Dionisio, E Et Al 2013., REv Inst Med Trop SP PDF

I
ISSN 0036-4665
ISSN 1678-9946 on line
Established: 1959.
The year 2013 is the 54
th
anniversary
of continuous publication
UNIVERSIDADE DE SO PAULO - BRAZIL
FACULDADE DE MEDICINA
Instituto de Medicina Tropical de So Paulo
Director: Prof. Dr. Paulo C. Cotrim
EDITOR-IN-CHIEF EMERITUS EDITORS
Prof. Dr. Thales F. de Brito Prof. Dr. Luis Rey (Founding Editor)
Associate Editors: Prof. Dr. Pedro Paulo Chief Prof. Dr. Carlos da Silva Lacaz
Prof. Dr. Thelma S. Okay
EDITORIAL BOARD
Alan L. de Melo (Belo Horizonte, MG)
Alberto Duarte (S. Paulo, SP)
Angela Restrepo M. (Medellin, Colombia)
Anna Sara S. Levin (S. Paulo, SP)
Antonio A. Barone (S. Paulo, SP)
Antonio Carlos Nicodemo (S. Paulo, SP)
Antonio Sesso (S. Paulo, SP)
Antonio W. Ferreira (S. Paulo, SP)
Barnett L. Cline (New Orleans, USA)
Carlos F. S. Amaral (Belo Horizonte, MG)
Celso Granato (S. Paulo, SP)
Cesar A. Cuba Cuba (Braslia, DF)
Csar Naquira V. (Lima, Peru)
Clarisse M. Machado (S. Paulo, SP)
Claudio S. Pannuti (S. Paulo, SP)
Cludio Santos Ferreira (S. Paulo, SP)
Dalton L. F. Alves (Belo Horizonte, MG)
Eridan Coutinho (Recife, PE)
Ernesto Hofer (Rio de Janeiro, RJ)
Euclides A. Castilho (S. Paulo, SP)
Eufrosina S. Umezawa (S. Paulo, SP)
Fan Hui Wen (S. Paulo, SP)
Fernando A. Corra (S. Paulo, SP)
Fernando Montero-Gei (San Jos, Costa Rica)
Flair J. Carrilho (S. Paulo, SP)
Gil Benard (S. Paulo, SP)
Gioconda San-Blas (Caracas, Venezuela)
Govinda Visvesvara (Atlanta, USA)
Heitor F. Andrade Jr. (S. Paulo, SP)
Henrique L. Lenzi (Rio de Janeiro, RJ)
Hiro Goto (S. Paulo, SP)
Ises A. Abrahamsohn (S. Paulo, SP)
Joo Carlos Pinto Dias (Belo Horizonte, MG)
Joo Renato Rebello Pinho (Sao Paulo, SP)
Jos Eduardo Levi (S. Paulo, SP)
Jos M. R. Zeitune (Campinas, SP)
Julia Maria Costa-Cruz (Uberlndia, MG)
Julio Litvoc (S. Paulo, SP)
Luiz Carlos Severo (P. Alegre, RS)
Luiz Jacintho da Silva (Campinas, SP)
Luiz T. M. Figueiredo (Rib. Preto, SP)
Lygia B. Iversson (S. Paulo, SP)
Marcello Fabiano de Franco (S. Paulo, SP)
Marcos A. Rossi (Ribeiro Preto, SP)
Marcos Boulos (S. Paulo, SP)
M. A. Shikanai-Yasuda (S. Paulo, SP)
Maria I. S. Duarte (S. Paulo, SP)
Maria L. Higuchi (S. Paulo, SP)
Mario Mariano (S. Paulo, SP)
Mirian N. Sotto (S. Paulo, SP)
Moiss Goldbaum (S. Paulo, SP)
Moyss Mincis (S. Paulo, SP)
Moyss Sadigursky (Salvador, BA)
Myrthes T. Barros (S. Paulo, SP)
Nilma Cintra Leal (Recife, PE)
Paulo C. Cotrim (So Paulo, SP)
Paulo M. Z. Coelho (Belo Horizonte, MG)
Regina Abdulkader (S. Paulo, SP)
Ricardo Negroni (B. Aires, Argentina)
Robert H. Gilman (Baltimore, USA)
Roberto Martinez (Rib. Preto, SP)
Semramis Guimares F. Viana (Botucatu, SP)
Silvino A. Carvalho (S. Paulo, SP)
Silvio Alencar Marques (Botucatu, SP)
Sumie Hoshino-Shimizu (S. Paulo, SP)
Tsutomu Takeuchi (Tokyo, Japan)
Venncio A. F. Alves (S. Paulo, SP)
Vicente Amato Neto (S. Paulo, SP)
Zilton A. Andrade (Salvador, BA)
Executive Board - Librarians: Maria do Carmo Berthe Rosa; Sonia Pedrozo Gomes; Maria ngela de Castro Fgaro Pinca; Carlos Jos Quinteiro
The Revista do Instituto de Medicina Tropical de So Paulo is abstracted and/or indexed in: Index Medicus, Biological Abstracts,
EMBASE/Excerpta Medica, Hepatology/Rapid Literature Review, Tropical Diseases Bulletin, Referativnyi Zhurnal: All-Russian Institute
of Scientic and Technical Information (VINITI), Peridica - ndice de Revistas Latinoamericanas en Ciencias, Helminthological Abstracts,
Protozoological Abstracts, Review of Medical and Veterinary Mycology, PubMed, UnCover, HealthGate, OVID, LILACS, MEDLINE,
New Jour, ExtraMED, Free Medical Journals, ISI (Institute for Scientic Information), BIOSIS Previews, Scopus, Science Citation
Index Expanded (SciSearch), Journal Citation Reports/Science Edition, Current Contents/Clinical Medicine and Index Copernicus.
ON LINE ACCESS - http://www.imt.usp.br/portal/ - FREE PDF ACCESS TO ALL PAST ISSUES, 1959-1989 (Financial
support by Alves de Queiroz Family Fund for Research).
http://www.scielo.br/rimtsp - FULL TEXT, SINCE 1984. E-mail: revimtsp@edu.usp.br
Reprints may be obtained from Pro Quest Inf. and Learning, 300 North Zeeb Road, Ann Arbor, Michigan 48106-1346 - USA.
The Revista do Instituto de Medicina Tropical de So Paulo is supported by: Fundao de Amparo Pesquisa do Estado de So Paulo
(FAPESP), Conselho Nacional de Desenvolvimento Cientco e Tecnolgico (CNPq), Universidade de So Paulo and Coordenao
de Aperfeioamento de Pessoal de Nvel Superior (CAPES).
This issue was nanced by: CNPq Proc. 403851/2012-2.
Desktop Publishing by: Hermano - e-mail: hermano@nextis.com. Phone: 55.11.5571-8937. - Printed by: Elyon Indstria Grca,
Phone: 55.11.3783-6527. English Revision: global@globaltranslations.com.br
II
The purpose of the Revista do Instituto de Medicina Tropical de So Paulo (Journal of the
So Paulo Institute of Tropical Medicine) is to publish the results of researches which contri-
bute signicantly to knowledge of all transmissible diseases.
REVISTA DO INSTITUTO DE MEDICINA TROPICAL DE SO PAULO
(JOURNAL OF THE S. PAULO INSTITUTE OF TROPICAL MEDICINE).
So Paulo, SP-Brasil, 1959 -
v. ilust. 28 cm
1959-2013, 1-55
1973-2002 (supl. 1-12)
2003 (supl. 13 - on-line only)
2005-2012 (supl. 14-18)
ISSN 0036-4665
III
Rev. Inst. Med. Trop. Sao Paulo Vol. 55 No. 6 P. 371-440 November-December, 2013
ISSN 0036-4665
ADDRESS
INSTITUTO DE MEDICINA TROPICAL DE SO PAULO
Av. Dr. Enas de Carvalho Aguiar, 470
05403-000 So Paulo, SP - Brazil
Phone/Fax: 55.11.3062.2174; 55.11.3061-7005
e-mail: revimtsp@edu.usp.br
SUBSCRIPTIONS
FOREIGN COUNTRIES
One year (six issues) ........ U$ 200.00
Single issue ...................... U$ 50.00
CONTENTS
MYCOLOGY
First report on Cryptococcus neoformans in pigeon excreta from public and residential locations in the metropolitan area of Cuiab,
State of Mato Grosso, Brazil - D.T. TAKAHARA, M.S. LAZRA, B. WANKE, L. TRILLES, V. DUTRA, D.A.J. PAULA, L. NAKAZATO,
M.C. ANZAI, D.P. LEITE JNIOR, C.R. PAULA & R.C. HAHN ...............................................................................................................................371
Distribution of dermatophytes from soils of urban and rural areas of cities of Paraiba State, Brazil - Z.B.V.S. PONTES, A.C. OLIVEIRA,
F.Q.S. GUERRA, L.R.A. PONTES & J.P. SANTOS .....................................................................................................................................................377
Molecular typing of Candida albicans isolates from hospitalized patients - P.S. BONFIM-MENDONA, A. FIORINI,
C.S. SHINOBU-MESQUITA, L.C. BAEZA, M.A. FERNANDEZ & T.I.E. SVIDZINSKI ..........................................................................................385
LEISHMANIASIS
Applicability of kDNA-PCR for routine diagnosis of American tegumentary leishmaniasis in a tertiary reference hospital -
M.M. SATOW, E.H. YAMASHIRO-KANASHIRO, M.C. ROCHA, L.K. OYAFUSO, R.C. SOLER, P.C. COTRIM & J.A.L. LINDOSO ................393
PCR
Comparison of six commercially-available DNA polymerases for direct PCR - M. MIURA, C. TANIGAWA, Y. FUJII & S. KANEKO ...................401
PHLEBOTOMINES
Phlebotomine sandies in rural locations in the state of Parana, Southern Brazil - S.C.C.S. MELO, W. CELLA, R. MASSAFERA,
N.M.M.G. SILVA, R. MARQUI, M.D.B. CARVALHO & U. TEODORO ....................................................................................................................407
PARASITOLOGY
Potentially pathogenic free-living amoebae in some ood-affected areas during 2011 Chiang Mai ood - A. WANNASAN,
P. UPARANUKRAW, A. SONGSANGCHUN & N. MORAKOTE ..............................................................................................................................411
MICROBIOLOGY
Smqnr variants in clinical isolates of Stenotrophomonas maltophilia in Brazil - J.I. GRACIA-PAEZ, J.R. FERRAZ,
I.A. FRANA E SILVA, F. ROSSI, A.S. LEVIN & S.F. COSTA ..................................................................................................................................417
BRIEF COMMUNICATION
Ovicidal effect of Piperaceae species on Biomphalaria glabrata, Schistosoma mansoni host - L.N. RAPADO,

P.O.M. LOPES,
L.F. YAMAGUCHI

& E. NAKANO ...............................................................................................................................................................................421
CASE REPORT
Case study of a patient with HIV-AIDS and visceral leishmaniasis co-infection in multiple episodes - E.D. SILVA, L.D. ANDRADE,
P.S.R. ARAJO, V.M. SILVEIRA, C.E. PADILHA, M.A.L. SILVA & Z.M. MEDEIROS ...........................................................................................425
Usefulness of kDNA PCR in the diagnosis of visceral leishmaniasis reactivation in co-infected patients - A.C. NICODEMO, V.S. AMATO,
F.F. TUON, R.M. SOUZA, T.S. OKAY & L.M.A. BRAZ .............................................................................................................................................429
LETTERS TO THE EDITOR
Differential diagnosis of respiratory viruses by using real time RT-PCR methodology - R.S. PAULINO, M.A. BENEGA, K.C.O. SANTOS,
D.B.G. SILVA, J.C. PEREIRA, N.A. SASAKI, P.E. SILVA, S.P. CURTI, M.I. OLIVEIRA, T.R.M.P. CARVALHANAS, T. PERET,
D. ERDMAN & T.M. PAIVA..........................................................................................................................................................................................432
High prevalence of hepatitis A antibodies among recyclable waste pickers, Central Brazil - H.O. SOARES, C.L.R. LOPES, N.R. FREITAS,
.M. COSTA E SILVA, L.R. MOURA & R.M.B. MARTINS .......................................................................................................................................433
Analogies in medicine: violin strings adhesions - J.S. ANDRADE-FILHO ..................................................................................................................435
AUTHOR INDEX ......................................................................................................................................................................................................437
SUBJECT INDEX .....................................................................................................................................................................................................439
Impact Factor: 0.959
IV
ENDEREO
INSTITUTO DE MEDICINA TROPICAL DE SO PAULO
Av. Dr. Enas de Carvalho Aguiar, 470
05403-000 So Paulo, SP - Brasil
Fone/Fax: 55.11.3062.2174; 55.11.3061-7005
e-mail: revimtsp@edu.usp.br
Rev. Inst. Med. Trop. Sao Paulo Vol. 55 No. 6 P. 371-440 Novembro-Dezembro, 2013
CONTEDO
ISSN 0036-4665
MICOLOGIA
Primeiro registro de Cryptococcus neoformans em excretas de pombos provenientes de locais pblicos e residenciais de rea metropolitana de
Cuiab, Estado do Mato Grosso, Brasil - D.T. TAKAHARA, M.S. LAZRA, B. WANKE, L. TRILLES, V. DUTRA, D.A.J. PAULA,
L. NAKAZATO, M.C. ANZAI, D.P. LEITE JNIOR, C.R. PAULA & R.C. HAHN ...................................................................................................371
Distribuio de dermattos isolados de solos de cidades do Estado da Paraba, Brasil - Z.B.V.S. PONTES, A.C. OLIVEIRA,
Tipagem molecular de Candida albicans isoladas de pacientes hospitalizados - P.S. BONFIM-MENDONA, A. FIORINI,
LEISHMANIOSE
Aplicao do kDNA-PCR para diagnstico de rotina de leishmaniose tegumentar americana em um hospital de referncia - M.M. SATOW,
E.H. YAMASHIRO-KANASHIRO, M.C. ROCHA, L.K. OYAFUSO, R.C. SOLER, P.C. COTRIM & J.A.L. LINDOSO ..........................................393
PCR
Comparao de seis polimerases de DNA disponveis comercialmente para o PCR direto - M. MIURA, C. TANIGAWA, Y. FUJII &
S. KANEKO ....................................................................................................................................................................................................................401
FLEBOTOMNEOS
Flebotomneos em localidades rurais do Estado do Paran, Sul do Brasil - S.C.C.S. MELO, W. CELLA, R. MASSAFERA, N.M.M.G. SILVA,
R. MARQUI, M.D.B. CARVALHO & U. TEODORO ...................................................................................................................................................407
PARASITOLOGIA
Amebas potencialmente patognicas de vida livre em algumas reas afetadas durante a inundao de 2011 em Chiang Mai - A. WANNASAN,
MICROBIOLOGIA
Variantes de Smqnr de isolados clnicos de Stenotrophomonas maltophilia no Brasil - J.I. GRACIA-PAEZ, J.R. FERRAZ,
COMUNICAO BREVE
Efeito ovicida de espcies de Piperaceae em Biomphalaria glabrata, hospedeiro do Schistosoma mansoni - L.N. RAPADO,

P.O.M. LOPES,
L.F. YAMAGUCHI

& E. NAKANO ...............................................................................................................................................................................421
RELATO DE CASO
Estudo de caso de paciente com mltiplos episdios da coinfeco HIV-AIDS e leishmaniose visceral - E.D. SILVA, L.D. ANDRADE,
Utilidade da kDNA PCR no diagnstico de reativao de leishmaniose visceral em pacientes co-infetados sintomticos - A.C. NICODEMO,
V.S. AMATO, F.F. TUON, R.M. SOUZA, T.S. OKAY & L.M.A. BRAZ ......................................................................................................................429
CARTAS AO EDITOR
D. ERDMAN & T.M. PAIVA..........................................................................................................................................................................................432
NDICE DE AUTORES ...........................................................................................................................................................................................437
NDICE DE ASSUNTOS .........................................................................................................................................................................................439
Impact Factor: 0.959
Rev. Inst. Med. Trop. Sao Paulo
55(6):371-376, November-December, 2013
doi: 10.1590/S0036-46652013000600001
(1) Laboratrio de Micologia, Faculdade de Medicina, Universidade Federal do Mato Grosso, Cuiab, MT, Brazil.
(2) Laboratrio de Micologia, Instituto de Pesquisas Clnicas Evandro Chagas, Fundao Oswaldo Cruz, Rio de Janeiro, RJ, Brazil.
(3) Laboratrio de Biologia Molecular Veterinria, Faculdade de Agronomia e Medicina Veterinria, Universidade Federal do Mato Grosso, Cuiab, MT, Brazil.
(4) Laboratrio de Leveduras Patognicas, Instituto de Cincias Biolgicas, Universidade de So Paulo, So Paulo, SP, Brazil.
Correspondence to: Prof Rosane Hahn. Laboratrio de Micologia/Investigao/FM/UFMT. Av. Fernando Corra da Costa 2369, Bairro Boa Esperana, 78060-900 Cuiab, MT, Brasil.
Phone: 55 65 3615-8809. E-mail: rchahn@terra.com.br
FIRST REPORT ON Cryptococcus neoformans IN PIGEON EXCRETA FROM PUBLIC
AND RESIDENTIAL LOCATIONS IN THE METROPOLITAN AREA OF CUIAB,
STATE OF MATO GROSSO, BRAZIL
Doracilde Terumi TAKAHARA(1), Mrcia dos Santos LAZRA(2), Bodo WANKE(2), Luciana TRILLES(2), Valria DUTRA(3), Daphine Ariadne Jesus de PAULA(3),
Luciano NAKAZATO(3), Mariana Caselli ANZAI(1), Diniz Pereira LEITE JNIOR(1), Claudete Rodrigues PAULA(4) & Rosane Christine HAHN(1)
SUMMARY
Cryptococcosis is a severe systemic mycosis caused by two species of Cryptococcus that affect humans and animals: C. neoformans
and C. gattii. Cosmopolitan and emergent, the mycosis results from the interaction between a susceptible host and the environment. The
occurrence of C. neoformans was evaluated in 122 samples of dried pigeon excreta collected in 49 locations in the City of Cuiab, State
of Mato Grosso, Brazil, including public squares (n = 5), churches (n = 4), educational institutions (n = 3), health units (n = 8), open
areas covered with asbestos (n = 4), residences (n = 23), factory (n = 1) and a prison (n = 1). Samples collected from July to December
of 2010 were seeded on Niger seed agar (NSA). Dark brown colonies were identied by urease test, carbon source assimilation tests
and canavanine-glycine-bromothymol blue medium. Polymerase chain reaction primer pairs specic for C. neoformans were also
used for identication. Cryptococcus neoformans associated to pigeon excreta was isolated from eight (6.6%) samples corresponding
to six (12.2%) locations. Cryptococcus neoformans was isolated from urban areas, predominantly in residences, constituting a risk
of acquiring the disease by immunocompromised and immunocompetent individuals.
KEYWORDS: Cryptococcus neoformans; Pigeon excreta; Urban environment; State of Mato Grosso.
INTRODUCTION
Although cryptococcosis has been studied since 1894, over the
past 40 years many important advances have been achieved regarding
taxonomy, epidemiology, capsular structure, virulence factors, serotypes
and specic genotypes
25
. In Brazil, reports have been registered in most
states
11,16,23,29,34,39
, but in the State of Mato Grosso little research has been
conducted in relation to clinical and environmental isolates of the agents
of cryptococcosis. The rst description of these microorganisms in HIV-
positive patients in Mato Grosso was reported by FAVALESSA et al., who
detected 26 Cryptococcus neoformans and 10 Cryptococcus gattii isolates
in distinct clinical materials from seropositive and seronegative patients
10
.
The genus Cryptococcus comprises more than 38 species, two of
which are considered potentially pathogenic: Cryptococcus neoformans
and C. gattii
17,18,20
. Although both are found worldwide, their main
ecological niches present some differences: Cryptococcus neoformans is
most commonly isolated from pigeon droppings, while C. gattii is more
frequently isolated from decaying wood and soil
14,24,25
.
The presence of Cryptococus neoformans in soil and old dried
pigeon excreta has been widely studied in several countries
7,8
. Poultry
manure is considered a natural substrate for C. neoformans. Pigeons
can even carry it on their beaks, feathers and legs, as well as presenting
colonization by this agent on the crop. They act as dispersers in the
environment, generating a source of infection for humans. Regarding
the primary habitat of C. neoformans, species of plants and aged woods
can be considered locations where the yeasts may naturally develop
their sexual state
32
.
Considering the complete lack of data reported in the literature to
date, the present study aimed to evaluate the possible environmental
distribution of C. neoformans in public places (churches, squares,
educational institutions, prisons, factories and health facilities) and
residences within the City of Cuiab and the neighbor metropolitan area.
MATERIAL AND METHODS
Study periods and locations: The samples were collected between
July and December of 2010 in the metropolitan area of Cuiab.
Mato Grosso is located in the Midwest region of Brazil. The state
occupies an area of 903,357km, being the third largest from Brazil
and it is the only one to have three characteristic biomes, Pantanal
TAKAHARA, D.T.; LAZRA, M.S.; WANKE, B.; TRILLES, L.; DUTRA, V.; PAULA, D.A.J.; NAKAZATO, L.; ANZAI, M.C.; LEITE-JNIOR, D.P.; PAULA, C.R. & HAHN, R.C.- First
report on Cryptococcus neoformans in pigeon excreta from public and residential locations in the metropolitan area of Cuiab, State of Mato Grosso, Brazil. Rev. Inst. Med. Trop. Sao
Paulo, 55(6): 371-6, 2013.
372
(marshland), Cerrado (Brazilian savanna) and Amazon. Its capital is the
City of Cuiab, which has about 551,000 inhabitants. In its territory is
situated the geodesic center of South America, at 153556 South and
560605 West (Fig. 1).
The climate is characterized by a mean annual rainfall of 1,469.4
mm and average annual temperature of 24 to 26 C. Despite unequally
distributed, the region is well supplied with rain and seasonality is
typically tropical, with maximal temperatures in summer and minimal
in winter. Over 70% of the total rainfall accumulated during the period
of November to March. The winters are excessively dry, due to very
scarce rainfall
35
. The average temperature during the collecting period
was 27 C (July to December 2010), with maximal that reached 40 C
for several times in August, September and October
15
.
The sites selected were characterized as follows: ve public squares,
four churches, three educational institutions, eight public health units,
four open areas covered with asbestos, 23 residences, one factory and
one prison.
Inclusion criteria: At all the sites selected, aspects related to the
excreta collected were evaluated according to the following parameters:
excreta presenting a dried aspect; deposited on the surfaces of public or
residential environments; the presence of pigeons close to the excreta;
the presence of chicks or nests; and sufcient quantity for posterior
weighing (> one gram) and analysis.
Sample processing: Following homogenization, 1 g of each sample
was suspended in 50 mL of sterile physiological saline with 0.4 g/L
chloramphenicol, shaken for ve min and allowed to settle for 30 min.
The supernatant was aspirated, inoculated onto Niger seed agar (NSA)
medium (0.1 mL of supernatant per plate, 10 plates per sample), incubated
at room temperature (25 C to 27 C) and observed for ve to seven days.
Yeast colonies on NSA were selected by observing the shiny, smooth,
and dark brown colonies (due to melanin production). The brown colonies
were sub-cultivated onto Sabouraud (Merck) medium for urease test and
other biochemical tests as well microscopic analysis with India ink to
visualize the capsule
21,22
.
For the biochemical tests, auxanogram technique
was used, in which the assimilation of eleven carbon sources (dextrose,
lactose, maltose, sucrose, inositol, galactose, cellobiose, melezitose,
melibiose, rhamnose and erythritol) and two nitrogen sources (peptone
and potassium nitrate)
18,22
were used to identify the cryptococcal isolates.
The dark brown colonies were also sub-cultivated onto NSA medium
which is recommended to conrm phenoloxidase activity
11
. After passage
through NSA medium, dark brown colonies were seeded on CGB medium
(L-canavanine glycine bromothymol blue) for species identication
19
.

No alteration in the yellow-green original color of the CGB medium
conrms C. neoformans.
For molecular identication of the cryptococcal isolates, the protocol
described by POETA et al.
33
was used, with modications, for DNA
extraction. Yeast cells were suspended in 0.5 mL TENTS [10 mM, Tris
pH 8.0, 5% sodium dodecyl sulfate (SDS)]. Then, 0.5g of 0.5-mm glass
beads were added and boiled at 100 C for 10 min. It was then added 0.5
mL of phenol: chloroform and samples were vortexed for two min. After
centrifugation for 10 min in a microfuge at 14,500 x g, the aqueous phase
was transferred to a tube with one volume of isopropanol and 0.3 M of
sodium acetate was added, and samples were placed at -20 C overnight.
Fig. 1 - Location of the City of Cuiab, State of Mato Grosso, Brazil.
Paulo, 55(6): 371-6, 2013.
373
DNA collected was precipitated, washed with 70% ethanol, re-suspended
in 50 L of ultrapure water and stored at -20 C.
To confirm the species of the isolates, pairs of primers
CNA70A (5-ATTGCGTCCATGTTACGTGGC-3) and CNA70S
(5-ATTGCGTCCACCAAGGAGCTC-3 ) specic for C. neoformans
were used, resulting in amplication products of 695 bp
2,13
.
RESULTS
All the brown colonies isolated on NSA medium were encapsulated
yeast forms, and have been observed in microscopy with India Ink.
All were thermotolerant to 37 C, urease-producing and inhibited by
cycloheximide. In Canavanine-glycine-bromothimol blue medium (CGB)
didnt have color change and this conrmed specie C. neoformans, as well
as the assimilation of carbohydrates (glucose, maltose, sucrose, galactose,
cellobiose, inositol, xylose, rafnose, trehalose, dulcitol) and no nitrate
assimilation. All colonies isolated was conrmed by PCR (Polymerase
Chain Reaction) from the use of specic primers. Further analysis should
be performed to investigate the molecular types of these isolates.
One hundred and twenty-two dry pigeon excreta samples were chosen
at random from different locations (Table 1).
The presence of excreta was detected in the eight groups evaluated.
However, considering the squares, the presence of excreta was only
observed in four of the eleven surveyed. Similarly, in four of the ten
churches and three of the ve schools the same fact was observed,
concomitant presence of pigeons and excreta. According to the isolation of
C. neoformans, it was possible to determine that these yeasts were mostly
detected in the pigeon excreta collected from the residences assessed.
Regarding the different groups evaluated, C. neoformans was detected
in one of the four churches, specically in the tower, where the presence
of both pigeons and excreta were observed. C. neoformans was isolated
in one of the three educational institutions inhabited by pigeons where
excreta were also observed. Isolates of C. neoformans were similarly
identied in samples from four of the 23 residences evaluated.
The presence of pigeon excreta was observed in 49 (78%) of the 63
sites visited. The presence of these substrata according to the different
sites is presented in Table 1.
Isolation of C. neoformans was obtained from six (12.2%) of the 49
sites analyzed, where eight (6.6%) out of 122 samples of dried pigeon
excreta collected were positive.
Two samples collected from the church were positive for C.
neoformans, eight colonies were detected. In the educational institution, C.
neoformans was detected in only one of the 13 samples analyzed and in this
sample, four colonies were detected. Regarding the residences, ve samples
positive for C. neoformans were obtained and 60 colonies were detected.
The identication of C. neoformans isolates was conrmed by PCR
using specic primers (Fig. 2).
DISCUSSION
The deposition of pigeon excreta (Columba livia) in public places
can serve as a source of infectious agents of importance for public health,
such as C. neoformans. In this study, certain facts observed during sample
collection deserve attention: the amount of excreta obtained was variable,
in that frequent cleaning was observed in several of the public spaces
evaluated. Thus, despite the presence of pigeons, the presence of excreta
was not veried at all the sites selected.
Furthermore, in the majority of the sites visited, there were no
mechanical barriers to prevent access by pigeons, a resource currently
used to hinder the approach of pigeons to windows, air conditioning units
and other physical barriers.
Table 1
Types and number of sites investigated (Groups) and positivity (%) associated with the presence of Cryptococcus neoformans in pigeon excreta of environments in
the Cuiab City, State of Mato Grosso, Brazil
Groups/type of location Number
Presence of
excreta
Sample (n)
Sample
positive
Isolation
absolute relative
n %
Group I: squares 11 5 12 0 0 0.0
Group II: churches 10 4 13 2 1/4 25.0
Group III: educational institutions 5 3 13 1 1/3 33.0
Group IV: health units 8 8 20 0 0 0.0
Group V: open areas* 4 4 11 0 0 0.0
Group VI: residences 23 23 44 5 4/23 17.0
Group VII: factories 1 1 3 0 0 0.0
Group VIII: prisons 1 1 6 0 0 0.0
Total 63 49 (78%) 122 8 (6.6%) 6/49 12.2
*with asbestos covering.
Paulo, 55(6): 371-6, 2013.
374
The isolation of virulent strains of the fungus from soil samples
was rst reported by SILVA & CAPUANO
37
in Brazil as early as 1960.
MACHADO et al.
27
also reported recovering this fungus from the soil in
an attempt to correlate the clinical-epidemiological history of patients
suffering from cryptococcosis in the Santa Casa of Porto Alegre, in the
State of Rio Grande do Sul (RS), Brazil.
In this study, only samples of pigeon excreta were collected, soil
samples were not included. However, when considering studies that
examined samples of pigeon excreta, positivity rates for the isolation of
the fungus in Brazil ranged from 4.3 to 31.3%
3,6,9,13,16,23,27,28,29,31,34,37,39
. The
ndings of this study show a positivity rate of 12% for C. neoformans,
values that are compatible with the rates of isolation in Brazil previously
reported in the literature. Most of the total samples analyzed (44/122)
were from residences, sites which presented expressive positivity (17%).
This nding may represent a risk for the acquisition of cryptococcosis,
since in several of the evaluated residences the habit of feeding pigeons by
residents was frequently observed, luring them and indirectly encouraging
them to reproduce. Food scraps were also found in these places, reecting
poor hygiene care in the common areas of residential estates.
Ten churches were visited and the presence of excreta was investigated
in four, though positivity for C. neoformans was demonstrated only in
one. BARONI et al.
3
also evaluated the presence of C. neoformans
in ten churches in the City of Rio de Janeiro and C. neoformans was
found in every church selected and was present in 37.8% of 219 pigeon
dropping samples. Samples of excreta were obtained, in addition to air
samples in church towers and from the surrounding areas. It is known
that high summer temperatures can inhibit the growth of C. neoformans,
possibly due to inactivation of the yeast
36,40
. Cuiab is known for its high
temperatures, a factor that should be considered in relation to the low rates
of detection of C. neoformans in pigeon excreta at the sites evaluated.
According to BULMER
4
, the problem is the long viability of C.
neoformans in dried excreta, about two years. Based on this information,
old buildings and towers of old churches can be considered potential
sources for C. neoformans and should be periodically evaluated by
public health authorities. In Cuiab, most churches are fairly old (over
50 years-old) and are considered historical monuments of the city, which
completed 292 years in 2011.
Uninfected pigeon excreta can become infected when exposed
to air containing aerosolized cells of C. neoformans
5
. Considering
all the locations where pigeon excreta might be deposited within the
urban areas of Cuiab, the aerial dispersion of cryptococcal propagules
from the positive sites to the surroundings is probably occurring. The
positivity (12%) rate for the isolation of C. neoformans from pigeon
excreta detected in this study is in agreement with the values obtained by
LOPEZ-MARTINEZ et al.
26
, who analyzed 711 samples from numerous
environmental sources in Mexico City, including bird droppings, fruits
and vegetables. They reported the presence of C. neoformans in 9.5%
of excreta samples, 9.5% in fruits and 4.2% vegetables. In contrast, in
another study in Bogota (Colombia), 480 samples of debris from trees
and 89 excreta samples were investigated. Among the plant samples,
99% were characterized as C. gattii and 1% as C. neoformans, while in
the excreta samples, only C. neoformans was isolated
12
.
Considering the public squares in the present study, the ndings in
Cuiab contrast with those obtained in Porto Alegre, Rio Grande do Sul
State, by REOLON et al.
34
They afrmed that in all ve squares in which
the investigation of yeasts of the genus Cryptococcus was conducted, a
total of 88 samples, positivity was obtained in all 88 (100%) samples. In
our study, 11 squares were evaluated, but it was not possible to isolate
yeasts of the genus Cryptococcus, despite the presence of excreta in ve
of the squares. The authors who conducted the study in Porto Alegre did
not mention the period or season in which the materials were collected,
making it virtually impossible to compare the factors that could interfere
with the isolation of yeasts in cities with very different bioclimatic
conditions, such as Cuiab and Porto Alegre.
In the City of Pelotas, Rio Grande do Sul State, FARIA et al.
9

