014) 26e31
Z.
miR398a/b under water deficit, ABA and salt treatment. However,
Wang et al. (2011) observed that, in M. trucatula, miR398 was down
regulated by drought. They provided some explanations for such
discovery, starting from different stress treatments and different
time of each treatment (which may vary from few hours to days). In
addition to withholding water supply, in several studies on the
effect of drought on miRNAs plants treated with PEG were used
(Zhao et al., 2007; Liu et al., 2008). Interestingly, miR398a/b and
miR408 have both been predicted to target copper-containing
proteins and they are proposed to be related to copper homeosta-
sis in Arabidopsis thaliana (Yamasaki et al., 2007; Abdel-Ghany and
Pilon, 2008).
Pea (Pisum sativum L.) is the most important legume crop in the
temperate climatic region both for human consumption and animal
feeding. It contains carbohydrates, proteins, fats, minerals, vitamins
in a reasonable amount and water soluble fiber and antioxidants. It
is the 4th most important grain legume crop of the world on the
production basis (Ashraf et al., 2011).
Since there are no data about the role of miRNA in pea stress
response, in order to investigate if miRNA-mediated regulation of
gene expression is involved in pea response to water deficit, we
analyzed the expression of three conserved miRNAs in vegetatively
grown pea plants subjected to progressive water deprivation. We
found that water deficit down-regulates miR398a/b and miR408
expression.
2. Material and methods
2.1. Plant material
Seeds of pea (P. sativum var. sativum cultivar “MRAZ”) were sown
in plastic pots, using commercial available substrate for plants (ecco
humus, Kova cevic) and regularly watered with 200 mL of water.
Plants were grown in the greenhouse of the Institute of Molecular
Genetics and Genetic Engineering in Belgrade, under 16 h photo-
period, 20  C/15  C temperature (day/night) and with a photosyn-
thetic active irradiation of 200 mmol m2 s1. Fifteen-day old pea
plants were subjected to drought stress. Stress treatment was
performed by withholding irrigation for 7 (treatment D1) and 10
days (treatment D2). After 10 days, the stressed plants were
recovered by watering, samples were collected after 24 h (treat-
ment R). After each treatment the shoots and the roots were
collected and immediately frozen in liquid nitrogen and stored
at 70  C for further analyses. Control plants (C) plants were
regularly watered during 10 days, and harvested at the same time
as treatment D1, D2 and R.
2.2. Estimation of water content
Relative water content (RWC) in leaves was determined for each
control and drought treatment and it was calculated according to
formula (Barrs and Weatherley, 1962):
RWC ð%Þ ¼ ½ðfresh weight  dry weightÞ=ðsaturated weight
 dry weightÞ$100
Leaf dry weight (DW) was measured after oven drying at 105  C
for 24 h, and the saturated weight was measured after incubation of
the leaves in moist filter paper for 24 h in Petri dishes at room
temperature.
2.3. Lipid peroxidation assay
The level of lipid peroxidation was determined by measuring
the amount of malondialdehyde (MDA) produced by the
27
thiobarbituric acid reaction as described by (Heath and Packer,
1986). The crude extract was mixed with the same volume of
0.5% (w/v) thiobarbituric acid solution containing 20% (w/v) tri-
chloroacetic acid. The mixture was heated at 95  C for 30 min and
then quickly cooled in an ice-bath. After centrifugation at 3.500  g
for 10 min, the absorbance of the supernatant was monitored at
532 nm. The MDA content was expressed as nmol MDA/DW.
2.4. Analysis of reactive oxygen species (ROS)
20 ,70 -Dichlorodihydrofluorescein diacetate (DCFH-DA) has been
used as a molecular probe for ROS levels in the cell (Alln and Fluhr,
1997; Collen and Davison, 1997). Every single leaves was incubated
in a tube containing 10 mL of buffer (Tris 10 mM, KCl 50 mM pH 7.2,
and 5 mL of 100 mM DCFH-DA dissolved in dimethyl sulfoxide), and
kept in a dark for 15 min at 25  C. The sample was quickly washed
with loading buffer, homogenized in liquid nitrogen, extracted in
4 mL of loading buffer and centrifuged for 10 min at 20,817  g and
4  C. Supernatant was transferred to another tube and volume was
recorded. The fluorescence was detected using excitation filter of
488 nm and emission filter of 525 nm in VERSA FLUOR fluorimeter
(BIORAD). The blank (loading buffer without shoot addition) was
subtracted from each sample. Finally, dichlorofluorescein (DCF)
content was expressed according to standard DCF concentration
curve, in nmol min1 g DW.
2.5. RNA isolation and small RNA hybridisation
Total RNA was isolated according to van Kan et al. (1992) using
GHME buffer (8 M guanidine hydrochloride, 20 mM MES, 20 mM
EDTA, 2% b-mercaptoethanol, pH 7.0) and phenol:-
chloroform:isoamilic alcohol (25:24:1, by vol.). RNA was precipi-
tated on 80  C for 1 h with 2 volumes of cold absolute ethanol
supplemented with 1/20 volumes of 4 M Na-acetate (pH 5.2), and
resuspend in 100 mL RNase free water. 15 mg of total RNA was
separated in a 15% polyacrilamide gel with 7 M urea, in MOPS buffer
(pH 7.0), along with the microRNA marker (New England Biolabs,
Ipswich, UK). Small nuclear RNA U6 was used as a loading control.
The samples were electroblotted using Biometra semy-dry system
to a Hybond-NX membrane (GE Healthcare, Piscataway, NJ, USA).
Transferred RNA was chemically crosslinked with soluble EDC and
1-methylimidazole, according to Pall et al. (2007). Locked Nucleic
Acid (LNA) probes (Exiqon, Vedbaek, Denmark) were end-labelled
with gP32-ATP (PerkinElmer, Waltham, MA, USA) for 1 h at 37  C,
using T4 polynucleotide kinase (ThermoScientific, Lithwania), ac-
cording the manufacturer's instruction. Unincorporated radioiso-
tope was removed using Ilustra G-25 MicroSpin columns (GE
Healthcare). Hybridisations were carried out at 42  C overnight in
ULTRAhyb-Oligo buffer (Ambion, Austin, TX, USA). Membranes
were washed at 42  C using 2xSSC þ 0.1% SDS solution, until
radioactivity was reduced to less then 300 cpm. Blots were visu-
alized after 7 days of exposure. The membranes were stripped by
incubation in boiled 0.1% SDS solution and hybridised to the U6
probe, following the procedure describe above, with the exception
that temperature for hybridisation and washing was 37  C. The
accumulation of miRNAs was quantified according to U6 snRNA
loading control and normalised to control condition.
2.6. cDNA synthesis and quantitative real time PCR
The integrity of isolated RNA was checked on formaldehyde 2%
(w/v) agarose gel and spectrophotometrically. To avoid any
genomic DNA (gDNA contamination), total RNA was treated with
DNAfree (Ambion, USA), according to manufacturer's instruction.
Absence of genomic DNA in RNA samples were tested before
28  Jovanovic et al. / Plant Physiology and Biochemistry 83 (2014) 26e31
Z.

Table 1
Primers used for quantitative real time PCR.

Gene Forward (50 e30 ) Reverse (30 e50 )

CSD1 AGTCAGGAGGGAAATGGTCC AAACTACTGGAAATGCTGGT

COX5b AGCTGCTTCGGTCAAAAAGA ACAGCAGGTGCGTCCTTAGT
P1B-ATPase GAGACAGGGAAGAAGCAGTTG CCATCGCAACATGATGTCCAG

reverse transcription by PCR using primers design to amplify the

111 bp intron fragment of phospolipase C gene (PLC), according to
Die et al. (2010). Total RNA (1 mg) was reverse transcribed using
RevertAid reverse transcriptase (ThermoScientific, Lithuania), ac-
cording the manufacture's protocol, using random hexamers.
The Real time quantitative RT-PCR amplification of selected
target genes was performed using the first strand cDNA, synthe-
sized from RNA samples collected from control (unstressed) and
Fig. 2. Effect of water stress treatment on DCF production rate in P. sativum leaves. C
plants exposed to different level of dehydration, as well as to re-
control; D1- dehydrated for 7 days; D2- dehydrated for 10 days; R-rehydrated plants.
covery. Polymerase chain reactions were performed in a 96-well DCF production rate is expressed as nM min1 per g of dried weight
plate with ABI PRISM 7500 (Applied Biosystem, USA), using SYBR- (nM min1 g1 DW) ± SE based on three independent experiments. Significant dif-
GREEN based technology. As reference gene, we used b-tubulin ferences are indicated for p  0.01 (*).
(Die et al., 2010). For each PCR reaction a final volume of 20 mL was
used, containing 1 mL of cDNA (50 ng coming from RNA reverse
transcribed), 10 mL of 2x SYBR GREEN Mix (Applied Biosystem, USA)
and 1 mL of each forward and reverse primers (Table 1). Universal
thermal cycling condition were used. At the end of PCR cycles, the
products were analysed through a meltcurve analysis to check the
specificity of PCR amplification. Three replicate of each reaction
were performed, and data were analyzed by Livak method (Livak
and Schmittgen, 2001) and expressed as normalized expression
ratio (2DDCt) of genes to specific stress treatment.