evaluated 70 environments, including squares (n = 1), historic buildings
(n = 8), church towers (n = 1), rice mills and warehouses (n = 7) and
outdoor locations (n = 9). Considering all these sites, the isolation of
C. neoformans was veried in 26.9% (n = 7/26). Among the 14 squares
evaluated in Pelotas, only one had a mean quantity excreta from which C.
neoformans was isolated. The City of Pelotas has no extreme temperatures
and relative humidity is high. This contrasts with the bioclimatic
conditions of Cuiab, where temperatures in August, September and
October, rise considerably and the relative humidity remains extremely
low, reaching critical levels. Sun light exposure associated with the
climate of Cuiaba may be critical for the survival of C. neoformans in
open areas of the city. Moreover the agent was mainly isolated from
protected places in Cuiab, such as an educational institution, a church
and four residences. These ndings reveal the risk of exposure for
immunosuppressed and even immunocompetent individuals in daily
activities or living in these microenvironments. Measures are required to
Fig. 2 - PCR amplication of Cryptococcus neoformans: M, 100 pb DNA ladder, 1 negative
control (NC), 1 positive control (PC) and sample isolates A1 (church), A2 (educational
institution), A3 (residence 1) and A4 (residence 2).
Paulo, 55(6): 371-6, 2013.
375
reduce the number of birds through the maintenance of adequate hygiene,
aeration, lighting and ventilation
1,11
. Simply performing adequate cleaning
of such environments could be effective, as well as not offering food to
pigeons, particularly in residential areas.
RESUMO
Primeiro registro de Cryptococcus neoformans em excretas de
pombos provenientes de locais pblicos e residenciais de rea
metropolitana de Cuiab, Estado do Mato Grosso, Brasil
A criptococose micose sistmica potencialmente grave causada por
duas espcies do gnero Cryptococcus que acometem tanto homens como
animais: Cryptococcus neoformans e C. gattii. So infeces cosmopolitas
e emergentes, resultantes da interao do hospedeiro - humano e animal
versus meio ambiente. A proposta deste trabalho foi avaliar a ocorrncia
de C. neoformans em 122 amostras de excretas secas de pombos coletadas
em 49 locais na cidade de Cuiab, Estado do Mato Grosso, Brasil,
incluindo: praas pblicas (n = 5), igrejas (n = 4), instituies de ensino
(n = 3), unidades de sade (n = 8), reas abertas exibindo cobertura de
amianto (n = 4), conjuntos residenciais domiciliares (n = 23), uma fbrica
(n = 1) e um presdio (n = 1). Semeadura de suspenso de amostras em
meio gar niger (NSA), identicao fenotpica por provas bioqumicas
e teste em meio de canavanina-glicina-azul de bromotimol, das colnias
isoladas com pigmentao marrom escura. Foi tambm utilizada a tcnica
da reao em cadeia da polimerase com pares de iniciadores especcos
para identicao de C. neoformans. As amostras foram coletadas de
julho a dezembro de 2010. Cryptococcus neoformans foi isolado em
oito (6,6%) de 122 amostras correspondendo a seis (12,2%) dos 49 stios
analisados. Cryptococcus neoformans associado a excretas de pombos
ocorre em reas de Cuiab, predominando em residncias nas amostras
analisadas, constituindo fator de risco potencial para aquisio da doena
tanto para indivduos imunocomprometidos como imunocompetentes.
ACKNOWLEDGMENTS
Financial support for this study was provided by FAPEMAT -
Fundao de Amparo Pesquisa no Estado de Mato Grosso [State of
Mato Grosso Foundation for the Support of Science].
REFERENCES
1. Abegg MA, Cella FL, Faganello J, Valente P, Schrank A, Vainstein MH. Cryptococcus
neoformans and Cryptococcus gattii isolated from the excreta of psittaciformes in a
southern Brazilian zoological garden. Mycopathologia. 2006;161:83-91.
2. Aoki FH, Imai T, Tanaka R, Mikami Y, Taguchi H, Nishimura NF, et al. New PCR
primer pairs specic for Cryptococcus neoformans serotype A or B prepared on the
basis of random amplied polymorphic DNA ngerprint pattern analyses. J Clin
Microbiol. 1999;37:315-20.
3. Baroni FA, Paula CR, Silva EG, Viani FC, Rivera ING, Oliveira MTB, et al.
Cryptococcus neoformans strains isolated from church towers in Rio de Janeiro City,
RJ, Brazil. Rev Inst Med Trop Sao Paulo. 2006;48:71-5.
4. Bulmer GS. Twenty-five years with Cryptococcus neoformans. Mycopathologia.
1990;109:111-22.
5. Casadevall A, Perfect JR. Cryptococcus neoformans. Washington: American Society
for Microbiology Press; 1998.
6. Casali AK, Goulart L, Rosa e Silva LK, Ribeiro AM, Almeida AA, et al. Molecular
typing of clinical and environmental Cryptococcus neoformans isolates in the
Brazilian State Rio Grande do Sul. FEMS Yeast Res. 2003;3:405-15.
7. Currie BP, Freundlich LF, Casadevall A. Restriction fragment length polymorphism
analysis of Cryptococcus neoformans isolates from environmental (pigeon excreta)
and clinical sources in New York City. J Clin Microbiol. 1994;32:1188-92.
8. Emmons CW. Saprophytic sources of Cryptococcus neoformans associated with the
pigeon (Columba livia). Amer J Hyg. 1955;62:227-32.
9. Faria RO, Nascente PS, Meinerz ARM, Cleff MB, Antunes TA, Silveira ES, et al.
Ocorrncia de Cryptococcus neoformans em excretas de pombos na cidade de Pelotas,
Estado do Rio Grande do Sul. Rev Soc Bras Med Trop. 2010;43:198-200.
10. Favalessa OC, Ribeiro LC, Tadano T, Fontes CJF, Dias FB, Coelho BP, et al. Primeira
descrio da caracterizao fenotpica e susceptibilidade in vitro a drogas de leveduras
do gnero Cryptococcus spp isoladas de pacientes HIV positivos e negativos, Estado
de Mato Grosso. Rev Soc Bras Med Trop. 2009;42:661-5.
11. Fili WF, Wanke B, Agena SM, Vilela VO, Macedo RC, Lazra MS. Cativeiro de
aves como fonte de Cryptococcus neoformans na cidade de Campo Grande, Mato
Grosso do Sul, Brasil. Rev Soc Bras Med Trop. 2002;35:591-5.
12. Granados DP, Castaeda E. Isolation and characterization of Cryptococcus neoformans
varieties recovered from natural sources in Bogot, Colombia, and study of ecological
conditions in the area. Microb Ecol. 2005;49:282-90.
13. Horta JA, Staats CC, Casali AK, Ribeiro AM, Schrank IS, Schrank A, et al.
Epidemiological aspects of clinical and environmental Cryptococcus neoformans
isolates in the Brazilian state Rio Grande do Sul. Med Mycol. 2002;40:565-71.
14. Idnurm A, Bahn Y, Nielsen K, Lin X, Fraser JA, Heitman J. Deciphering the model
pathogenic fungus Cryptococcus neoformans. Nat Rev Microbiol. 2005;3:753-64.
15. Instituto Nacional de Meteorologia (INMET) [Internet]. Brasilia, DF, Brasil: INMET;
[Updated 2011 January 2001; Cited 2011 October 29] Available from: http://www.
inmet.gov.br/html/observacoes.php?/
16. Kobayashi CC, Souza LK, Fernandes OF, Brito SC, Silva AC, Sousa ED, et al.
Characterization of Cryptococcus neoformans isolated from urban environmental
sources in Goinia, Gois, Brazil. Rev Inst Med Trop Sao Paulo. 2005;47:203-7.
17. Kon AS, Grumach AS, Colombo AL, Penalva ACO, Wanke B, Telles FQ, et al.
Consenso em criptococose - 2008. Rev Soc Bras Med Trop. 2008;41:524-44.
18. Kwon-Chung KJ, Bennet JE. Cryptococcosis. In: Kwon-Chung KJ, Bennet JE, editors.
Medical Mycology. Philadelphia: Lea & Febiger; 1992. p. 426-36.
19. Kwon-Chung KJ, Bennet JE. Culture media and reagents. In: Kwon-Chung KJ,
Bennet JE, editors. Medical Mycology. Appendix B. Philadelphia: Lea & Febiger;
1992. p. 816-26.
20. Kwon-Chung KJ, Boekhout T, Fell TJ, Diaz M. Proposal to conserve the name
Cryptococcus gattii against C. hondurianus and C. bacillisporus (Basidiomycota,
Hymenomycetes, Tremellomycetidae). Taxon. 2002;51:804-6.
21. Kwon-Chung KJ, Polacheck I, Bennett JE. Improved diagnostic medium for separation
of Cryptococcus neoformans var. neoformans (serotypes A and D) and Cryptococcus
neoformans var. gattii (serotypes B and C). J Clin Microbiol. 1982;15:535-7.
22. Lacaz CS, Porto E, Martins JEC, Heins-Vaccari EM, Mello NT. Criptococcose. In:
Lacaz CS, Porto E, Martins JEC, Heins-Vaccari EM, Mello NT, editors. Tratado de
Micologia Mdica. 9
th
. ed. So Paulo: Sarvier; 2002. p. 416-40.
23. Lazra MS, Wanke B, Nishikawa MM. Isolation of both varieties of Cryptococcus
neoformans var. neoformans from saprophytic sources in the city of Rio de Janeiro,
Brazil. J Med Vet Mycol. 1993;31:449-54.
Paulo, 55(6): 371-6, 2013.
376
24. Levitz SM. The ecology of Cryptococcus neoformans and the epidemiology of
cryptococcosis. Rev Infect Dis. 1991;13:1163-9.
25. Lin X, Heitman J. The biology of the Cryptococcus neoformans species complex.
Ann Rev Microbiol. 2006;8:69-105.
26. Lpez-Martnez R, Castan-Olivares LR. Isolation of Cryptococcus neoformans
var. neoformans from bird droppings, fruits and vegetables in Mexico City.
Mycopathologia. 1995;129:25-8.
27. Machado CC, Amaral AA, Severo LC. Cryptococcus neoformans var. neoformans
isolado do solo. Rev Inst Med Trop Sao Paulo. 1993;35:77-9.
28. Montenegro H, Paula CR. Environmental isolation of Cryptococcus neoformans
var. gattii and C. neoformans var. neoformans in the city of So Paulo, Brazil. Med
Mycol. 2000;38:385-90.
29. Melo NT, Nigro RC, Pereira AD, Huggins D, Lacaz CS. Isolamento de Cryptococcus
neoformans de fezes de pombos, do solo e ninhos de pombos. Rev Bras Med.
1987;44:6-9.
30. Pappalardo MC, Melhem MS. Cryptococcosis: a review of the Brazilian experience
for the disease. Rev Inst Med Trop Sao Paulo. 2003;45:299-305.
31. Passoni LF, Wanke B, Nishikawa MM, Lazra MS. Cryptococcus neoformans
isolated from human dwellings in Rio de Janeiro, Brazil: an analysis of the domestic
environmental of AIDS patients with and without cryptococcosis. Med Mycol.
1998;36:305-11.
32. Passoni LF. Wood, animals and human beings as reservoirs for human Cryptococcus
neoformans infection. Rev Iberoam Micol. 1999;16:77-81.
33. Poeta MD, Toffaletti DL, Rude TH, Dykstra CC, Heitman J, Perfect JR. Topoisomerase
I is essential in Cryptococcus neoformans: role in pathobiology and as an antifungal
target. Genetics. 1999;152:167-78.
34. Reolon A, Perez LRR, Mezzari A. Prevalncia de Cryptococcus neoformans nos
pombos urbanos da cidade de Porto Alegre, Rio Grande do Sul, Brasil. J Bras Patol
Med Lab. 2004;40:293-8.
35. Rolim GS, Camargo MBP, Lania DG, Moraes JFL. Classicao climtica de Kppen
e Thornthwaite e sua aplicabilidade na determinao de zonas agroclimticas para o
Estado de So Paulo. Bragantia. 2007;66:711-20.
36. Rosario I, Hermoso-de-Mendonza M, Dniz S, Soro G, lamo I, Acosta B. Isolation
of Cryptococcus species including C. neformans from cloaca of pigeons. Mycoses.
2005;48:421-4.
37. Silva JO, Capuano DM. Ocorrncia de Cryptococcus spp e de parasitas de interesse
em sade pblica, no excreta de pombos na cidade de Ribeiro Preto, SP, Brasil. Rev
Inst Adolfo Lutz. 2008;67:137-41.
38. Silva ME, Paula LA. Isolamento de Cryptococcus neoformans de excrementos e
ninhos de pombos (Columba livia) em Salvador, Bahia. Rev Inst Med Trop Sao
Paulo. 1963;5:9-11.
39. Silva ME. Ocorrncia de Cryptoccocus neoformans e Microsporum gypseum em
solos da Bahia, Brasil. Bol Fund Gonalo Moniz. 1960;17:1-14.
40. Sorrell TC, Ellis DH. Ecology of Cryptococcus neoformans. Rev Iberoam Micol.
1997;14:42-3.
Received: 10 December 2012
Accepted: 4 April 2013
doi: 10.1590/S0036-46652013000600002
(1) Laboratory of Mycology, Department of Pharmaceutical Sciences, Federal University of Paraba, Joo Pessoa, PB, Brazil.
(2) Laboratory of Ceramic, Department of Mechanical Engineering, Federal University of Paraba, Joo Pessoa, PB, Brazil.
(3) Department of Statistic, Federal University of Paraba, Joo Pessoa, PB, Brazil.
Correspondence to: Felipe Queiroga Sarmento Guerra, Tel.: 55.83.9602-1666. E-mail: felipeqsguerra@gmail.com
DISTRIBUTION OF DERMATOPHYTES FROM SOILS OF URBAN AND RURAL AREAS
OF CITIES OF PARAIBA STATE, BRAZIL
Zlia Braz Vieira da Silva PONTES(1), Aurylene Carlos de OLIVEIRA(1), Felipe Queiroga Sarmento GUERRA(1),
Luiz Renato de Arajo PONTES(2) & Jozemar Pereira dos SANTOS(3)
SUMMARY
The dermatophytes, keratinophilic fungi, represent important microorganisms of the soil microbiota, where there are cosmopolitan
species and others with restricted geographic distribution. The aim of this study was to broaden the knowledge about the presence of
dermatophytes in soils of urban (empty lots, schools, slums, squares, beaches and homes) and rural areas and about the evolution of
their prevalence in soils of varying pH in cities of the four mesoregions of Paraiba State, Brazil. Soil samples were collected from 31
cities of Paraiba State. Of 212 samples, 62% showed fungal growth, particularly those from the Mata Paraibana mesoregion (43.5%),
which has a tropical climate, hot and humid. Soil pH varied from 4.65 to 9.06, with 71% of the growth of dermatophytes occurring
at alkaline pH (7.02 - 9.06) ( = 0.000). Of 131 strains isolated, 57.3% were geophilic species, particularly Trichophyton terrestre
(31.3%) and Mycrosporum gypseum (21.4%). M. nanum and T. ajelloi were isolated for the rst time in Paraiba State. The zoophilic
species identied were T. mentagrophytes var. mentagrophytes (31.3 %) and T. verrucosum (7.6 %), and T. tonsurans was isolated as
an anthropophilic species. The soils of urban areas including empty lots, schools, slums and squares of cities in the mesoregions of
Paraiba State were found to be the most suitable reservoirs for almost all dermatophytes; their growth may have been inuenced by
environmental factors, soils with residues of human and/or animal keratin and alkaline pH.
KEYWORDS: Dermatophytes; Keratinophilic fungi; Soil; pH conditions; Brazil.
INTRODUCTION
The dermatophytes (Trichophyton, Microsporum and Epidermophyton),
keratinophilic fungi, represent important microorganisms of the soil
microbiota, where there are cosmopolitan species and others with
restricted geographic distribution
1,2,6,10,17,21
. There have been reports of
the isolation of T. ajelloi, T. rubrum, T. mentagrophytes, T. verrucosum,
T. terrestre, T. tonsurans, T. simii, T. schoenleinii, M. gypseum, M. canis,
M. audouinii, M. nanum, M. cookei and/or E. occosum, from the soils
of various Brazilian states and locals around the world
8,20,24,25,30,32,34
.
The occurrence of fungi in the soil can also be influenced by
non-biological factors such as soil temperature, humidity, rainfall,
environmental light, climate, chemical composition, quantity of organic
matter in the soil and pH. Some have a wide range of tolerance for
acidic to alkaline soils
2,7,14,16
. However, studies of soil pH in relation to
occurrence of dermatophytes are uncommon in Brazil.
The study of the diversity of dermatophytes in the soil is important
because changes in the distribution of species of dermatophytes due to
ecological factors, socio-economic, therapeutic, and migration processes
of livestock populations, reect the epidemiology of dermatophytosis,
which are one of the source infections of the soil
2,3,16,18,31
. Thus, the aim
of this study was to broaden the study into the presence of dermatophytes
from soils of urban and rural areas of cities of four mesoregions of Paraiba
State and the inuence of pH on fungi growth.
MATERIALS AND METHODS
The state of Paraiba is situated in the eastern portion of Northeast
Brazil, with coordinates between 6 and 8 S and between 34 and 38 W;
therefore, it is included in the tropical zone. It comprises an area of 56,372
km
2
and is divided into four mesoregions (Mata Paraibana, Borborema,
Agreste Paraibano and Serto Paraibano) and into 23 geographic
microregions, including a total of 223 cities. In the Mata Paraibana, the
predominant climate is warm, humid tropical (As) with an average annual
rainfall of 1,800 mm, temperature of 26 C and relative humidity of 80%.
The soils are sandy and muddy, which are inuenced by sea water and
have especially coastal vegetation of mangrove swamp, rainforest and
cerrado. In Borborema, the predominant climate is semi-arid (Bsh), warm
and dry with average annual rainfall of 500 mm, temperature of 26 C and
relative humidity of 75%. The soils are shallow stony soil with caatinga
PONTES, Z.B.V.S.; OLIVEIRA, A.C.; GUERRA, F.Q.S.; PONTES, L.R.A. & SANTOS, J.P. - Distribution of dermatophytes from soils of urban and rural areas of cities of Paraiba State,
Brazil. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 377-83, 2013.
378
vegetation. The climate Bsh, together with As are observed in Agreste
Paraibano. However, in Serto Paraibano, the predominant climate is semi-
humid (Aw) with an average annual rainfall of 800 mm, temperature of
27 C and relative humidity of 70%. In the two last mesoregions, a slow
development of soils with caatinga vegetation (Fig. 1)
28
.
An ecological study was performed with a total of 212 soil samples.
The sampling was non-probabilistic, as it was done by convenience
and accessibility to the members of the team, taking into consideration
conglomerates of cities in Paraiba mesoregions. Each mesoregion was
represented by a city of great geographical and population density: Joo
Pessoa for Mata Paraibana, Monteiro for Borborema, Campina Grande
for Agreste Paraibano and Patos for Serto Paraibano. The other cities
were randomly included.
Soil samples were selected from urban (empty lots, schools, slums,
squares, homes and beaches) and rural areas of cities. The sampling
sites were selected on the basis of the likely presence of soil with keratin
residues from humans and animals.
The collection, processing and pH of soil solutions were according
to the techniques described by VANBREUSEGHEM
33
. Approximately
100g of soil at a depth of three to ve centimeters was collected, placed
in polyethylene bags and brought to be processed at the Laboratory of
Mycology in the Department of Pharmaceutic Sciences and Laboratory
of Ceramic, Department of Mechanical Engineering at the Federal
University of Paraiba.
Using a pHmetrer, the pH of each soil sample (20 g) was measured
Fig. 1 - Location of 31 cities, according to four mesoregions, soils type, vegetation and climate of the state of Paraba, Brazil. Adapted from RODRIGUEZ
28
.
379
after dilution in distilled sterile water (20 mL) with 20 minutes of agitation
and decantation. Each sample was distributed in sterile Petri plates,
moistened with sterile water (20 mL) and some sterile human hair strips
were placed over each surface. The plates were identied and incubated
(27-30 C) and from the 5
th
to the 70
th
day the hair strips were regularly
observed with magnifying glasses for signs of fungal growth. Hair strips
with a development of prominent fungal growth around them, were
placed between slide and cover slid, colored in lactophenol blue cotton
and examined in a microscope (10X and 40X). They were cultivated in
Sabouraud dextrose agar
medium with chloramphenicol (0.05 mg mL

-1
)
and in Mycobiotic agar

and incubated at room temperature for another
minimum period of two weeks.
The identication of the species was based on macromorphology and
micromorphology features (slide-culturing) and physiological tests (urea
hydrolysis, in vitro hair perforation, vitamin requirement and sensitive
media). The classication was based on BARNETT & HUNTER
5
,
REBELL & TAPLIN
27
and HOOG et al.
12
.
The data were subjected to statistical analysis, which consisted of
the Binomial test. The process was carried out by computing SPSS 13
22
,
allowing to verify if the dermatophytes growth soil acidic pH is equal
to alkaline pH.
RESULTS
In 31 cities of four mesoregions of the state of Paraiba (Fig. 1), 62%
of the growth of dermatophytes occurred in soil with different pH. In
cities from Mata Paraibana, isolations were observed in 43.5% of samples,
where this rate was 84% in the capital, Joo Pessoa. In cities from Serto
Paraibano, the isolation rate was 20.6%, whereas 23.7% in cities from
Agreste Paraibano and 12.2% in cities from Borborema (Table 1).
A total of 131 strains of dermatophytes were isolated, where 57.3%
of the geophilic species were identied. T. terrestre (31.3%) was the
most common species, followed by M. gypseum (21.4%), M. nanum
(3%), T. ajelloi (0.8%) and Anthroderma gypsea (0.8%), a teleomorph
form of M. gypseum, observed in sample soil. M. nanum and T. ajelloi
were isolated for the rst time in Paraiba State. The zoophilic species
identied included T. mentagrophytes var. mentagrophytes (31.3%) and
T. verrucosum (7.6%). T. tonsurans (3.8%) was the only anthropophilic
species isolated. The growth of more than one fungal species was
observed in 13 samples (Table 1).
The soils that showed the highest rates of dermatophytes were those of
urban areas (95%), especially in soils of empty lots (25.2% of isolations),
around schools (22.9%), in slums (21.4%) and squares (19.8%), compared
to around homes (3.8%) and on beaches (2.3%) (Table 2).
Dermatophytes developed in a wide pH range: acid to alkaline
(4.65 - 9.06), with 71% in alkaline pH (7.02 - 9.06). T. terrestre
develops within the pH range of 5.76 - 8.90. T. mentagrophytes var.
mentagrophytes and M. gypseum develop within the pH range 4.65 -
9.06 and 5.77 - 8.31, respectively and T. verrucosum was reported from
urban areas at pH 6.65 - 8.05. In acid pH soil, an inhibition of growth
M. nanum, A. gypsea and T. ajelloi was observed. The dermatophytes
growth in soil of alkaline pH was signicantly different from the acidic
pH ( = 0.000) (Table 3).
DISCUSSION
Studies worldwide have examined various variables, such as soil
type, pH, climate, temperature, moisture and organic matter content, and
have revealed the presence of dermatophytes and other keratinophilic
fungi in soil
1,3,6,9,14,21,31
. In Brazil, there are few reports on the isolation
of dermatophytes in soil, specically in the Northeast region
16,26,32
. In
the mesoregion of Mata Paraibana, with an As climate and sandy and
muddy soils
28
, dermatophytes were isolated in 43.5% of samples. A
previous study reported that 55.7% of 68 soil samples from the city of
Joo Pessoa-Paraiba State (PB), showed the growth of dermatophytes
26
. In
Borborema, the isolation rate was 12.2%. This area has a Bsh climate and
shallow rocky soil. In other mesoregions, the lack of water for prolonged
periods accounts for the slow development of soil. The distribution of
climates is related to the geographic localization, that is, the closer to
the coast the more humid and the farther from the coast the drier. The
four mesoregions of Paraiba have predominantly caatinga vegetation,
except Mata Paraibana
28
. Although the roles of fungi in ecosystems have
been well documented, knowledge about their population dynamics
and community structure and of the diversity of soil fungi is still poor.
Further studies of Paraiba soils are necessary to analyze the changes and
inuence of variables such as types of climate, soil and vegetation on the
development of dermatophytes.
The pH range of 7.2 - 8.0 is favorable for the production of proteolytic
enzymes (keratinases) by keratinophilic fungi, which are necessary for
their growth, along with other soil conditions
15
. However, the results of
this study indicate the growth of dermatophytes in acid and alkaline pH,
where 71% of isolations were observed in the alkaline pH range between
7.02 and 9.06 ( = 0.000). These results, obtained with different soil
samples, conrm the importance of pH in the habitat to the occurrence and
distribution of dermatophytes. In acidic soils, there is growth inhibition
of dermatophytes and other keratinophilic fungi, but soils that are weakly
acidic to neutral or alkaline are optimal for their growth
14,16,21,23
. In this
investigation, in acid pH soils, the growth of A. gypseum, M. nanum and
T. ajelloi was inhibited. Some authors
6
observed that the frequency of
T. ajelloi (33%) increased with a decrease in pH, reaching a maximum
in strongly acidic soil.
Eight species of dermatophytes were identied in the soils of cities
in Paraiba. Of the geophilic species (57.3%), T. terrestre (31.3%) was
especially found in soils from squares, empty lots, schools, slums and
beaches. This variable distribution rate can be related to the sampling
sites, where the presence of people and animals are frequent, providing
residues of organic matter, which are essential for the growth of these
fungi. The results obtained are close to those for other cities in Brazil
such as: Belo Horizonte and So Paulo
29
and in soils of countries such as
Germany and Argentina
7,21
. However, the frequency of this species was
low in Italy
25
and India
31
. T. terrestre has been found to be a pathogen
particularly in pets and humans including the elderly who exhibit
complications related to immunological factors
25
.
Other geophilic species that were isolated included M. gypseum
(21.4%), M. nanum (3%), T. ajelloi (0.8%) and A. gypsea (0.8%) at
alkaline pH, except M. gypseum, which also showed growth at acid pH.
Similar results were obtained in soils from the Brazilian states of Rio de
Janeiro (31%)
10
, So Paulo (30%)
29
and Bahia (28.8%)
32
. However, in
Recife, Pernambuco State, 5.6% isolation was observed for this species
380
at alkaline pH
16
. High rates of M. gypseum were observed in soils from
Rio Grande do Sul, Brazil (79%)
8
, Argentina (89%)
13
, India (64%)
4
,
Kuwait (50%) in parks and gardens
1
, and Italy (39%)
25
.
M. gypseum has a universal distribution, and it is the etiological
agent of tinea capitis and tinea corporis in humans and animals,
where dogs, horses and rodents are common reservoirs of keratin
1
. In
this investigation, it was found in soils of empty lots, slums, schools,
squares, homes and rural areas. HAYASHI & TOSHITANI
11
reported,
in Japan, 271 cases of human infection by this fungal species. A case
of tinea capitis due to infection by this species, has been diagnosed
in Joo Pessoa-PB
18
.
Table 1
Dermatophytes isolated from urban and rural soil samples from 31 cities in four mesoregions of Paraiba State
Mesoregions Cities
Soil*
n
Dermatophytes**
A.g
n
M.g
n
M.n
n
T.a
n
T.m
n
T.te
n
T.t
n
T.v
n
Total
n
Mata Paraibana
Joo Pessoa 68 1 10 - - 18 12 2 5 48
Lucena 4 - - - - - 1 1 - 2
Pilar 5 - 1 - - 1 1 - - 3
Rio Tinto 5 - - - - 1 - - - 1
Santa Rita 3 - 1 - - - 1 - 1 3
Subtotal 85 1 12 - - 20 15 3 6 57
Agreste Paraibano
Alagoa Nova 7 - 1 - - - - - 1 2
Araruna 4 - 1 1 - - 3 - - 5
Areia 3 - - - - - 1 - - 1
Boa vista 4 - 1 - - 3 - - - 4
C. Grande 6 - 1 - - - - - - 1
Cuit 4 - 2 - - 2 - - 1 5
Ing 4 - - - - - 2 - - 2
Itabaiana 8 - - 1 - - 2 - 1 4
Soledade 3 - 1 - - - 2 - - 3
Subtotal 43 - 7 2 - 5 10 - 3 27
Borborema
Monteiro 4 - - - - 1 - - - 1
Pedra Lavrada 2 - - - - - 2 - - 2
So Joo Cariri 6 - - - - 3 - - 1 4
S. S.Umbuzeiro 3 - - - - - 2 - - 2
Santa Luzia 4 - - 1 - 1 1 - - 3
Sum 12 - - - 1 2 1 - - 4
Subtotal 31 - - 1 1 7 6 - 1 16
Serto Paraibano
Brejo Santos 7 - 1 - - - 1 1 - 3
Cajazeiras 4 - 1 - - 4 - - - 5
Catol Rocha 5 - 3 - - - 1 - - 4
Conceio 6 - - - - - 2 - - 2
Ibiara 4 - - 1 - - - - - 1
Jeric 3 - 1 - - 3 - - - 4
Patos 4 - - - - - 1 - - 1
Princesa Isabel 6 - 1 - - 1 3 - - 5
Souza 3 - 2 - - - - - - 2
Triunfo 6 - - - - 1 2 - - 3
Uirana 5 - - - - - - 1 - 1
Subtotal 53 - 9 - - 9 10 2 - 31
Total 212 1 28 4 1 41 41 5 10 131
* Some soil samples showed growth of more than one species of dermatophyte. ** Dermatophytes: A.g - Arthroderma gypsea; M.g - Microsporum gypseum; M.n - M.
nanum; T.a - Trichophyton ajelloi; T.m - T. mentagrophytes var. mentagrophytes; T.te - T. terrestre; T.to - T. tonsurans; T.v - T. verrucosum.
381
M. nanum (3%) was isolated for the rst time from soil of schools,
beaches and empty lots in Paraiba State. In a study carried out on soil of
a swimming resort, in Mexico, its isolation rate was 5%
19
.
T. ajelloi was isolated from soils of the South and Southeast regions
of Brazil
8,10,29
. ALVAREZ et al.
2
reported an isolation rate of 66% for this
fungus in soil of Argentina. In this study, the rst and only isolation of
this species (0.8%) was observed in soil around a school.
Among the zoophilic species, T. mentagrophytes var. mentagrophytes
was the species of highest incidence in soils of various places (schools,
gardens, parks, beaches, caverns, chicken coops, pens and homes) in
some Brazilian states such as Amazonas, So Paulo and Goias
29,34,35
, as
well as soils of Mexico, Iran, Nigeria and India
4,19,24,30,31
. In this study,
this species (31.3%) was isolated from all soils of urban and rural areas,
and one strain of this species was reported in highly acidic soil at pH
4.65. In Berlin, the average pH of positive keratinophilic fungal samples
was 5.8
7
, and in India, it was the most common isolated species from
pH 6.5 to 9.5 soils
14
.
T. verrucosum is a zoophilic species cited as the agent encountered
in the case of cattle, which can be transmitted to humans. It is usually
highly inammatory involving the scalp, beard or exposed area of
body
3,18
. In this investigation, T. verrucosum was reported from urban
areas at pH 6.65 - 8.05.
The isolation rate of T. tonsurans as an anthropophilic species was
3.8% in soils of schools, slums, beaches and empty lots and 80% at
alkaline pH. GOULART et al.
10
also reported the isolation of this species
in the soil of Rio of Janeiro. In Recife, an epidemiological correlation
has been observed between T. tonsurans isolated from soils of parks I
(28%) and II (20%) and dermatophytosis agents
16,18
.
CONCLUSION
The soils of urban areas within empty lots, schools, slums and
Table 2
Distribution of dermatophytes from soil samples of urban and rural areas of cities of Paraiba State
Urban Area
Rural Area
n
Total
n (%)
School*
n
Square*
n
Empty lot*
n
Slum*
n
Residence
n
Beach
n
Soils Samples
Negative 21 23 15 12 07 06 14 94 (44.3)
Positive 28 24 29 23 05 03 06 118 (55.7)
Dermatophytes
Trichophyton terrestre 10 12 11 07 - 01 - 41 (31.3)
T. mentagrophytes var. mentagrophytes 11 08 08 07 02 01 04 41 (31.3)
T. verrucosum 01 02 03 04 - - - 10 (7.6)
T. tonsurans 02 - 01 01 - 01 - 05 (3.8)
T. ajelloi 01 - - - - - - 01 (0.8)
Microsporum gypseum 03 03 09 08 03 - 02 28 (21.4)
M. nanum 02 01 01 - - - - 04 (3.0)
Anthroderma gypsea - - - 01 - - 01 (0.8)
Total 30 26 33 28 05 03 06 13
(%) (22.9) (19.8) (25.2) (21.4) (3.8) (2.3) (4.6) (100.0)
* Some soil samples showed growth of more than one species of dermatophytes.
Table 3
Distribution of dermatophytes, with reference to soil pH
Dermatophytes
Soil pH
Acid
4.65-6.65
Alkaline
7.02-9.06
Total
n (%)
Trichophyton terrestre 09 32 41 (31.3)
T. mentagrophytes var.
mentagrophytes
16 25 41 (31.3)
T. verrucosum 02 08 10 (7.6)
T. tonsurans 01 04 05 (3.8)
T. ajelloi - 01 01 (0.8)
Microsporum gypseum 10 18 28 (21.3)
M. nanum - 04 04 (3.1)
Anthroderma gypsea - 01 01 (0.8)
Total n (%) 38 (29%) 93 (71%) 131 (100.0)
Binomial test. H
0
: acid pH = alkaline pH and H
1
: acid pH alkaline pH;
= 0.000 0.05, reject H
0
.
382
squares of cities of mesoregions of Paraiba State were found to be the
most suitable reservoirs for almost all dermatophytes. Its growth may
have been inuenced by environmental factors such as residues of human
and/or animal keratin and alkaline pH.
RESUMO
Distribuio de dermattos isolados de solos de cidades do
Estado da Paraba, Brasil
Os dermattos, fungos queratinoflicos, representam importantes
microrganismos da microbiota do solo, onde existem espcies
cosmopolitas e outras de distribuio geogrca restrita. Este estudo teve
como objetivo ampliar o conhecimento da distribuio de dermattos
do solo proveniente de reas urbanas (terrenos baldios, escolas, favelas,
praas, praias e residncias) e rurais de quatro mesorregies paraibanas
e da inuncia do pH na adaptao desse grupo de fungos. Amostras
de solos urbanos e rurais foram coletadas de 31 cidades do estado da
Paraba, Brasil. De 212 amostras 62% apresentaram crescimento fngico,
destacando-se a Mesorregio da Mata Paraibana (43.5%), a qual apresenta
clima tropical, quente e mido. O pH das amostras de solo variou de
4.65 a 9.06, com crescimento de 71% dos dermattos em pH alcalino
(7.02 - 9.06) ( = 0.000). Das 131 cepas isoladas 57.3% eram espcies
geoflicas, destacando-se Trichophyton terrestre (31.3%) e Microsporum
gypseum (21.4%). M. nanum e T. ajelloi foram isolados pela primeira
vez no estado da Paraba. Entre as espcies zooflicas foram identicadas
T. mentagrophytes var. mentagrophytes (31.3%) e T. verrucosum (7.6%)
e como espcie antropoflica foi isolada T. tonsurans. Os solos de
terrenos baldios, escolas, favelas e praas de cidades paraibanas so os
reservatrios mais adequados dos dermattos, cujo crescimento pode ter
sido inuenciado por fatores ambientais, solos com resduos de queratina
humana e ou animal e pH alcalino.
ACKNOWLEDGEMENTS
The authors would like to thank to the Laboratory of Ceramics for
collecting and measuring the pH of soils samples.
REFERENCES
1. Al-Musallam AA, Al-Zarban SS, Al-San NA, Ahmed TM. A report on the
predominant occurrence of a dermatophytes species in cultivated soil from Kuwait.
Mycopathologia. 1995;130:159-61.
2. Alvarez DP, Luque AG, Marini P. Inuencia del sustrato queratinoso de suelos de
Pradera sobre la colonizacin por dermatotos geoflicos. Bol Micol. 1986;3:25-9.
3. Amaral CDP, Pereira DIB, Meireles MCA. Caracterizao da microbiota por fungos
lamentosos no tratamento hpico de bovinos de corte. Ci Rural. 2011;41:2137-42.
4. Anbu P, Hilda A, Gopinath SC. Keratinophilic fungi of poultry farm and feather
dumping soil in Tamil Nadu, India. Mycopathologia. 2004;158:303-9.
5. Barnett HL, Hunter BB. Illustrated genera of imperfect fungi. 4
th
ed. New York:
Burgess; 1986.
6. Bohacz J, Kowalska TK. Species diversity of keratinophilic fungi in various soil
types. Cent Eur J Biol. 2012;7:259-66.
7. Bhme H, Ziegler W. The distribution of geophilic dermatophytes and other
keratinophilic fungi in relation to the pH of the soil. Mycopathol Mycol Appl.
1969;38:247-55.
8. Fischman O, Ramos CD. Geophilic dermatophytes recovered from Rio Grande do
Sul soil. Mycopathol Mycol Appl. 1967;33:157-60.
9. Ganaie MA, Sood S, Rizvi G, Khan TA. Isolation and identication of keratinophilic
fungi from different soil samples in Jhansi city (India). Plant Pathol J. 2010;9:194-7.
10. Goulart EG, Lima SMF, Carvalho MA, Oliveira JA, Jesus MM, Campos RE, et al.
Isolamento de fungos patognicos do solo no municpio do Rio de Janeiro, RJ, Brasil.
Folha Md. 1986;93:15-20.
11. Hayashi N, Toshitani S. Human infections with Microsporum gypseum in Japan.
Mykosen. 1983;26:337-45.
12. Hoog GS, Guarro J, Figueras MJ. Atlas of clinical fungi. 2
nd
ed. Utrecht:
Centraalbureau voor Schimmelcultures; 2000. 1126p.
13. Iovannitti CA, Malliarchuk O, Casanova A, Dawson M. Estudio micolgico en
muestras de tierra de la ciudad de la Plata. Rev Argent Micol. 1985;8:9-11.
14. Jain N, Sharma M. Distribution of dermatophytes and other related fungi in Jaipur
city, with particular reference to soil pH. Mycoses. 2011;54:52-8.
15. Kaul S, Sumbali G. Impact of some ecological factors on the occurrence of poultry
soil-inhabiting keratinophiles. Mycopathologia. 1998;143:155-9.
16. Leal AFG, Macdo DPC, Laranjeira D, Souza-Motta CM, Fernandes MJS, Magalhes
OMC, et al. Correlao epidemiolgica entre fungos queratinoflicos isolados do solo
e agentes de dermatomicoses. Rev Soc Bras Med Trop. 2009;42:471-3.
17. Lee MJ, Park JS, Chung H, Jun JB, Bang YJ. Distribuition of soil keratinophilic
fungi isolated in summer beaches of the east sea in Korea. Korea J Med Mycol.
2011;16:44-50.
18. Lima OE, Pontes ZBVS, Oliveira NMC, Carvalho MFFP, Guerra MFL, Santos JP.
Freqncia de dermatotoses em Joo Pessoa, Paraba, Brasil. An Bras Dermat.
1999;74:127-32.
19. Lpez Martnez R. Investigacin de algunas fuentes de infeccin en las dermatotoses:
estudio de suelos, animales y hombre. Gac Md Mx. 1986;122:167-72.
20. Mahmoudabadi AZ, Zarrin M. Isolation of dermatophytes and related keratinophilic
fungi from the two public parks in Ahvaz. Jundishapur J Microbiol. 2008;1:20-3.
21. Mangiaterra ML, Alonso JM. Keratinophilic fungi in soils of Corrientes city
(Argentina). Bol Micol. 1989;4:129-33.
22. Norusis MJ. SPSS for Windows-Base System Users Guide, Release 13.0. Chicago:
SPSS.
23. Ogbonna CI, Pugh GJ. Keratinophilic fungi from Nigerian soil. Mycopathologia.
1987;99:115-8.
24. Oyeka CA, Okoli I. Isolation of dermatophytes and non-dermatophytic fungi from
soil in Nigeria. Mycoses. 2003;46:336-8.
25. Papini R, Mancianti F, Grassotti G, Cardini G. Survey of keratinophilic fungi isolated
from city park soils of Pisa, Italy. Mycopathologia. 1998;143:17-23.
26. Pontes ZBVS, Oliveira AC. Dermatophytes from urbain soils in Joo Pessoa, Paraba,
Brazil. Rev Arg Microbiol. 2008;40:161-3.
27. Rebell G, Taplin D. Dermatophytes: their recognition and identication. Coral Gables;
University of Miami; 1974.
28. Rodriguez JL. Atlas escolar da Paraba. 3. ed. Joo Pessoa: Graset; 2002.
29. Rogers AL, Beneke EJ. Human pathogenic fungi recovered from Brazilian soil.
Mycopathol Mycol Appl. 1964;22:15-20.
383
30. Shadzi S, Chadeganipour M, Alimoradi M. Isolation of keratinophilic fungi from
elementary schools and public parks in Isfahan, Iran. Mycoses. 2002;45:496-9.
31. Sharma M. Incidence of dermatophytes and other keratinophilic fungi in the schools
and college playground soils of Jaipur, India. Afr J Microbiol Res. 2010;4:2647-54.
32. Silva ME. Ocorrncia de Cryptococcus neoformans e Microsporum gypseum em
solos da Bahia, Brasil. Bol Fund Gonalo Moniz. 1960;17:1-14.
33. Vanbreuseghem R. Technique biologique pour lisolement des dermatophytes de sol.
Ann Soc Belge Md Trop. 1952;32:173-8.
34. Vilela EM, Moraes MAP. Isolamento de Microsporum gypseum e Trichophyton
mentagrophytes no solo da cidade de Manaus, Amazonas (Brasil). Rev Inst Med
Trop Sao Paulo. 1962;4:299-301.
35. Zampronha VCC, Oliveira IP, Monteiro MSR, Souza H, Santos KJG, Arajo AA.
Isolamento e identicao de dermattos presentes no contnuo do solo de cerrado
do campus II da Universidade Catlica de Gois. Rev Eletrn Fac Montes Belos.
2005;1:37-46.
Received: 16 January 2012
Accepted: 28 March 2013
Revista do Instituto de Medicina Tropical de So Paulo
on line.
Publications from 1987 to the present data are now available on:
http://www.scielo.br/rimtsp
PAST ISSUES 1959-1989 (PDF)
www.imt.usp.br/portal/
SciELO The Scientifc Electronic Library OnLine - SciELO is an electronic virtual covering a selected
collection of Brazilian scientifc journals.
The library is an integral part of a project being developed by FAPESP Fundao de Amparo Pesquisa do
Estado de So Paulo, in partnership with BIREME the Latin American and Caribbean Center on Health Sciences
Information.
SciELO interface provides access to its serials collection via an alphabetic list of titles or a subject index or a
search by word of serial titles, publisher names, city of publication and subject.
The interface also provides access to the full text of articles via author index or subject index or a search form
on article elements such as author names, words from title, subject and words from full text.
FAPESP/BIREME Project on Scientifc Electronic Publications
Latin American and Caribbean Center on Health Sciences Information
Rua Botucatu 862 04023-901 So Paulo, SP Brazil
Tel. (011) 5576-9863
scielo@bireme.br
doi: 10.1590/S0036-46652013000600003
(1) Laboratory of Medical Mycology, Department of Clinical Analysis and Biomedicine.
(2)

Laboratory of Cell Biology, Department of Cell Biology and Genetics. State University of Maringa, Parana,Brazil.
Correspondence to: Terezinha Inez Estivalet Svidzinski, Departmento de Anlises Clnicas e Biomedicina, Universidade Estadual de Maring, Av. Colombo 5790, sala 203, Bloco T20,
87020-900 Maring, PR, Brasil. Phone: +55 44 3011 48 09, FAX: +55 44 3011 49 59. E-mail: terezinha.svidzinski@gmail.com
MOLECULAR TYPING OF Candida albicans ISOLATES FROM HOSPITALIZED PATIENTS
Patrcia de Souza BONFIM-MENDONA(1), Adriana FIORINI(1), Cristiane Suemi SHINOBU-MESQUITA(1), Lilian Cristiane BAEZA(1),
Maria Aparecida FERNANDEZ(2) & Terezinha Inez Estivalet SVIDZINSKI(1)
SUMMARY
Introduction: The majority of nosocomial fungal infections are caused by Candida spp. where C. albicans is the species most
commonly identied. Molecular methods are important tools for assessing the origin of the yeasts isolated in hospitals. Methods:
This is a study on the genetic proles of 39 nosocomial clinical isolates of C. albicans using two typing methods: random amplied
polymorphic DNA (RAPD) and microsatellite, two different primers for each technique were used. Results: RAPD provided 10 and
11 different proles with values for S
AB
of 0.84 0.126 and 0.88 0.08 for primers M2 and P4, respectively. Microsatellite using
two markers, CDC3 and HIS3, allowed the observation of six and seven different alleles, respectively, with combined discriminatory
power of 0.91. Conclusions: Although genetic variability is clear, it was possible to identify high similarity, suggesting a common
origin for at least a part of isolates. It is important to emphasize that common origin was proven from yeasts isolated from colonization
(urine, catheter or endotracheal secretions) and blood culture from the same patient, indicating that the candidemia must have started
from a site of colonization. The combination of RAPD and microsatellite provides a quick and efcient analysis for investigation of
similarity among nosocomial isolates of C. albicans.
KEYWORDS: Candida albicans; Microsatellite; RAPD; Nosocomial infection.
INTRODUCTION
The incidence of fungal infections in hospitals is increasing
substantially in different parts of the world. This is due, among other factors,
to the increase of immunocompromised patients undergoing invasive
treatments and prolonged hospital stay
27
. Candida spp. is the most frequent
genus of fungal infections, in the U.S. it is the fourth agent of bloodstream
infections, which are considered severe and with attributed mortality rates
of 30-60%
4,8,18
. In Brazil, the incidence of candidemia in teaching hospitals
is of 2.49 cases per 1,000 admissions
14
, which represents the values 6.6-12.5
times higher than those reported in some European countries
14
. C. albicans
is still the most frequently isolated species of both supercial and invasive
infections in Brazil as well as in the world
3,9
.
Despite the evidence for transmission of Candida spp. by direct
or indirect contact and evidence of cross-infection by health care
workers, little is known about the origin of clinical isolates of C.
albicans. Information on molecular epidemiology has great relevance
for the clinical management, treatment and epidemiology of recurrent
infections, especially among critically ill patients
10,11,30
. This context led
to the proposal of a variety of molecular typing techniques aiming at
distinguishing isolates of Candida spp. from different sources. Among
others, the best known are: multilocus sequence typing (MLST), pulsed-
eld gel electrophoresis (PFGE), duplex PCR, restriction fragment length
polymorphisms (RFLP), randomly amplied polymorphic DNA (RAPD)
and microsatellites
5,13,21,26,31,34,38
.
The microsatellite analysis is a technique which has been recently
used for genotyping C. albicans
1,6,7
. It is formed by short tandem repeats
of two to six nucleotides known to be highly polymorphic, generating
a characteristic prole of different alleles for a given locus. Due to its
high discriminatory potential, this approach allows studies of nosocomial
transmission routes
6,32,33
. Microsatellite has been used to investigate the
molecular prole of C. albicans from healthy individuals
15
, HIV sero-
positive
26
and with recurrent vulvovaginal candidiasis
32
.
Among the currently available to C. albicans genotyping techniques,
RAPD is relatively cost-effective and it offers similar resolving power
to electrophoretic karyotyping. These characteristics together with
dendrograms of genetic relatedness among C. albicans isolates has
signicantly advanced lineage studies over progressive infective episodes
or during asymptomatic carriage
16,36
. In addition, RAPD has been used to
investigate infections caused by identical or similar strains
35
, emergence
of resistance strains during antifungal therapy
20,26
, colonization patterns
of yeast strains in different clinical situations, and microevolution of
strains within a particular species
20
.
Thus, the aim of this study was to determine the genetic relatedness
BONFIM-MENDONA, P.S.; FIORINI, A.; SHINOBU-MESQUITA, C.S.; BAEZA, L.C.; FERNANDEZ, M.A. & SVIDZINSKI, T.I.E. - Molecular typing of Candida albicans isolates from
hospitalized patients. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 385-91, 2013.
386
of C. albicans from hospitalized patients by using the RAPD and
microsatellites assays.
Microorganisms: A total of 39 strains of C. albicans isolated
from different sources of patients hospitalized at University Hospital
of Maringa in 2009, were used in this study. The yeasts were screened
in chromogenic media CHROMagar
Candida and identified by

conventional phenotypic methods (germ tube, microculture in cornmeal
agar supplemented with 1% Tween 80, auxanogram and zymogram test)
39
.
Yeasts were taken from the following sources: urine 51.5% (N = 20),
blood 20.5% (N = 8), catheter tip 15.5% (N = 6), orotracheal discharge
10% (N = 4) and peritoneal uid 2.5% (N = 1). Regarding hospital sectors,
49% (N = 19) were isolated from adult Intensive Care Unit (ICU), 18%
(N = 7) medical clinic, 13% (N = 5) pediatrics, 7.5% (N = 3) Neonatal
Intensive Care Unit (NICU), 5% (N = 2) surgical clinic and 7.5% (N =
3) pediatric ICU.
DNA Extraction: The yeast strains were grown overnight at 25 C
using Sabouraud Dextrose Broth (SDB, Difco, USA) and genomic DNA
extracted as described by CHONG et al.
12
. The concentration (260 nm)
and purity (260/280) of the genomic DNA obtained were determined by
optical density in a spectrophotometer, the visualization was made out
in agarose gel at 0.7% with 1X TBE buffer (Tris-base 90 mmol l
-1
, Boric
acid 90 mmol l
-1
, EDTA 2 mmol l
-1
pH 8.0).
Nested-PCR: Identication of yeasts was conrmed by Nested-
PCR which comprised two amplication stages, according to LUO &
MITCHELL
23
. Briey, primers that amplied Internal Transcribed Spacer
(ITS) fragments of DNAr and identied the genus Candida were used
in the rst reaction. Amplication of species specic primers was used
in the second reaction.
RAPD (Random Amplified Polymorphic DNA): RAPD was
performed using the kit Ready-To-Go RAPD Analysis Beads
(Amersham
Biosciences Corporation, Piscataway, NJ, USA) as described by the
manufacturer. The RAPD reactions were performed by adding 30 ng of
genomic DNA, one mol l
-1
oligonucleotide and water for a nal volume of
25 L to each tube containing Ready-To-Go beads. The oligonucleotides
used were M2 (5-CTTGATTGCC-3)
25
and P4 (5-AAGAGCCCGT-3
- Analysis Kit Ready-To-Go/RAPD Beads). The reaction was conducted
in a in a Eppendorf Mastercycler Gradient Thermocycler
as follows: 95
C for ve min, followed by 45 cycles consisting of 95 C for one min,
36 C for one min and 72 C for ve min. Control tubes without template
DNA were included in each run and reproducibility of the method was
checked by repeating the amplication using different DNA extractions
from two isolates and at least three different days.
The PCR products were electrophoresed in 2% agarose gel (w/v) in
1X TBE buffer at 150 volts for three hours. Amplicons in the gel were
stained with ethidium bromide (0.5 mg mL
-1
) and visualized under
UV transillumination (UVP Bioimaging Systems, Upland, CA
). The
RAPD proles were analyzed using Bionumerics
software version 4.6

(Applied Maths
).
The similarity was veried by the coefcient (S
AB
) between each
pair of standards for A and B isolates and calculated with the formula
S
AB
= 2E / (2E + a + b), where E is the number of common bands in
the patterns A and B, a is the number of bands with an a pattern and no
B correlated patterns, and b is the number of bands with B pattern and
no correlation in pattern A. From the similarity matrix, the units were
grouped by UPGMA (Unweighted Pair-Group Method with Arithmetical
Average). An S
AB
value of 1.00 indicates that the pattern of bands for line
A is identical to B; values between 0.80 to 0.99 represent very similar
clinical isolates but not identical, and may suggest microevolution of
a single strain; S
AB
values less than 0.80 represent independent lines
12
.
Microsatellites: Samples were genotyped using two microsatellite
markers, CDC3 and HIS3, whose primer sequences were shown in Table
1, and all technical procedure was performed as described by BOTTEREL
et al.
7
. The amplication products were analyzed by electrophoresis in
polyacrylamide gel at 8% (w/v) in 1X TBE buffer for ve hours at 140
volts. For the determination of the sizes of the fragments we used the
molecular size marker 25 bp (Invitrogen
). After the run, the gel was

stained with ethidium bromide (0.5 mg mL
-1
) and photodocumented
under UV transillumination (UVP Bioimaging Systems, Upland, CA
).
The size of the amplied fragments was determined by image analysis
software LabImage 1D (Loccus Biotech
).
The results were expressed according to the tested locus name and
size of the two alleles observed in base pairs. The reproducibility of this
step was ensured by the inclusion of analysis of a strain of C. albicans
ATCC 38696 which provided repeatable and consistent results with those
obtained by BOTTEREL et al.
7
.
RESULTS
Analysis by Nested-PCR: Amplications with primers ITS1/ITS4
Table 1
Primers used for genotyping of C. albicans isolates by Microsatellite and RAPD
Locus (GenBank access number), chromosome Primer Nucleotide sequence (forward and reverse)
Microsatellite
CDC3 (Z25869), chromosome 1 CDC3
5-CAGATGATTTTTTGTATGAGAAGAA-3
5-CAGTCACAAGATTAAAATGTTCAAG-3
HIS3 (AF006605), chromosome 2 HIS3
5-TGGCAAAAATGATATTCCAA-3
5-TACACTATGCCCCAAACACA-3
RAPD
- P4 5-AAGAGCCCGT-3
- M2 5-CTTGATTGCC-3
387
resulted in patterns of bands with 500 bp identifying Candida spp.
The species-specic primers provided amplication of fragments with
approximately 272 bp, thus conrming the classic identication that the
isolated are indeed C. albicans species.
RAPD profiles: Analysis using primer M2 demonstrated the
formation of 10 proles with values of 0.84 0.126 for S
AB
(Fig. 1). Three
groups (I, II and III) were formed with 67% similarity between them.
Group I consisted of four subgroups (IA, IB, IC and ID), which clustered
approximately 70% of the isolates with similarity of 80%. Primer P4
generated 11 different proles, with a S
AB
value of 0.88 0.08. There
was the formation of only one cluster, containing 95% of the isolates
with approximately 85% similarity (Fig. 2).
Microsatellites: For all isolates tested we obtained products
characteristic of microsatellite amplication. One or two PCR fragments
by locus were produced for each isolate, since C. albicans is diploid,
and each fragment was dened as an allele. The observed differences
in size of alleles are attributed to the different numbers of repeats of
microsatellites. The strains with two PCR products were typed as
heterozygous, while those who had a single amplication product were
considered homozygous.
The analysis of independent 39 isolates showed that all microsatellite
loci were polymorphic, evidencing between six and seven alleles, and
eight and nine different genotypes for the CDC3 and HIS3 primers
respectively (Table 2). The discriminatory power (DP) was calculated
for each marker according to the Simpson index:
where N is the number of strains, s is the total number of different
genotypes, and nj is the number of strains of genotype j
22
. The results
showed that CDC3 was the microsatellite with the highest DP value (0.85),
while HIS3 presented the lowest DP value (0.90). When the two markers are
combined, the DP was 0.91. An index over or greater than 0.90 is desirable
if the typing results are to be interpreted with condence
22
.
The 39 samples were recovered from 34 patients because in ve of
them the same species was isolated from two different sites. A comparison
of the genetic prole by microsatellite and RAPD (Table 3) showed total
identity between these pairs.
Fig. 2 - Dendrogram generated from the amplication by primer P4 and by UPGMA grouping,
in which S
AB
was calculated by the coefcient of Dice for 39 C. albicans isolates. Vertical line
divides dendrogram as from 80% similarity level, in which Group I gathers 95% of samples.
In the samples identication the equal number and different letter mean same patient. SC:
Surgery clinic; aICU: adult ICU; pICU: pediatry ICU; nICU: neonatal ICU; MC: Medical
clinic; Ped: Pediatrics.
Fig. 1 - Dendrogram generated by amplication of primer M2 and by UPGMA grouping, in
which S
AB
was calculated by the coefcient of Dice for 39 C. albicans isolates. Vertical line
divides dendrogram as from the 80% similarity level; the four sub-groups (IA, IB, IC and ID)
gather almost 70% of samples. In the samples identication the equal number and different
letter mean same patient. SC: Surgery clinic; aICU: adult ICU; pICU: pediatry ICU; nICU:
neonatal ICU; MC: Medical clinic; Ped: Pediatrics.
388
Table 2
Origin of 39 Candida albicans isolates and their respective genotypes determined by microsatellite analysis
Samples
Origin of isolates Primer CDC3 Primer HIS3
N Genotypes
H. U. Source
Allele 1
(bp)
Allele 2
(bp)
Allele 1
(bp)
Allele 2
(bp)
2A SC Blood 129 125 150 194
2 A
2B aICU TOT 129 125 150 194
07 aICU Catheter tip 121 117 154 154 1 B
3B pICU Catheter tip 129 125 150 162
2 C
3A pICU Blood 129 125 150 162
08 aICU Catheter tip 125 117 162 162
9 D
11 nICU Blood 125 117 162 162
32 MC Urine 125 117 162 162
33 aICU Urine 125 117 162 162
20 Pediatrics Catheter tip 125 117 162 162
34 aICU TOT 125 117 162 162
21 aICU Urine 125 117 162 162
19 aICU Urine 125 117 162 162
10 nICU Blood 125 117 162 162
1B Pediatrics Catheter tip 137 121 158 162
6 E
23 MC Urine 137 121 158 162
30 MC Urine 137 121 158 162
14 aICU Urine 137 121 158 162
15 aICU Urine 137 121 158 162
1A Pediatrics Blood 137 121 158 162
4A MC Blood 129 121 158 158
4 F
4B MC Urine 129 121 158 158
5B aICU Catheter tip 129 121 158 158
5A aICU TOT 129 121 158 158
09 aICU Blood 117 113 150 162
2 G
13 aICU Peritoneal uid 117 113 150 162
31 aICU Urine 121 121 154 174
2 H
06 nICU Blood 121 121 154 174
22 MC Urine 121 117 166 166
2 I
12 aICU TOT 121 117 166 166
17 aICU Urine 125 125 166 166 1 J
16 aICU Urine 125 125 162 162
2 K
18 aICU Urine 125 125 162 162
25 pICU Urine 129 121 150 150 1 L
24 MC Urine 129 121 162 162
5 M
28 aICU Urine 129 121 162 162
29 aICU Urine 129 121 162 162
27 SC Urine 129 121 162 162
26 aICU Urine 129 121 162 162
SC: Surgery clinic; aICU (Intensive Care Unit): adult ICU; pICU: pediatric ICU; nICU: neonatal ICU; MC: medical clinic. N: number of genotype. H.U.: Hospital
Unit; TOT: endotracheal aspirate.
389
DISCUSSION
RAPD and microsatellite analysis were able to show similarity
among C. albicans isolates recovered from a hospital. Microsatellite
analysis supplied a good DP with markers used, it allowed formation of
various genotypes grouping samples, conrming the similarity between
them, which reinforces the interpretation of the data found in RAPD.
Additionally, it was possible to prove the high similarity (100%) of
the same yeast which was from colonization (urinary catheter, tracheal
secretions) and later detected in blood cultures from the same patient.
The RAPD results showed S
AB
values of 0.84 0.126 for the primer
M2 and S
AB
0.88 0.08 for P4 (Fig. 1 and 2). It is important to highlight
that the strains that are considered identical by a primer are not always
necessarily also considered identical or belong to the same cluster when
analyzed by another primer. This should be referred as a limitation of the
technique, nevertheless according to CHONG et al.
12
the values found,
in RAPD, indicate high similarity between the isolates.
In microsatellite analysis we were able to verify the presence of six
different alleles with the primer CDC3 and seven alleles with primer
HIS3, of which 113bp, 117bp, 125bp, 150bp, 154bp, 158bp and 162bp
have already been recognized by other authors
1,6,7
. These primers amplify
microsatellite regions highly polymorphic for C. albicans. Moreover,
these regions are stable over generations and were chosen because they
are located on different chromosomes, which increase the chances of
nding polymorphisms
7
. The discriminatory power (DP) found using
markers CDC3 and HIS3, was 0.85 and 0.90 respectively. These results
and especially the combined value of DP (0.91) are considered by several
authors as reliable studies of molecular typing
7,22
. The data presented in
Table 2 show the prevalence of genotypes (D, E, F, M), however, there
is no relation with sites of isolation of yeasts. This type of observation
has already been described in another study using the same genotyping
technique
2
. Finally, by putting together epidemiological data (Fig. 1 and
2, Table 2), it is possible to observe the formation of groups with high
similarity (90-100%). These are mostly from patients hospitalized in ICU
where the evidence of common origin is of great importance. According
to AL-KARAAWI et al.
2
, the clinical isolates of C. albicans tend to be
genetically similar to each other if they were isolates from patients with a
similar prole, as those interned in ICU. CHAVES et al.
10
recently showed
that candidemic patients had highly related microsatellites genotype in
colonizing and bloodstream isolates. However, it should be noted that
the detection of yeasts highly similar in our study was not associated
with hospital unit. The same prole was found in various hospital areas
such as pediatric and internal medicine. These data reinforce that most
C. albicans infections are from endogenous sources. They should also
suggest that these strains may be circulating in the various units, but not
characterizing the occurrence of outbreaks.
Although the infection of different patients from different sectors with
yeasts of the same genetic prole insinuates cross-transmission
17,19
, high
similarity among samples suggests an adaptation to the environmental
conditions, thus characterizing microevolutions
28
. Five (14.70%) of all
patients enrolled in this study are particularly interesting since C. albicans
were isolated from different sites. In all cases the analysis conrmed that
the clinical isolates were identical to each other (Table 3) indicating the
migration of yeasts from colonization (urine catheters, tracheal secretion)
into the blood, suggesting the source of systemic infection. This result
indicates that each isolated pair has genotypic identity, suggesting
clonal origin. This fact has been demonstrated by molecular typing, in
several studies
10,24,29,37
and helps conrm that previous colonization is an
important predisposing factor for systemic infection.
Despite the small number of samples analyzed, this study contributes
with the understanding on epidemiology of fungal infections in hospitals.
The analyzed data allow us to conclude that both techniques generated
reproducible proles showing similarity among the isolates. These
techniques are suitable for epidemiological molecular studies of C.
albicans and can be applied in larger populations. The good performance
of these techniques allows its use for genotyping of outbreaks of hospital
Table 3
Similarity by Random Amplied Polymorphic DNA and genotype by Microsatellite of Candida albicans isolated in two sources from a same patient
Patient Source
Genotype RAPD
CDC3
(bp)
HIS3
(bp)
S
AB
Primer M2 S
AB
Primer P4
1
1B Catheter tip 137:121 158:162 1.00 1.00
1A Blood 137:121 158:162 1.00 1.00
2
2B TOT 129:125 150:194 1.00 1.00
2A Blood 129:125 150:194 1.00 1.00
3
3B Catheter tip 129:125 150:162 1.00 1.00
3A Blood 129:125 150:162 1.00 1.00
4
4B Urine 129:121 158:158 1.00 1.00
4A Blood 129:121 158:158 1.00 1.00
5
5A TOT 129:121 158:158 1.00 1.00
5B Catheter tip 129:121 158:158 1.00 1.00
TOT: endotracheal aspirate.
390
origin or not, and characterization of isolates from different sites,
including recurrent infections such as vulvovaginal candidiasis and
investigations before and after treatments. Knowledge of the relationship
of clinical isolates involved in infections is extremely important for the
development and application of the correct therapeutic strategy and to
better understand the epidemiology of these infections.
RESUMO
Tipagem molecular de Candida albicans isoladas de pacientes
hospitalizados
Introduo: A maioria das infeces fngicas hospitalares so
causadas por Candida spp. e C. albicans a espcie mais comumente
identicada. Mtodos moleculares so ferramentas importantes para a
avaliao da origem das leveduras isoladas em hospitais. Mtodos: Este
um estudo sobre o perl gentico de 39 isolados clnicos nosocomiais
de C. albicans atravs das tcnicas de RAPD e microssatlite, foram
usados dois diferentes iniciadores para cada tcnica. Resultados:
RAPD forneceu 10 e 11 diferentes pers com valores de SAB 0,84
0,126 e 0,88 0,08 para os primers M2 e P4, respectivamente. A anlise
de microssatlites, usando os marcadores CDC3 e HIS3 permitiu a
observao de seis e sete diferentes alelos respectivamente, com poder
discriminatrio combinado de 0,91. Concluses: Embora seja clara a
variabilidade gentica, foi possvel identicar alta similaridade, sugerindo
origem comum para pelo menos parte deles. importante enfatizar que
foi comprovada origem comum de leveduras isoladas de colonizao
(urina, cateter ou secreo orotraqueal) e hemocultura do mesmo
paciente, indicando que a candidemia deve ter iniciado a partir de um
stio de colonizao. A combinao das tcnicas RAPD e microssatlites
fornece uma anlise rpida e eciente para investigao de similaridade
entre isolados nosocomiais de C. albicans.
REFERENCES
1. Adachi H, Shimizu K, Hattori H, Tanaka R, Chibana H, Takagi Y, et al. Genotyping of
Candida albicans by fragment analysis of microsatellites combined with 25S rDNA
and RPS-based strategies. Nihon Ishinkin Gakkai Zasshi. 2009;50:167-74.
2. Al-Karaawi ZM, Manfredi M, Waugh ACW, McCullough MJ, Jorge J, Scully C, et al.
Molecular characterization of Candida spp. isolated from the oral cavities of patients
from diverse clinical settings. Oral Microbiol Immunol. 2002;17:44-9.
3. Arajo SM, Fontes CJ, Leite Jnior DP, Hahn RC. Fungal agents in different anatomical
sites in public health services in Cuiab, state of Mato Grosso, Brazil. Rev Inst Med
Trop Sao Paulo. 2012;54:5-10.
4. Asmundsdottir LR, Erlendsdottir H, Haraldsson G, Guo H, Xu J, Gottfredsson M.
Molecular epidemiology of candidemia: evidence of clusters of smoldering
nosocomial infections. Clin Infect Dis. 2008;47:17-24.
5. Ben Abdeljelil J, Saghrouni F, Emira N, Valentin-Gomez E, Chatti N, Boukadida J, et al.
Molecular typing of Candida albicans isolates from patients and health care workers
in a neonatal intensive care unit. J Appl Microbiol. 2011;111:1235-49.
6. Beretta S, Fulgencio JP, Enache-Angoulvant A, Bernard C, El Metaoua S, Ancelle T, et
al. Application of microsatellite typing for the investigation of a cluster of cases of
Candida albicans candidaemia. Clin Microbiol Infect. 2006;12:674-6.
7. Botterel F, Desterke C, Costa C, Bretagne S. Analysis of microsatellite markers of Candida
albicans used for rapid typing. J Clin Microbiol. 2001;39:4076-81.
8. Bougnoux ME, Kac G, Aegerter P, dEnfert C, Fagon JY, CandiRea Study Group.
Candidemia and candiduria in critically ill patients admitted to intensive care units
in France: incidence, molecular diversity, management and outcome. Intensive Care
Med. 2008;34:292-9.
9. Chang MR, Correia FP, Costa LC, Xavier PCN, Palhares DB, Taira DL, et al. Candida
bloodstream infection: data from a teaching hospital in Mato Grosso do Sul, Brazil.
Rev Inst Med Trop Sao Paulo. 2008;50:265-8.
10. Chaves GM, Santos FP, Colombo AL. The persistence of multifocal colonisation
by a single ABC genotype of Candida albicans may predict the transition from
commensalism to infection. Mem Inst Oswaldo Cruz. 2012;107:198-204.
11. Chong PP, Abdul Hadi SR, Lee YL, Phan CL, Tan BC, Ng KP, et al. Genotyping and
drug resistance prole of Candida spp. in recurrent and one-off vaginitis, and high
association of non-albicans species with non-pregnant status. Infect Genet Evol.
2007;7:449-56.
12. Chong PP, Lee YL, Tan BC, Ng KP. Genetic relatedness of Candida strains isolated from
women with vaginal candidiasis in Malaysia. J Med Microbiol. 2003;52:657-66.
13. Chvez-Galarza J, Pais C, Sampaio P. Microsatellite typing identies the major clades
of the human pathogen Candida albicans. Infect Genet Evol. 2010;10:697-702.
14. Colombo AL, Nucci M, Park BJ, Nour SA, Arthington-Skaggs B, Da Matta DA, et
al. Epidemiology of candidemia in Brazil: a nationwide sentinel surveillance of
candidemia in eleven medical centers. J Clin Microbiol. 2006;44:2816-23.
15. Dalle F, Dumont L, Franco N, Mesmacque D, Caillot D, Bonnin P, et al. Genotyping of
Candida albicans oral strains from healthy individuals by polymorphic microsatellite
locus analysis. J Clin Microbiol. 2003;41:2203-5.
16. Dassanayake RS, Samaranayake LP. Amplication-based nucleic acid scanning techniques
to assess genetic polymorphism in Candida. Crit Rev Microbiol. 2003;29:1-24.
17. De Pinho Resende JC, Franco GR, Rosa CA, Hahn RC, Hamdan JS. Phenotypic and
genotypic identication of Candida spp. isolated from hospitalized patients. Rev
Iberoam Micol. 2004;21:24-8.
18. DiNubile MJ, Lupinacci RJ, Strohmaier KM, Sable CA, Kartsonis NA. Invasive
candidiasis treated in the intensive care unit: observations from a randomized clinical
trial. J Crit Care. 2007;22:237-44.
19. Eggimann P, Garbino J, Pittet D. Epidemiology of Candida species infections in critically
ill non-immunosuppressed patients. Lancet Infect Dis. 2003;3:685-702.
20. Enger L, Joly S, Pujol C, Simonson P, Pfaller M, Soll DR. Cloning and characterization
of a complex DNA ngerprinting probe for Candida parapsilosis. J Clin Microbiol.
2001;39:658-69.
21. Ge SH, Xie J, Xu J, Li J, Li DM, Zong LL, et al. Prevalence of specic and phylogenetically
closely related genotypes in the population of Candida albicans associated with
genital candidiasis in China. Fungal Genet Biol. 2011;49:86-93.
22. Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems:
an application of Simpsons index of diversity. J Clin Microbiol. 1988;26:2465-6.
23. Luo G, Mitchell TG. Rapid identication of pathogenic fungi directly from cultures by
using multiplex PCR. J Clin Microbiol. 2002;40:2860-5.
24. Marco F, Lockhart SR, Pfaller MA, Pujol C, Rangel-Frausto MS, Wiblin T, et al.
Elucidating the origins of nosocomial infections with Candida albicans by DNA
ngerprinting with the complex probe Ca3. J Clin Microbiol. 1999;37:2817-28.
25. Melo AS, de Almeida LP, Colombo AL, Briones MR. Evolutionary distances and
identification of Candida species in clinical isolates by randomly amplified
polymorphic DNA (RAPD). Mycopathologia. 1998;142:57-66.
391
26. Metzgar D, Van Belkum A, Field D, Haubrich R, Wills C. Random amplication of
polymorphic DNA and microsatellite genotyping of pre-and posttreatment isolates
of Candida spp. from human immunodeciency virus-infected patients on different
uconazole regimens. J Clin Microbiol. 1998;36:2308-13.
27. Patterson TF. Advances and challenges in management of invasive mycoses. Lancet.
2005;366:1013-25.
28. Pires-Gonalves RH, Miranda ET, Baeza LC, Matsumoto MT, Zaia JE, Mendes-Giannini
MJS. Genetic relatedness of commensal strains of Candida albicans carried in the oral
cavity of patients dental prosthesis users in Brazil. Mycopathologia. 2007;164:255-
63.
29. Pittet D, Monod M, Suter PM, Frenk E, Auckenthaler R. Candida colonization and
subsequent infections in critically ill surgical patients. Ann Surg. 1994;220:751-8.
30. Richards MJ, Edwards JR, Culver DH, Gaynes RP. Nosocomial infections in medical
intensive care units in the United States. Crit Care Med. 1999;27:887-92.
31. Robles JC, Koreen L, Park S, Perlin DS. Multilocus sequence typing is a reliable alternative
method to DNA ngerprinting for discriminating among strains of Candida albicans.
J Clin Microbiol. 2004;42:2480-8.
32. Sampaio P, Gusmo L, Alves C, Pina-Vaz C, Amorim A, Pais C. Highly polymorphic
microsatellite for identication of Candida albicans strains. J Clin Microbiol.
2003;41:552-7.
33. Sampaio P, Gusmo L, Correia A, Alves C, Rodrigues AG, Pina-Vaz C, et al.
New microsatellite multiplex PCR for Candida albicans strain typing reveals
microevolutionary changes. J Clin Microbiol. 2005;43:3869-76.
34. Schmid J, Tortorano AM, Jones G, Lazzarini C, Zhang N, Bendall M, et al. Increased
mortality in young candidemia patients associated with presence of a Candida albicans
general-purpose genotype. J Clin Microbiol. 2011;49:3250-6.
35. Shin JH, Kook H, Shin DH, Hwang TJ, Kim M, Suh SP, et al. Nosocomial cluster of
Candida lipolytica fungemia in pediatric patients. Eur J Clin Microbiol. 2000;19:344-
9.
36. Soll DR. The ins and outs of DNA ngerprinting the infectious fungi. Clin Microbiol
Rev. 2000;13:332-70.
37. Tay ST, Na SL, Chong J. Molecular differentiation and antifungal susceptibilities of
Candida parapsilosis isolated from patients with bloodstream infections. J Med
Microbiol. 2009;58:185-91.
38. Vaz C, Sampaio P, Clemons KV, Huang YC, Stevens DA, Pais C. Microsatellite multilocus
genotyping claries the relationship of Candida parapsilosis strains involved in a
neonatal intensive care unit outbreak. Diagn Microbiol Infect Dis. 2011;71:159-62.
39. Yarrow D. Methods for the isolation, maintenance and identication of yeasts. In:.
Kurtzman CP, Fell JW, editors. The yeast, a taxonomic study. New York: Elsevier;
1998. p. 77-100.
Received: 13 October 2012
LIBRARY OF THE
SO PAULO INSTITUTE OF TROPICAL MEDICINE
Website: www.imt.usp.br/portal
Address: Biblioteca do Instituto de Medicina Tropical de So Paulo da Universidade de So Paulo
Av. Dr. Enas de Carvalho Aguiar, 470. Prdio 1 Andar trreo.
05403-000 So Paulo, SP, Brazil.
Telephone: 5511 3061-7003 - Fax: 5511 3062-2174
The Library of the So Paulo Institute of Tropical Medicine (IMTSP Library) was created on January
15, 1959 in order to serve all those who are interested in tropical diseases. To reach this objective, we
select and acquire by donation and / or exchange appropriate material to be used by researchers and we
maintain interchange between Institutions thorough the Journal of the So Paulo Institute of Tropical
Medicine, since the Library has no funds to build its own patrimony.
The IMTSP Library has a patrimony consisting of books, theses, annals of congresses, journals,
and reference works.
The collection fo journals existing in the Library can be veried through the USP Bibliographic
Database OPAC DEDALUS http://dedalus.usp.br:4500/ALEPH/eng/USP/USP/DEDALUS/start
of the USP network.
doi: 10.1590/S0036-46652013000600004
(1) Instituto de Medicina Tropical de So Paulo, So Paulo, SP, Brazil. E-mails: mmsatow@usp.br, kanash@usp.br, mussyarocha@yahoo.com.br, pccotrim@usp.br, jlindoso@usp.br
(2) Laboratrio de Investigao Mdica HC-FMUSP, So Paulo, SP, Brazil.
(3) Departamento de Molstias Infecciosas e Parasitrias, Faculdade de Medicina, Universidade de So Paulo, So Paulo, SP, Brazil.
(4) Instituto de Infectologia Emlio Ribas, So Paulo, SP, Brazil. E-mails: luizakeiko@uol.com.br; rita@labirintus.com.br
Correspondence to: Marcela M. Satow, Instituto de Medicina Tropical de So Paulo, Av. Dr. Enas de Carvalho Aguiar 500, 05403-000 So Paulo, SP, Brasil. E-mail: mmsatow@usp.br
APPLICABILITY OF kDNA-PCR FOR ROUTINE DIAGNOSIS OF AMERICAN TEGUMENTARY
LEISHMANIASIS IN A TERTIARY REFERENCE HOSPITAL
Marcela M. SATOW(1), Edite H. YAMASHIRO-KANASHIRO(1), Mussya C. ROCHA(1,2), Luiza K. OYAFUSO(4), Rita C. SOLER(4),
Paulo C. COTRIM(1,2,3) & Jos Angelo L. LINDOSO(1,2,4)
SUMMARY
This study evaluated the applicability of kDNA-PCR as a prospective routine diagnosis method for American tegumentary
leishmaniasis (ATL) in patients from the Instituto de Infectologia Emlio Ribas (IIER), a reference center for infectious diseases in So
Paulo - SP, Brazil. The kDNA-PCR method detected Leishmania DNA in 87.5% (112/128) of the clinically suspected ATL patients,
while the traditional methods demonstrated the following percentages of positivity: 62.8% (49/78) for the Montenegro skin test, 61.8%
(47/76) for direct investigation, and 19.3% (22/114) for in vitro culture. The molecular method was able to conrm the disease in
samples considered negative or inconclusive by traditional laboratory methods, contributing to the nal clinical diagnosis and therapy
of ATL in this hospital. Thus, we strongly recommend the inclusion of kDNA-PCR amplication as an alternative diagnostic method
for ATL, suggesting a new algorithm routine to be followed to help the diagnosis and treatment of ATL in IIER.
KEYWORDS: American tegumentary leishmaniasis; Diagnostic; kDNA-PCR; Leishmania (Viannia) braziliensis.
INTRODUCTION
American tegumentary leishmaniasis (ATL) presents different clinical
manifestations in Latin America, including mucosal leishmaniasis (ML),
cutaneous localized leishmaniasis (CL), disseminated leishmaniasis
(LCD), and diffuse leishmaniasis (DCL). These manifestations are caused
by seven different species of Leishmania: Leishmania (Leishmania)
amazonensis, L. (Viannia) braziliensis, L. (V.) guyanensis, L. (V.)
lainsoni, L. (V.) naif, L. (V.) lindenberg, and L. (V.) shawi
7,24
. Currently,
the diagnosis of ATL is based mainly on a clinical examination,
epidemiological data, and complementary laboratory methods, including
direct investigation (DI), Montenegro skin test (MST), and in vitro
culture
7
. Nevertheless, these classical diagnostic methods are often time
consuming; require an expert in microscopy; have low sensitivity and/
or specicity and can be inuenced by the age of infection and quality
of sampling
7
. Furthermore, these methods are unable to differentiate
between the seven species of parasite involved, which can be considered
an important failure for the disease prognosis and choice of an appropriate
treatment
9,32
. VOLPINI et al., 2004
41
described the potential of a PCR-
RFLP method performed with primers specic for kinetoplast DNA
(kDNA) of Leishmania genus, followed by HaeIII restriction enzyme
digestion, for detection of L. (V.) braziliensis in infected DNA samples.
This species is reported to be the major causative agent of ML in Latin
America; and it is estimated that 3-5% of CL patients progress to ML form
when infected with this species
7
. The specicity of these specic primers
for the Leishmania genus has been reported in previous studies and no
cross-reaction was observed for paracoccidioidomycosis, histoplasmosis,
cutaneous tuberculosis, and candidiasis
3
, squamous cell carcinoma,
sporotrichosis, leprosy, lentigo, pyodermitis and vascular ulcer
17
.
The identication of L. (V.) braziliensis in ATL suspected patients is
important for elaboration of accurate prognoses and adequate therapy to
prevent the resurgence of lesions, and the progression of the disease
7,24
.
Thus, the aim of this study was to evaluate the applicability of the
kDNA-PCR followed by restriction enzyme analyze method for routine
diagnosis of ATL at the IIER
Patients. The study was conducted on a convenience sample of 128
patients who attended the Instituto de Infectologia Emlio Ribas (IIER),
So Paulo, Brazil from March 2007 to January 2012, with clinical signs
and symptoms compatible with CL or ML. Cutaneous leishmaniasis was
clinically suspected by the presence of ulcer, while mucosal leishmaniasis
by the presence of nasal bleeding, drilling nasal septum or inltrate
in mucosal
7,13,24
. The results of the clinical examinations, Montenegro
skin test, epidemiologic data, and administered drugs were obtained
by reviewing the medical records. Collected samples from 128 lesions
were transferred for our lab to be analyzed by Direct Investigation, in
vitro culture and kDNA PCR.
SATOW, M.M.; YAMASHIRO-KANASHIRO, E.H.; ROCHA, M.C.; OYAFUSO, L.K.; SOLER, R.C.; COTRIM, P.C. & LINDOSO, J.A.L. - Applicability of kDNA-PCR for routine diagnosis
of American tegumentary leishmaniasis in a tertiary reference hospital. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 393-9, 2013.
394
The study was approved by the Research Ethics Committee of IIER
(Process number 326/2009), and by the Research Ethics Committee
of the Instituto de Medicina Tropical de So Paulo (Process CEP-IMT
046/2009).
Montenegro skin test (MST). Montenegro skin test was performed
by Instituto Adolfo Lutz, So Paulo - SP. The technique consists of
application of 0.5 mL of antigen of L. (L) amazonensis (MHOM/BR/73/
PH8), distributed by the Brazilian Ministry of Health. After 72 h the
papule was measured using a ruler and the result is expressed in mm.
It is considered positive if the test is higher than 5 mm
10,31
. The results
of the MST were obtained by reviewing the medical records of the
suspected ATL patients.
Direct investigation (DI). Lesion samples were obtained by biopsy
after asepsis, and local anesthesia using a 4 mm diameter punch. The
excess blood was removed from the samples and lesion imprints were
collected on glass slides. After air drying, the slides were xed in
methanol, stained with Giemsa, and microscopically examined by two
technicians. The results were based on the following criteria: the presence
of typical Leishmania amastigotes indicated a positive result; the absence
of amastigotes indicated a negative result; and the presence of atypical
forms of parasite was considered to suggest a positive result.
In vitro culture and isolation of the parasites. Parts of the lesion
samples were transferred to a plastic tube with a physiological salt
solution with 100 U penicillin, 100 mg/mL streptomycin, and 50 g/mL
5-uorocytosine, and forwarded to the Instituto de Medicina Tropical
(IMT-USP). Each sample was further divided for the in vitro culture
of parasites and for the DNA extraction procedures. A fraction of the
sample designated for parasite isolation was incubated in Media 199,
(SIGMA, USA) with 10% fetal bovine serum at 26 C in BOD and it
was examined weekly for a month.
Reference strains. L. (V.) braziliensis (MHOM/BR/75/M2903),
and L. (L.) amazonensis (IFLA/BR/67/PH8) promastigote forms were
cultivated in Media 199 with 10% fetal bovine serum at 26 C in BOD.
The promastigotes were collected at the exponential growth phase with
approximately 10
7
cells per mL (+/- 96 h).
DNA extraction. DNA extraction from tissue lesion samples from
patients and promastigote reference strains was processed using the
Wizard Genomic DNA Purication Kit (Promega, USA) following
the manufacturers protocol. The quantication and quality control
of the DNA extraction procedures were performed using a nano
spectrophotometer (NanoDrop 1000, Thermo Fisher Scientic). All
reactions were performed in appropriated places, following the good
practice of laboratories to avoid sample contamination.
kDNA-PCR: The technique was performed based on the protocol
described previously
41
using the following primers that amplify a 120
bp fragment of the conserved region of a Leishmania kDNA minicircle:
kDNA20 forward, 5- GGG (G/T)AG GGG CGT TCT (G/C)CG AA-
3, and kDNA22 reverse, 5 (G/C)(G/C)(G/C) (A/T)CT AT(A/T) TTA
CAC CAA CCC C- 3.