2.7. Statistical analysis

Data of ten plants each for control (unstressed) and dehydrated,
as well as recovered plants were collected in three independent
experiments. All data obtained were subjected to statistical analysis
by the Sigma stat program. Comparisons with p < 0.05 were
considered significantly different. In all the figures, the spread of
values is shown as error bars representing standard errors of the
means.
3. Results and discussion
Fig. 3. Effect of water stress treatment on MDA content in P. sativum leaves. C control;
D1- dehydrated for 7 days; D2- dehydrated for 10 days; R-rehydrated plants. MDA
content is expressed as nM per g of dried weight (nM g1DW) ± SE based on three
independent experiments. Significant differences are indicated for p  0.01 (*).
gradually decreased RWC during first 7 days of treatment, and more
intensely during the second phase of treatment. However, after re-
watering, plants restored their RWC, nearly to the level observed in
control plants. Dehydration, but also re-watering of plants caused

The dehydration stressed pea plants exhibited strongly reduced

relative water content (Fig. 1). It is evident that applied treatment

Fig. 4. Expression patterns of conserved miRNAs in Pisum sativum plants. Northern-

Fig. 1. Changes of the relative water content (RWC) in leaves of Pisum sativum plants
subjected to water stress treatment. C control; D1- dehydrated for 7 days; D2- dehy-
drated for 10 days; R-rehydrated plants. Data points represent the average of three
independent measurements ± standard errors based on three replicates.
blot analysis of P. sativum plants subjected to progressive water deficit revealed dif-
ferences in the expression levels of miRNAs (a-miR398a; b-miR398b; c-miR408).
Shoots and roots were analysed s in control conditions (C), moderate water deficit (D1),
severe water deficit (D2) and recovery (R). (m) microRNA size marker from New En-
gland Biolabs (the darker bands correspond to 24 and 21 nt). Small nuclear RNA U6 was
used as a loading control (d). The accumulation of all miRNAs was quantified according
to U6 snRNA loading control.
  Jovanovic et al. / Plant Physiology and Biochemistry 83 (2014) 26e31
Z. 29

augmentation of total ROS in leaves (Fig. 2). The most prominent
accumulation of reactive oxygen species was observed in phase 2 of
dehydration (D2), when the level of ROS was more then 5-fold
higher than in control plants regularly watered. After rehydration,
the plants still accumulated ROS, but the level was slightly higher
than that in control plants. Accumulation of reactive oxygen species
caused the augmentation in membrane lipid peroxidation, showing
similar pattern as ROS accumulation (Fig. 3).
3.1. Analysis of miRNA expression profile in water deficit
The expression profiles of three conserved miRNAs e miR398a,
miR398b and miR408 e were determined, using the northern blot
procedure (Fig. 4). Having in mind the synteny between pea and
M. truncatula (Young and Cook, 2004), we used a probe designed
according to M. truncatula miRNA. In addition, bioinformatic anal-
ysis revealed that these miRNAs are well conserved, so it is possible
to use a probe designed for one plant for detection on another one.
The expression analysis of pea miRNAs was carried out using the
shoots and roots of plants grown in the greenhouse, and the water-
stress treatment took 10 days. These conditions probably prevented
the evaluation of molecular pattern at earlier stages in the stress
response, but we were interested in relating changes in gene
expression during a time frame that reflects as closely as possible
those time frames during which water stress starts having visible
effects under field condition.