The reaction mixtures were prepared in a nal
volume of 20 L that contained Taq DNA polymerase Buffer with KCl
(10 mM Tris-HCl pH8.8, 50 mM KCl, and 0.08% (v/v) Nonidet P-40);
1.0 mM MgCl
2
;

0.2 mM of each dNTP; 375 pM of each primer; 1 U
Taq DNA polymerase (recombinant) (Fermentas); and 4 L (~ 200 ng)
of DNA. Amplication was conducted using an MWG Biotech Model
Primus 96 Plus Thermal Cycler with an initial denaturation step at 94
C for four min, followed by 35 cycles at 94 C for one min, 58 C for
one min, 72 C for 30 s, and a nal extension step at 72 C for ve min.
The amplicons were visualized by electrophoresis on 2% agarose gels
stained with ethidium bromide.
Positive controls that contained the DNA from the reference strains,
and a negative control with no DNA were included in each reaction set.
In addition, the samples that were negative according to kDNA-PCR
protocol were submitted to PCR amplication with primers directed
to human -globin PCR
1
to verify the quality of the DNA extraction
procedure.
PCR-RFLP (kDNA- HaeIII): Finally, 10 L microliters of the
positive kDNA-PCR products were digested at 37 C for three hours with
10 U of HaeIII enzyme (Fermentas), with specic buffer and deionized
water, total volume of 15 L, according to the manufacturers protocol.
The restriction fragments were separated on a 10% polyacrylamide gel,
and stained with ethidium bromide.
RESULTS
Analysis of the results of the traditional diagnosis methods. A
total of 128 patients with clinically suspected ATL were enrolled in this
study: 59 (46.1%) patients with a suspicious mucosal lesion (sML), and
69 (53.9%) patients with suspicious of cutaneous lesions (sCL). As a
result of problems encountered during the data collection from medical
records, which were often incomplete lacking important information,
we were unable to get the results of the three traditional methods for
routine diagnosis of all 128 patients. Then, tests were analyzed in the
following frequencies: 89.1% by in vitro culture, 60.9% by MST, and
59.4% by DI, only kDNA-PCR was performed on all 128 collected
samples (Table 1). As shown in Table 1, we observed that DI test was
performed more frequently in sCL patients than for sML patients: 81.2%
(56/69), and 33.9% (20/59), respectively. On the contrary, MST was
performed on 71.2% (42/59) of the sML patients, and on 52.2% (36/69)
of the sCL patients. The results of the DI, MST and in vitro tests were
analyzed considering only the number of samples truly performed for
each test (76/128 samples for DI, 78/128 for MST and 114/128 for
culture (Table 1).
Evaluation of the efciency of the kDNA-PCR method and
traditional diagnostic methods. kDNA-PCR was performed on all
128 collected samples, and amplied Leishmania DNA was observed
in 112/128 (87.5%) clinically suspected ATL samples (Table 1). The 16
remaining samples (12.5%) were considered negative after conrmation
of DNA integrity by human -globin PCR analysis. In addition, these
samples were also negative for ATL according to the traditional methods,
excluding one sample (Table 2).
Thus, we can conclude that kDNA-PCR was the most efcient test,
with a positivity of 87.5%, followed by the MST with 62.8%, DI with
61.8%, and in vitro culture with 19.3%. We observed that the efciency
of DI, and MST methods was distinct for each clinical manifestation.
DI test was 1.5 times more efcient for samples from sCL patients,
than for samples from sML patients. The opposite was observed in the
395
MST results: an efciency 1.5 times greater for sML patients (73.8% of
positivity), than for sCL patients (50.0% of positivity).
For DI test and in vitro culture we respectively observed high
frequencies of suggestive results (25.0%) and, contamination (36.0%)
indicating the limitations of these techniques. Curiously, in vitro culture
contamination was 2.9 times more frequent in sML samples (30/55 or
54.5%) than in sCL samples (11/59 or 18.6%).
As only kDNA-PCR was performed on all collected samples, we
can compare the efciency of the three traditional diagnostic methods
(DI test, MST and in vitro culture) with PCR. We can see in Table 2
that kDNA-PCR was able to detect the parasite in all samples that were
positive for the DI test
47
, and for in vitro culture
22
. Surprisingly, from
the 49 samples considered positive after the MST analysis, one was
negative for kDNA-PCR (it was derived from a patient with chronic ATL
presenting a recurrent lesion).
Besides that, we verified that the molecular method detected
Leishmania DNA in 77 samples considered negative or contaminated
by in vitro culture (41 and 36, respectively), and in the 20 samples
considered negative or suggestive by the DI test (5 and 15, respectively).
Interestingly, from the 29 samples considered negative by MST, 25 (or
86.2%) were positive after kDNA-PCR amplication (17 samples from
sCL patients, and eight from sML patients - data not shown). From the
16 samples negative by kDNA-PCR, 15 present the same result when
performed by traditional methods; just one sample presents different
results for kDNA-PCR and MST, as discussed above.
The importance of the kDNA-PCR in the clinical practice. We
divided the 128 DNA samples enrolled in this study into two groups:
the conrmed ATL patients (CATL), that presented at least one positive
result for traditional diagnosis tests (DI, MST or in vitro culture); and the
non-conrmed ATL patients (NCATL), composed by samples with non
positive results following the same traditional techniques (respectively
with 83 and 45 DNA samples - Table 3). As expected, kDNA-PCR was
able to detect parasite DNA in 98.8% of the DNA samples from the CATL
group (82/83), where the diagnosis had been previously conrmed by a
combination of the three traditional diagnostic methods. The exception
was only the patient with chronic ATL with a recurrent lesion, already
discussed. The importance of the kDNA-PCR amplication in the routine
diagnosis becomes evident when we analyzed the results of the NCATL
group. In this group of samples with negative results by the traditional
diagnostic methods, kDNA-PCR was able to detect the parasite in 66.6%
(or 30/45).
To better verify the acceptance of the kDNA-PCR results, we
checked the physician follow-up through the analysis of the medical
records. Out of 128 samples analyzed, only 92 records presented
correct data on the conduct adopted by the physician. According to
Table 1
Results of the four diagnostic methods performed with samples from patients
with suspected ATL who attended the Instituto de Infectologia Emlio Ribas
(IIER) in So Paulo, Brazil
Clinical manifestation
Cutaneous Mucosal Total
N (%) N (%) N (%)
Patients 69 53.9% 59 46.1% 128
Direct investigation (76)
Not performed (52)
Positive 38 67.9% 9 45.0% 47 61.8%
Negative 6 10.7% 4 20.0% 10 13.2%
Suggestive 12 21.4% 7 35.0% 19 25.0%
Total 56 20 76
Montenegro skin test (78)
Not performed (50)
Positive (> 5 mm) 18 50.0% 31 73.8% 49 62.8%
Negative (< 5 mm) 18 50.0% 11 26.2% 29 37.2%
Total 36 42 78
In vitro culture (114)
Not performed (14)
Positive 14 23.7% 8 14.5% 22 19.3%
Negative 34 57.6% 17 30.9% 51 44.7%
Contamination 11 18.6% 30 54.5% 41 36.0%
Total 59 55 114
kDNA-PCR (128)
Positive 61 88.4% 51 86.4% 112 87.5%
Negative 8 11.6% 8 13.6% 16 12.5%
Total 69 59 128
Table 2
Comparison of the kDNA-PCR results with those obtained by the traditional diagnostic methods with samples from patients with suspected of cutaneous and
mucosal leishmaniasis*
kDNA-PCR
Traditional diagnostic methods
In vitro culture DI test MST
P N Cont. P N Sug. P N
Positive 22 (100%) 41 (80.4%) 36 (87.8%) 47 (100%) 5 (50%) 15 (78.9%) 48 (97.9%) 25 (86.2%)
Negative 0 10 (19.6%) 5 (12.2%) 0 5 (50%) 4 (21%) 1 (2%) 4 (13.8%)
kDNA-PCR: Polymerase chain reaction using specic primers for Leihmanias kinetoplast DNA, DI test: Direct Investigation test, MST: Montenegro skin test. P:
Positive result, N: Negative result; Sug.: Suggestive, Cont.: contamination. *The same sample could be analyzed by more than one diagnostic method.
396
the records, most of these patients, 95.7% (88/92), received specic
treatment for ATL. Of these 88 treated patients, 18 were positive only
by kDNA-PCR analysis, 63 presented a positive result in at least one
of the traditional diagnostic methods (and also positive kDNA-PCR
positive results), and seven patients were treated based exclusively on
the clinical examination (when all diagnostic tests, including PCR,
presented negative or inconclusive results). Interestingly, one of the
seven treated patients that presented a negative result for kDNA-PCR,
was later diagnosed as paracoccidioidomycosis, conrming the previous
PCR result. Contrary, two patients from this same group responded
clinically well to the ATL drug administration, besides the negative
results in all diagnosis tests. No information concerning the response
of treatment about the remaining four treated patients was found in
the records. Overall, 3/92 patients were not treated even though they
presented positive kDNA-PCR results (one patient presented positive
results for both kDNA-PCR and MST). The remaining untreated patient
was negative by kDNA-PCR analysis.
PCR-RFLP results. To verify the contribution of the PCR-RFLP
method for identication of L. (V.) braziliensis, HaeIII restriction
digestion was performed in all 112 amplification products of the
kDNA-PCR reaction. We veried that 96/112 (or 85.7%) of these
samples presented the two expected DNA fragments (80 bp and 40
bp), characteristic of the L. (V.) braziliensis electrophoresis pattern
41

(Fig. 1, lanes 2 to 7). The frequency of L. (V.) braziliensis according to
the suspected clinical manifestation was 51/61(83.6%) in sCL samples,
and 45/51(88.23%) in sML samples.
16/112 kDNA-PCR amplication products (10 from sCL samples
and six from sML samples) did not present the cleavage of the 120
pb amplication product (Fig. 1, lane 1). Eight samples were from
patients that have been in endemic regions of L. (L.) amazonensis: ve
from Bahia, one from Maranho, one from Minas Gerais and one from
Pernambuco, which can be an evidence of infection caused by this or
other Leishmania species. One individual reported to have acquired the
disease in Angola where L. (L.) infantum is the main specie that causes
leishmaniasis, where specic zymodemes can be related with LC
24
. Four
patients have not reported probable local of infection. The remaining three
individuals indicated So Paulo and Paran to be the local of infection,
which are states where L. (V.) braziliensis was the only specie causative
of human disease. This last result may indicate limitation of the PCR-
RFLP or absence of correct information concerning the probable locals
of infection.
DISCUSSION
This study evaluated the applicability and efciency of PCR based on
kDNA as a routine diagnostic method for ATL, comparing these results
with the results of tests performed routinely for leishmaniasis diagnosis.
The data that were obtained indicate that inclusion of the PCR-RFLP
(kDNA-HaeIII) technique in the routine diagnosis of ATL would improve
the accuracy of the diagnosis, support an appropriate prognosis, and
ensure adequate treatment. Moreover, the data indicated that the kDNA-
PCR results are in agreement with the clinical practice performance and
conrmed the clinical ndings (Table 3) that were negative according to
the traditional methods (Table 2).
The higher efciency of the kDNA-PCR method over the traditional
methods for ATL diagnosis (Table 1) observed here is in agreement with
the literature, which describes sensitivities that range from 75% - 98%,
and it is attributed to the naturally amplied DNA in the kinetoplast
minicircle
2,4,5,6,14,17,20,30,34,35,40
.
Comparative analysis between the sensitivity levels of the methods
tested here and those from previous studies, was difcult to process due
to a variety of the techniques and the type of biological samples that were
used, the inclusion criteria of the samples and the differences among the
sequences of the kDNA primers
34
, and the expertise of the technicians.
Nevertheless, we performed a comparison of the efciency among the
kDNA-PCR and traditional methods (Tables 1 and 2) that allowed us to
evaluate the limitations of each laboratory method.
The in vitro culture presented a lower percentage of positivity and/
or parasite isolation (19.3%, Table 1), than those described by other
authors, which ranged from 30.3% to 81.5%
9,17,18,23
. The low sensitivity
of the in vitro culture test was evidenced in Table 2 were 77 contaminated
or negative samples by this method were positive by kDNA-PCR. On
the other hand, these results also indicate that the efciency of the
PCR method was not affected by secondary infections, as pointed by
BOGGILD et al.
6
.
Concerning the DI test, several studies have demonstrated that the
quality of the prepared slides, the age of the lesions, the presence of
Table 3
Number of ATL suspected samples presenting none or at least one positive
result by traditional methods compared with the kDNA-PCR results
Result/
group
Traditional methods
Positive*
CATL
Negative
NCATL
Total
kDNA-PCR
Positive 82 (98.8%) 30 (66.6%) 112
Negative 1 (1.2%) 15 (33.3%) 16
Total 83 45 128
*Positive result for at least one reference method (direct investigation, Montenegro
skin test or in vitro culture). CATL: ATL DNA samples conrmed by at least one
of the traditional method(s). NCATL: ATL DNA samples without conrmation
by traditional method(s).
Fig. 1 - A 10% polyacrylamide gel electrophoresis representing the products of PCR-RFLP
(kDNA/HaeIII): 1- 7 samples from LTA suspected patients, Lb- DNA from L. (V.) braziliensis
(positive control).
397
secondary microorganisms
6,24
, and pre-treatment of the lesions can lead
to atypical forms of the parasite
23
, resulting in a wide variation in the
level of sensitivity of the DI tests ranging from 10% to 74.4%
3,4,5,11,15,17
.
Corroborating this, we observed that 20 of the 29 samples presenting
negative or suggestive results by DI test were positive when evaluated
by kDNA-PCR (Table 2). Eleven of these 20 patients received treatment
after the positive kDNA-PCR result which conrmed the clinical ndings
and may indicate the acceptance of the kDNA-PCR for diagnosis of ATL
by the physicians. Thus, we suggest that samples with results that are
negative or suggestive by DI test require an additional laboratory method,
as kDNA-PCR to conrm the nal diagnosis.
We veried that MST method was more efcient for sML patients
(73.8% of positivity), than for sCL patients (50% of positivity) (Table
1). These low positivity rates are in accordance with the literature, which
reports a range from 51.9%-100% for this test
14,16,22,28
, and could be a
consequence of immunosuppression
25
or even misinterpretation of the
result. It is also reported that the sensitivity of the MST can vary with the
presence of secondary infections
6
, or the age of the patient
15
. In our study,
we also observed that 25 of the 29 samples presenting negative results by
MST were positive when evaluated by kDNA-PCR amplication (Table
2). We noted that 17 of these 25 kDNA-PCR positive samples came
from sCL patients, and eight samples from sML patients, which could
indicate a recent infection or a weak response from the immune system
of the patients
12,25,29,33
. In contrast, one patient that presented positive
result for MST was considered negative by kDNA-PCR. This ambiguity
may be due to the fact that the patient had a chronic lesion and few or
no parasites might be present in the sample subjected to kDNA-PCR
reaction. As proposed by DA-CRUZ et al.
12
the inammatory lesion, in
this case, could be due to the activation of T-cells (CD8 +), and not due
to the presence of parasites. Detection of false-positive MST results was
also reported in 35% (20 of 57) of the patients with reactions up to 11
mm in diameter by GOMES et al.
22
These patients had negative results
for in vitro culture, stained tissue smears and PCR for Leishmanias mini
exon SL RNA gene. The authors suggested that false-positive results in
MST could also be result of an allergic process to the antigen diluent, or
an immune response of patients who are not sick, but have already had
contact with the parasite in an endemic area
22,36
.
Therefore, we can infer that the limitation factors that have been
observed for other laboratory methods, such as contamination by
secondary microorganisms
4,33
, the age of infection, cross-reaction to
antigens or other reagents that are used in antigen production, the intrinsic
characteristics of the parasite, and the pre-treatment of patients
22
does
not seem to inuence the kDNA-PCR results. In addition, the molecular
method has several advantages: complex procedures are not required to
collect and to maintain DNA samples for PCR reaction, in contrast to in
vitro culture and DI test. Complementary, a wide variety of biological
material can be used as sources of DNA, including material obtained
by less invasive or non-invasive methods, such as blood
28,34
, lesion
impressions on lter paper
4,34
, scraped, and aspirated lesions
6,28
, urine
40
,
samples xed in parafn
9
and xed and stained material from glass
slides
35,37
. Despite the promising results of the kDNA-PCR method,
carry-over contamination must be avoided
14
, and in our experiments,
each PCR step was always performed in separate rooms using appropriate
equipment.
According to our kDNA-HaeIII PCR-RFLP data, 83.6% of sCL
patients could be infected with L. (V.) braziliensis, suggesting that these
patients may be at risk of developing the mucosal manifestation or have
re-activation of lesions, if they do not receive adequate treatment and
clinical assistance. Although kDNA-HaeIII PCR-RFLP reaction can
contribute to the identication of L. (V.) braziliensis infected samples, the
conrmation of the species of the parasite by other molecular methods
is recommended, once similar electrophoretic patterns may occur within
related species from Viannia subgenus as reported in other PCR-RFLP
studies
2,38,39
.
Studies describing techniques based on PCR for identication of
the species from Viannia subgenus using DNA of clinical samples have
been reported such as the Polymorphism-Specic PCR (PS-PCR)
26
,
G6PD PCR
8
, LBF1-LBR1 PCR
27
. Despite the ability to identify the
Leishmanias species, the use of these techniques as routine may not
be validated since they require high concentration of total DNA
27
and
the employment of several primers for each species
8,26
. On the contrary,
the kDNA-HaeIII PCR-RFLP protocol used in our study was simple
to execute and presented sensibility higher than the traditional routine
methods.
On the other hand, most of the 128 patients analyzed here are from
regions where L. (V.) braziliensis is the main causative species responsible
for the severe manifestation of the disease, which supports the use of
kDNA-HaeIII PCR-RFLP to assist in posterior clinical practices.
The medical reports review has shown that kDNA-PCR results
contributed to the treatment of at least 18 patients who had got negative
results by the traditional methods. The decision to treat these patients
was also based on the clinical symptoms and epidemiological data,
conrming that kDNA-PCR is important as a complementary test for
the diagnosis and treatment of ATL.
Unfortunately, we failed to collect all results of the traditional
diagnostic tests, as well as the response of the patients treatment,
mainly because the medical records were incomplete or lacked important
information, which made our comparative analysis difcult (Tables 1,
and 3). The difculty in establishing a gold standard method for the
diagnosis of ATL based on a comparison of diagnostic methods has been
reported in previous studies
22
. Moreover, we observed that the results of
the reference diagnostic methods that were recommended by the National
Council of Health of the Brazil Ministry of Health (MST for suspected
ML patients, and DI for suspected CL patients) were not registered in
the medical records or solicited by the physicians. The same limitations
were observed in other studies that were conducted in the following states
of Brazil: Pernambuco
36
, Mato Grosso
33
, and Ribeiro Preto, SP
19
. These
ndings demonstrate that standardization of the tests that are solicited
for ATL diagnosis, and improvement or modernization of the medical
records systems in public hospitals in Brazil is needed.
Finally, we strongly recommend the use of the kDNA-PCR to be
added as routine method for diagnosis of ATL. Patients with suspicion
of cutaneous lesions (sCL) after the clinical examination, must collect
biopsies of the border lesion, and send for DI test. Patients with suspicion
of mucosal lesions (sML) must be submitted for the MST. Patients with
positive results according to the DI, and/or MST tests must be treated.
kDNA-PCR can be solicited by the physician in addition to DI/MST or
performed for disease conrmation when the results of the DI tests, and
398
MST were negative. Patients with positive results for kDNA-PCR can be
treated. If suspected leishmaniasis patient present negative results for DI
test, MST and kDNA-PCR ATL could be discharged without treatment.
The complementary kDNA-HaeIII PCR-RFLP technique can be done
to help L. (V.) braziliensis identication of infected samples.
RESUMO
Aplicao do kDNA-PCR para diagnstico de rotina de
leishmaniose tegumentar americana em um hospital de referncia
Este estudo avaliou a aplicabilidade do kDNA-PCR como mtodo de
rotina para diagnstico de leishmaniose tegumentar americana (ATL) no
Instituto de Infectologia Emlio Ribas (IIER), So Paulo, SP, Brasil. O
mtodo kDNA-PCR detectou DNA de Leishmania em 87,5% (112/128)
dos pacientes com suspeita de ter leishmaniose e, os mtodos tradicionais
apresentaram as seguintes porcentagens de positividade: 62,8% (49/78)
para o teste de Montenegro, 61,8% (47/76) para a pesquisa direta e 19,3%
(22/114) para cultura in vitro. O mtodo molecular conrmou a doena
em amostras negativas ou inconclusivas pelos mtodos laboratoriais
tradicionais e, mostrou-se capaz de auxiliar na identicao de infeces
causadas pela espcie Leishmania (V.) braziliensis. Alm disso, a reviso
dos pronturios mdicos conrmou a importncia do mtodo PCR-RFLP
no diagnstico nal de ATL, prognstico e escolha do tratamento. Assim,
recomendamos a incluso do PCR como mtodo diagnstico de ATL na
rotina hospitalar, e sugerimos um uxograma para solicitao de exames
laboratoriais.
ACKNOWLEDGMENTS
We would like to thank Marta Teixeira (Instituto de Cincias
Biolgicas, Universidade de So Paulo, Brazil) for the reference species
of Leishmania, and Regina Maia, and Elisabete Ourique (Instituto de
Medicina Tropical de So Paulo) for their technical assistance.
FINANCIAL SUPPORT
This study was supported by the Fundao de Amparo Pesquisa
do Estado de So Paulo - FAPESP (Process No.: 2010/16963-4), the
Coordenao de Aperfeioamento de Pessoal de Nvel Superior (CAPES),
CNPq and the Laboratrio de Investigao Mdica 38 e 48 (LIM 38
and 48).
REFERENCES
1. Al-Jawabreh A, Schnur L, Nasereddin A, Schwenkenbecher J, Abdeen Z, Barghuthy F,
et al. The recent emergence of Leishmania tropica in Jericho (Ariha) and its environs,
a classical focus of L. major. Trop Med Int Health. 2004;9:812-6.
2. Andrade RV, Massone C, Lucena MN, Talhari AC, Talhari S, Guerra JAO, et al. The
use of polymerase chain reaction to conrm diagnosis in skin biopsies consistent
with American tegumentary leishmaniasis at histopathology: a study of 90 cases. An
Bras Dermatol. 2011;86:892-6.
3. Barrio A, Mora MC, Ramos F, Moreno S, Samson R, Basombro MA. Short report: use
of kDNA-based polymerase chain reaction as a sensitive and differentially diagnostic
method of American tegumentary leishmaniasis in disease-endemic areas of northern
Argentina. Am J Trop Med Hyg. 2007;77:636-9.
4. Bensoussan E, Nasereddin A, Jonas F, Schnur LF, Jaffe CL. Comparison of PCR
assays for diagnosis of cutaneous leishmaniasis. J Clin Microbiol. 2006;44:1435-9.
5. Boggild AK, Ramos, AP, Espinosa D, Valencia BM, Veland N, Miranda-Verastegui C,
et al. Clinical and demographic stratication of test performance: a pooled analysis
of ve laboratory diagnostic methods for American cutaneous leishmaniasis. Am J
Trop Med Hyg. 2010;83:345-50.
6. Boggild AK, Ramos AP, Valencia BM, Veland N, Calderon F, Arevalo J, et al.
Diagnostic performance of lter paper lesion impression PCR for secondarily infected
ulcers and nonulcerative lesions caused by cutaneous leishmaniasis. J Clin Microbiol.
2011;49:1097-100.
7. Brasil. Manual de vigilncia da leishmaniose tegumentar americana. Gentil K,
Pamplona M, Assuno L, Souza F, editores. 2
nd
Ed. Braslia: Editora do Ministrio
da Sade; 2010.
8. Castilho T, Shaw J, Floeter-Winter L. New PCR assay using glucose-6-phosphate
dehydrogenase for identification of Leishmania species. J Clin Microbiol.
2003;41:540-6.
9. Coelho LI, Paes M, Guerra J, Barbosa M, Coelho C, Lima B, et al. Characterization
of Leishmania spp. causing cutaneous leishmaniasis in Manaus, Amazonas, Brazil.
Parasitol Res. 2011;108:671-7.
10. Costa C, de Toledo VP, Genaro O, Williams P, Mayrink W. Montenegro skin test-
evaluation of the composition and stability of the antigen preparation. Mem Inst
Oswaldo Cruz. 1996;91:193-4.
11. Curti MC, Silveira TG, Arraes SM, Bertolini DA, Zanzarini PD, Venazzi E, et al.
Epidemiological and clinical characteristics of cutaneous leishmaniasis and their
relationship with the laboratory data, south of Brazil. Braz J Infect Dis. 2011;15:12-6.
12. Da Cruz AM, Bertho AL, Oliveira-Neto MP, Coutinho SG. Flow cytometric analysis
of cellular inltrate from American tegumentary leishmaniasis lesions. Br J Dermatol.
2005;153:537-43.
13. David CV, Craft N. Cutaneous and mucocutaneous leishmaniasis. Dermatol Ther.
2009;22:491-502.
14. Degrave W, Fernandes O, Campbell D, Bozza M, Lopez U. Use of molecular probes
and PCR for detection and typing of Leishmania - a mini-review. Mem Inst Oswaldo
Cruz. 1994;89:463-9.
15. Delgado O, Silva S, Coraspe V, Ribas MA, Rodriguez-Morales AJ, Navarro P, et al.
American cutaneous leishmaniasis in children and adolescents from northcentral
Venezuela. Trop Biomed. 2008;25:178-83.
16. Diniz J, Costa M, Gonalves D. Mucocutaneous leishmaniasis: clinical markers in
presumptive diagnosis. Braz J Otorhinolaryngol. 2011;77:380-4.
17. Fagundes A, Schubach A, Paula CC, Bogio A, Antonio L de F, Schiavoni PB, et al.
Evaluation of polymerase chain reaction in the routine diagnosis for tegumentary
leishmaniasis in a referral centre. Mem Inst Oswaldo Cruz. 2010;105:109-12.
18. Farahmand M, Nahrevanian H, Shirazi HA, Naeimi S, Farzanehnejad Z. An overview
of a diagnostic and epidemiologic reappraisal of cutaneous leishmaniasis in Iran. Braz
J Infect Dis. 2011;15:17-21.
19. Ferreira M, Roselino A, Nascimento M, Aires J, Figueiredo, J. Sensitivity of an
immunoenzymatic test for the detection of anti-L. braziliensis antibodies compared
to other tests used for the diagnosis of American cutaneous leishmaniasis. Rev Inst
Med Trop Sao Paulo. 2006;48:215-7.
20. Garcia AL, Kindt A, Quispe-Tintaya K, Bermudez H, Llanos A, Arevalo J, et al.
American tegumentary leishmaniasis: antigen-gene polymorphism, taxonomy and
clinical pleomorphism. Infect Genet Evol. 2005;5:109-16.
21. Garcia L, Kindt A, Bermudez H, Llanos-Cuentas A, Doncker SD, Arevalo J, et al.
Culture-independent species typing of neotropical Leishmania for clinical validation
of a PCR-based assay targeting heat shock protein 70 genes. J Clin Microbiol.
2004;42:2294-97.
399
22. Gomes AHS, Armelin IMI, Menon SSZ, Pereira-Chioccola VL. Leishmania (V.)
braziliensis: detection by PCR in biopsies from patients with cutaneous leishmaniasis.
Exp Parasitol. 2008;119:319-24.
23. Gomes AHS, Ferreira IM, Lima ML, Cunha EA, Garcia AS, Araujo MF, et al. PCR
identication of Leishmania in diagnosis and control of canine leishmaniasis. Vet
Parasitol. 2007;144:234-41.
24. Goto H, Lindoso JAL. Current diagnosis and treatment of cutaneous and
mucocutaneous leishmaniasis. Expert Rev Anti Infect Ther. 2010;8:419-33.
25. Lindoso JA, Barbosa RN, Posada-Vergara MP, Duarte MI, Oyafuso LK, Amato VS,
et al. Unusual manifestations of tegumentary leishmaniasis in AIDS patients from
the New World. Br J Dermatol. 2009;160:311-8.
26. Marco JD, Barroso PA, Mimori T, Locatelli FN, Tomatani A, Mora MC, et al.
Polymorphism-specic PCR enhances the diagnostic performance of American
tegumentary leishmaniasis and allows the rapid identication of Leishmania species
from Argentina. BMC Infect Dis. 2012;12:191.
27. Marcussi VM, Marcussi, LM, Barbosa-Tessmann IP, Lonardoni MVC, Silveira TGV.
Leishmania (Viannia ) braziliensis: new primers for identication using polymerase
chain reaction. Exp Parasitol. 2008;120:300-5.
28. Marques MJ, Volpini AC, Machado-Coelho GL, Machado-Pinto J, Costa CA, Mayrink
W, et al. Comparison of polymerase chain reaction with other laboratory methods
for the diagnosis of American cutaneous leishmaniasis: diagnosis of cutaneous
leishmaniasis. Diagn Microbiol Infect Dis. 2006;54:37-43.
29. Martins L, Alexandrino A, Guimares G. The detection of Leishmania braziliensis
DNA in American tegumentary leishmaniasis patients. Rev Sade Pblica.
2010;44:571-4.
30. Medeiros A, Rodrigues S, Roselino A. Comparison of the specicity of PCR and the
histopathological detection of Leishmania for the diagnosis of American cutaneous
leishmaniasis. Braz J Med Biol Res. 2002;35:421-4.
31. Melo MN, Mayrink W, Da Costa CA, Magalhaes PA, Dias M, Williams P, et al.
Padronizao do antgeno de Montenegro. Rev Inst Med Trop Sao Paulo. 1977;19:161-
4.
32. Mitropoulos P, Konidas P, Durkin-Konidas M. New World cutaneous leishmaniasis:
updated review of current and future diagnosis and treatment. J Am Acad Dermatol.
2010;63:309-22.
33. Murback ND, Hans Filho G, Nascimento RA, Nakazato KR, Dorval ME. American
cutaneous leishmaniasis: clinical, epidemiological and laboratory studies conducted
at a university teaching hospital in Campo Grande, Mato Grosso do Sul, Brazil. An
Bras Dermatol. 2011;86:55-63.
34. Oliveira DM, Lonardoni MV, Teodoro U, Silveira TG. Comparison of different primes
for PCR-based diagnosis of cutaneous leishmaniasis. Braz J Infect Dis. 2011;15:204-
10.
35. Oliveira JGS, Novais FO, Oliveira CI, Cruz Junior AC, Campos LF, Rocha AV, et
al. Polymerase chain reaction (PCR) is highly sensitive for diagnosis of mucosal
leishmaniasis. Acta Trop. 2005;94:55-9.
36. Reis LDC, Brito ME, Almeida EL, Flix SM, Medeiros AC, Silva CJ, et al. Clinical,
epidemiological and laboratory aspects of patients with American cutaneous
leishmaniasis in the State of Pernambuco. Rev Soc Bras Med Trop. 2008;41:439-43.
37. Romero GAS, Noronha EF, Pirmez C, Pires FESS, Fernandes O, Nehme NS, et al.
Sensitivity and reproducibility of a PCR assay for Leishmania detection using skin
biopsy imprints on lter paper. Acta Trop. 2009;109:74-7.
38. Schnian G, Nasereddin A, Dinse N, Schweynoch C, Schallig HDFH, Presber W, et
al. PCR diagnosis and characterization of Leishmania in local and imported clinical
samples. Diagn Microbiol Infect Dis. 2003;47:349-58.
39. Silva L, De Sousa C, Da Graa G, Porrozzi R, Cupolillo E. Sequence analysis and
PCR-RFLP proling of the hsp70 gene as a valuable tool for identifying Leishmania
species associated with human leishmaniasis in Brazil. Infect Genet Evol. 2010;10:77-
83.
40. Veland N, Espinosa D, Valencia BM, Ramos AP, Calderon F, Arevalo J, et al.
Polymerase chain reaction detection of Leishmania kDNA from the urine of Peruvian
patients with cutaneous and mucocutaneous leishmaniasis. Am J Trop Med Hyg.
2011;84:556-61.
41. Volpini AC, Passos VM, Oliveira GC, Romanha AJ. PCR-RFLP to identify Leishmania
(Viannia) braziliensis and L. (Leishmania) amazonensis causing American cutaneous
Received: 3 Februarry 2013
Accepted: 13 June 2013
Revista do Instituto de Medicina Tropical de So Paulo
on line.
Publications from 1987 to the present data are now available on:
http://www.scielo.br/rimtsp
PAST ISSUES 1959-1989 (PDF)
www.imt.usp.br/portal/
SciELO The Scientifc Electronic Library OnLine - SciELO is an electronic virtual covering a selected
collection of Brazilian scientifc journals.
The library is an integral part of a project being developed by FAPESP Fundao de Amparo Pesquisa do
Estado de So Paulo, in partnership with BIREME the Latin American and Caribbean Center on Health Sciences
Information.
SciELO interface provides access to its serials collection via an alphabetic list of titles or a subject index or a
search by word of serial titles, publisher names, city of publication and subject.
The interface also provides access to the full text of articles via author index or subject index or a search form
on article elements such as author names, words from title, subject and words from full text.
FAPESP/BIREME Project on Scientifc Electronic Publications
Latin American and Caribbean Center on Health Sciences Information
Rua Botucatu 862 04023-901 So Paulo, SP Brazil
Tel. (011) 5576-9863
scielo@bireme.br
doi: 10.1590/S0036-46652013000600005
Department of Eco-epidemiology, Institute of Tropical Medicine (NEKKEN), Nagasaki University, Nagasaki, Japan.
Correspondence to: Masashi Miura, Department of Eco-epidemiology, Institute of Tropical Medicine (NEKKEN), Nagasaki University, 1-12-4 Sakamoto, 852-8523 Nagasaki, Japan. Tel:
+81-95-819-7866. Fax: +81-95-819-7865. E-mail: miuram@nagasaki-u.ac.jp
COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR
Masashi MIURA, Chihiro TANIGAWA, Yoshito FUJII & Satoshi KANEKO
SUMMARY
The use of a direct PCR DNA polymerase enables PCR amplication without any prior DNA purication from blood samples
due to the enzymes resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available.
We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion
Blood II, KAPA Blood, and BIOTAQ) in dried blood eluted from a lter paper with TE buffer. GoTaq Flexi was used as a standard
DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA
in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the
standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations
of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild
detergent, only KOD FX DNA polymerase retained the original amount of amplied product. These results indicate that KOD FX
DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be
useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus
not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.
KEYWORDS: Blood direct PCR; Blood pathogen; Filter paper; DNA polymerase; PCR diagnosis; Field survey.
INTRODUCTION
Mutational alteration of DNA polymerases to render them resistant
to inhibition by blood components led to the development of direct
PCR methods for the analysis of blood and soil samples
5
. Recently,
various DNA polymerase kits have become commercially available for
use in amplifying DNA directly from whole blood. During introduction
of direct PCR experiments in our laboratory, we noticed a striking
difference in blood-resistant performance between several kits. However,
no studies have been conducted to evaluate these differences. We therefore
compared the PCR performance of six commercially-available direct
PCR-type DNA polymerases against a standard Taq DNA polymerase
in the presence of PCR inhibitors found in blood components using a
diagnostic nested PCR method for the detection of Plasmodium species
genomic DNA.
Due to the limited infrastructure in many tropical countries, storage
of blood samples for laboratory diagnosis is logistically complicated.
Filter papers are often used as a practical means of sampling, storing,
and transporting blood samples for the detection of blood pathogens such
as Plasmodium falciparum
2,4
. The utility of lter paper blood samples
for the measurement of serum antibodies and diagnostic PCR analyses
has also been demonstrated
3
. Thus, we used blood samples eluted from
dried blood on lter papers to which was added exogenous puried P.
falciparum genomic DNA to examine the PCR performance and inhibitor
resistance of the commercial DNA polymerases.
METHODS
DNA polymerases for direct PCR. The six commercially-available
direct PCR-type DNA polymerases examined in this study were
purchased from the following suppliers: KOD FX, Toyobo (Tokyo,
Japan); MightyAmp, Takara bio (Tokyo, Japan); Hemo KlenTaq, New
England Biolabs (Ipswich, MA, USA); Phusion Blood II, Thermo
Fisher Scientic (Hudson, NH, USA); KAPA Blood, KAPA Biosystems
(Woburn, MA, USA); BIOTAQ, Bioline (London, UK). Non-direct PCR-
type standard Taq DNA polymerase (Go Taq Flexi, Promega (Madison,
WI, USA)) was used as a control.
Preparation of PCR inhibitory blood components. Filter papers
(ADVANTECH, Tokyo, Japan) containing dried blood obtained from two
healthy Japanese volunteers were cut into several 2.5-mm diameter disks.
The blood was eluted by placing each disk in a tube containing 20 L of
TE buffer (10 mM Tris-HCl (pH8.0), 0.1 mM EDTA)
1
or a PBS-based
elution buffer containing 0.05% Tween 20 and 0.05% sodium azide as
used in simultaneous serological and PCR analyses
3
. The tubes were then
MIURA, M.; TANIGAWA, C.; FUJII, Y. & KANEKO, S. - Comparison of six commercially-available DNA polymerases for direct PCR. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 401-6, 2013.
402
heated for 15 min at 50C, after which the disks were pressed gently
to the bottom of the tube several times using a new pipette tip for each
disk, and then heated for 15 min at 97 C. The tubes were centrifuged
at 15,000 rpm for 5 min and 1~8 L of the supernatant (5%~40% blood
eluent) was used in the 20-L PCR reaction.
PCR cycling conditions and primers. A slightly modied standard
nested PCR protocol was used to detect genus-specic Plasmodium
genomic DNA within the highly conserved regions of the small-subunit
rRNA gene
6,7
. The following primers, modied to increase sensitivity,
were used: rPLU1-MOD1/rPLU5-MOD2 for nest 1 and rPLU3-MOD3/
rPLU4-MOD4 for genus-specic nest 2 amplications; rPLU1-MOD1:
GCTTGTCTCAMAGATTAAGCCATGCAAGTGA; rPLU5-MOD2:
CACAGACCTGTTGTTGCCTTAAACTTCC; rPLU3-MOD3:
TTTTTWHTATAAGGATAACTACGGAAAAKCTGTAGCTAATAC
TTG; rPLU4-MOD4: TACCCGTCATAGCCATGTTAGGYCAATACC.
Changes in the above nucleotide sequences are underlined. Details
regarding the PCR mixture used in this study are summarized in Table 1.
To ensure maximal performance of each DNA polymerase, the PCR
conditions recommended by each respective supplier were employed
(Table 2). In case of PCRs using the Phusion DNA polymerase, we
employed the PCR protocol for whole blood. Except in the case of
negative controls, puried P. falciparum (strain 3D7) genomic DNA
(2 ng) was added to the reaction mixture to serve as the template. For
all DNA polymerases tested, the nest 2 reaction was performed in a
similar manner using the nest 1 product (2 L), with the exception of
the annealing temperature, which was 58 C.
All PCR assays were performed using a DNA Thermal Cycler 9700
(Applied Biosystems, Foster City, CA) with a standard ramp mode. Nest
2 PCR products (5 L) were analyzed by gel electrophoresis on 3%
agarose gels stained with ethidium bromide. Densitometric analysis (NIH
ImageJ software) was used to determine the relative level of amplied
target DNA. Amplied target DNA produced at more than 80% of the
relative densitometric value of the positive control (PCR without blood
components) were considered indicative of blood component-resistance.
RESULTS
While the non-blood direct DNA polymerase (Go Taq Flexi,
Promega) did not amplify the target gene region in the presence of
blood components, all blood-direct DNA polymerases were resistant
to blood components and produced the target PCR product in reaction
mixtures containing as much as 10% blood eluent (Fig. 1). No prominent
differences in the PCR results were observed between blood donors.
Both the KOD FX and BIOTAQ DNA polymerases were resistant
to the inhibitory effects of blood components in 40% blood eluent
reaction mixtures, whereas the intensity levels of the target band as
compared to the positive control in each blood eluent were 83.8% and
111.1% for KOD FX and 43.0% and 85.5% for BIOTAQ, respectively.
Table 1
Final composition of PCR mixtures used in this study
The concentrations of nest 1 and 2 were identical. Each 20-L reaction mixture for nest 1 amplications contained 2 ng of P. falciparum genomic
DNA in the absence or presence of 5%, 10%, 15%, 20%, or 40% blood eluent (or 40% elution buffer). Two microliters of the nest 1 amplication
product were used as the DNA template for each of the 20-L amplications.
KOD FX MightyAmp Hemo KlenTaq Phusion Blood KAPA Blood BIOTAQ Go Taq
5-primer 0.3 M 0.3 M 0.3 M 0.5 M 0.5 M 0.5 M 0.5 M
3-primer 0.3 M 0.3 M 0.3 M 0.5 M 0.5 M 0.5 M 0.5 M
PCR buffer 1x 1x 1x 1x 1x
1x
dNTP 0.4 mM * 0.2 mM * * 0.2 mM
DNA polymerase 0.02 units 0.025 units (1.6 L)
1 unit (10 L)
0.5 units 2 units

*denotes dNTPs were included in the PCR buffer. denotes indicated volume from each supplier. denotes dNTPs and PCR buffer components were included in the
DNA polymerase mixture vial. denotes that the PCR buffer was supplied by SHIMADZU Corporation.
Table 2
Nest 1 PCR conditions
KOD FX MightyAmp Hemo KlenTaq Phusion Blood KAPA Blood BIOTAQ Go Taq
Initial denaturation 94 C, 2 min 98 C, 2 min 95 C, 3 min 98 C, 5 min 95 C, 5 min 95 C, 10 min 95 C, 2 min
Denaturation 98 C, 10 sec 98 C, 10 sec 95 C, 20 sec 98 C, 1 sec 95 C, 30 sec 94 C, 30 sec 95 C, 45 sec
Annealing 55 C, 30 sec 55 C, 15 sec 55 C, 30 sec 55 C, 5 sec 55 C, 30 sec 55 C, 1 min 55 C, 45 sec
Extension 68 C, 45 sec 68 C, 45 sec 68 C, 45 sec 72 C, 45 sec 72 C, 45 sec 72 C, 45 sec 72 C, 45 sec
Final extension 68 C, 7 min 68 C, 7 min 68 C, 10 min 72 C, 1 min 72 C, 10 min 72 C, 7 min 72 C, 5 min
Thirty-ve cycles of PCR were performed using each DNA polymerase.
403
Fig. 1 - Analysis of the PCR performance of six commercially-available direct PCR-type DNA polymerases in the presence of 5-40% blood components in the reaction mixture. Nested PCR
cycling conditions recommended by each enzymes manufacturer were used. Plasmodium falciparum genomic DNA (2 ng) was detected by PCR using Plasmodium species detection primers
in the presence of various concentrations of dried blood obtained from two apparently healthy Japanese volunteers that was eluted from lter papers (Left portion of each gel: eluents of blood
from volunteer #1; right portion of each gel: eluents of blood from volunteer #2). Arrowheads indicate the target PCR product of the 18S ribosomal RNA gene region (240 bp). *Denotes elution
buffer control (without blood components). The gure shows representative results from two independent experiments.
404
Fig. 2 - Analysis of the PCR performance of six commercially-available direct PCR-type DNA polymerases in the presence of 5-40% blood components and mild detergent (0.05% Tween20).
PCR cycling conditions recommended by each enzymes manufacturer were used. Plasmodium falciparum genomic DNA (2 ng) was detected by nested PCR using Plasmodium species
detection primers in the presence of various concentrations of dried blood obtained from two apparently healthy Japanese volunteers that was eluted from lter papers (Left portion of each
gel: eluents of blood from volunteer #1; right portion of each gel: eluents of blood from volunteer #2). Arrowheads indicate the target PCR product of the 18S ribosomal RNA gene region (240
bp). *Denotes elution buffer control (without blood components). The gure shows representative results from two independent experiments.
405
Hemo KlenTaq DNA polymerase was resistant to blood components at
concentrations up to 20%, while Mighty Amp, Phusion Blood II, and
KAPA Blood DNA polymerases were resistant to blood components
at concentrations up to 10% of the reaction mixture (Fig. 1). These
results suggest that of the six commercially-available DNA polymerases
we tested, KOD FX DNA polymerase is the most resistant to blood
component inhibitors.
Although some additional high-molecular-weight bands (over
2,000 base pairs) were produced using KOD FX DNA polymerase, no
primer dimers (under 100 base pairs) were detected. On the other hand,
BIOTAQ DNA polymerase produced no detectable high-molecular-
weight additional bands, but the formation of primer dimers was
observed in the negative control (without template DNA) and 40%
blood eluent samples.
It has been shown that dried blood spotted onto lter paper is
suitable for laboratory diagnostic procedures involving PCR analysis
combined with immunoglobulin detection
3
. Therefore, we also examined
the performance of the six commercially-available DNA polymerases
in combined diagnostic tests using a phosphate buffered saline-based
elution buffer containing a mild detergent (0.05% Tween 20). As shown in
Figure 2, KOD FX DNA polymerase was resistant to blood components
from one of the donors at concentrations up to 20%, and from the other
donor at concentrations up to 15%. A DNA band of similar intensity
level (88.5% as compared to the control band) was produced in the
40% elution buffer sample without blood components, suggesting that
the activity of KOD FX DNA polymerase is not affected by Tween 20.
The other DNA polymerases were not resistant to the 40% elution buffer
containing 0.05% Tween 20, clearly demonstrating the superiority of the
KOD FX DNA polymerase for assays of this type.
DISCUSSION
It is both time-consuming and costly to determine which direct PCR
DNA polymerase would be the most suitable for detecting a target gene
from a specic pathogen. However, our data highlight the importance
of comparing the performance of several DNA polymerases prior
to establishing PCR conditions. The PCR delity of KOD FX DNA
polymerase is reportedly more than 10-fold higher than that of standard
Taq DNA polymerases, and similar to that of Pfu DNA polymerase.
The high delity of KOD FX DNA polymerase results in more accurate
PCR analyses
8,9
.
Our results indicate that among the commercially available
polymerases we tested, KOD FX DNA polymerase has the highest
potential for resistance to blood components, making it the most
suitable enzyme for attempting to detect the genomic DNA of pathogens
in samples containing high concentrations of blood. Theoretically,
employing DNA polymerases with higher resistance to blood components
would enable researchers to perform PCR assays with sensitivity high
enough for large-scale epidemiological studies. In addition, because
of its resistance to mild detergents such as Tween 20, KOD FX DNA
polymerase could be useful in serological studies to simultaneously
detect both antibodies and DNA in eluents used in testing for antibodies.
However, KOD FX DNA polymerase retains 3 to 5 exonuclease
activity, which potentially leads to a non-specic binding between
primers and contaminated human genomic DNA (Toyobo web site:
http://www.toyobo.co.jp/seihin/xr/lifescience/products/product/jisshirei/
archives/2008/04/pcr3pcr.html). Therefore, we can not exclude the
possibility of 3 to 5 exonuclease activity of the enzymes (KOD FX)
leading to the non-specic band (240 bp) in the negative control (Fig. 1)
was involved. In this line, KOD FX may not be suitable for PCR using
primers such as targeting the ribosomal RNA gene.
In PCR protocols, we did not employ modifications of the
recommendation of the manufacturers, which might give better results.
Indeed, FUEHRER et al. reported a modied protocol for Phusion Direct
PCR
4
. Such a modication method should be applied for each PCR
enzyme to achieve more improved results.
The results of the present study suggest that the increased PCR
sensitivity of KOD FX DNA polymerase may aid diagnostic eld research
efforts that involve the analysis of large numbers of samples for the
presence of P. falciparum and other Plasmodium species. Our results
suggest that this enzyme could also be employed for the detection of
other blood-borne pathogens.
RESUMO
Comparao de seis polimerases de DNA disponveis
comercialmente para o PCR direto
O propsito deste estudo foi avaliar 6 polimerases de DNA
disponveis comercialmente que so resistentes aos inibidores do PCR
para uma amplicao potencial de DNA de amostras de sangue total. O
DNA genmico do parasita humano da malria, Plasmodium falciparum,
foi analisado sob condies que incluram os componentes inibidores do
sangue extrado de sangue ressacado em papel de ltro. Nossos resultados
sugerem que a polimerase KOD FX DNA superior a outras polimerases.
ACKNOWLEDGEMENTS
This work was supported in part by Strategic Funds for the Promotion
of Science and Technology of MEXT (Ministry of Education, Sport,
Culture, Science and Technology) of Japan and by the Global Center
of Excellence (GCOE) Program at Nagasaki University. Plasmodium
falciparum genomic DNA was kindly provided by Dr. H. Uemura
(Institute of Tropical Medicine, Nagasaki University).
REFERENCES
1. Bereczky S, Mrtensson A, Gil JP, Frnert A. Short report: Rapid DNA extraction from
archive blood spots on lter paper for genotyping of Plasmodium falciparum. Am J
Trop Med Hyg. 2005;72:249-51.
2. Chaorattanakawee S, Natalang O, Hananantachai H, Nacher M, Brockman A, Krudsood
S, et al. Storage duration and polymerase chain reaction detection of Plasmodium
falciparum from blood spots on lter paper. Am J Trop Med Hyg. 2003;69:42-4.
3. De Swart RL, Nur Y, Abdallah A, Kruining H, El Mubarak HS, Ibrahim SA, et al.
Combination of reverse transcriptase PCR analysis and immunoglobulin M detection
on lter paper blood samples allows diagnostic and epidemiological studies of
measles. J Clin Microbiol. 2001;39:270-3.
4. Fuehrer HP, Fally MA, Habler VE, Starzengruber P, Swoboda P, Noedl H. Novel nested
direct PCR technique for malaria diagnosis using lter paper samples. J Clin
Microbiol. 2011;49:1628-30.
406
5. Kermekchiev MB, Kirilova LI, Vail EE, Barnes WM. Mutants of Taq DNA polymerase
resistant to PCR inhibitors allow DNA amplication from whole blood and crude
soil samples. Nucleic Acids Res. 2009;37(5):e40.
6. Singh B, Bobogare A, Cox-Singh J, Snounou G, Abdullah MS, Rahman HA. A genus-
and species-specic nested polymerase chain reaction malaria detection assay for
epidemiologic studies. Am J Trop Med Hyg. 1999;60:687-92.
7. Snounou G, Viriyakosol S, Jarra W, Thaithong S, Brown KN. Identication of the four
human malaria parasite species in eld samples by the polymerase chain reaction
and detection of a high prevalence of mixed infections. Mol Biochem Parasitol.
1993;58:283-92.
8. Takagi M, Nishioka M, Kakihara H, Kitabayashi M, Inoue H, Kawakami B, et al.
Characterization of DNA polymerase from Pyrococcus sp. strain KOD1 and its
application to PCR. Appl Environ Microbiol. 1997;63:4504-10.
9. Toyobo Co. Instruction manual KOD FX 0905. Tokyo: Toyobo Co.; 2011. 10p.
doi: 10.1590/S0036-46652013000600006
Financial support given by CNPq (Proc. 410550/2006-0).
(1) Universidade Estadual do Norte do Paran Campus Luiz Meneghel. E-mails: simonecastanho@uenp.edu.br, natyguerra@uenp.edu.br
(2) Universidade Paranaense Campus Cianorte. E-mail: wilsandrei_bio@hotmail.com
(3) Ncleo de Entomologia de Jacarezinho. Secretaria de Estado da Sade do Paran. E-mail: rubensmassafera-@hotmail.com
(4) Secretaria Municipal de Sade de Bandeirantes. E-mail: reimarquibio@hotmail.com
(5) Universidade Estadual de Maring. E-mails: mdbcarvalho@uem.br, uteodoro@uem.br
Correspondence to: Simone C. Castanho S. de Melo, R. So Paulo 801, Vila Paraso, 86360-000 Bandeirantes, PR, Brasil. E-mail: simonecastanho@uenp.edu.br
PHLEBOTOMINE SANDFLIES IN RURAL LOCATIONS IN THE STATE OF PARANA, SOUTHERN BRAZIL
Simone Cristina Castanho Sabaini de MELO(1), Wilsandrei CELLA(2), Rubens MASSAFERA(3), Natlia Maria Maciel Guerra SILVA(1),
Reinaldo MARQUI(4), Maria Dalva de Barros CARVALHO(5) & Ueslei TEODORO(5)
SUMMARY
This study reports the fauna and frequency of sandies in domestic animal shelters, residences and other ecotopes in rural areas
of the municipality of Bandeirantes, Paran State. Sandies were collected twice in eight rural villages by using Falcon traps from
8pm to 6am in 2008. In these localities 4,790 sandies were collected, which were represented by ten sandy species, prevailing of
Nyssomyia neivai and Nyssomyia whitmani species. It was observed that animal shelters are the domestic ecotopes where there is the
greatest frequency of these insects. The localities where the collections were made had the environmental characteristics that allow the
persistence of transmission of parasites from the American tegumentary leishmaniasis. Although the fauna and the behavior of sandies
species are similar in different localities, the method of controlling these insects should be adjusted to the environmental characteristics
of each one of the most diverse endemic areas of American tegumentary leishmaniasis in the municipalities of Paran State.
KEYWORDS: Sandies; American Tegumentary Leishmaniasis; Leishmania; Animals shelter; Fauna; Control.
INTRODUCTION
The leishmaniasis condition is sited among the top ve diseases that
have a major impact on public health worldwide
14
. In Latin America,
the cutaneous leishmaniasis (CL) has a strong impact on public health,
especially in Brazil, where it occurs in every State
12
. In the State of
Paran, CL is an endemic disease and it has been registered in more
than 300 of the 399 municipalities
10
including the municipality of
Bandeirantes.
In Bandeirantes municipality, 232 autochthonous cases of TL
were noted, with yearly occurrences from 1990 to 2009. As a result,
this research on phlebotomine fauna and frequency in domiciliary,
peridomiciliary and rural localities was conducted in order to provide
detailed knowledge on the areas where the leishmania transmissions
have happened that could be helpful when choosing the most effective
method to control the vectors.
Municipality description: The municipality of Bandeirantes is
located in the North Pioneer mesoregion of Paran and according to the
Demographic Census conducted in 2010, has a population of 32,182
inhabitants, of which 28,382 are living in urban and 3,800 in rural areas.
The vegetation type of the municipality is of semi-deciduous forest and
the soil is a composite type (Red Podzol, Red Latosol and Red Nitosol).
The climate is subtropical humid reaching in the coldest month averaged
temperatures lower than 18 C and in the warmest month averaging higher
than 22 C. The municipality has an area of 44,527.9 hectares (ha), where
only 872.9 ha are native forest. Nowadays, 80% of the municipalitys
territory is occupied by grain crops (soya and maize), alfalfa and sugar
cane. According to Figure 1, the rural zone of Bandeirantes is divided
into 17 districts, of which eight of them (gua da Jacutinga, gua das
Perobas, So Paulo, Cabina, gua do Cateto, gua do Caixo, gua
Vermelha and gua da Boa Pastora) were selected for collection of
sandies. In these districts in gua do Caixo and gua da Boa Pastora
there were no reported cases of CL.
Rural neighborhoods where the phlebotomines were collected:
1. gua da Jacutinga (23

05S/50

25W). Two farms were selected
from which to collect the samples: (3 irmos Farm and Silva Farm).
In the rst one, the traps were installed in the woods 984.25m from a
house (E1); in a chicken coop (E2); 9.84m from a house (E3), and in a
pigsty 6.56m from this same house (E4). In the second farm, the traps
were installed in a pigsty 64.04m from a house (E5); in the woods,
984.25m from the same house (E6); in a house made of wood which
is used as chicken coop and is 6.56m from another house (E7), and in
a banana plantation (E8). In both farms there are soybean and sugar
cane plantations.
2. gua das Perobas (23

14S/50

18W). Samples were collected
in Peroba Farm. The traps were installed in sites (E1, E2 and E4) which
were located behind the houses (E3, E5, E6, E9) where traps were also
installed; in chicken coops (E7, E8) 6.56m from these houses, and in the
woods, 984.25m from the same houses.
MELO, S.C.C.S.; CELLA, W.; MASSAFERA, R.; SILVA, N.M.M.G.; MARQUI, R.; CARVALHO, M.D.B. & TEODORO, U. - Phlebotomine sandies in rural locations in the state of Parana,
Southern Brazil. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 407-10, 2013.
408
3. So Paulo (23

10S/50

16W). Samples were collected in three
farms: Santo Antnio, Boa Esperana and Santa Rita. In the rst one,
the traps were installed in a house (E1) and in a pigsty (E2) 164.04m
from a house. In the second farm, the collection was taken in a chicken
coop (E3) 6.56m from a house; in a pigsty (E4) 16.4m from a house; in a
chicken coop (E5) 9.84m from the same house, and in a corral (E6) 16.4m
from another house. In Santa Rita Farm, the samples were collected in
a chicken coop (E7) 9.84m from a house; 3.8m from a pigsty (E8); in a
house (E9), and in a chicken coop (E10) 6.56m from a house.
4. Cabina. (23

13S/50

23W). The phlebotomine collection was
taken in Durval Mariquito Farm, Lazarini Farm and in Santa Maria
Farm. In the rst one, the collection was taken in a pigsty (E1) 16.4m
from a house (E4 and E5), where traps were also installed. In the woods
(E2)164.04m from these houses; in a chicken coop (E3) 9.84m from
those houses. In Lazarini Farm, the samples were collected in a house
(E6) and in a chicken coop (E7) 6.56m from E6 and 1,148.29 m from the
woods. In Santa Maria farm, the collection was taken in a house (E8),
in a pigsty (E9) 6.56m from a house and 984.25m from the woods and
in a chicken coop (E10).
5. gua do Cateto (23

12S/50

18W). The collection was taken
in Cateto Nomura Farm in houses (E1, E2, E5, E8 and E9); in chicken
coops close to these houses (E3, E4 and E7); in a pigsty (E6) near these
same houses, and in a corral (E10). Considering all the localities where
the work was done, this one has the largest residual area, which is located
approximately 656.17m from the residences.
6. gua Vermelha (23

09S/50

26W). The collect was done in Boa
Vista Farm in houses (E1, E2, E6 and E8); chicken coops (E3 and E9);
in pigsty (E4) 196.85m from the woods (E5), in a hangar (E7), and in a
dam shore (E10) 6.56m from the woods.
7. gua do Caixo (23

06S/50

20W). The collections were done
in Tanaka Farm, in two houses (E1, E6); in a chicken Coop (E2); in a
corral linked to a pigsty (E3); in a duck barn (E4); in canebrakes (E5,
E8); in a pigsty (E7) and in hangars (E9, E10). The house (E1) was 6.56m
from the chicken coop (E2) and the corral linked to the pigsty (E3). The
pigsty was located 6.56m from E6.
8. gua da Boa Pastora (23

08S/50

22W). The phlebotomines
collection was done in So Luiz Farm, Francisco Marques and Bela
Manh Farms. In the rst one, in a chicken coop (E1) and in a house (E2).
In Francisco Marques Farm, the collection was done in a goat barn (E3);
in a pigsty (E4); in a house (E5) and in a chicken coop (E6). In the last
one, in a pigsty (E7); in a chicken coop (E8) and in two houses (E9, E10).
Collection and phlebotomines identication: The phlebotomines
were caught in 15 localities distributed between eight rural neighborhoods.
During area selection, in order to implement the capture, six disease
registers in humans were found in two of these areas and in two of them
there was no occurrence. The collection was done with a light trap, from
8pm to 6am, from January to March and September to December of 2008,
and it consisted of two collections per locality (20 hours).
The number of traps installed in each locality varied from eight
to ten because of each houses availability and other ecotopes in the
peridomiciliary area. The collected specimens were sacrificed in
chloroform and then kept in cardboard boxes containing mothballs.
Phlebotomines were prepared and identied in the Medical Entomology
Laboratory of 19
th
Health Dept. of Jacarezinho, Parana State. The
nomenclature follows GALATI
3
and abbreviation follows MARCONDES
6
.
RESULTS
A total of 4,790 phlebotomines, belonging to 11 species, were
collected: Nyssomyia neivai, Nyssomyia whitmani, Pintomyia pessoai,
Migonemyia migonei, Pintomyia scheri, Evandromyia cortelezzii,
Micropygomyia ferreirana, Expapillata firmatoi, Brumptomyia
brumpti, Evandromyia sallesi and Brumptomyia cunhai. The hourly
average (HA) of total phlebotomines collected was 239.5 (Table 1).
In the gua do Cateto, gua da Boa Pastora and gua das Perobas
neighborhoods 79.6% (HA = 190.20) of its total was collected. The most
frequent species collected were Ny. neivai (HA = 104.70), Ny. whitmani
(HA = 96.95) and Pi. pessoai (HA = 26.25) (Table 1).
In its total neighborhood set 1,788 (HA = 89.40) phlebotomines were
collected in 20 chicken coops, 1,350 (HA = 67.50) in 15 piggeries and
973 (HA = 48.65) in 26 house porches (Table 2).
Fig. 1 - gua da Jacutinga, gua das Perobas, So Paulo, Cabina, gua do Cateto, gua
Vermelha, gua do Caixo and gua da Boa Pastora localities, where Phlebotomine sandies
were collected in the city of Bandeirantes, State of Paran, Brazil.
409
DISCUSSION
The eleven species collected in several districts of the municipality
of Bandeirantes has already been described in several municipalities of
Paran State
7,11-12
, including in Peroba Farm (gua das Perobas locality)
8
.
The Ny. neivai, Ny. whitmani, Mi. migonei, Pi. pessoai and Pi. scheri
phlebotomines have a very common occurrence in many endemic areas of
CL in Paran State
1,11-12
, demonstrating that these species of phlebotomine
sand ies present genetic characteristics that allow them to adapt to
anthropogenic environments with distinct levels of changes and due to
a sort of spatial, olfactory memory and/or to the host delity that direct
them to recognize environments of blood supply, rest and reproduction
2
.
The rst four species were already marked with natural infection by
protozoa of Leishmania genus in other regions of Brazil, showing the
potential of vector insects in natural and anthropogenic environments
4,6
.
The natural infection of Ny. whitmani was observed in Paran State
4
and
Ny. neivai in Paran and Santa Catarina States
5,9
.
Tabela 1
Phlebotomine sandies species collected in rural localities in the city of Bandeirantes, State of Paran, from January to December of 2008
Specie/Zone/Hourly Average AJ HA AP HA SP HA CA HA AC HA AV HA AX HA AB HA Total HA
Nyssomyia neivai 104 5.20 99 4.95 112 5.60 10 0.50 1,144 57.20 192 9.60 48 2.40 385 19.25 2,093 104.70
Nyssomyia whitmani 31 1.55 135 6.75 113 5.65 21 1.05 968 48.40 210 10.50 21 1.05 440 22.00 1,939 96.95
Pintomyia pessoai 21 1.05 388 19.40 6 0.30 - - 51 2.55 16 0.80 - - 43 2.15 525 26.25
Migonemyia migonei 7 0.35 23 1.15 11 0.55 3 0.15 53 2.65 4 0.20 1 0.05 10 0.50 112 5.60
Pintomyia scheri 6 0.30 27 1.35 2 0.10 - - 35 1.75 6 0.30 - - 1 0.05 71 3.55
Evandromyia cortelezzii 4 0.20 4 0.20 - - - - - - - - - - - - 8 0.40
Micropygomyia ferreirana 12 0.60 2 0.10 1 0.05 - - - - - - - - - - 15 0.75
Expapillata rmatoi 8 0.40 - - - - - - - - 3 0.15 - - - - 11 0.55
Brumptomyia cunhai - - 7 0.35 - - - - - - - - - - - - 7 0.35
Brumptomyia brumpti 1 0.05 - - - - - - - - - - - - - - 1 0.05
Evandromyia sallesi 1 0.05 - - - - - - - - - - - - - - 1 0.05
Total 195 9.75 685 34.25 245 12.25 34 1.70 2,251 112.55 431 21.55 70 3.50 879 43.95 4,790 239.50
AJ = gua da Jacutinga; AP = gua das Perobas; SP = So Paulo; CA = Cabina; AC = gua do Cateto; AV = gua Vermelha; AX = gua do Caixo; AB = gua da
Boa Pastora; HA = Hourly Average.
Tabela 2
Phlebotomine sandies collected in several environments, in rural localities in the city of Bandeirantes, State of Paran, from January to December of 2008
Environments/sites AJ HA AP HA SP HA CA HA AC HA AV HA AX HA AB HA Total HA
Hennery 49 2.45 11 0.55 76 3.80 1 0.05 1,563 78.15 14 0.70 2 0.10 85 4.25 1,788 89.40
Piggery 103 5.15 152 7.60 46 2.30 - - 292 14.60 235 11.75 31 1.55 491 24.55 1,350 67.50
Houses 15 0.75 139 6.95 3 0.15 13 0.65 391 19.55 169 8.45 - - 243 12.15 973 48.65
Woods 28 1.40 383 19.15 - - 20 1.00 - - 4 0.20 - - - - 435 21.75
Corrals - - - - 120 6.00 - - - - - - - - - - 120 6.00
Goat shelter - - - - - - - - - - - - - - 60 3.00 60 3.00
Corral/Piggery - - - - - - - - - - - - 29 1.45 - - 29 1.45
Banana tree - - - - - - - - - - - - - - - - 13 0.65
Mango tree - - - - - - - - 5 0.25 - - - - - - 5 0.25
Water reservoir margin - - - - - - - - - - 5 0.25 - - - - 5 0.25
Sheds - - - - - - - - - - 4 0.20 2 0.10 - - 6 0.30
Bamboo plantation - - - - - - - - - - - - 4 0.20 - - 4 0.20
Duck shelter - - - - - - - - - - - - 2 0.10 - - 2 0.10
Total 195 9.75 685 34.25 245 12.25 34 1.70 2,251 112.55 431 21.55 70 3.50 879 43.95 4,790 239.50
AJ = gua da Jacutinga; AP = gua das Perobas; SP = So Paulo; CA = Cabina; AC = gua do Cateto; AV = gua Vermelha; AX = gua do Caixo; AB = gua da
Boa Pastora; HA = Hourly Average.
410
In the majority of the districts where the phlebotomine collections
were made in bad hygiene condition homes the presence of humidity
and organic matter in the soil (leaves, fruits, domestic animal feces,
food and vegetal waste) of domestic animals shelters and residences in
the neighborhoods of remaining forests was noticed in the peridomicile.
These factors are crucial for the formation of phlebotomine breeding sites
that invade domiciles
6,10,13
, increasing the vulnerability of the inhabitants
to the CL.
CONCLUSION
In the neighborhoods where the collections were done, 10
phlebotomines species were found, and, among those, Ny. neivai and
Ny. whitmani were the main ones. Domestic animal shelters are the
ecotopes where these insects frequency occurs the most. The localities
where the collections were done have environmental characteristics that
allow Leishmania transmission persistence.
Even though fauna and phlebotomines species behavior are similar
in many localities, the control method of these insects has to be adjusted
to the environmental characteristics of each CL endemic area in Paran
municipalities.
The detailed knowledge on the localities where there is leishmaniasis
transmission chain gives the public health administration the option
to choose more efcient methods in order to control the spread of the
disease. The municipalities have not maintained their promise when it
comes to the endemic control of diseases that involve vectors, and it shows
the demand for changes in Ministry of Health policies. The increase of
cases of diseases related to these insects shows the need to capacitate
community health agents for vector vigilance development activities.
RESUMO
Flebotomneos em localidades rurais do Estado do Paran,
Sul do Brasil
Relatam-se, neste trabalho, a fauna e frequncia de ebotomneos
em abrigos de animais domsticos, residncias e outros ectopos
em reas rurais do municpio de Bandeirantes, Estado do Paran. Os
ebotomneos foram coletados em oito bairros rurais, com armadilhas
de Falco, duas vezes em cada bairro, das 20 s 6 horas, em 2008. No
conjunto dos bairros coletaram-se 4.790 ebotomneos, representados
por dez espcies, com predomnio de Nyssomyia neivai e Nyssomyia
whitmani. Os abrigos dos animais domsticos so os ectopos onde h
maior frequncia desses insetos. As localidades onde as coletas foram
realizadas tm caractersticas ambientais que permitem a persistncia
da transmisso de parasitos da leishmaniose tegumentar americana.
Apesar da fauna e do comportamento das espcies de ebotomneos
serem semelhantes nas diversas localidades, o mtodo de controle desses
insetos deve ser ajustado s caractersticas ambientais de cada uma das
mais diversas reas endmicas de leishmaniose tegumentar americana,
nos municpios do Paran.
ACKNOWLEDGEMENTS
To the Healthcare agents of the Entomology Group of the municipality
of Jacarezinho/Secretary of Health of the State of Paran, Mr. Hlio
Aparecido Barbosa, Nivaldo Paulino, and Valdeci Aparecido Fagundes
for their assistance in collection and identication of sandies and to the
Technical in Health Surveillance, Mr. Edson Carlos Capi in supporting
the orientation process of the localities where the collections were made.
REFERENCES
1. Andrade-Filho JD, Galati EAB, Falco AL. Nyssomyia intermedia (Lutz & Neiva,
1912) and Nyssomyia neivai (Pinto, 1926) (Diptera: Psychodidae: Phlebotominae)
geographical distribution and epidemiological importance. Mem Inst Oswaldo Cruz.
2007;102:481-7.
2. Freitas JS, Reinhold-Castro KR, Casanova C, Silva JP, Previdelli I, Teodoro U.
Memria espacial e/ou olfativa em ebotomneos em rea endmica de leishmaniose
tegumentar americana, sul do Brasil. Rev Soc Bras Med Trop. 2009;42:151-5.
3. Galati EAB. Morfologia e taxonomia. In: Rangel EF, Lainson R, editores.
Flebotomneos do Brasil. Rio de Janeiro: Editora Fiocruz; 2003. p. 23-51.
4. Luz E, Membrive N, Castro EA, Dereure J, Pratlong F, Dedet JA, et al. Lutzomyia
whitmani (Diptera: Psychodidae) as vector of Leishmania (V). braziliensis in Paran
State, Southern Brazil. Ann Trop Med Parasitol. 2000;94:623-31.
5. Marcondes CB, Bittencourt IA, Stoco PH, Eger I, Grisard EC, Steindel M. Natural
infection of Nyssomyia neivai (Pinto, 1926) (Diptera: Psychodidae, Phlebotominae)
by Leishmania (Viannia) spp. in Brazil. Trans R Soc Trop Med Hyg. 2009;103:1093-7.
6. Marcondes CB. A proposal of generic and subgeneric abbreviations for phlebotomine
sandies (Diptera: Psychodidae: Phlebotominae) of the world. Entomol News.
2007;118:351-6.
7. Massafera R, Silva AM, Carvalho AP, Santos DR, Galati EAB, Teodoro U. Fauna
de ebotomneos do municpio de Bandeirantes, no Estado do Paran. Rev Sade
Pblica. 2005;39:571-7.
8. Membrive NA, Rodrigues G, Membrive U, Monteiro WM, Neitzke HC, Lonardoni
MVC, et al. Flebotomneos de municpios do norte do Estado do Paran, sul do
Brasil. Entomol Vec. 2004;11:673-80.
9. Oliveira DM. Padronizao de tcnicas moleculares para o diagnstico e epidemiologia
de leishmaniose tegumentar americana. [dissertao]. Maring: Universidade Estadual
de Maring; 2009.
10. Reinhold-Castro KR, Scodro RB, Dias-Sversutti AC, Neitzke HC, Rossi RM, Khl
JB, et al. Avaliao de medidas de controle de ebotomneos. Rev Soc Bras Med
Trop. 2008;41:269-76.
11. Silva AM, Camargo NJ, Santos DR, Massafera R, Ferreira AC, Posta C, et al.
Diversidade, distribuio e abundncia de ebotomneos (Diptera: Psychodidae) no
Paran. Neotrop Entomol. 2008;37:209-25.
12. Teodoro U, Santos DR, Santos AR, Oliveira O, Poiani LP, Silva AM, et al.
Informaes preliminares sobre ebotomneos do norte do Paran. Rev Sade Pblica.
2006;40:327-30.
13. Teodoro U, Santos DR, Santos AR, Oliveira O, Santos ES, Neitzke HC, et al. Avaliao
de medidas de controle de ebotomneos no Municpio de Lobato, Estado do Paran,
Sul do Brasil. Cad Sade Pblica. 2006;22:451-5.
14. World Health Organization. Leishmaniasis: magnitude of the problem. [cited 2008
Nov 08]. Available from: http://www.who.int/leishmaniasis/burden/magnitude
Received: 15 August 2012
doi: 10.1590/S0036-46652013000600007
Department of Parasitology, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand.
Correspondence to: Assist. Prof. Anchalee Wannasan, Department of Parasitology, Faculty of Medicine, Chiang Mai University, Chiang Mai, 50200, Thailand. Tel: 66 53 945343. Fax: 66
53 945347. E-mail: awannasa@mail.med.cmu.ac.th
POTENTIALLY PATHOGENIC FREE-LIVING AMOEBAE IN SOME
FLOOD-AFFECTED AREAS DURING 2011 CHIANG MAI FLOOD
Anchalee WANNASAN, Pichart UPARANUKRAW, Apichart SONGSANGCHUN & Nimit MORAKOTE
SUMMARY
The survey was carried out to investigate the presence of potentially pathogenic free-living amoebae (FLA) during ood in Chiang
Mai, Thailand in 2011. From different crisis ood areas, seven water samples were collected and tested for the presence of amoebae
using culture and molecular methods. By monoxenic culture, FLA were detected from all samples at 37 C incubation. The FLA
growing at 37 C were morphologically identied as Acanthamoeba spp., Naegleria spp. and some unidentied amoebae. Only three
samples (42.8%), dened as thermotolerant FLA, continued to grow at 42 C. By molecular methods, two non-thermotolerant FlA were
shown to have 99% identity to Acanthamoeba sp. and 98% identity to Hartmannella vermiformis while the two thermotolerant FLA
were identied as Echinamoeba exundans (100% identity) and Hartmannella sp. (99% identity). This rst report of the occurrence
of FLA in water during the ood disaster will provide information to the public to be aware of potentially pathogenic FLA.
KEYWORDS: Flood; Chiang Mai; Free-living amoebae.
INTRODUCTION
Free-living amoebae (FLA) are ubiquitous in nature, mainly in
soil and water. Among them, Naegleria, Acanthamoeba, Balamuthia
and Sappinia are now known to cause brain infections in humans
7,8,27
.
Moreover, Acanthamoeba, Hartmannella and Vahlkampfia can be
causative agents of amoebic keratitis in humans
1,17
. Several FLA are
also known to play a role as vectors of several intracellular pathogenic
microorganisms, such as Legionella pneumophila
4
, Mycobacterium
18

and Chlamydia-like bacterium
20
as they can support the growth of those
micropathogens and protect them from the harsh environment.
Surveys in Thailand showed the presence of FLA in the environment
including water
14,16,21
. Recently, FLA were detected in soil and water
samples in Chiang Mai areas
34
. As FLA are abundant in soil, they may
be dispersed during ood and as a result human may have increased a
risk of getting infected. It is therefore interesting to see if the pathogenic
FLA are abundant in water during recent major oods in the country. The
present study looked for the occurrence of FLA in the water during the
2011 ood disaster in Chiang Mai, Thailand. The results will provide
more useful information to the public so as to have increased awareness
of these FLA which can cause severe, life-threatening diseases.
Sample collection: At end of September 2011, approximately 50 mL
of water samples were collected from each of seven ood crisis areas in
Chiang Mai including Pracha Sampan Intersection (cmf1), Chang Klan
Road (cmf2), Nawarat Bridge (cmf3), Chiang Mai-Lampun road (cmf4),
Chiang Mai Land Village (cmf5), Nong Hoi Road (cmf6) and Charoen
Pratet Road (cmf7) (Fig. 1). Samples were transported to the laboratory
in the Department of Parasitology, Faculty of Medicine, Chiang Mai
University, and processed on the same day.
Amoebae culture: To detect free-living amoebae, 10 L of the
sediment after centrifugation (1,200g, 10 min, RT) was dropped onto
the middle of NNA-E. coli plates (1.5% non-nutrient agar pre-coated
with heat-inactivated Escherichia coli). The plates were incubated at
37 C for two weeks and daily observed for the growth of amoebae using
an inverted microscope. If the amoebae existed, Pages amoeba saline
solution (PAS) was applied to the culture and amoebae were harvested by
scraping the agar surface with spatula. In case of fungal contamination,
sub-culturing was performed by cutting the uncontaminated area of agar
harboring amoebae and transferring to a new plate. Collected amoebae
were subjected to trichrome staining for morphological identication
and sub-culturing at 42 C in order to examine the thermotolerance
characteristics
34
.
Morphological identification: The morphological criteria
used to identify amoebae were based on the previous publication
30
.
Acanthamoeba cysts are characterized by a double-walled structure
with an outer wrinkled wall, while its trophozoite represents ne,
WANNASAN, A.; UPARANUKRAW, P.; SONGSANGCHUN, A. & MORAKOTE, N. - Potentially pathogenic free-living amoebae in some ood-affected areas during 2011 Chiang Mai
ood. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 411-6, 2013.
412
Fig. 1 - Map showing the sampling sites of ood crisis areas in Chiang Mai 2011. Whole picture of Mueang District, Chiang Mai is shown on the upper right. A: Nawarat Bridge (cmf3). B:
Charoen Pratet Road (cmf7). C: Chang Klan Road (cmf2). D: Pracha Sampan Intersection (cmf1). E: Chiang Mai Land Village (cmf5). F: Nong Hoi Road (cmf6). G: Chiang Mai-Lampun
road (cmf4).
413
tapering, hyaline projections called acanthopodia, Naegleria cyst bears
single layer and smooth cyst wall, where as its trophozoite possesses a
large karyosome surrounded by a halo and typical blunt pseudopodia,
lobopodia
30,34
. Morphological examination and photography were done
under a light microscope (Olympus CHA) with 1,000x magnication.
Acanthamoeba castellanii originated from a keratitis patient of Siriraj
Hospital was used as positive control. Enagellation experiment was
done to verify the presence of Naegleria spp
30
. Briey, the suspected
trophozoites grown on a NNA-E. coli plate were suspended in sterile
distilled water and left at room temperature for at least one hour.
The presence of agellate form containing two long agella
34
can be
periodically examined under the light microscope.
Molecular identication: DNA preparation was performed by
boiling method
29
. In brief, the amoebae were harvested from the culture
plates, washed twice with PAS, and centrifuged at 5,000xg for ve min
at room temperature. After discarding the supernatant, the remaining
cell sediment was suspended and directly heated at 95 C for 10 min.
Following brief centrifugation, 5 L of the supernatant was freshly used
for PCR. Whole sediments of the original water samples that showed
no growth in culture were heated and used for PCR as described above.
Two different sets of PCR employed in this study included FLA PCR
designed for the detection of 18S rDNA of FLA
28
and Acanthamoeba
spp.-specic PCR (ACA PCR) targeted to 18S rDNA of Acanthamoeba
24
.
All PCR reactions were done in 50 L reactions containing 5 L of
10x PCR buffer (Fermentas
), 1.25 units of i-Taq

TM
DNA polymerase
(Fermentas
) and 0.2 mM of each dNTP (Applied Biosystems). The

MgCl
2
concentrations were 3 and 4 mM and the primer concentrations
were 0.8 M and 0.5 M for FLA PCR and ACA PCR, respectively. For
FLA PCR, the reactions were performed by incubation for seven min at
94 C, followed by 40 cycles of one min at 94 C, one min at 63 C and
three min 30 s at 74 C, with a nal extension at 74 C for 10 min
28
. The
reaction cycles for ACA PCR were pre-incubation step at seven min at
95 C, followed by 20 cycles of one min at 95 C, one min at 60 C and
two min at 72 C. This was followed by 25 cycles of one min at 95 C and
two min at 72 C
24
. The PCR was carried out using DNA engine thermal
cycler PTC-100 (MJ Research, USA). PCR products were analyzed by
electrophoresis on 1.5% agarose gels and puried using QIAquick PCR
purication kit (QIAGEN). The puried PCR products were sent to
1
st
Base DNA sequencing services (Singapore) for sequencing at both
directions using the same primers used in the same PCR. The obtained
sequencing data were compared with all published sequences in GenBank
using BLASTn at National Center for Biotechnology Information [http://
blast.ncbi.nlm.nih.gov/] and submitted to the GenBank database.
RESULTS
Agar plate culture: At 37 C culture, all seven water samples
collected from the ood affected areas showed FLA growth on the
second day of incubation. The growth areas of FLA, as shown by the
presence of clear zones on 1.5% NNA-E. coli plates, were then cut and
sub-cultured at 42 C. Three out of seven samples (42.8%) were able to
grow at 42 C (Table 1).
Morphological identication: The amoebae growing at 37 C
were collected and subjected to trichrome staining. Acanthamoeba and
Naegleria were concurrently found in most of the ood samples (5/7,
71%) stained with trichrome. Acanthamoeba sp. (Fig. 2A) were observed
in ve samples (except cmf6 and cmf7), while Naegleria sp. (Fig. 2B)
were detected in six samples (except cmf6). The presence of Naegleria
spp. in six samples was in correspondence with positive enagellation
test (Table 1). Acanthamoeba-like trophozoites showing ne short
acanthopodia were also detected (Fig. 2C). Additionally, morphologically
unidentied FLA including round double-walled cysts bearing one
nucleus with central karyosome (Fig. 2D, E), small round cysts with
unstained nucleus (Fig. 2F), small trophozoites presenting short spiny
pseudopodia resembling Echinamoeba (Fig. 2G, H) and Hartmannella-
like trophozoites with elongated shape (Fig. 2I) were often seen.
Molecular identication: The amoebae growing on agar culture
plate at 42
o
C or 37
o
C were harvested and identied by PCR. Using the
FLA PCR screening, cmf1 yielded a DNA fragment of approximately
1,000 bp (Fig. 3), whereas cmf3 to cmf6 yielded a distinctive band at
800 bp. However, cmf2 and cmf7 were negative by FLA PCR. When
the ACA PCR was employed, the approximately 500-bp specic band
for Acanthamoeba spp. was observed only in cmf1 (Fig. 4). Puried
PCR products obtained from ACA PCR (cmf1) and FLA PCR (cmf3,
cmf4, cmf5 and cmf6) were used for sequencing. Results from BLASTn
revealed that sequence from cmf1 belonged to Acanthamoeba sp. (99%
maximum identity with Acanthamoeba sp. UNB13 from Brazil Accession
No. JQ268234, followed by 96% maximum identity with Acanthamoeba
castellanii Accession No. GU001160). FLA isolated from cmf4 was
Table 1
FLA detected during 2011 Chiang Mai ood
Isolate Growth at 37 C Growth at 42 C Enagellation test FLA-PCR ACA-PCR Sequencing data
cmf1 G
a
NG
b
+ Pos Pos Acanthamoeba sp.
cmf2 G NG + Neg Neg ND
c
cmf3 G G + Pos Neg Invalid data
cmf4 G G + Pos Neg Echinamoeba sp.
cmf5 G G + Pos Neg Hartmannella sp.
cmf6 G NG - Pos Neg Hartmannella sp.
cmf7 G NG + Neg Neg ND
a
G: growth,
b
NG: no growth,
c
ND: not done.
414
Echinamoeba exundans (100% identity with E. exundans Accession No.
AF293895), while those from cmf5 and cmf6 were most closely related
to Hartmannella sp. (Accession No. HM363627) and Hartmannella
vermiformis (Accession No. FJ940709) with 99 and 98% maximum
identity, respectively. On the other hand, we failed to obtain unambiguous
sequencing data from cmf3. It was also impossible to further analyze
FLA isolated from cmf2, cmf3 and cmf7 since they were lost during
culture. The sequences of FLA reported in this study were deposited in
GenBank (Accession Number: JX507295-JX507297).
DISCUSSION
In Thailand, at least 17 cases of human brain infection caused
by Acanthamoeba, Naegleria and Balamuthia
13,25,35
, 29 cases of
acanthamoebic keratis
6,15,33
, and one case of Acanthamoeba infection
of gastric ulcer
26
have been reported from several provinces. Although
there has never been any case of brain infection due to FLA reported
from Chiang Mai, the importance of FLA cannot be neglected. In the
previous survey of natural water sources in Chiang Mai in 2009, FLA
frequently found were Naegleria spp. (37.5%) and Acanthamoeba spp.
(18.8%). The number of positive thermotolerant FLA from water samples
(62.5%) was higher than that from soil samples (37.5%)
34
. As far as the
ood conditions are concerned, such potentially pathogenic FLA in the
environment may disperse and increase during the ood. Surprisingly,
neither thermotolerant Naegleria nor Acanthamoeba was found in the
present survey. Although the number of samples in the present study was
low, detection of thermotolerant FLA were demonstrated in three out of
seven water samples analyzed.
To our knowledge, this is the rst report of the occurrence of FLA
during ood disaster in Thailand. It was not surprising that several
amoebae including Acanthamoeba and Naegleria were detected by
microscopic examination after 37
C incubation in all ood water samples.