Fig. 5. Relative expression level of CSD1 (A and B), COX5b (C and D) and P1B-ATPase (E) in roots (B and D) and shoots (A, C and E) of control and water stressed P. sativum plants. C
control; D1- dehydrated for 7 days; D2- dehydrated for 10 days; R-rehydrated plants. Data points represent the average of three independent experiments ± standard errors based
on three replicates. Significant differences are indicated for p  0.01 (*).
30  Jovanovic et al. / Plant Physiology and Biochemistry 83 (2014) 26e31
Z.
Recent investigations suggested that the expression of these
miRNAs was strongly induced by water deficit in Arabidopsis and
M. truncatula (Trindade et al., 2011). Using LNA probes for northern
blot analysis we detected that all investigated miRNAs (miR398a/b
and miR408) had the same profile of expression in pea roots and
shoots. The profile in drought stressed plants differed from that in
well-watered control plants (Fig. 4). The high level of expression
was observed in non-stressed plants, both in shoots and roots. With
water deficit treatment, the expression level was reduced, even in
recovered plants and shoots. At first, these results were unex-
pected, having in mind the literature data explaining that these
miRNAs were up-regulated under water stress condition (Trindade
et al., 2010; Zhu et al., 2011). Kantar et al. (2011) also observed such
type of up-regulation of miR408 in barley leaves after dehydration
treatment for 4 h and 8 h. Jia et al. (2009) also showed up-
regulation of miR398a/b under water deficit, ABA and salt treat-
ment. In contrast, Wang et al. (2011) observed that, in M. truncatula,
miR398 was down regulated by drought. This discrepancy could be
explained by different stress treatments. In our study, similarly to
the one performed by Wang et al. (2011), drought stressed samples
were collected after exposing plants to drought for varying periods
(7 and 10 days of withholding water), thus our samples included
plant materials suffering from a wide range of drought stress
(Zheng et al., 2004; Gazendam and Oelofse, 2007). However, it is
difficult to compare the natural drought stress (occurring in the
soil) with PEG or mannitol induced osmotic stress, as these treat-
ments may differ in induction of water stress, in terms of rapidity
and severity (Wang et al., 2011).
3.2. Analysis of miRNA target gene expression in water deficit
conditions
In order to analyse whether the expression of investigated
miRNAs has an effect on their target transcript abundance, quan-
titative real time PCR was performed, using RNA from roots and
shoots of control and water deficit-treated pea plants.
The target of miR398 are two Cu/Zn SODs (cytosolic and chlo-
roplast); miR398 expression was reported to be transcriptional
down-regulated by oxidative stress (Sunkar et al., 2006). Quanti-
tative real time PCR analysis of cytosolic superoxide dismutase 1
(CSD1) revealed that the expression is altered by water-deficit
treatment in pea plants. It was up-regulated by water deficit in
both shoots and roots (Fig. 5A and B), which would lead to an in-
crease in the activity of SOD. The increase in expression seems to
inversely correlate with miR398a/b down-regulation during water
deficit and recovery. Such down regulation of miR398 in pea is
consistent with the results obtained on maize (Wei et al., 2009;
Wang et al., 2011), but it is in contrast with the results reported
by Trindade (2011) and Kantar et al. (2011). This could result from
differences in investigated species, extent and duration of drought
stress in these studies. However, the expression profile of CSD1
suggests that this gene is regulated by miR398, having in mind that
its expression is inversely correlated with miR398 expression. In
addition, the level of lipid peroxidation and the total amount of ROS
(Figs. 2 and 3) indicate the existence of oxidative stress in pea plants
subjected to water deficit, so it is not unexpected that the expres-
sion of superoxide dismutase is induced by such kind of treatment.