The presence of Acanthamoeba and Naegleria in this survey is due to
their abundance in nature and ability to dwell in unsanitary conditions.
However, both Acanthamoeba and Naegleria isolated from the ood
samples failed to grow at 42
C. This was unexpected as the previous

FLA survey in Chiang Mai showed the occurrence of both thermotolerant
Acanthamoeba and Naegleria in water and soil samples
34
. Instead,
thermotolerant Hartmannella and Echinamoeba were identied for the
rst time in Chiang Mai in this survey.
In the present study, ve out of seven samples were successfully
amplied by FLA PCR. The usefulness of FLA PCR, of which its
primers are targeted at the conserved regions of Acanthamoeba 18S
rDNA, was stated in some studies showing a detection range of several
Fig. 2 A-I - Trichrome staining of free-living amoebae under light microscopy (1,000x),
bar = 10 m. A: A cyst of Acanthamoeba sp. B: A large trophozoite of Naegleria sp. C:
Acanthamoeba-like trophozoites (arrow showing ne short acanthopodia). D, E: Different
sizes of unidentied double-walled cysts with distinct nuclei. F: Unidentied amoebae with
small round cysts (arrow). G, H: Small Echinamoeba-like trophozoites (arrow showing few
spiny short pseudopodia). I: An elongated cylindrical trophozoite of Hartmannella-like
amoeba (arrow).
Fig. 3 - Gel electrophoresis of amplicons from FLA PCR conditions. A: N - negative
control. Lane P (positive control) and lane 1 (cmf1) showing the specic bands (1 kb) for
Acanthamoeba. Lane 2 (cmf2) showing negative result. B: Lanes 3, 4, 5 and 6 (cmf3, cmf4,
cmf5 and cmf6, respectively) showing the bands (~800 bp) for other free-living amoebae.
Lane 7 (cmf7) showing negative result. M - 100 bp Ladder DNA (Fermentas
).
Fig. 4 - Gel electrophoresis of amplicons from ACA PCR conditions. N - negative control.
Lane P (positive control) and lane 1 (cmf1) showing the approximately specic bands (500-
bp) for Acanthamoeba. Lanes 2, 3, 4, 5, 6 and 7 (cmf2, cmf3, cmf4, cmf5, cmf6 and cmf7,
respectively) showing negative results. M - 100 bp Ladder DNA (Fermentas
).
415
FLA such as Naegleria, Acanthamoeba, Hartmannella, Vahlkampa
28
,
Echinamoeba, Vannella and Protacanthamoeba
9
and also ciliated
freshwater protozoan Tetrahymena
3
. The negative results of FLA PCR in
two of the ood samples might in part be due to the presence of unknown
FLA which could not be detected by this PCR. The discrepancy between
the sequencing data and microscopic examination and enagellation
test (Table 1) might be the result of sub-culturing procedures that lead
to the overgrowth of predominant FLA. Moreover, some samples used
for DNA preparation were harvested from continuous sub-culturing, not
from the rst inoculation as done for microscopic examination. Therefore,
FLA detected by PCR could be only the subset of population of the
entire samples. In contrast, FLA detected by microscopic examination
represented the amoebae grown on the whole culture plates. Regarding
cmf3, despite a distinct band obtained by FLA PCR, we could not get
the valid sequencing data. It is possible that more than one species of
amoebae were present in cmf3 resulting in heterogeneous PCR products
and hence ambiguous sequence. In such a failure, axenic culture or
cloning by limiting dilution should be considered in future surveys.
Among the non-thermotolerant FLA, only cmf1 and cmf6 were
successfully sequenced showing the close relationship to Acanthamoeba
sp. and Hartmannella vermiformis, respectively. The FLA isolated from
cmf1 was most similar to Acanthamoeba sp. (JG268234, 99% identity).
It also had 96% identity to Acanthamoeba castellanii (GU001160).
It is widely accepted that temperature tolerance is a characteristic
of potential pathogenicity, particularly for Acanthamoeba
10,31
. It is
therefore unlikely that Acanthamoeba identied in this study is virulent.
As for Hartmannella, no evidence supporting correlation between
thermotolerance and pathogenicity has been demonstrated but the health
impact of non-thermotolerant Hartmannella could not be ignored.
Among the three thermotolerant FLA detected in this study, cmf4
and cmf5 were successfully sequenced and identied as Echinamoeba
exundans and Hartmannella sp., respectively. Although Echinamoeba has
been occasionally reported from aquatic sources, e.g. lake, leaf litter
22
,
hot water systems of hospitals
23
, water bodies
9
and hot springs
2
. To our
knowledge this genus has never been described as a human pathogen.
Hartmannella is ubiquitous in nature and has recently been associated
with amoebic keratitis as it was found to co-infect with Acanthamoeba
or even with Vahlkampa
1,12,17
. Even if Echinamoeba and Hartmannella
of thermotolerant isolates investigated in this study are not considered
to be as serious as Acanthamoeba or Naegleria, their important role as
potential vectors of pathogens could not be overlooked. Acanthamoeba,
Echinamoeba and Hartmannella have been reported to serve as vectors
harboring several human pathogenic bacteria, such as, Legionella
pneumophila
4,9
, Exophiala dermatitidis
5
, Pseudomonas aeruginosa
9,19
,
Comamonas acidovorans, Escherichia coli, Proteus mirabilis, Vibrio
cholerae
32
and Mycobacterium
11
. Thus the ndings of such amoebae
in this survey during ood in Chiang Mai should provide evidence for
awareness of outbreaks of human infections caused by these FLA.
RESUMO
Amebas potencialmente patognicas de vida livre em algumas
reas afetadas durante a inundao de 2011 em Chiang Mai
A pesquisa foi feita para investigar a presena de amebas de vida
livre (FLA) durante a inundao em Chiang Mai, Tailndia, ano de
2011. A partir de diferentes reas de inundao sete amostras de
gua foram coletadas e testadas para a presena de amebas usando
mtodos moleculares e de cultura. Atravs da cultura monoxnica,
FLA foi detectada em todas as amostras aps incubao a 37 C. As
FLA crescendo a 37 C foram identicadas morfologicamente como
Acanthamoeba spp, Naegleria spp e algumas amebas no determinadas.
Somente trs amostras (42,8%) denidas como FLA termotolerantes
continuaram a crescer a 42 C. Por mtodos moleculares duas FLA
termotolerantes tiveram 99% de identidade com a Acanthamoeba sp e
98% de identidade com Hartmannella vermiformis enquanto as duas
FLA termotolerantes foram identicadas como Echinamoeba exundans
(100% de identidade) e Hartmannella sp (99% de identidade). Este
primeiro relato da ocorrncia de FLA em guas durante inundaes
informa ao pblico que ele deve estar atento de FLA potencialmente
patognica.
ACKNOWLEDGEMENTS
This study was nancially supported by the Faculty of Medicine
Endowment Fund for Medical Research, Chiang Mai University. The
authors thank Assist. Prof. Koson Roongruangchai for providing the
Acanthamoeba castellanii positive control used in this study and Mr.
Pathamet Khositharattanakool, Ms. Rungkanta Methanitikorn for their
help in producing the map and pictures. The authors acknowledge
Regional Centre for Geo-informatics and Space Technology (North),
Faculty of Social Sciences, Chiang Mai University for the information
and the maps of the affected areas during the 2011 Chiang Mai ood.
REFERENCES
1. Aitken D, Hay J, Kinnear FB, Kirkness CM, Lee WR, Seal DV. Amebic keratitis in
a wearer of disposable contact lenses due to a mixed Vahlkampa and Hartmannella
infection. Ophthalmology. 1996;103:485-94.
2. Baumgartner M, Yapi A, Grbner-Ferreira R, Stetter KO. Cultivation and properties
of Echinamoeba thermarum n. sp., an extremely thermophilic amoeba thriving in
hot springs. Extremophiles. 2003;7:267-74.
3. Behets J, Declerck P, Delaedt Y, Verelst L, Ollevier F. Survey for the presence of
specic free-living amoebae in cooling waters from Belgian power plants. Parasitol
Res. 2007;100:1249-56.
4. Brieland J, McClain M, LeGendre M, Engleberg C. Intrapulmonary Hartmannella
vermiformis: a potential niche for Legionella pneumophila replication in a murine
model of legionellosis. Infect Immun. 1997;65:4892-6.
5. Cateau E, Mergey T, Kauffmann-Lacroix C, Rodier MH. Relationships between
free living amoebae and Exophiala dermatitidis: a preliminary study. Med Mycol.
2009;47:115-8.
6. Chuckpaiwong V, Vathesatokkit C, Lekhanont K, Vongthongsri A. Acanthamoeba
keratitis: character and outcome of treatment in tropical area. Thai J Opthalmol.
2010;24:26-36.
7. Gelman BB, Popov V, Chaljub G, Nader R, Rauf SJ, Nauta HW, et al.
Neuropathological and ultrastructural features of amoebic encephalitis caused by
Sappinia diploidea. J Neuropathol Exp Neurol. 2003;62:990-8.
8. Gelman BB, Rauf SJ, Nader R, Popov V, Bokowski J, Chaljub G, et al. Amoebic
encephalitis due to Sappinia diploidea. JAMA. 2001;285:2450-541.
9. Gianinazzi C, Schild M, Wuthrich F, Ben NN, Fuchslin HP, Schurch N, et al. Screening
Swiss water bodies for potentially pathogenic free-living amoebae. Res Microbiol.
2009;160:367-74.
416
10. Griffin JL. Temperature tolerance of pathogenic and nonpathogenic free-living
amoebas. Science. 1972;178(4063):869-70.
11. Gryseels S, Amissah D, Durnez L, Vandelannoote K, Leirs H, De Jonckheere J, et
al. Amoebae as potential environmental hosts for Mycobacterium ulcerans and other
mycobacteria, but doubtful actors in Buruli ulcer epidemiology. PLoS Negl Trop Dis.
2012;6:e1764.
12. Inoue T, Asari S, Tahara K, Hayashi K, Kiritoshi A, Shimomura Y. Acanthamoeba
keratitis with symbiosis of Hartmannella ameba. Am J Ophthalmol. 1998;125:721-3.
13. Intalapaporn P, Suankratay C, Shuangshoti S, Phantumchinda K, Keelawat S, Wilde
H. Balamuthia mandrillaris meningoencephalitis: the rst case in southeast Asia.
Am J Trop Med Hyg. 2004;70:666-9.
14. Jariya P, Tiewchalore S, Junne V, Lertlaituan P, Suvithayasri V. Survey of Naegleria
fowleri the causative agent of primary amoebic meningoencephalitis (PAM) in
stagnant waters around factory area in Thailand. Siriraj Med J. 1997;49:222-9.
15. Korriruvongs P, Wanachiwanawin D, Visvesvara GS. Treatment of Acanthamoeba
keratitis with chlorhexidine.Opthalmology. 1999;106:798-802.
16. Lekkla A, Sutthikornchai C, Bovornkitti S, Sukthana Y. Free-living ameba
contamination in natural hot springs in Thailand. Southeast Asian J Trop Med Public
Health. 2005;36(Suppl 4):5-9.
17. Lorenzo-Morales J, Martinez-Carretero E, Batista N, Varez-Marin J, Bahaya Y,
Walochnik J, et al. Early diagnosis of amoebic keratitis due to a mixed infection
with Acanthamoeba and Hartmannella. Parasitol Res. 2007;102:167-9.
18. Marciano-Cabral F, Jamerson M, Kaneshiro ES. Free-living amoebae, Legionella
and Mycobacterium in tap water supplied by a municipal drinking water utility in
the USA. J Water Health. 2010;8:71-82.
19. Michel R, Burghardt H, Bergmann H. Acanthamoeba, naturally intracellularly
infected with Pseudomonas aeruginosa, after their isolation from a microbiologically
contaminated drinking water system in a hospital. Zentralbl Hyg Umweltmed.
1995;196:532-44.
20. Michel R, Mller KD, Zller L, Walochnik J, Hartmann M, Schmid EN. Free-living
amoebae serve as a host for the Chlamydia-like bacterium Simkania negevensis. Acta
Protozool. 2005;44:113-21.
21. Nacapunchai D, Kino H, Ruangsitticha C, Sriwichai P, Ishih A, Terada M. A brief
survey of free-living amebae in Thailand and Hamamatsu District, Japan. Southeast
Asian J Trop Med Public Health. 2001;32(Suppl 2):179-82.
22. Page FC. A new family of amoebae with fine pseudopodia. Zool J Linn Soc.
1975;56:73-89.
23. Rohr U, Weber S, Michel R, Selenka F, Wilhelm M. Comparison of free-living
amoebae in hot water systems of hospitals with isolates from moist sanitary areas by
identifying genera and determining temperature tolerance. Appl Environ Microbiol.
1998;64:1822-4.
24. Schroeder JM, Booton GC, Hay J, Niszl IA, Seal DV, Markus MB, et al. Use
of subgenic 18S ribosomal DNA PCR and sequencing for genus and genotype
identication of Acanthamoebae from humans with keratitis and from sewage sludge.
J Clin Microbiol. 2001;39:1903-11.
25. Siripanth C, Punpoowong B, Riganti M. Early detection and identification of
amphizoic amoebae from nasal exudates of a symptomatic case. J Med Assoc Thai.
2005;88:545-9.
26. Thamprasert K, Khunamornpong S, Morakote N. Acanthamoeba infection of peptic
ulcer. Ann Trop Med Parasitol. 1993;87:403-5.
27. Trabelsi H, Dendana F, Sellami A, Sellami H, Cheikhrouhou F, Neji S, et al.
Pathogenic free-living amoebae: epidemiology and clinical review. Pathol Biol (Paris).
2012;60:399-405.
28. Tsvetkova N, Schild M, Panaiotov S, Kurdova-Mintcheva R, Gottstein B, Walochnik
J, et al. The identication of free-living environmental isolates of amoebae from
Bulgaria. Parasitol Res. 2004;92:405-13.
29. Uparanukraw P, Morakote N. Detection of circulating Trichinella spiralis larvae by
polymerase chain reaction. Parasitol Res. 1997;83:52-6.
30. Visvesvara GS. Pathogenic and opportunistic free-living amoebae. In: Murray PR,
Baron EJ, Pfaller MA, Tenover FC, Yolken RH, ed. Manual of clinical microbiology.
7
th
ed. Washington DC: ASM Press; 1999. p. 1383-90.
31. Walochnik J, Haller-Schober E, Kolli H, Picher O, Obwaller A, Aspock H.
Discrimination between clinically relevant and nonrelevant Acanthamoeba strains
isolated from contact lens- wearing keratitis patients in Austria. J Clin Microbiol.
2000;38:3932-6.
32. Walochnik J, Picher O, Aspck C, Ullmann M, Sommer R, Aspck H. Interactions
of Limax amoebae and gram-negative bacteria: experimental studies and review
of current problems. Tokai J Exp Clin Med. 1998;23:273-8.
33. Wanachiwanawin D, Booranapong W, Kosrirukvongs P. Clinical features of
Acanthamoeba keratitis in contact lens wearers and non-wearers. Southeast Asian J
Trop Med Public Health. 2012;43:549-56.
34. Wannasan A, Chaiwong P, Bunchoo M, Morakote N. Occurence of thermotolerant
Naegleria and Acanthamoeba in some natural water sources in Chiang Mai. Chiang
Mai Med J. 2009;48:117-24.
35. Wiwanitkit V. Review of clinical presentations in Thai patients with primary amoebic
meningoencephalitis. MedGenMed. 2004;6:2.
doi: 10.1590/S0036-46652013000600008
(1) LIM-54, Departamento de Doenas Infecciosas e Parasitrias da Faculdade de Medicina da Universidade de So Paulo, Av. Dr. Enas de Carvalho Aguiar 500, 1 andar, sala 112, 05403-
000 Sao Paulo, SP, Brazil.
(2) Servio de Controle de Infeco Hospitalar, Hospital do Cncer A.C. Camargo, Rua Prof. Antonio Prudente 211, 01509-010 Sao Paulo, SP, Brazil.
(3) Laboratorio de Microbiologia, Hospital das Clinicas da Universidade de So Paulo, Av. Dr. Enas de Carvalho Aguiar 155, piso 08, bloco 08, 05403-010 Sao Paulo, SP, Brazil.
Correspondence to: Silvia Figueiredo Costa, MD, PhD, LIM-54 Departamento de Doenas Infecciosas e Parasitrias da Faculdade de Medicina da Universidade de So Paulo, Av. Dr. Enas
de Carvalho Aguiar 500, 1 andar, sala 112, 05403-000 Sao Paulo, SP, Brasil. E-mail: costasilviaf@ig.com.br
Smqnr VARIANTS IN CLINICAL ISOLATES OF Stenotrophomonas maltophilia IN BRAZIL
Jorge Isaac GRACIA-PAEZ(1), Juliana Rosa FERRAZ(1), Ivan Avelino FRANA E SILVA(2), Flvia ROSSI(3), Anna Sara LEVIN(1) & Silvia Figueiredo COSTA(1)
SUMMARY
Stenotrophomonas maltophilia contains a novel chromosomally-encoded qnr gene named Smqnr that contributes to low intrinsic
resistance to quinolone. We described Smqnr in 13 clinical isolates of S. maltophilia from two Brazilian hospitals, over a 2-year
period. The strains were identied by API 20 NE (bioMrieux, France). Susceptibility by microdilution method to trimetroprim/
sulfamethoxazole, ciprooxacin, levooxacin, minocycline, ceftazidime, chloramphenicol and ticarcillin/clavulanate was performed
according to CLSI. PCR detection of Smqnr gene was carried out. The sequence of Smqnr was compared with those deposited in
GenBank. Pulsed-eld gel electrophoresis (PFGE) of all strains was performed. Thirteen Smqnr positives isolates were sequenced
and three novel variants of Smqnr were identied. All 13 Smqnr isolates had distinguishable patterns by PFGE. This is the rst report
of Smqnr in S. maltophilia isolated in Brazil.
KEYWORKS: Stenotrophomonas maltophilia; Levooxacin resistance; qnr genes.
INTRODUCTION
Stenotrophomonas maltophilia, a non-fermentative Gram-negative
bacillus that is ubiquitous in the environment, has emerged as an
important opportunistic pathogen
2
. This microorganism exhibits intrinsic
and acquired resistance to a wide variety of antimicrobial agents
and few options of treatment are available
2,15
. So far, trimethoprim/
sulfamethoxazole is the drug of choice to treat infections caused by this
microorganism, however, during the past few years increased resistance
to this antibiotic has been reported
8,15
. The new uoroquinolones such as
levooxacin and moxioxacin showed promising in vitro activity against
S. maltophilia
13
. Resistance to these new uoroquinolones, among S.
matophilia, is rare and needs to be further researched.
S. maltophilia contains a novel chromosomally-encoded S.
maltophilia qnr gene named Smqnr with 219 amino acids with two
classic pentapeptide repeat motifs separated by a glycine residue, which
confers low level resistance to quinolone antibiotics as showed in vitro
experiments
12
. The role of Smqnr on quinolones resistance, however, is
controversial and there is a lack of research evaluating its association
with levooxacin resistance in S. maltophilia.
We describe the characterization of Smqnr genes in clinical isolates of
S. maltophilia susceptible and resistant to ciprooxacin and levooxacin.
Clinical samples of S. maltophilia isolates from two Brazilian teaching
hospitals, over a 2-year period were evaluated. Isolates were identied
by API 20 NE (bioMrieux, France). Susceptibility by microdilution
method to trimethoprim/sulfamethoxazole, ciprooxacin, levooxacin,
minocycline, ceftazidime, chloramphenicol and ticarcillin/clavulanate
was performed according to the CLSI (CLSI 2011)
4
. Tigecycline MIC
was interpreted following the Food and Drug Administration (FDA)
recommendation for Enterobacteriaceae. Endonuclease-digested
genomic DNAs were separated by pulsed-eld gel electrophoresis
(PFGE) using a CHEF-DR III system (Bio-Rad, USA). Genomic DNA
was digested with 10U of SpeI (fermentas, USA). Running conditions
were 21 h at 14 C, with and initial switching time of one s and nal
time of 30 s, at 6 V/cm.
PCR for the Smqnr gene was carried out using ve different set
of specic sequence primers QnrM+ (5-CTTGGCATGGAATCCC
TGAT-3)/QnrM- (5-TGATGCCTACGGCACCAC-3), QnrMR55+
(5-CATGGCATGGAATCCCCGAT-3)/QnrMR55- (5-TGATG
TCTACGGCACCAC-3), qnrA (F:5-CTCGAATGCCTGGCGCG
TGTTT-3) (R: 5- AAGAGATTTCTCAGCCAGG-3), qnrB (F:
5-TGCCAGGCACAGATCTTGAC-3) (R: AGGMATHGAAATTCG
CCACTG-3) and qnrS (F: 5- TTTGCYGYYCGCCAGTCGAA-3)
(R:5:GCAAGTTCATTGAACAGGGT-3) and was performed in accor-
dance with SANCHEZ et al. (2008) and ROBICSEK et al. (2006)
10,11
.
We used ve set of primers because the regions around qnr are different
in the sequences of S. maltophilia strains K279a, R551-3 and qnr A, B,
S of Enterobacteriaceae species.
The nucleotide sequences and the deduced amino acid sequence were
GRACIA-PAEZ, J.I.; FERRAZ, J.R.; FRANA E SILVA, I.A.; ROSSI, F.; LEVIN, A.S. & COSTA, S.F. - Smqnr variants in clinical isolates of Stenotrophomonas maltophilia in Brazil. Rev.
Inst. Med. Trop. Sao Paulo, 55(6): 417-20, 2013.
418
analyzed using the biological sequence aligment editor and CLUSTALW
(www.mbio.ncsu.edu/bioedit/bioedit) (CA, USA).
This study was approved by the Ethics Committee of the two
hospitals.
RESULTS
Thirteen S. maltophilia isolates harboring Smqnr were studied,
eight resistant to ciprooxacin and two to levooxacin. QnrM gene was
detected only using primers derived from S. maltophilia strain K279a;
qnr A, B and S genes of Enterobacteriaceae were not detected.
All 13 isolates showed distinguishable patterns by PFGE (Table 1).
The distribution of isolates occurred evenly in different units and with
different clonal proles during the study period, which ruled out the
possibility of an outbreak.
Two of the 13 isolates were resistant (MIC 8 and 16 mg/L) and two
showed increased MIC to levooxacin (MIC 4 mg/L). Eight isolates
were resistant and one exhibited increased MIC to ciprooxacin (MIC
2 mg/L). Two isolates were resistant to trimethoprim/sulfamethoxazole
(MIC 4 and 8 mg/L). Two isolates were resistant to tigecycline (MIC 4
and 8 mg/L) and all isolates were susceptible to minocycline (MIC < 4
mg/L) (Table 1).
The Smqnr peptide sequences of the 13 isolates were compared
with the known Smqnr 1-27 subtypes in GenBank. Sequence analysis
showed that seven isolates were identical to the equivalent sequence of
Smqnr6 from Japan (AB430849), the other isolates were distributed as
followed: one Smqnr4 (GenBank AB430842), one Smqnr12 (GenBank
AB430844) and one Smqnr1 (Genbank AB430839) identied in Japan.
Three novel variants were observed, the subtype SmqnrLIM31 have six
amino acid residues differences, the subtype SmqnrLIM39 have four
amino acid residues differences and subtype SmqnrLIM45 showed two
amino acids alteration (Fig. 1).
DISCUSSION
S. maltophilia strains display high ciprooxacin resistance, mainly
due to several efux systems
1
. However, in vitro, susceptibility testing
to levooxacin is recommended by CLSI (CLSI 2009), and levooxacin
and moxioxacin are used to treat infections caused by this pathogen.
Resistance to levooxacin and moxioxacin is still rare among S.
maltophilia
5,14
. Two recent studies of clinical isolates of S. maltophilia
that evaluated 102 isolates of bloodstream infection and 377 isolates
(majority from the respiratory tract and blood) showed respectively 92.9%
and 79.6% of susceptibility to levooxacin
5,14
. In our study two isolates
showed resistance and two increased MIC to levooxacin. All isolates
were susceptible to minocycline and two were resistant to trimethoprim/
sulfamethoxazole. Despite good activity in vitro, the experience of the
clinical use of minocycline to treat infections caused by S. maltophilia
is restricted to anecdotal reports
7
.
The Smqnr plasmid mediated genes are pentapeptides repeat
proteins that confer low-level resistance to quinolone by protecting DNA
gyrase. The potential source of qnr is believe to be horizontal transfer
by integrons and mobile genetic elements from chromosome of aquatic
or environmental bacterial, such Shewanella algae, Aeromonas spp.,
Psychromonas spp and Vibrionaceae
14
.
Table 1
Characteristics and antimicrobial susceptibilities of 13 clinical isolates of S. maltophilia
Isolates Source PFGE
MIC (mg/L)
SMX LEV CIP MIN TIG CAZ CLO TIC
LIM7 Blood A 0.5 1 8 <0.25 0.5 64 8 8
LIM9 Blood B 2 2 8 0.5 1 32 8 8
LIM11 Blood C 2 <0.25 1 0.25 0.25 32 8 >128
LIM14 CVC D <0.25 <0.25 0.5 0.25 0.25 >128 8 32
LIM31 CVC E <0.25 1 2 <0.25 0.5 4 32 32
LIM33 CVC F 1 16 64 2 4 16 32 64
LIM35 CVC G 0.5 0.25 4 <0.25 0.25 >128 16 128
LIM37 CVC H 0.25 0.5 8 <0.25 2 128 16 32
LIM39 CVC I 0.5 4 16 4 2 8 64 128
LIM41 CVC J 8 8 32 2 8 64 128 32
LIM45 BAL K 4 0.5 2 0.5 2 64 >128 128
LIM47 Blood L 0.5 1 1 <0.25 2 4 32 32
LIM49 Blood M 1 4 16 <0.25 1 8 128 >128
MIC, microdilutional method; BAL, Bronchoalveolar lavage; CVC, cateter venous central; PFGE, Pulsed eld gel electrophoresis; SXT, trimethoprim/sulfamethoxa-
zole; LEV, levooxacin; CIP, ciprooxacin; MIN, minocycline; TIG, tigecycline; CAZ, ceftazidime; CLO,chloramphenicol; TIC, ticarcillin/clavulanate. PFGE: 13
distinguishable patterns (letter A to M).
419
The qnr genes in S. maltophilia isolates have been studied by some
authors
3,6,17,18
. In our study, among 13 isolates harboring Smqnr; two
were resistant (MIC 8 and 16 mg/L) and two exhibited increased MIC
to levooxacin (MIC 4 mg/L) and eight isolates exhibited resistant to
ciprooxacin. Three new Smqnr variants were identied. Two (LIM31
and LIM45) of them presented high levooxacin MIC. The isolates were
polyclonal, showing that they did not have a clonal relationship. This is the
rst study that reports Smqnr in S. maltophilia clinical isolates in Brazil.
One important limitation of our study is that we were not able to
perform cloning and transformation assays to conrm the role of Smqnr
on uorquinolone resistance in S. maltophilia.
The role of Smqnr on quinolones resistance among S. maltophilia,
remains controversial, and appears to be associated with the clonality of
strains and varies with the hospital and country. A recent study conducted
in China, evaluated 442 clinical isolates of S. maltophilia from nine
hospitals. The resistance against co-trimoxazole was 48.6%, and a high
susceptibility was shown to levooxacin, only 6.1% of strains were resistant
to levooxacin
18
. Smqnr genes were detected in 114 (26%) isolates in
similar frequency in both quinolones sensitive and nonsensitive strains.
Twenty new variants of Smqnr genes were identied and called Smqnr
(28-47)
18
. An in vitro study, showed that overexpression of Smqnr upon
deletion increased modestly the MIC of nalidixic acid and moxioxacin
3
.
And nally, a study conducted in the UK, identied two new variants of
Smqnr that when expressed in E. coli top10 showed reduced susceptibility
to several quinolone including levooxacin and moxioxacin
16
.
In conclusion, this is the rst report of the presence of Smqnr in
isolates of S. matophilia resistant or with high levooxacin MIC in
Brazil. Three new Smqnr variants were identied. These ndings alert
the clinicians to the emergence of resistance to this antibiotic that is
widely used in the treatment of infections by this agent, and strengthens
the role of Smqnr with levooxacin resistance. In addition, minocycline
presented good activity in vitro against multidrug resistant strains of S.
maltophilia and, in the future, may be an option for the treatment of
infections caused by this agent.
RESUMO
Variantes de Smqnr de isolados clnicos de Stenotrophomonas
maltophilia no Brasil
S. maltophilia contem um novo gene qnr cromossmico denominado
Smqnr que contribui para baixa resistncia intrnseca a quinolonas.
Descrevemos Smqnr em 13 isolados clnicos de S. maltophilia de dois
hospitais brasileiros, ao longo do perodo de dois anos. Os isolados foram
identicados pela API 20 NE (bioMrieux, Frana). Susceptibilidade
pelo mtodo de microdiluio dos seguintes antibiticos trimetroprim/
sulfametoxazol, ciprooxacina, levooxacina, minociclina, ceftazidima,
cloranfenicol e ticarcilina/clavulanato foi realizada segundo o CLSI.
Deteco do gene de Smqnr foi realizada por PCR. A sequncia de Smqnr
foi comparada com aquelas depositadas no GenBank. Foi realizada
eletroforese em gel de campo pulsado (PFGE) de todos os isolados.
Treze isolados contendo Smqnr foram sequenciados e identicados trs
variantes do gene Smqnr. Todos os 13 isolados de Smqnr apresentaram
diferentes padres por PFGE. Este o primeiro relato de Smqnr em
isolados de S. maltophilia no Brasil.
Fig. 1 - Aminoacid sequence alignments of 13 SmQnr proteins from Brazil, SmQnr1
(SHIMIZU et al.) and SmQnr 13 (GORDON et al). Asterisks, identical aminoacids, colons,
strongly similar aminoacids (conserved substitutions); full stops, weakly similar amino
acids (semi-conserver substitutions); spaces, variable aminoacids. Amino acid differences
are shown in redbold.
420
FUNDING
This study was supported by Fundao de Amparo Pesquisa do
Estado de So Paulo (FAPESP) number: 2009/022844.
TRANSPARENCY DECLARATIONS
None to declare.
CONFLICT OF INTEREST
The authors declare that they have no conict of interest with the
organization that sponsored the research.
REFERENCES
1. Alonso A, Martnez JL. Cloning and charecterization of SmeDEF, a novel multidrug
efux pump from Stenotrophomonas maltophilia. Antimicrob Agents Chemother.
2000;44:3079-86.
2. Brooke JS. Stenotrophomonas maltophilia: an emerging global opportunistic
pathogen. Clin Microbiol Rev. 2012;25:2-41.
3. Chang YC, Tsai MJ, Huang YW, Chung TC, Yang TC. SmQnrR, a DeoR-type
transcriptional regulator, negatively regulates the expression of Smqnr and SmtcrA
in Stenotrophomonas maltophilia. J Antimicrob Chemother. 2011;66:1024-8.
4. Clinical and Laboratory Standards Institute. Performance standars for antimicrobial
susceptibility testing. CLSI. 2011;3:M100-S21.
5. Garazi M, Singer C, Tai J, Ginocchio CC. Bloodstream infections caused by
Stenotrophomonas maltophilia: a seven-year review. J Hosp Infect. 2012;81:114-8.