Sunkar et al. (2006) propose the role of miR398 in oxidative
stress attenuation. The mRNA level of cytochrome c oxidase subunit
5 (COX5b), potential target gene for miR398b, was not changed
in roots and shoots of drought-stressed plants (Fig. 5C and D),
compared to well hydrated plants (C). This suggests that COX5b is
not the target of miR398, or that its expression is regulated by some
other mechanism. Interestingly, miR398a/b and miR408 have both
been predicted to target copper-containing proteins and they are
proposed to be related to copper homeostasis in A. thaliana
(Yamasaki et al., 2007; Abdel-Ghany and Pilon, 2008). These au-
thors assume that, under limited copper supply, plants could
down-regulate the expression of CSD1 and COX5b. However, there
are no data about copper homeostasis in pea plants subjected to
such kind of treatment. Furthermore, in the potential target for
miR408, P1B-ATPase, the mRNA level changed only in the shoots of
treated plants (Fig. 5E). Obviously, this target gene might be regu-
lated by miR408, but further and deeper analysis is required. These
two miRNA families, with miR397 and miR857, are now called
copper-miRNAs (Burkhead et al., 2009) and they are proposed to
down-regulate less essential copper proteins as a mechanism to
save copper for plastocyanin (Yamasaki et al., 2007; Abdel-Ghany
and Pilon, 2008).
4. Conclusion
Presented data suggest that it is of interest to further examine
the connection between P. sativum responses to water deficit (un-
der conditions similar to the field ones), miRNA regulation, and
possibly metal, especially copper homeostasis. Our results could
help to understand the possible role of investigated miRNAs and
their contribution to pea capacity to cope with water deficit. An
investigation on other pea cultivars, especially wild pea, will pro-
vide further insight.
Acknowledgments
This work was supported by The Ministry of Education, Science
and Technological Development of Republic of Serbia, Grants No.
173005 and SEE ERA NET Project 168-SEELEGUMES. We are
extremely grateful to prof. Ivana Bosi
c for language editing of the
 is grateful to dr Pedro Fevereiro (ITQB, Portugal)
manuscript. Z.J.
and to dr Ines Trindade and Claudio Capitao for northern blot
training. This part was realized in the frame of Serbian-Portugal
bilateral cooperation, project leader dr Pedro Fevereiro and dr
Mira Milisavljevi
c.
Contributions
 S.R. and V.M. designed research, A.M. provided plant ma-
Z.J.,
 and N.S., N.S. performed
terial and established treatment with Z.J.
biochemical analyses.
References
Abdel-Ghany, S.E., Pilon, M., 2008. MicroRNA-mediated systemic down-regulation
of copper protein expression in response to low copper availability in Arabi-
dopsis. J. Biol. Chem. 283, 15932e15945.
Agarwal, P.K., Agarwal, P., Reddy, M.K., Sopory, S.K., 2006. Role of DREB transcription
factors in abiotic and biotic stress tolerance in plants. Plant Cell Rep. 25,
1263e1274.
Alln, A.C., Fluhr, R., 1997. Two distinct sources of elicited reactive oxygen species in
tobacco epidermal cells. Plant Cell 9, 1559e1572.
Ashraf, M., Pervez, M., Amjad, M., Ahmad, R., Ayub, M., 2011. Qualitative and
quantitative response of pea (Pisum sativum L.) cultivars to judicious applica-
tions of irrigation with phospohorous and potassium. Pak J. Life Soc. Sci. 9,
1159e1164.
Barrs, H.D., Weatherley, P.E., 1962. A re-examination of the relative turgidity tech-
nique foe estimating water degicits in leaves. Aust. J. Biol. Sci. 15, 413e428.
Bray, E.A., Bailey-Seres, J., Weretilnyk, E., 2000. Responses to abiotic stresses. In:
Buchanan, B.B., Gruissem, W., Jones, R.L. (Eds.), Biochemisry and Molecular
Biology of Plants. American Society of Plant Biologists, Rockville, MD,
pp. 1158e1203.
Burkhead, J.L., Reynolds, K.A.G., Abdel-Ghany, S.E., Cohu, C.M., Pilon, M., 2009.
Copper homeostasis. New Phytol. 182, 799e816.
Collen, J., Davison, I.R., 1997. In vivo measurement of active oxygen production in