6. Gordon NC, Wareham DW. Novel variants of the Smqnr family of quinolone resistance
genes in clinical isolates of Stenotrophomonas maltophilia. J Antimicrob Chemother.
2010;65:483-9.
7. Harada N, Soejima Y, Taketomi A, Yoshizumi T, Uchiyama H, Maehara Y.
Stenotrophomonas maltophilia bacteremia after living donor liver transplantation:
report of a case. Surg Today. 2008,38:469-72.
8. Hu LF, Chang X, Ye Y, Wang ZX, Shao YB, Shi W, et al. Stenotrophomonas
maltophilia resistance to trimethoprim/sulfamethoxazole mediated by acquisition of
sul and dfrA genes in a plasmid-mediated class 1 integron. Int J Antimicrob Agents.
2011;37:230-4.
9. Nordmann P, Poirel l. Emergency of plasmid-mediated resistance of quinolones in
Enterobacteriaceae. J Antimicrob Chemother. 2005;56:463-9.
10. Robicsek A, Strahilevitz J, Sahm DF, Jacoby GA, Hooper DC. qnr prevalence in
ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob
Agents Chemother. 2006;50:2872-4.
11. Snchez MB, Hernndez A, Rodrguez-Martnez JM, Martnez-Martnez L,
Martnez JL. Predictive analysis of transmissible quinolone resistance indicates
Stenotrophomonas maltophilia as a potential source of a novel family of Qnr
determinants. BMC Microbiol. 2008;8:148-52.
12. Snchez MB, Martinez JL. Smqnr contributes to intrinsic resistance to quinolones
in Stenotrophomonas maltophilia. Antimicrob Agents Chemother. 2010;54:580-1.
13. Saugel B, Eschermann K, Hoffmann R, Hapfelmeier A, Schultheiss C, Phillip V, et
al. Stenotrophomonas maltophilia in the respiratory tract of medical intensive care
unit patients. Eur J Clin Microbiol Infect Dis. 2012;31:1419-28.
14. Shimizu K, Kikuchi K, Sasaki T, Takahashi N, Ohtsuka M, Ono Y, et al. Smqnr, a
new chromosome-carried quinolone resistance gene in Stenotrophomonas maltophilia.
Antimicrob Agents Chemother. 2008;52:3823-5.
15. Toleman MA, Bennett PM, Bennett DMC, Jones RN, Walsh TR. Global emergence of
Trimethoprim/sulfamethoxazole resistance in Stenotrophomonas maltophilia mediated
by acquisition of sul genes. Emerg Infect Dis. 2007;13:559-65.
16. Wareham DW, Gordon NC, Shimizu K. Two new variants of and creation of a
repository for Stenotrophomonas maltophilia quinolone protection protein (Smqnr)
genes. Int J Antimicrob Agents. 2011;37:89-90.
17. Wu H, Wang JT, Shiau YR, Wang HY, Lauderdale TL, Chang SC, et al. A multicenter
surveillance of antimicrobial resistance on Stenotrophomonas maltophilia in Taiwan.
J Microbiol Immunol Infect. 2012;45:120-6.
18. Zhang R, Sun Q, Hu YJ, Yu H, Li Y, Shen Q, et al. Detection of the Smqnr quinolone
protection gene and its prevalence in clinical isolates of Stenotrophomonas maltophilia
in China. J Med Microbiol. 2012;61(Pt 4):535-9.
Received: 1 April 2013
Accepted: 3 July 2013
doi: 10.1590/S0036-46652013000600009
(1) Instituto de Cincias Biomdicas, Universidade de So Paulo, So Paulo, SP, Brazil. E-mail: ludmilanr@usp.br
(2) Lab. Parasitologia, Instituto Butantan, So Paulo, SP, Brazil. E-mails: priorechio@hotmail.com; eliananakano@butantan.gov.br
(3) Lab. Qumica e Produtos Naturais, Universidade de So Paulo, So Paulo, SP, Brazil. E-mail: lydyama@iq.usp.br
Correspondence to: Ludmila Nakamura Rapado, E-mail: ludmilanr@usp.br
BRIEF COMMUNICATION
OVICIDAL EFFECT OF PIPERACEAE SPECIES ON Biomphalaria glabrata,
Schistosoma mansoni HOST
Ludmila Nakamura RAPADO(1,2), Priscila Orechio de Moraes LOPES(2), Lydia Fumiko YAMAGUCHI(3)

& Eliana NAKANO(2)
SUMMARY
Schistosomiasis is a neglected disease with public health importance in tropical and subtropical regions. An alternative to the disease
control is the use of molluscicides to eliminate or reduce the intermediate host snail population causing a reduction of transmission in
endemic regions. In this study nine extracts from eight Piperaceae species were evaluated against Biomphalaria glabrata embryos at
blastula stage. The extracts were evaluated in concentrations ranging from 100 to 10 mg/L. Piper crassinervium and Piper tuberculatum
extracts were the most active (100% of mortality at 20 mg/L and 30 mg/L respectively).
KEYWORDS: Schistosomiasis; Biomphalaria glabrata; Embryos; Crude extracts; Piperaceae; Molluscicide.
INTRODUCTION
Schistosomiasis is one of the most prevalent, debilitating and
neglected diseases of tropical and subtropical regions, such as Africa,
Asia and South America. This disease is a relevant health and social-
economic problem with more than 390-600 million people estimated to
have been infected worldwide, while 800 million people remain under
infection risk
11,29
.
Currently, the main strategy to control schistosomiasis is based on the
periodic treatment of people living in risk areas with anti-schistosomicidal
drugs in order to reduce morbidity and transmission
28
. However, evidence
indicates that resistance and tolerance to praziquantel, a main drug used
in Schistosoma mansoni treatment, have been increasing
6,9
.
Freshwater snails of Biomphalaria genus play a major role as
intermediate hosts in the transmission of S. mansoni because an intense
multiplication of parasites occurs in these snails. Thus, any strategy to
control snail populations for reduction of schistosomiasis transmission in
endemic regions should consider some treatment at this critical stage
15
.
Currently, niclosamide marketed as Bayluscide
is the most important

molluscicide recommended by World Health Organization (WHO) to
control the host of schistosomiasis
32
. However, niclosamide, has plenty of
adverse factors, such as, non-selective toxicity, that harms other aquatic
organisms; high cost; instability in sunlight, which in addition requires
frequent reapplication due to the permanence of surviving snails after its
application
1,10,32
. Thus, novel natural molluscicidal should be investigated
as a possible alternative to synthetic products
16,17,18,25
.
The genus Piper belongs to the Piperaceae family and includes more
than 2000 species widely distributed in the tropical and subtropical
regions of the world
13
. Piper species are important plants used in Chinese
medicine, in the Indian Ayurvedic system and folk medicine practices of
Latin America and West Indies. Furthermore, studies with plants from the
Piperaceae family have shown a great diversity of secondary metabolites
with biological activity
14
.
Recently, schistosomicidal and molluscicidal activities of Piperaceae
species have been described and this family is considered promising for
studies of schistosomiasis prevention and control
19,20,25
.
In this work, nine crude extracts of eight Piperaceae species were
assessed for ovicidal activity against Biomphalaria glabrata (Say, 1818)
embryos.
Ovicidal assay was performed according to the methodology
recommended by the WHO
30,31
and the experimental procedures were
according to the accepted principles of animal welfare in experimental
science.
Embryos were obtained from Biomphalaria glabrata snail originally
RAPADO, L.N.; LOPES, P.O.M.; YAMAGUCHI, L.F. & NAKANO, E. - Ovicidal effect of Piperaceae species on Biomphalaria glabrata, Schistosoma mansoni host. Rev. Inst. Med. Trop.
Sao Paulo, 55(6): 421-4, 2013.
422
from Belo Horizonte, MG, Brazil, and kept in a laboratory under light,
temperature and feeding controlled.
Plant material: Fresh material of each Piperaceae species (Table
1) was collected by Dr Massuo Jorge Kato from Universidade de So
Paulo (Chemical Institute) and identied by Dr Elsie F. Guimares from
Instituto de Pesquisas Jardim Botnico do Rio de Janeiro. Vouchers were
deposited in the Herbarium of Jardim Botnico do Rio de Janeiro, Brazil.
Preparation of extracts and samples: Selected parts of freshly
collected plant material were separated, immediately air dried and
nally dried in an oven at 45 C for 24 h (Table 1). Material was ground
and extracted with ethyl acetate: methanol (2:1) at room temperature
(25-28 C) three times and ltered. Extracts were concentrated to dryness
under vacuum in a rotary evaporator and stored at -20 C.
A stock solution containing 1 g/L of each extract was prepared by
suspending 10 mg of extract in 0.1 mL of 99.9% dimethylsulphoxide
(DMSO: Aldrich, Milwaukee, WI, USA) and making up to 10 mL with
dechlorinated water. Stock solutions were diluted with dechlorinated
water in order to provide assay solutions
.
Assay for ovicidal activity: Egg masses with embryos at blastula
stage
5
were exposed to Piperaceae extracts (Table 1) rstly at 100
mg/L for 24 hours and observed for seven days. Inactive extracts at this
concentration were not further investigated since crude preparation of
plant material should be active at 100 mg/L or less, according to WHO
31
.
Tests were carried out with egg masses laid on small pieces of
plastic sheet that had been left oating on the aquaria water. The pieces
of plastic sheets with adhered egg masses were carefully transferred
to Petri dishes, where they were further exposed to testing solutions.
For each concentration, ve egg masses were used and assays were
repeated three times. The number of snail embryos to each concentration
is indicated in Tables 2 and 3. At the end of exposure (24 hours), egg
masses were washed with dechlorinated water. Petri dishes containing
egg masses were kept within climatic chambers under controlled
temperature (25 C 1 C). All egg masses were examined daily under
a stereomicroscope up to the 7
th
day. Embryos were considered as dead
whenever disintegrating embryonic forms were noted within the egg
and or, at later developmental stages and no heartbeats were detected. A
negative control group was maintained in 1% DMSO on dechlorinated
water under the same experimental conditions. Bayluscide WP70
was
used as a positive control
2
.
The LC
50
(50% lethal concentration) and the 95% condence intervals
for active extracts were estimated using Trimmed Spearman-Karber
Method
12
.
RESULTS AND DISCUSSION
Three extracts from Piperaceae species were active with 100% of
embryo mortality at 100 mg/L: P. crassinervium inorescence extract
and P. tuberculatum inorescence and leaf extracts (Table 2). Both
species showed 100% of lethality at 100 mg/L during the 24 h exposure
period (Table 2, Fig. 1). These extracts were also evaluated at lower
concentrations and inorescence extract of P. crassinervium was more
active than P. tuberculatum inorescence and leaf extracts (100% of
mortality at 20 mg/L and 30 mg/L respectively) (Table 3).
No increase of embryolethality was observed in embryos exposed to
leaf extracts of P. solmsianum, P. callosum, P.oreophylla, P. tretraphylla, P.
mallacophyllum and P. glabella at 100 mg/L (Table 2). Percentage of dead
embryos in control groups during all the study was not higher than 1.2%.
RAPADO et al. (2011) evaluated the molluscicidal effect of P.
Table 1
Piperaceae species screened for ovicidal activity in B. glabrata embryos
Species Collecting sites Selected part Voucher
Piper callosum Ruiz & Pav. So Paulo, SP leaf K-161
Piper crassinervium Kunth Apia, SP inorescence K-091
Peperomia glabella (Sw.) A. Dietr. Apia, SP leaf K-856
Piper mallacophyllum (C.Presl).C.DC. Capo Bonito, SP leaf K-447
Peperomia oreophylla Hensch Extrema, MG leaf K-579
Piper solmsianum C.DC So Paulo, SP leaf K-487
Peperomia tetraphylla G. Forst Apia, SP leaf K-370
Piper tuberculatum Jacq. So Paulo, SP leaf and inorescence K-169
SP- So Paulo; MG- Minas Gerais.
Table 2
Ovicidal effect of Piperaceae extracts at blastula stage at 100 mg/L
Species Part No.

embryos
Mortality in 7
days (%)
P. callosum leaf 99 5.05
P. crassinervium* inorescence 106 100
P. glabella leaf 102 73.01
P. malacophyllum leaf 143 5.59
P. oreophyllla leaf 108 0
P. solmsianum leaf 103 1.78
P. tetraphylla leaf 89 0
P. tuberculatum* leaf 101 100
inorescence 98 100
* Death during the 24 h exposure period.
Sao Paulo, 55(6): 421-4, 2013.
423
crassinervium leaf extract in B. glabrata adult and embryos at blastula
stage obtained 100% of mortality at 60 mg/L and 50 mg/L respectively.
This species has flavonoids and prenylated benzoic acid as major
compound in leaf, classes of compounds with molluscicide activities
already described
8,24
. Nevertheless is not known if those compounds are
responsible for the molluscicidal activity obtained in this study using
inorescence extract.
The P. tuberculatum is largely used in folk medicine as a sedative
and antidote for snake bite. It has been shown that extracts and amides
isolated from P. tuberculatum fruit and seeds have also a potent antifungal
activity against Cladosporium sphaerospermum (100% active in 5 g)
and parasitic activity in Trypanosoma cruzi (IC
50
= 17.2 g/mL in
epimastigote), Leishmania donovani (IC
50
= 7.5 g/mL in promastigote)
and S. mansoni (100% mortality in 9.5 M)
4,7,19,21,22,27
. In this study,
leaves and inorescences extract showed ovicidal activity in equal
concentrations, suggesting the possible presence of active compounds
in both parts of the plant.
Studies with molluscicides compounds show that it is usual to
obtain the death of B. glabrata snail but not the embryos
18,23,25
. The
lack of ovicidal activity allows the permanence of the snail host in the
environment, maintaining the transmission of schistosomiasis.
The Euphorbiaceae species are known for producing latex with
molluscicidal activity restricted to B. glabrata adults (100% mortality at
1.5 mg/L)
3,26
. Different from this, Piper species are lethal to B. glabrata
adults and embryos in concentrations recommended by WHO as Piper
cuyabanum (100% lethal for adults and embryos at 20 mg/L), Piper
aduncum (100% lethal in adults at 10 mg/L and embryos at 50 mg/L) and
Piper hostmannianum (100% lethal in adults at 40 mg/L and embryos
at 20 mg/L)
25
.
In this work, three extracts from two Piperaceae species were lethal
to B. glabrata embryos under concentrations recommended by WHO
31
.
Thus P. tuberculatum and P. crassinervium extracts were active at 30
mg/L and 20 mg/L respectively which make them species targets for
isolation and identication of ovicidal compounds since these species
are also active in B. glabrata adult
25
.
RESUMO
Efeito ovicida de espcies de Piperaceae em Biomphalaria glabrata,
hospedeiro do Schistosoma mansoni
A esquistossomose uma doena negligenciada de importncia para
a sade pblica em regies tropicais e subtropicais. Uma alternativa
para o controle da doena o uso de moluscicidas para eliminar ou
reduzir a populao de caramujo hospedeiro, acarretando uma reduo
da transmisso da doena nas regies endemicas. Neste estudo, nove
extratos vegetais provenientes de oito espcies de Piperaceae foram
expostos a embries de Biomphalaria glabrata no estgio de blstula.
Os extratos foram avaliados em concentraes que variaram entre
100 e 10 mg/L, sendo Piper crassinervium e Piper tuberculatum
os extratos mais ativos (100% de mortalidade a 20 mg/L e 30 mg/L
respectivamente).
Table 3
Species with ovicidal activity at the blastula stage in concentrations lower than 100 mg/L
Species Selected part
Concentration
(mg/L)
No. embryos Mortality (%)
LC
50
(mg/L)
P. crassinervium inorescence
5
10
15
20
94
108
113
105
0
21.29
62.83
100
12.39 [11.75-13.07]
P. tuberculatum
leaf
10
15
20
25
30
110
125
98
107
101
0
5.6
31.63
55.14
100
22.15 [21.41-22.92]
inorescence
5
10
15
20
25
30
117
109
91
102
116
120
0
77.09
78.42
94.11
96.68
100
9.07 [8.57-9.60]
[ ] 95% condence intervals; Mortality obtained in 7 days.
Fig. 1 - Embryos of B. glabrata at blastula stage during the exposure period. A- Dead embryos
exposure to leaf extract of P. tuberculatum at 100 mg/L and B- Normal embryo (control group).
Sao Paulo, 55(6): 421-4, 2013.
424
ACKNOWLEDGEMENTS
This article is dedicated to the memory of Dr. Toshie Kawano, a
researcher who initially coordinated this work and devoted her studies
to schistosomiasis control.
This work was supported by grants from FAPESP (Project number
09/51850-9) coordinated by Prof. Dr Massuo Jorge Kato.
The authors are grateful to Dr Massuo Jorge Kato for providing
access to the Piperaceae extracts.
REFERENCES
1. Abreu FC, Goulart MOF, Brett AMO. Detection of the damage caused to DNA by
niclosamide using an electrochemical DNA-biosensor. Biosens Bioelectron.
2002;17:913-9.
2. Andrews P, Thyssen J & Lorke D. The biology and toxicology of molluscicides,
Bayluscide. Pharmacol Ther. 1983;19:245-95.
3. Baptista DF, Vasconcellos MC, Lopes FE, Silva IP, Schall VT. Perspectives of using
Euphorbia splendens as a molluscicide in schistosomiasis control programs. Southeast
Asian J Trop Med Public Health. 1994;25:419-24.
4. Bodiwala H, Singh G, Singh R, Dey CS, Sharma SS, Bhutani KK, et al. Antileishmanial
amides and lignans from Piper cubeba and Piper retrofractum. J Nat Med.
2007;61:418-21.
5. Camey T, Verdonk NH. The early development of the snail Biomphalaria glabrata (Say)
and the origin of the head organs. Netherlands J Zool. 1969;20:93-121.
6. Cioli D. Praziquantel: is there real resistance and are there alternatives? Curr Opin Infect
Dis. 2000;13:659-63.
7. Cotinguiba F, Regasini LO, Bolzani VS, Debonsi HM, Passerini GD, Cicarelli RMB,
et al. Piperamides and their derivatives as potential anti-trypanosomal agents. Med
Chem Res. 2009;18:703-11.
8. Danelutte AP, Lago JHG, Young MCM, Kato MJ. Antifungal avanones and prenylated
hydroquinones from Piper crassinervium Kunt. Phytochemistry. 2003;64:555-9.
9. Doenhoff MJ, Cioli D, Utzinger J. Praziquantel: mechanisms of action, resistance and
new derivatives for schistosomiasis. Curr Opin Infect Dis. 2008;21:659-67.
10. Giovanelli A, Silva CL, Medeiros L, Vasconcellos MC. The molluscicidal activity of
niclosamide (Bayluscide WP70
) on Melanoides tuberculata (Thiaridae), a snail

associated with habitats of Biomphalaria glabrata (Planorbidae). Mem Inst Oswaldo
Cruz. 2002;97:743-5.
11. Gray DJ, McManus DP, Li Y, Williams GM, Bergquist R, Ross AG. Schistosomiasis
elimination: lessons from the past guide the future. Lancet Infect Dis. 2010;10:733-6.
12. Hamilton MA, Russo RC, Thurston RV. Trimmed Spearman-Karber method for estimating
median lethal concentrations in toxicity bioassays. Environ Sci Technol. 1977;11:714-
8.
13. Jaramillo MA, Manos PS, Zimmer EA. Phylogenetic relationships of the perianthless
Piperales: reconstructing the evolution of oral development. Int J Plant Sci.
2004;165:403-16.
14. Kato M, Furlan M. Chemistry and evolution of the Piperaceae. Pure Appl Chem.
2007;79:529-38.
15. Lardans VD, Dissous C. Snail control strategies for reduction of schistosomiasis
transmission. Parasitol Today. 1998;14:413-7.
16. Luna JS, Santos AF, Lima MRF, Omena MC, Mendona FAC, Bieber LW, et al. A study
of the larvicidal and molluscicidal activities of some medicinal plants from northeast
Brazil. J Ethnopharmacol. 2005;97:199-206.
17. Mello-Silva CC, Vilar MM, Bezerra JCB, Vasconcellos MC, Pinheiro J, Rodrigues ML.
Reproductive activity alterations on the Biomphalaria glabrata exposed to Euphorbia
splendens var. hislopii latex. Mem Inst Oswaldo Cruz. 2007;102:671-4.
18. Miyasato PA, Kawano T, Freitas JC, Berlinck RGS, Nakano E, Tallarico LF. Molluscicidal
activity of some marine substances against the snail Biomphalaria glabrata (Mollusca,
Planorbidae). Parasitol Res. 2012;110:1873-9.
19. Moraes J, Nascimento C, Lopes PO, Nakano E, Yamaguchi LF, Kato MJ, et al. Schistosoma
mansoni: in vitro schistosomicidal activity of piplartine. Exp Parasitol. 2011;127:357-
64.
20. Moraes J, Nascimento C, Yamaguchi LF, Kato MJ, Nakano E. Schistosoma mansoni: in
vitro schistosomicidal activity and tegumental alterations induced by piplartine on
schistosomula. Exp Parasitol. 2012;132:222-7.
21. Navickiene HMD, Alcio AC, Kato MJ, Bolzani VS, Young MC, Cavalheiro AJ, et al.
Antifungal amides from Piper hispidum and Piper tuberculatum. Phytochemistry.
2000;55:621-6
22. Navickiene HMD, Bolzani VS, Kato MJ, Pereira AM, Bertoni BW, Frana SC, Furlan
M. Quantitative determination of anti-fungal and insecticide amides in adult plants,
plantlets and callus from Piper tuberculatum by reverse-phase high-performance
liquid chromatography. Phytochemical Anal. 2003;14:281-4.
23. Oliveira-Filho EC, Geraldino BR, Coelho DR, De-Carvalho RR, Paumgartten FJ.
Comparative toxicity of Euphorbia milii latex and synthetic molluscicides to
Biomphalaria glabrata embryos. Chemosphere. 2010;81:218-27.
24. Orjala J, Erdelmeier CAJ, Wright AD, Rali T, Sticher O. Five new prenylated
p-hydroxybenzoic acid-derivatives with antimicrobial and molluscicidal activity
from Piper aduncum leaves. Planta Med. 1993;59:546-51.
25. Rapado LN, Nakano E, Ohlweiler FP, Kato MJ, Yamaguchi LF, Pereira CA, et
al. Molluscicidal and ovicidal activities of plant extracts of the Piperaceae on
Biomphalaria glabrata (Say, 1818). J Helminthol. 2011;85:66-72.
26. Schall VT, Vasconcellos MC, Souza CP, Baptista DF. The molluscicidal activity of crown
of christ (Euphorbia splendens var. hislopii) latex on snails acting as intermediate
hosts of Schistosoma mansoni and Schistosoma haematobium. Am J Trop Med Hyg.
1998;58:7-10.
27. Silva RV, Navickiene HM, Kato MJ, Bolzani VS, Mda CI, Young MC, et al. Antifungal
amides from Piper arboreum and Piper tuberculatum. Phytochemistry. 2002;59:521-
7.
28. World Health Organization. Working to overcome the global impact of neglected tropical
diseases. First WHO report on neglected tropical diseases. Geneva: WHO; 2010.
[WHO/HTM/NTD/2010.1].
29. World Health Organization. Schistosomiasis: population requiring preventive
chemotherapy and number of people treated in 2010. Wkly Epidemiol Rec. 2012;4:37-
44.
30. World Health Organization. Molluscicide screening and evaluation. Bull World Health
Organ. 1965;334:567-81.
31. World Health Organization. Report of the scientic working group on plant molluscicides.
Bull World Health Organ.1983;12:1-11.
32. World Health Organization. The role of mollusciciding in schistosomiasis control. Geneva:
WHO; 1992. [WHO/SCHISTO/92.107;1992].
Received: 27 January 2013
doi: 10.1590/S0036-46652013000600010
(1) Postgraduate Course of Biology applied to Health, Federal University of Pernambuco, PE, Brazil. E-mail: dionisio.elis@gmail.com
(2) Graduate Course on Biological Sciences, Institute of Biological Sciences, University of Pernambuco, PE, Brazil.
(3) Parasitology Department, Aggeu Magalhes Research Center, Oswaldo Cruz Foundation, PE, Brazil. E-mails: dias@cpqam.ocruz.br, almerice@cpqam.ocruz.br
(4) Tropical Medicine Department, Clinical Hospital, Federal University of Pernambuco, PE, Brazil. E-mails: psergio@cpqam.ocruz.br, vemagalhaes@uol.com.br
(5) Service of Infectious and Parasitic Diseases, Clinical Hospital, Federal University of Pernambuco, Brazil. E-mail: cegpadilha@gmail.com
(6) Pathology Department, Institute of Biological Sciences, University of Pernambuco, PE, Brazil. E-mail: medeiros@cpqam.ocruz.br
Correspondence to: Zulma M. Medeiros, Centro de Pesquisas Aggeu Magalhes CPqAM/Fiocruz, Av. Professor Moraes Rego s/n, 50670-420 Cidade Universitria, Recife, PE, Brazil. E-mail:
medeiros@cpqam.ocruz.br
CASE STUDY OF A PATIENT WITH HIV-AIDS AND VISCERAL LEISHMANIASIS
CO-INFECTION IN MULTIPLE EPISODES
Elis Dionsio da SILVA(1,2,3), Luiz Dias de ANDRADE(3), Paulo Srgio Ramos de ARAJO(3,4), Vera Magalhes SILVEIRA(4),
Carlos Eduardo PADILHA(5), Maria Almerice Lopes da SILVA(3) & Zulma Maria de MEDEIROS(3,6)
SUMMARY
Report of a 45-year-old male farmer, a resident in the forest zone of Pernambuco, who was diagnosed with human immunodeciency
virus (HIV) in 1999 and treated using antiretroviral (ARV) drugs. In 2005, the rst episode of visceral leishmaniasis (VL), as assessed
by parasitological diagnosis of bone marrow aspirate, was recorded. When admitted to the hospital, the patient presented fever,
hepatosplenomegaly, weight loss, and diarrhea. Since then, six additional episodes of VL occurred, with a frequency rate of one per
year (2005-2012, except in 2008). In 2011, the patient presented a disseminated skin lesion caused by the amastigotes of Leishmania,
as identied by histopathological assessment of skin biopsy samples. In 2005, he was treated with N-methyl-glucamine-antimony and
amphotericin B deoxycholate. However, since 2006 because of a reported toxicity, the drug of choice was liposomal amphotericin B.
As recommended by the Ministry of Health, this report emphasizes the need for HIV patients living in VL endemic areas to include
this parasitosis in their follow-up protocol, particularly after the rst infection of VL.
KEYWORDS: Co-infection; Visceral leishmaniasis; HIV infection; AIDS.
INTRODUCTION
Cases of visceral leishmaniasis (VL) co-infection with human
immunodeficiency virus (HIV) and acquired immune deficiency
syndrome AIDS (VL/HIV-AIDS) have been registered in 35 countries,
mainly in southwestern Europe. VL/HIV-AIDS co-infections increase
in areas where these two diseases coexist, as observed in Asian, African,
and Latin American countries. In the latter group, Brazil has the highest
number of cases.
In 2011, in Brazil, VL appeared in 22 of the 27 Brazilian states,
covering urban and suburban areas. Between 1998 and 2009, the annual
average was 3,349 cases
7
. From 1980 to 2011 in Brazil, 608,230 cases of
AIDS were reported. This epidemic tends to spread to poorly inhabited
macro-regions as well as to medium and small cities
8
. When AIDS and
VL databases were correlated, 176 cases of VL/HIV-AIDS co-infection
were detected among the Federal States
7
.
Several episodes of VL are frequent in cases of VL/HIV-AIDS
co-infection. According to BOURGEOIS et al., 2010, these patients
present a novel nosological entity called active chronic visceral
leishmaniasis. This condition may be termed chronic because of the
presence of relapses over a period of several years and active because
of the continuous blood circulation of the parasite. On the other hand,
its impossible to know if repeated episodes are relapses or reinfections
by using conventional parasitological and immunological methods
15
.
Some studies show that individuals with HIV/AIDS and infected with
VL often present atypical clinical manifestations and high incidence of
relapse
5,22,24,25
. Molecular methods conrm that more than 90% of these
cases are relapses, rather than reinfections
27
. The discrimination between
relapses and reinfection can be made by molecular techniques based on
restriction fragment length polymorphism (RFLP) analysis. The use
of this technology may provide the physician with more information
to determine Leishmania infections in patients who do not respond to
treatment
20
.
Professionals, who treat patients with HIV/AIDS, report that this
co-infection was not prioritized because of the variety of diseases related
to immunosuppression, in addition to not being included among the
AIDS-dening conditions
11
. To alert healthcare professionals about this
association, we describe the case of a patient presenting multiple VL/HIV-
AIDS co-infections during the seven years of evolution of this disease.
CASE REPORT
In 1999, a 31-year-old male farmer, who was a resident in the forest
zone of Pernambuco, was admitted to the Clinics Hospital of the Federal
University of Pernambuco. At the time of admission, he presented with
SILVA, E.D.; ANDRADE, L.D.; ARAJO, P.S.R.; SILVEIRA, V.M.; PADILHA, C.E.; SILVA, M.A.L. & MEDEIROS, Z.M. - Case study of a patient with HIV-AIDS and visceral leishmaniasis
co-infection in multiple episodes. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 425-8, 2013.
426
asthenia and headache, and had diarrhea for at least 30 days. He was
diagnosed with HIV, and began receiving antiretroviral therapy (ART)
with stavudine, lamivudine, and efavirenz. Meanwhile, his 25-year-old
partner and 9-month-old daughter were diagnosed with HIV infection.
Five years after initiating ART, the patient presented virological
failure; after genotyping, his treatment was changed to tenofovir,
lamivudine, and lopinavir/ritonavir. In 2005, he was diagnosed with VL
as assessed by directly testing Leishmania in the bone marrow aspirate
and initially treated with N-methyl-glucamine-antimony. However,
because of pancreatitis, the patient began receiving amphotericin B,
which was then replaced by a liposomal formulation because of the
onset of renal failure.
In 2011, the patient presented disseminated cutaneous lesions caused
by Leishmania, as assessed by histopathological analysis of skin biopsy
samples. In July 2012, the patient was readmitted for presenting febrile
disease with splenomegaly and pancytopenia, in addition to showing
positive results for laboratory tests for leishmaniasis (Table 1). After
administration of liposomal amphotericin B deoxycholate, the patients
condition improved, and he was discharged upon recommendation of
a secondary prophylaxis by administering liposomal amphotericin B
twice a week. Between 2005 and 2012, seven VL infections occurred,
as shown in the Table 1.
DISCUSSION
This case describes some of the many clinical, diagnostic, and
epidemiologic aspects of VL/HIV-AIDS co-infection. Immunosuppression
caused by HIV might lead to the development of symptomatic VL
14
. In
turn, VL might promote the clinical progression of HIV and of AIDS-
dening conditions, thus, reducing the possibility of recovery after
treatment and increasing the incidence of relapse
11
. This report showed
that individuals with HIV/AIDS and living in endemic areas of VL
should include VL assessment in their follow-up protocol. After the rst
co-infection, by means of clinical and laboratory support, a follow-up
Table 1
Description of clinical events, additional diagnostics, and treatment for the case of co-infection from Pernambuco, between 1999 and 2012
Period
(month/year)
Clinical events
CD4+ T cells
(cells/mm
3
)
Viral load
(copies/mL)
Laboratory diagnosis Treatment
Prophylactic
treatment
09/99 Positive for HIV N.A. N.A. N.A. d4T + 3TC + EFV N.A.
05/04 24 208,000 N.A. TDF + 3TC + LPVr N.A.
03/05 154 29,000 N.A. TDF + 3TC + LPVr N.A.
06/05
Visceral leishmaniasis
(Hepatosplenomegaly/
diarrhea/fever/ cachexia/
pancytopenia)
N.A. N.A. B.M. aspirate
TDF + 3TC + LPVr
N-methyl-glucamine-
antimony
a
, amphotericin B
b
,
liposomal amphotericin
N.A.
11/05 58 87,800 N.A. TDF + 3TC + LPVr N.A.
02/06
(Second infection)
170 <50 B.M. aspirate
TDF + 3TC + LPVr
N-methyl-
glucamine-
antimony
02/07
(Third infection)
72 N.A. B.M. aspirate
TDF + 3TC + LPVr
N.D
06/08 113 <50 N.A. TDF + 3TC + LPVr
Amphotericin
B
07/09
(Fourth infection)
TDF + 3TC + LPVr
Amphotericin
B
05/10
(Fifth infection)
TDF + 3TC + LPVr
Amphotericin
B
05/11
Skin lesions on the forehead/
right forearm; Visceral
leishmaniasis (Sixth
infection)
120 <50
Skin biopsy, rK39
rapid test, DAT, latex
agglutination test, and
PCR
TDF + 3TC + LPVr
Liposomal
amphotericin
07/12
(Seventh infection)
(Splenomegaly/diarrhea/
fever/cachexia/pancytopenia)
114 <50
rK39 rapid test , DAT,
latex agglutination test,
and PCR
TDF + 3TC + LPVr
amphotericin B
b
, liposomal
amphotericin
Liposomal
amphotericin
HIV, human immunodeciency virus; N.A., not available; N.D., not done; B.M. aspirate, bone marrow aspirate; d4T, stavudine; 3TC, lamivudine; EFV, efavirenz;
TDF, tenofovir; LPVr, lopinavir/ritonavir; DAT, direct agglutination test; PCR, polymerase chain reaction.
a
Developed acute pancreatitis.
b
Developed renal failure.
427
protocol of the patient should be created for early detection of relapse
and re-infection.
One of the common features of co-infection is the increased tendency
of relapse, observed in 37-80% of the patients
22
. Additionally, in some
cases a chronic course with multiple occurrences might take place. This
can be attributed not only to immunodeciency but also to re-infection,
host deciencies correlating with ART, secondary prophylaxis, and
CD4+ lymphocyte count
16,18
. CD4+ lymphocyte count is one of the
most signicant prognostic factors for survival
11,22
. VL usually appears
as an opportunistic disease

in HIV patients when CD4+ cell count is less
than 200 cells/mm
3 (1,6,12,13,17,25)
. During the seven years of follow-up, the
patient presented a CD4+ cell count 170 cells/mm
3
. This represents
an important predictor of relapse. Relapses of VL are suggested to occur
mainly in individuals with poor responses to antiretroviral treatment who
have no improvement in CD4+ counts with a few exceptions
3,9
.
Based on clinical and biological [polymerase chain reaction (PCR)-
based] follow-up, an active chronic visceral leishmaniasis
5
has been
proposed by BOURGEOIS et al. (2010). In our case, only the 6
th
and 7
th

episodes were able to have the peripheral blood (PB) analyzed by PCR,
which showed positive results for Leishmania spp. As PCR-RFLP was
only found in the 7
th
sample episode, the etiological agent is Leishmania
chagasi, according to the pattern of bands dened by SCHONIAN et
al. (2003)
26
. Due to the absence of PB samples in previous episodes, the
analysis by PCR-RFLP was not made. Therefore, it wasnt possible to
distinguish between relapse and reinfection or characterize the case as
chronic visceral leishmaniasis. Despite the medical importance of a
clinical and laboratory monitoring of coinfected patients, this practice
is still little used
12,19,20.
ART plays an important role in reducing the effect of opportunistic
diseases and in recent studies has shown a reduction in the incidence
of VL. Studies in individuals with HIV/AIDS treated using ARV drugs
showed a similar incidence of VL relapse when compared to studies of the
pre-highly active antiretroviral therapy (HAART) era
11,14
. The increased
survival resulting from ART might partially explain the high incidence
of relapse observed in this population
18
. In the present study, during the
eight years of follow-up, we observed seven VL infections, despite the
patient receiving ART before the rst infection.
VL manifestations associated with HIV infection might appear in a
classical form, particularly in patients from VL-endemic areas, as well
as with relatively aggressive symptoms that are sometimes non-specic
and difcult to clinically diagnose
11
. In individuals with HIV/AIDS
and presenting symptoms such as asthenia, anorexia, and weight loss,
VL might be responsible for 7-23% of instances of fever of unknown
origin
11
. This patient presented classic clinical manifestations during
the study period, although in 2011, we observed the formation of skin
lesions because of the parasite, as assessed by histopathological analysis.
Among the previously treated VL cases, several patients present a
skin condition characterized by macular, popular, or nodular lesions,
called Post-kala-azar dermal Leishmaniasis (PKDL) caused by the
amastigotes of Leishmania donovani on the Indian subcontinent (India,
Nepal, Bangladesh) and east Africa (Sudan, Ethiopia, Kenya) and caused
by Leishmania chagasi in South America where it is rarely reported,
as well as its presence in HIV positives
2,4,23,28
. It is worth noticing that
exclusive involvement of the skin is an unusual condition, because
the simultaneous appearance of skin lesions along with other VL
manifestations was more frequently observed
21
. In this case, the skin
lesion suggests a clinical PKDL, which developed ve years after the
rst VL episodes, administration of multiple therapeutic regimens, and
treatments of discontinuous secondary prophylaxis. Although it has been
viewed amastigotes in biopsy specimens obtained from skin lesions,
the hypothesis of PKDL can be suggested but not stated categorically
because there was no characterization of Leishmania species involved
in the cutaneous lesions, and may have been an infection of some sort
cutaneous Leshmania endemic to the region as L. braziliensis.
Several studies on co-infected individuals show that they present a
decrease in anti-Leishmania antibody levels in the peripheral blood
11
;
that is, in only 40-50% of VL/HIV-AIDS cases, specic antibodies are
detected
1
. Conversely, assessment of Leishmania antigen in urine by latex
agglutination test showed a sensitivity of 85-100%
1
. Polymerase chain
reaction (PCR) in peripheral blood and bone marrow is a useful tool to
diagnose, for follow-up, and detect relapses
22
. Although the literature
shows that serological analyses are not the most convenient in patients
presenting co-infection
1,6
, two serological tests (direct agglutination
test and rK39-based rapid immunochromatographic test) performed
enabled the diagnosis of such cases in 2011 and 2012. In the same
years, latex agglutination test and PCR test showed positive results,
thus, conrming the data in the literature. Similar to the nding in our
study, CAVALCANTI et al. (2012), described a series of case studies of
co-infection in the main hospitals of Recife, Brazil
10
.
There is currently sufcient evidence suggesting that secondary
prophylaxis provides some protective effect but does not completely
prevent the occurrence of relapse
11
. A meta-analysis study described
that the average incidence of relapse in patients who did not receive
secondary prophylaxis was 67%, whereas in those who received it was
31%
16
. Current recommendations from the Ministry of Health of Brazil
2