the brown alga Fucus evanescens using 20 ,70 -dichlorohydrofluorescein diacetate.
J. Phycol. 33, 643e648.
  Jovanovic et al. / Plant Physiology and Biochemistry 83 (2014) 26e31
Z.
Die, J.V., Roman, B., Nadal, S., Gonzales-Verdejo, C., 2010. Evaluation of candidate
reference genes for expression studies in Pisum sativum under different
experimental conditions. Planta 232, 145e153.
Gazendam, I., Oelofse, D., 2007. Isolation of cowpea genes conferring drought
tolerance: construction of a cDNA drought expression library. Water SA 33,
387e391.
Heath, R.L., Packer, L., 1986. Photoperoxidation in isolated chloroplasts. I. Kinetics and
stoichiometry of fatty acid peroxidation. Arch. Biochem. Biophys. 125, 189e198.
Jia, X., Wang, W.X., Ren, L.G., Chen, Q.G., Mendu, V., Willcut, B., Dinkins, R.,
Tang, X.Q., Tang, G.L., 2009. Differential and dynamic regulation of miR398 in
response to ABA and salt stress in Populus tremula and Arabidopsis thaliana.
Plant Mol. Biol. 71, 51e59.
Jones-Rhoades, M.W., Bartel, D.P., 2004. Computational identification of plant
microRNAs and their targets, including a stress-induced miRNA. Mol. Cell 14,
787e799.
Kantar, M., Lucas, S.J., Budak, H., 2011. miRNA expression patterns of Triticum
dicoccoides in response to shock drought stress. Planta 233, 471e484.
Liu, H.H., Tian, X., Li, Y.J., Wu, C.A., Zheng, C.C., 2008. Microaaray-based analysis of
stress-regulated microRNAs in Arabidopsis thaliana. RNA 14, 836e843.
Livak, K., Schmittgen, D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2DDCt method. Methods 25, 402e408.
Pall, G.S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A., 2007. Carbodiimide-
mediated cross-linking of RNA to nylon membranes improves the detection of
siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60.
Sunkar, R., Li, Y.F., Jagadeeswaran, G., 2012. Functions of microRNAs in plant stress
responses. Trends Plant Sci. 17, 196e203.
Sunkar, R., Kapoor, A., Zhu, J.K., 2006. Posttranscriptional induction of two Cu/Zn
superoxide dismutase genes in Arabidopsis is mediated by downregulation of
miR398 and important for oxidative stress tolerance. Plant Cell 18, 2051e2065.
31
Sunkar, R., Zhu, J.K., 2004. Novel and stress-regulated microRNAs and other small
RNAs from Arabidopsis. Plant Cell 16, 2001e2019.
Trindade, I., Capitao, C., Dalmay, T., Fevereiro, M.P., Santos, M.D., 2010. miR398 and
miR408 are up-regulated in response to water deficit in Medicago truncatula.
Planta 231, 705e716.
van Kan, J.A.L., Joosten, M.H.A.J., Wagemakers, C.A.M., van den Berg-Velthuis, G.C.M.,
de Wit, P.J.G.M., 1992. Differential accumulation of mRNAs encoding extracel-
lular and intracellular PR proteins in tomato induced by virulent and avirulent
races of Cladosporium fulvum. Plant Mol. Biol. 20, 513e517.
Wang, T., Chen, L., Zhao, M., Tian, Q., Zhang, W.H., 2011. Identification of drought-
responsive microRNAs in Medicago truncatula by genome-wide high
throughput sequencing. BMC Genomics 12, 367.
Wei, L.Y., Zhang, D.F., Xuang, F., Zhang, Z.X., 2009. Differentially expressed miRNAs
potentially involved in the regulation of defense mechanism to drought stress
in maize seedlings. Int. J. Plant Sci. 170, 979e989.
Yamasaki, H., Abdel-Ghany, S.E., Cohu, C.M., Kobayashi, Y., Shikanai, T., Pilon, M.,
2007. Regulation of copper homeostasis by micro-RNA in Arabidopsis. J. Biol.
Chem. 282, 16369e16378.
Young, N., Cook, D., 2004. Estimating genome conservation between crop and
model legume species. Prot. Nac. Acad. U S A 43, 15289e15294.
Zhao, B., Liang, R., Ge, L., Li, W., Xiao, H., Lin, H., Ruan, K., Jin, Y., 2007. Identification
of drought-induced microRNAs in rice. Biochem. Biophys. Res. Commun. 354,
585e590.
Zheng, J., Zhao, J., Tao, Y., Wang, J., Liu, Y., Fu, J., Jin, Y., Gao, P., Zhang, J., Bai, Y., et al.,
2004. Isolation and analysis of water stress induced genes in maize seedlings by
subtractive PCR and cDNA macroarray. Plant Mol. Biol. 55, 807e823.
Zhu, C., Ding, Y., Liu, H., 2011. MiR398 and plant stress responses. Physiol. Plant 143,
1e9.