for the diagnosis, treatment, and follow-up of patients presenting co-
infection

state that the efcacy of the secondary prophylaxis after the
rst successfully treated VL infection, was not completely established.
The suggested secondary prophylaxis (Table 1) was poorly adopted,
thus, compromising the clinical follow-up. Based on this case study
and literature review, it is evident that co-infection presents typical
clinical, diagnostic, and therapeutic features, and can be observed in
the prognosis of the disease. Therefore, prospective studies are required
to clarify gaps such as the efcacy of secondary prophylaxis and need
for clinical and laboratory monitoring tools for the early assessment of
relapse or re-infection.
RESUMO
Estudo de caso de paciente com mltiplos episdios da coinfeco
HIV-AIDS e leishmaniose visceral
Relato de caso de paciente masculino de 45 anos, agricultor, residente
na zona da mata do Estado de Pernambuco, diagnosticado com HIV em
1999 e em uso de ARV. Em 2005 foi registrada a primeira ocorrncia
de LV atravs do diagnstico parasitolgico a partir do aspirado da
medula ssea. admisso no hospital apresentava-se com febre,
hepatoesplenomegalia, perda de peso e diarria. Desde ento houve a
ocorrncia de mais sete episdios de LV, tendo ocorrido em media, um
428
evento a cada ano (2005-2012 exceto em 2008). O paciente apresentou,
em 2011, um quadro cutneo disseminado, sendo realizada biopsia
de pele que evidenciou formas amastigotas de Leishmania no exame
histopatolgico. Em 2005, o tratamento foi realizado com antimoniato
de N-metil-glucamina e anfotericina B desoxicolato, mas desde 2006,
devido toxicidade, o medicamento de escolha foi a anfotericina B
lipossomal. Como recomendado pelo Ministrio da Sade, esse relato
refora a necessidade de que os casos de HIV residentes em rea endmica
de LV devero ter inserido em seu protocolo de acompanhamento essa
parasitose, principalmente aps o primeiro episdio.
ACKNOWLEDGEMENTS
This study was supported by the FACEPE/MS/CNPq Programme
for Research and priority development to unied health system - SUS/
PCT Sade II (project 03/2004) and CNPq/PIBIC/Fiocruz (process
139172/2012-2).
REFERENCES
1. Alvar J, Caavate C, Gutirrez-Solar B, Jimnez M, Laguna F, Lpez-Vlez R, et al.
Leishmania and human immunodeciency virus coinfection: the rst 10 years.Clin
Microbiol Rev. 1997;10:298-319.
2. Badar R, Carvalho EM, Rocha H, Queiroz AC, Jones TC. Leishmania donovani:
an opportunistic microbe associated with progressive disease in three
immunocompromised patients. Lancet. 1986;1(8482):647-8.
3. Berenguer J, Cosin J, Miralles P, Lpez JC, Padilla B. Discontinuation of secondary
anti-Leishmania prophylaxis in HIV-infected patients who have responded to highly
active antiretroviral therapy. AIDS. 2000;14:2946-8.
4. Bittencourt A, Silva N, Straatmann A, Nunes VL, Follador I, Badar R. Post kala-azar
dermal leishmaniasis associated with AIDS. Braz J Infect Dis. 2002;6:313-6.
5. Bourgeois N, Bastien P, Reynes J, Makinson A, Rouanet I, Lachaud L. Active chronic
visceral leishmaniasis in HIV-1-infected patients demonstrated by biological and
clinical long-term follow-up of 10 patients. HIV Med. 2010;11:670-3.
6. Bourgeois N, Lachaud L, Reynes J, Rouanet I, Mahamat A, Bastien P. Long-term
monitoring of visceral leishmaniasis in patients with AIDS: relapse risk factors,
value of polymerase chain reaction, and potential impact on secondary prophylaxis.
J Acquir Immune Dec Syndr. 2008;48:13-9.
7. Brasil. Ministrio da Sade. Secretaria de Vigilncia em Sade. Manual de recomendaes
para diagnstico, tratamento e acompanhamento de pacientes com a coinfeco
Leishmania-HIV. Braslia: Ministrio da Sade; 2011.
8. Brasil. Ministrio da Sade. Secretaria de Vigilncia em Sade. Aids no Brasil. Epidemia
concentrada e estabilizada em populaes de maior vulnerabilidade. Bol Epidemiol
AIDS/DST. 2011;8(1):10-5.
9. Casado JL, Lopez-Velez R, Pintado V, Quereda C, Antela A, Moreno S. Relapsing visceral
leishmaniasis in HIV-infected patients undergoing successful protease inhibitor
therapy. Eur J Clin Microbiol Infect Dis. 2001;20:202-5.
10. Cavalcanti ATA, Medeiros Z, Lopes F, Andrade L, Ferreira VM, Magalhes V, et al.
Diagnosing visceral leishmaniasis and HIV/AIDS co-infection: a case series study
in Pernambuco, Brazil. Rev Inst Med Trop Sao Paulo. 2012;54:43-7.
11. Cota GF, Sousa MR, Rabello A. Predictors of visceral leishmaniasis relapse in HIV
patients: a systematic review. PLoS Negl Trop Dis. 2011;5(6):e1153.
12. Cruz I, Nieto J, Moreno J, Caavate C, Desjeux P, Alvar J. Leishmania/HIV co- infections
in the second decade. Indian J Med Res. 2006;123:357-88.
13. Daher EF, Fonseca PP, Gerhard ES, Leito TM, Silva Jnior GB. Clinical and
epidemiological features of visceral leishmaniasis and HIV co-infection in fteen
patients from Brazil. J Parasitol. 2009;95:652-5.
14. Fernndez Cotarelo MJ, Abelln Martnez J, Guerra Vales JM, Martnez Snchez P,
Rodrigo Gmez De La Brcena M, Salto Fernndez E. Effect of highly active
antiretroviral therapy on the incidence and clinical manifestations of visceral
leishmaniasis in human immunodeciency virus-infected patients. Clin Infect Dis.
2003;37:973-7.
15. Hailu A. Pre- and post-treatment antibody levels in visceral leishmaniasis. Trans R Soc
Trop Med Hyg. 1990;84:673-5.
16. Kubar J, Marty P, Lelivre A, Quaranta JF, Staccini P, Caroli-Bosc C, et al. Visceral
leishmaniosis in HIV-positive patients: primary infection, reactivation and latent
infection. Impact of the CD4+ T-lymphocyte counts. AIDS. 1998;12:2147-53.
17. Lopez-Velez R, Perez-Molina JA, Guerrero A, Baquero F, Villarrubia J, Escribano L, et
al. Clinicoepidemiologic characteristics, prognostic factors, and survival analysis of
patients coinfected with human immunodeciency virus and Leishmania in an area
of Madrid, Spain. Am J Trop Med Hyg. 1998;58:436-43.
18. Maia-Elkhoury AN, Alves WA, Sousa-Gomes ML, Sena JM, Luna EA. Visceral
leishmaniasis in Brazil: trends and challenges. Cad Sade Pblica. 2008;24:2941-7.
19. Marfurt J, Niederwieser I, Makia ND, Beck HP, Felger I. Diagnostic genotyping of Old
and New World Leishmania species by PCR- RFLP. Diagn Microbiol Infect Dis.
2003;46:115-24.
20. Morales MA, Cruz I, Rubio, JM, Chicharro C, Caavate C, Laguna F, et al. Relapses
versus reinfections in patients coinfected with Leishmania infantum and human
immunodeciency virus type 1. J Infect Dis. 2002;185:1533-7.
21. Orsini M, Silva M, Luz ZM, Disch J, Fernandes O, Moreira D, et al. Identication of
Leishmania chagasi from skin in Leishmania/HIV co-infection: a case report. Rev
Soc Bras Med Trop. 2002;35:259-62.
22. Pintado V, Martn-Rabadn P, Rivera ML, Moreno S, Bouza E. Visceral leishmaniasis
in human immunodeciency virus (HIV)-infected and non-HIV infected patients.
Medicine (Baltimore). 2001;80:54-73.
23. Prata A, Domingues A. Leishmaniide drmico. O Hospital. 1955;50:93-113.
24. Rosenthal E, Marty P, del Giudice P, Pradier C, Ceppi C, Gastaut JA, et al. HIV and
Leishmania coinfection: a review of 91 cases with focus on atypical locations of
Leishmania. Clin Infect Dis. 2000;31:1093-5.
25. Russo R, Laguna F, Lpez-Vlez R, Medrano FJ, Rosenthal E, Cacopardo B, et al. Visceral
leishmaniasis in those infected with HIV: clinical aspects and other opportunistic
infections. Ann Trop Med Parasitol. 2003;97(Suppl 1):S99-S105.
26. Schonian G, Nasereddin A, Dinse N, Schweynoch C, Schallig HD, Presber W, et al. PCR
diagnosis and characterization of Leishmania in local and imported clinical samples.
Diagn Microbiol Infect Dis. 2003;47:349-58.
27. World Health Organization. 5
th
Consultative Meeting on Leishmania/HIV Coinfection;
2007 Mar 20-22; Addis Ababa, ET. Geneva: World Health Organization; 2007.
28. Zijlstra EE, Musa AM, Khalil EA, el-Hassan IM, el-Hassan AM. Post kala-azar dermal
leishmaniasis. Lancet Infect Dis. 2003;3:87-98.
Received: 7 November 2012
doi: 10.1590/S0036-46652013000600011
(1) Department of Infectious and Parasitic Diseases, School of Medicine, University of So Paulo, So Paulo, SP, Brazil.
(2) Laboratory of Parasitology (LIM46), Institute of Tropical Medicine, University of So Paulo, So Paulo, SP, Brazil.
(3) Division of Infectious Diseases, Clinics Hospital, Federal University of Paran, Curitiba, Paran, Brazil.
(4) Seroepidemiology Laboratory, Institute of Tropical Medicine, University of So Paulo, So Paulo, SP, Brazil.
Correspondence to: Antonio Carlos Nicodemo. Phone: +55 11 3214-4251; Fax +55 11 3259-1318. E-mail: ac_nicodemo@uol.com.br
CASE REPORT
USEFULNESS OF kDNA PCR IN THE DIAGNOSIS OF VISCERAL LEISHMANIASIS
REACTIVATION IN CO-INFECTED PATIENTS
Antonio Carlos NICODEMO(1), Valdir Sabbaga AMATO(1,2), Felipe Francisco TUON(3), Regina Maia de SOUZA(2),
Thelma Suely OKAY(4) & Lcia Maria Almeida BRAZ(2)
SUMMARY
It is important to develop new methods for diagnosing relapses in the co-infection of visceral leishmaniasis (VL) and HIV to
enable earlier detection using less invasive methods. We report a case of a co-infected patient who had relapses after VL treatment,
where the qualitative kDNA PCR showed a good performance. The kDNA PCR seems to be a useful tool for diagnosing VL and may
be a good marker for predicting VL relapses after treatment of co-infected patients with clinical symptoms of the disease.
KEYWORDS: Visceral Leishmaniasis; Polymerase Chain Reaction; Diagnosis; Co-infection Visceral Leishmaniasis-HIV.
INTRODUCTION
Visceral leishmaniasis(VL) is a vector-borne disease caused by the L.
donovani complex (L. donovani and L. infantum or its syn. L. chagasi). It
currently affects around 12 million individuals in 88 countries, although
more than 90% of the global VL cases occur in only six countries,
namely India, Bangladesh, Sudan, South Sudan, Ethiopia and Brazil
1,9
.
In Brazil the disease has expanded following a process of rural-to-urban-
transmission, and this urbanization has paralleled ruralization of the HIV
infection. The VL/HIV co-infection has emerged as a serious disease
pattern with a reduction in therapeutic response and a high relapse rate
2
.
Both pathogens have the same target cell (macrophage), thus worsening
the outcome of both diseases. Therefore, it is essential to improve and
make diagnostic techniques available, including molecular tools, which
could replace invasive techniques.
Laboratory diagnosis can be reached by serological techniques, such
as indirect immunouorescence [IFI], enzyme-linked immunosorbent
assay [ELISA], or immunochromatography [IC]. The diagnosis can also
be performed by demonstration of amastigotes in stained bone marrow
aspirate which has a sensitivity of 58%-85% and even by culture in
Novy-MacNeal - Nicolle [NNN]/BHI medium; the latter can additionally
improve sensitivity
10
and molecular tests such as kDNA PCR. Serological
tests have limited sensitivity and, as a general rule, should not be used to
exclude the diagnosis of VL in HIV-infected patients
3
. The microscopic
examination requires an invasive procedure and is extremely subjective
and time consuming. Culture has low sensitivity and takes from one to
four weeks to give results. Molecular techniques, such as kDNA PCR, in
which preserved sequences in Leishmania kinetoplast mini-circle DNA
are amplied, have shown promise
6,11
. Even when they only allow for
diagnosis of the genus, it is possible to diagnose recurrence early since
the molecular method can produce a positive result for VL/HIV several
weeks before the clinical onset of disease
2
. Consequently, the tests based
on DNA detection in peripheral blood (PB) or in bone marrow (BM)
aspirates can provide an important approach to the diagnosis of VL
reactivation in co-infected VL/HIV patients.
METHODS
PCR kDNA Methodology
DNA extraction: The DNA from PB and BM samples collected
with EDTA anticoagulant was extracted according to the manufacturers
protocol of the RBC (Real Biotech Corporation) Genomic DNA Mini Kit
and eluded in 25 L of elution buffer (TE). The quantity and the purity
of the DNA in the samples were determined using the Nanodrop Thermo
Scientic 1000 spectrophotometer. The samples were subsequently stored
in a freezer at 20
o
C for later use.
The polymerase chain reaction (PCR): In the PCR reaction,
kDNA 20 (5GGG KAG GGG CGT TCT SCG AA 3) and kDNA 22
(5 SSS WCT ATW TTA CAC CAA CC CC3) were used to target the
amplication of the conserved region of kDNA mini circles of Leishmania
sp, producing a fragment of 120 base pairs
5
. According to the amount of
NICODEMO, A.C.; AMATO, V.S.; TUON, F.F.; SOUZA, R.M.; OKAY, T.S. & BRAZ, L.M.A. - Usefulness of kDNA PCR in the diagnosis of visceral leishmaniasis reactivation in co-infected
patients. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 429-31, 2013.
430
DNA from the extracted material, volumes between 2 and 4 L (100 ng)
of sample were added to 20 L of reaction buffer containing 50 mM
of KCl, 10 mM of Tris-HCl (pH 8.0), 0.2 mM of dNTPs, 1.0 mM of
MgCl
2
, 0.4 M of each primer and one unit of Taq DNA polymerase
(Fermentas, Canada). Two negative controls were employed containing
all of the components of the reaction together with milli-Q water. The
positive control was obtained from the culture material of the Leishmania
infantum strain (reference M6445). Each reaction was performed at an
initial denaturation temperature of 94 C for ve minutes followed by
35 cycles of denaturation at 94 C for one minute, annealing at 58 C
for one minute, extension at 72 C for 30 seconds, and a nal extension
of 72 C for ve minutes. Reactions were performed in a thermocycler
(Mini Cycler MJ Research/USA). PCR products were visualized on 2%
agarose gel. Immediately after electrophoresis, the gel was stained with
0.5 g/mL of ethidium bromide. The amplied products were visualized
by UV light over a transilluminator (AlphaImager) (Fig. 1).
CASE REPORT AND RESULTS
Herein, we report a case of a co-infected (HIV/VL) 32-year-old
female, who was hospitalized six times over a period of one year and a
half with clinical suspicion of VL reactivation.
The patient has had the HIV infection since she was 19 years old. The
highly active antiretroviral therapy (HAART) has been used irregularly
and the count of CD4+ T cell never exceeded 100 cells/mm
3
. The rst
diagnosis of VL was made in 2008.
In the patients rst admission to the hospital, she clinically presented
chills, fever, anorexia, and enlargement of liver and spleen. Leishmania
was found in samples from smear examination of BM, and kDNA PCR
was positive in the PB. She received liposomal amphotericin B, 4 mg/
kg/day for ve days. At this time, the NNN/BHI culture medium from
BM was negative. She was discharged without symptoms.
In a second hospitalization, six months later, the patient had fever and
asthenia. Laboratory diagnosis of leishmaniasis was established through
PB samples only; evaluation of smear and culture yielded negative results,
but PCR turned out positive, allowing the patient to receive the same
treatment as on the rst admission.
The patient was hospitalized a third time ve months later due to
fever, prostration, and dyspnea. Once more, using only PB samples, smear
microscopy, culture examination, and kDNA PCR were carried out. Again,
only the kDNA PCR yielded positive results. This led to a diagnosis of
reactivation and the patient underwent an additional treatment.
Yet another time, ve months later, the patient was hospitalized
with symptoms of headache, fever, liver and spleen enlargement,
and pancytopenia. Samples of BM and PB were obtained to perform
microscopic examination of smear, culture, and kDNA PCR. The smear
from PB only suggested the presence of amastigotes; the culture was
negative. Once again, because of the positivity of kDNA, the patient
was treated. One month later, the patient was admitted to the hospital
once more, this time due to anemia and again to pancytopenia. In the
culture of BM aspirate, promastigotes were observed by microscopy.
The microscopic examination of smear after panoptic staining revealed
the presence of amastigotes. Only at this time PCR was not performed.
Finally, in the patients last hospitalization two months later, positive
results were obtained in samples of both BM and PB using kDNA PCR,
and in BM alone using smear. The PB smear only suggested the presence
of amastigotes; cultures were negative. The patient received the same
treatment as before and was well when discharged.
DISCUSSION AND CONCLUSION
Leishmania/HIV co-infection emerges as a serious disease,
demanding a fast diagnostic method for detecting active disease and
relapse so as to enable prompt treatment. The patient herein reported
had several predictors of recurrence, such as CD4+ cell count below 100
cells/mL at the time of the primary diagnosis of VL, failure to recover the
number of CD4+ lymphocytes after the rst episode of VL, and previous
episodes of failure
4
. Signicantly, the patient was always a poor adherent
to antiviral therapy. However, even patients who use HAART regularly
and have a recovery of the CD4+ cell count and an undetectable viral
load ,and who also receive secondary prophylaxis can suffer VL relapses.
Since co-infection favors a poor outcome, amastigotes can be found in
PB
1
. Hence, it is possible to avoid invasive and painful techniques, such as
bone marrow aspiration, by replacing them with others that use peripheral
blood. The kDNA PCR assay can be a useful technique especially
when PB is utilized. In a study comparing PCR with parasitological
and serological techniques, PIARROUX et al. obtained a sensitivity
of 82% for PCR
7
. In our report, kDNA PCR investigation produced
positive results in all ve molecular diagnoses in the patients total of six
hospitalizations, suggesting the hypothesis of VL reactivation. Only once
was PCR not performed. In three of her six hospital stays, when both
BM and PB were investigated, PCR was always positive. In two of the
six hospitalizations, only PB was examined, and only kDNA PCR was
positive. Amastigotes were observed by microscopic smear examination
four times, and in three of these, the sample was obtained from BM,
necessarily using an invasive technique. On the sixth admission, the
NNN/BHI culture medium was positive in a sample proceeding from
BM. Considering these ndings and our aim to apply a non-invasive
technique for obtaining samples, in order to avoid unnecessary pain and
to prevent time-consuming techniques and subjective test interpretations,
it is a priority to improve molecular tools for monitoring patients who are
liable to VL reactivation, which is usual in HIV/VL co-infected patients.
It is important to emphasize that co-infected patients do not clear
Leishmania DNA from peripheral blood nor can they show a rapid
Fig. 1 - Detection of kDNA-120 bp amplication in the sample from bone marrow (BM) and
peripheral blood (PB) of the patient with LV.
NICODEMO, A.C.; AMATO, V.S.; TUON, F.F.; SOUZA, R.M.; OKAY, T.S. & BRAZ, L.M.A. - Usefulness of kDNA PCR in the diagnosis of visceral leishmaniasis reactivation in co-infected
patients. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 429-31, 2013.
431
reappearance of Leishmania DNA after therapy and these situations can
or cannot be associated with clinical disease.
A negative result is strongly indicative of successful control of
infection and efcacy of treatment, whereas a positive PCR result could
be indicative only of the presence of the parasite, but not necessarily
of relapse during an asymptomatic period
8
. Therefore, qualitative PCR
testing positive in the absence of clinical symptoms of the disease is not
always related to VL reactivation in co-infected patients.
The kDNA PCR seems to be a useful tool for diagnosing VL, and
it may be a good marker for predicting VL relapses after treatment in
co-infected patients with clinical symptoms of the disease.
RESUMO
Utilidade da kDNA PCR no diagnstico de reativao de
leishmaniose visceral em pacientes co-infectados sintomticos
importante a pesquisa de novos mtodos laboratoriais para o
diagnstico de recidivas em casos de co-infeco leishmaniose visceral
(LV) e vrus da imunodecincia humana (HIV), que permitam o
diagnstico precoce das recidivas, utilizando mtodos menos invasivos.
Descrevemos aqui, o caso de paciente co-infectada que apresentou
recidivas aps o tratamento da LV e onde a PCR qualitativa demonstrou
bom desempenho. A kDNA PCR parece ser ferramenta til para o
diagnstico de recidivas de LV aps o tratamento em pacientes co-
infectados com sintomas clnicos da doena.
FUNDING
This study was supported by So Paulo Research Foundation
(Fundao de Amparo Pesquisa do Estado de So Paulo - FAPESP,
Proc. 2010 50304-8).
CONFLICTS OF INTEREST STATEMENT
The authors have no associations or commercial relationships which
might represent conicts of interest.
REFERENCES
1. Alvar J, Vlez ID, Bern C, Herrero M, Desjeux P, Cano J, et al. Leishmaniasis worldwide
and global estimates of its incidence. PLoS One. 2012;7:e35671.
2. Alvar J, Aparicio P, Aseffa A, Den Boer M, Caavate C, Dedet JP, et al. The relationship
between leishmaniasis and AIDS: the second 10 years. Clin Microbiol Rev.
2008;21:334-59.
3. Cota GF, de Sousa MR, Demarqui FN, Rabello A. The diagnostic accuracy of serologic
and molecular methods for detecting visceral leishmaniasis in HIV infected patients:
meta-analysis. PLoS Negl Trop Dis. 2012;6:e1665.
4. Cota GF, de Sousa MR, Rabello A. Predictors of visceral leishmaniasis relapse in HIV-
infected patients: a systematic review. PLoS Negl Trop Dis. 2011;5:e1153.
5. Degrave W, Fernandes O, Campbell D, Bozza M, Lopes U. Use of molecular probes and
PCR for detection and typing of Leishmania - a mini review. Mem Inst Oswaldo Cruz.
1994;89:463-9.
6. Nasreen SA, Hossain MA, Paul SK, Mahmud MC, Ahmed S, et al. PCR-based detection
of Leishmania DNA in skin samples of post kala-azar dermal leishmaniasis patients
from an endemic area of Bangladesh. Jpn J Infect Dis. 2012;65:315-7.
7. Piarroux R, Gambarelli F, Dumon H, Fontes M, Dunan S, Mary C, et al. Comparison of
PCR with direct examination of bone marrow aspiration, myeloculture, and serology
for diagnosis of visceral Leishmaniasis in immunocompromised patients. J Clin
Microbiol. 1994;32:746-9.
8. Riera C, Fisa R, Ribera E, Carri J, Falc V, Gllego M, et al. Value of culture and
nested polymerase chain reaction of blood in the prediction of relapses in patients
co-infected with Leishmania and human immunodeciency virus. Am J Trop Med
Hyg. 2005;73:1012-5.
9. Srivastava A, Sweat JM, Azizan A, Vesely B, Kyle DE. Real-time PCR to quantify
Leishmania donovani in hamsters. J Parasitol. 2013;99:145-50.
10. van Griensven J, Diro E. Visceral leishmaniasis. Infect Dis Clin North Am. 2012;26:309-
22.
11. Volpini AC, Passos VM, Oliveira GC, Romanha AJ. PCR-RFLP to identify Leishmania
(Viannia) braziliensis and L. (Leishmania) amazonensis causing American cutaneous
Received: 15 April 2013
Accepted: 26 June 2013
55(6):432, November-December, 2013
doi: 10.1590/S0036-46652013000600012
LETTER TO THE EDITOR
DIFFERENTIAL DIAGNOSIS OF RESPIRATORY VIRUSES BY USING
REAL TIME RT-PCR METHODOLOGY
So Paulo, August 8, 2013
Dear Editor
The emergence of new respiratory viruses including: the Severe
Acute Respiratory Syndrome; the coronavirus in 2003 (SARS-CoV);
inuenza A(H1N1)pdm09, in the human population in the past ten
years; the emergence of a new coronavirus identied in a patient
presenting severe acute respiratory syndrome who travelled to
Saudi Arabia (June, 2012), denominated as Middle East Respiratory
Syndrome (MERS-CoV); and laboratory conrmation of three human
infections with an avian inuenza A(H7N9) virus not previously
reported in humans on March 29, 2013, has encouraged scientists to
develop diagnostic tests to identify these viruses
1,2,3,4
. The Adolfo Lutz,
a Public Health Institute, has been improving its methodology tools
in order to provide a timely answer to public health authorities facing
acute respiratory disease outbreaks.
To apply the Centers for Disease Control and Prevention (CDC)
Real Time RT-PCR as respiratory viruses differential diagnosis in
clinical specimens, a total of 252 respiratory secretions were collected
from patients presenting inuenza-like syndrome by the three Brazilian
National Inuenza Surveillance Network - Sentinel Units: Hospital
Menino Jesus; Hospital Vila Maria; Hospital Geral de Guarulhos; during
inuenza season 2010. These samples presented negative results for
inuenza virus A(H1N1), A(H1N1)pdm09, A(H3N2) and B strains by
CDC rRT-PCR ; and were also proven negative by differential diagnosis
by the use of respiratory monoclonal panel to investigate: inuenza A
and B viruses, respiratory syncytial virus, adenovirus and parainuenza
1, 2 and 3 viruses by Indirect Immunouorescence (IFI). The differential
diagnosis in samples presenting negative results, by both methodologies,
was submitted to the CDC Real RT-PCR containing primers and probes
for adenovirus (ADV), rhinovirus (RVs), respiratory syncytial virus
(RSV), human metapneumovirus (hMPV ), parainfluenza 1, 2, 3,
4(PV1, PV2, PV3, PV4), kindly provided by Dr. Dean Erdman. Of the
252 clinical specimens presenting negative results by using differential
monoclonal respiratory panel IFI, 60 (23.80%) were positive by Real
Time RT-PCR, the following etiologic agents have been identied:
RSV 20 (33.40%); PV1 3 (5%); PV2 7 (11.60%); PV3 9 (15%) RVs 10
(16.60%); ADV 11 (18.40%).
This study demonstrates the high sensitivity of Real Time RT-PCR in
respiratory differential diagnosis, by the National Inuenza Surveillance
Network, sponsored by Brazilian Ministry of Health.
In addition, fast, accurate and sensitive detection of respiratory viruses
in clinical specimens through the use of this methodology would also
increase our understanding of the epidemiology of both new emerging
viruses such as inuenza A (H1N1) pdm09, and conventional viruses
such as the common cold viruses, including rhinovirus and coronavirus.
Taking into account the development of vaccines and antiviral drugs,
successful measures of prevention and control of the disease can be
warranted as soon as the etiology of the disease is revealed.
Renato de Souza PAULINO

(1)
Margarete Aparecida BENEGA

(1)
Katia Corra de Oliveira SANTOS (1)
Daniela Bernardes Borges da SILVA (1)
Juliana Cristina PEREIRA (1)
Norio Augusto SASAKI (1)
Patricia Evelin SILVA (1)
Suely Pires CURTI (1)
Maria Isabel OLIVEIRA (1)
Telma R.M.P. CARVALHANAS (2)
Teresa PERET (3)
Dean ERDMAN (3)
Terezinha Maria de PAIVA (1)
(1) Respiratory Disease Centre, Virology Center,
Instituto Adolfo Lutz, So Paulo, SP, Brazil
(2) Epidemiologic Surveillance Center of the State of So Paulo,
So Paulo, SP, Brazil
(3) Centers for Disease Control and Prevention, Division of Viral
Diseases
Correspondence to: Terezinha Maria de Paiva
Ncleo de Doenas Respiratrias, Centro de Virologia,
Instituto Adolfo Lutz
Av. Dr. Arnaldo 355, 01246-902 So Paulo, SP, Brasil
Phone: +55 11 30682913, Fax + 55 11 3085-3505
E- mail: tterezinha@uol.com.br
Supported by: Institute Adolfo Lutz/SES/SP,
National Inuenza Surveillance Network
Sponsored by: Ministry of Health of Brazil,
Centers for Diseases Control and Prevention.
REFERENCES
1. Gao R, Cao B, Hu Y, Feng Z, Wang D, Hu W, et al. Human infection with a novel avian
- origin inuenza A (H7N9) virus. N Engl J Med. 2013;368:1888-97. doi: 10.1056/
NEJMoa1304459. Epub 2013 Apr 11.
2. Paiva TM, Kisielius JJ, Benega MA, Ueda M, Sugahara TKN, Santos CLS, et al.
Severe acute respiratory syndrome - a global concern - inuenza virus isolated from
suspected cases in Brazil from April to June 2003. In: Proceedings of the International
Conference on Options for the Control of Inuenza V. Okinawa, October 7-13, 2003.
Netherlands: Elsevier; 2004. p. 422.
3. Rota PA, Oberste MS, Monroe SS, Nix WA, Campagnoli R, Icenogle JP, et al.
Characterization of a novel coronavirus associated with severe acute respiratory
syndrome. Science. 2003;300:1394-9.
4. Zaki AM, van Boheemen S, Bestebroer TM, Osterhaus AD, Fouchier RA. Isolation of
a novel coronavirus from a man with pneumonia in Saudi Arabia. N Engl J Med.
2012;367:1814-20.
doi: 10.1590/S0036-46652013000600013
HIGH PREVALENCE OF HEPATITIS A ANTIBODIES AMONG RECYCLABLE WASTE PICKERS,
CENTRAL BRAZIL
April 26, 2013
Dear Editor,
In South America, a shift has been observed from high to intermediate endemicity for hepatitis A virus (HAV) infection in several countries,
including Brazil, which has generally been explained by improvements in public health programs and sanitary conditions in most parts of these areas
3,13
.
A multicentric population-based study conducted in Brazilian capital cities classied the North, Northeast and Central-West regions as having an
intermediate endemicity for HAV infection, while South and Southeast regions as having a low endemicity
8
. Furthermore, seroprevalence rates may
vary by age, socio-economic status, urbanization level and access to clean water as sanitation facilities
3
.
In Brazil, recyclable waste pickers collect, separate, classify and sell all types of recyclable waste materials. These individuals are autonomous
workers who may or may not belong to recyclable cooperatives or associations. In 2002, this job became regulated by the Brazilian Occupational
Classication. The number of recyclable waste pickers has increased signicantly in urban areas, and it is estimated that there are one million recyclable
waste pickers in Brazil
1
. They have a lifestyle that makes this group highly vulnerable to unfavorable socioeconomic and environmental factors.
Additionally, their occupation is associated with poor health and high levels of risk of acquiring infectious diseases occupationally
5,9,11,12
. However,
the epidemiological status of HAV infection in recyclable waste pickers remains unknown.
A seroprevalence survey for HAV was conducted among recyclable waste pickers in Goinia City (population 1,300,000), the capital of the state
of Gois, Central Brazil. Since 2008, Goinia has been engaged in the implementation of the Programa Goinia Coleta Seletiva recycling program.
This program focuses on integrating actions between the municipal government that provides collection of recyclables for every household. The rise
in household recyclable waste collection has led to the creation of 15 cooperatives.
Between April 2010 and May 2011, 431 individuals from all recycling cooperatives were enrolled. Participation was voluntary. Written informed
consent was obtained from all participants prior to the start of the study. Participants were interviewed to collect data on their sociodemographic
characteristics, professional information, and other risk behaviors. Blood was collected from all participants and serum samples tested by enzyme-linked
immunosorbent assay (ELISA) for the presence of total antibodies against HAV (Eti-Ab-HAVK Plus, Diasorin, Italy). Anti-HAV positive samples
were assayed for IgM anti-HAV (Eti-HA-IgMK Plus, Diasorin). The protocol used in the present study was approved by the Ethical Committee of
the Federal University of Gois (No. 002/2010).
Almost all recyclable waste pickers were positive for total anti-HAV antibodies (429/431). By contrast, none were IgM anti-HAV positive,
indicating that 99.5% of the study population had previously been exposed to HAV since no participants in this population were vaccinated against
HAV. The population ranged in age from 18 to 80 years (mean 36.9 years). There were 269 females (62.4%) and 162 males (37.6%). Most of the
participants had low educational (78.7% had received eight years or less of education, corresponding to primary or elementary school level of
education) and socioeconomic levels (60% reported an income of 1 Brazilian minimum wage/month, approximately US $300 or less). Regarding
the locations of their residences, 11.2% reported living in waste deposits, 4.1% lived on the streets, and 84.7% either rented or owned their residence
in periphery areas where environmental conditions are still poor (crowded conditions and lack of sewage system). The majority of recyclable waste
pickers reported consumption of non-ltered water (60%) and had eaten food from the garbage (73.6%). Most participants reported having contact
with human stools present on diapers (85.8%) and toilet paper (95.3%), among other wastes, as well as inconsistent glove use (63.6%) and other
personal protective equipment.
This letter represents the rst investigation designed to estimate the prevalence of HAV in a population of recyclable waste pickers in Brazil.
Although no similar reports are available for direct comparison, the anti-HAV prevalence found among recyclable waste pickers was higher than
those reported in waste collectors in Greece and Thailand (62.5%, 61% and 89.2%)
2,6,10
.

It should be stressed that recyclable waste pickers are in
closer contact with garbage than waste collectors who handle waste products using gloves. Furthermore, garbage is kept in a closed plastic bag that
is seldom opened by waste collectors. In addition, the prevalence of anti-HAV found in this study was in agreement with other high rates reported in
low socioeconomic Brazilian groups
4,7
. Thus, despite a shift in the endemicity of HAV infection in Brazil from high to intermediate or low
8,13
, pockets
of highly exposed individuals may co-exist within this country.
In conclusion, a high prevalence for past infection of hepatitis A was found among recyclable waste pickers in Central Brazil. Most of these
workers reported having contact with human stools, indicating a potential risk of occupational exposure to HAV infection. These ndings highlight
SOARES, H.O.; LOPES, C.L.R.; FREITAS, N.R.; COSTA E SILVA, A.M.; MOURA, L.R. & MARTINS, R.M.B. - High prevalence of hepatitis A antibodies among recyclable waste pickers,
Central Brazil. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 433-4, 2013.
434
the importance of having a public health policy that addresses this population which should be aimed at improving education, hygiene practice, and
safer equipments for collecting selective waste. In addition, vaccination against HAV could also be considered.
Helen de Oliveira SOARES
Carmen Luci Rodrigues LOPES
Nara Rbia de FREITAS
gabo Macdo da COSTA E SILVA
Ludimila Rispoli de MOURA
Regina Maria Bringel MARTINS
Universidade Federal de Gois (UFG), Goinia, Gois, Brasil.
Correspondence to: Regina Maria Bringel Martins,
Instituto de Patologia Tropical e Sade Pblica/UFG,
Caixa Postal 131, 74605-050 Goinia, Gois, Brazil
Phone: +55 62 32096129; Fax: +55 62 32096363
E-mail: rbringel.iptsp.ufg@gmail.com
Supported by:
Conselho Nacional de Desenvolvimento Cientco e Tecnolgico (CNPq)
Fundao de Amparo Pesquisa do Estado de Gois (FAPEG)
REFERENCES
1. Compromisso Empresarial para Reciclagem. CEMPRE. Poltica Nacional de Resduos Slidos. Agora lei: Novos desaos para poder pblico, empresas, catadores e populao. [Cited
2012 December 14]. Available from: http://www.cempre.org.br/download/pnrs_002.pdf
2. Dounias G, Rachiotis G. Prevalence of hepatitis A virus infection among municipal solid-waste workers. Int J Clin Pract. 2006;60:1432-6.
3. Franco E, Meleleo C, Serino L, Sorbara D, Zaratti L. Hepatitis A: epidemiology and prevention in developing countries. World J Hepatol. 2012;4:68-73.
4. Gomes MA, Ferreira A de S, da Silva AA, de Souza ER. Hepatitis A: seroprevalence and associated factors among schoolchildren of So Lus (MA), Brazil. Rev Bras Epidemiol.
2011:14:548-55.
5. Gutberlet J, Baeder AM. Informal recycling and occupational health in Santo Andr, Brazil. Int J Environ Health Res. 2008;18:1-15.
6. Luksamijarulkul P, Sujirarat D, Charupoonphol P. Risk behaviors, occupational risk and seroprevalence of hepatitis B and A infections among public cleansing workers of Bangkok
Metropolis. Hepat Mon. 2008;8:35-40.
7. Matos MA, Reis NR, Kozlowski AG, Teles SA, Motta-Castro AR, Mello FC, et al. Epidemiological study of hepatitis A, B and C in the largest Afro-Brazilian isolated community.
Trans R Soc Trop Med Hyg. 2009:103:899-905.
8. Ministrio da Sade. Brasil. Secretaria de Vigilncia em Sade. Departamento de DST, AIDS e Hepatites Virais. Braslia: Ministrio da Sade; 2011. Bol Epidemiol Hepat Virais. 2011;
II(1). Available from: http://www.aids.gov.br/sites/default/les/anexos/publicacao/2011/50073/boletim_hepatites2011_pdf_64874.pdf
9. Porto MF, Junc DC, Gonalves R de S, Filhote MI. Lixo, trabalho e sade: um estudo de caso com catadores em um aterro metropolitano no Rio de Janeiro, Brasil. Cad Saude Publica.
2004;20:1503-14.
10. Rachiotis G, Papagiannis D, Thanasias E, Dounias G, Hadjichristodoulou C. Hepatitis A virus infection and the waste handling industry: a seroprevalence study. Int J Environ Res
Public Health. 2012;9:4498-503.
11. Rozman MA, Alves IS, Porto MA, Gomes PO, Ribeiro NM, Nogueira LA, et al. HIV infection and related risk behaviors in a community of recyclable waste collectors of Santos,
Brazil. Rev Sade Pblica. 2008;42:838-43.
12. Silva MC, Fassa AG, Siqueira CE, Kriebel D. World at work: Brazilian ragpickers. Occup Environ Med. 2005;62:736-40.
13. Vitral CL, Ospina FL, Artimos S, Melgao JG, Cruz OG, de Paula VS, et al. Declining prevalence of hepatitis A virus antibodies among children from low socioeconomic groups
reinforces the need for the implementation of hepatitis A vaccination in Brazil. Mem Inst Oswaldo Cruz. 2012:107:652-8.
doi: 10.1590/S0036-46652013000600014
ANALOGIES IN MEDICINE: VIOLIN STRINGS ADHESIONS
Belo Horizonte, August, 2013
Dear Sir
Brief history of the violin. The emergence of the violin in Upper
Italy: The violin evolved from the viola da braccio family between
1520-1550, the Upper Italian towns of Milan, Brescia, Cremona and
Venice being the most important centers. The term violin (from the
Italian word violino) is derived from the word viola and had the general
meaning small stringed instrument rather than small viola. The
earliest surviving violins are those made by the Cremonese violin maker
Andrea Amati (1500-1576) in the year 1542. They still have only three
strings: G3, D4 and A4. It was probably not until after 1550 that Amati
made the rst violins with four strings. Andrea Amati was therefore in all
likelihood the rst instrument maker to produce instruments with those
characteristics that justied the appellation violin.
The violin proved an enormous success in Italy, very quickly
supplanting all the other small stringed instruments in the soprano
register which were played in the "da braccio position" (arm position). No
other instrument which had undergone the major part of its development
before 1650 was accepted so readily as an essential part of musical
practice; this was due to the limitless range of means of expression that it
offered. The subsequent development of Western music history is linked
closely to the further development of the violins playing techniques
and possibilities for expression. Whereas violins and later, other
members of the violin family have always been played exclusively by
professional musicians, the viol remained an instrument also adopted by
educated lay musicians such as noblemen and merchants and as such
was endowed with a certain social standing. Italian players introduced
the new instrument to a wider audience at European courts.
The Golden Age (1600-1750): The violins popularity led to the
emergence of the most famous schools of violin-making: The Cremonese
School was led by Amatis sons until Nicola Amati (1596-1684). The
Brescian School produced master craftsmen such as Gasparo da Sal
(1540-1609) and his pupil Giovanni Paolo Maggini (1580-1632).
The Cremonese School continued with Nicola Amatis pupil Andrea
Guarnieri (1626-1698) and later Antonio Stradivari (1644-1737), who
was presumably a pupil of Guarnieris. Antonio Stradivari, who made
around one thousand instruments during his career of which 600 are
said to be still in existence, is still regarded as the apogee of the art of
violin-making. Despite repeated attempts, which continue today and
make use of the most modern technology, it has proved impossible to
reproduce the sheer brilliance of timbre of a Stradivarius. The dimensions
of Stradivaris model were accepted as denitive by later generations.
Giuseppe Guarnieri, known as del Ges (1698-1744), made
instruments that were appreciated chiey on account of their sustaining
tone. Niccol Paganini (1782-1840), the greatest violin virtuoso of all
time, played a Guarnieri
1
.
Dr. Malcom M. Stanley
3
: Peritonitis of the upper part of the
abdomen in young women occurring during the course of gonorrhea was
rst described as a denite syndrome in 1919 by Carlos Stajano, in a paper
read before the Society of Obstetrics and Gynecology of Montevideo,
Uruguay. In his subsequent publications the clinical features of the acute
stage of the disease were completely and graphically depicted. Little
information of a clinical nature has been added since. Unfortunately,
none of his work, printed in Spanish and French, was widely circulated
in the United States. Hence it was not until 1930 that Curtis called
attention to the frequent coexistence of gonococcic salpingitis and
violin string adhesions between the anterior surface of the liver and the
anterior abdominal wall discovered at operation conditions indicating,
presumably, a chronic, healing or healed perihepatitis. Fitz-Hugh, in
1934, described three cases in the acute stage, including one in which
laparotomy was performed; in smears of the draining secretions from
the wound Gram-negative intracellular diplococci were seen. Since then
numerous articles have appeared in the literature, and the clinical entity
has been well documented
3
.
Pelvic inammatory disease (PID) is a disorder characterized by
pelvic pain, adnexal tenderness, fever and vaginal discharge; it results
from infection by one or more of the following organisms: gonococci,
chlamydiae, and enteric bacteria. The gonococcus continues to be a
common cause of PID, the most serious complication of gonorrhea in
women. Chlamydia infection is another well-recognized cause of PID
2
.
Fig. 1 - Laparoscopic view of violin string adhesions. Diagnostic picture tests in sexually
transmitted diseases - Taylor, PK, 1995. Bristol Royal Inrmary, Bristol, England.
ANDRADE-FILHO, J.S. - Analogies in Medicine: violin strings adhesions. Rev. Inst. Med. Trop. Sao Paulo, 55(6): 435-6, 2013.
436
In about one half of infected women, gonorrhea remains
asymptomatic. The other infected women initially exhibit endocervicitis,
with a vaginal discharge or bleeding. Infection often extends to the
fallopian tubes, where it produces acute and chronicle salpingitis and
eventually PID.
From the fallopian tubes, gonorrhea spreads to the peritoneum,
healing as ne violin string adhesions between the liver capsule and
the parietal peritoneum (Stajano - Fitz-Hugh - Curtis syndrome) (Fig. 1).
Jos de Souza ANDRADE-FILHO
Faculdade de Cincias Mdicas de Minas Gerais
Belo Horizonte, Minas Gerais, Brasil
E-mail: labjsouzandrade@terra.com.br
REFERENCES
1. History of the violin. In: Vienna Symphonic Library. Available from: <http://www.
vsl.co.at/en/70/3189/3190/5620.vsl#top>
2. Kumar V, Abbas AK, Fausto N. Robbins & Cotran pathologic basis of disease. 7
th

ed. Philadelphia: Elsevier Saunders; 2005. p. 1064-5.
3. Stanley MM. Gonococci peritonitis of the upper part of the abdomen in young
women: phrenic reaction, or subcostal syndrome of Stajano; Fitz-Hugh - Curtis
syndrome. Report of cases of three patients treated successfully with penicillin and
a summary of the literature. Arch Intern Med (Chic). 1946;78:1-3. doi:10.1001/
archinte.1946.00220010011001
437
AUTHOR INDEX - VOLUME 55
ACARDI, S.A., 239
ACOSTA, M.M., 239
ADAMI, C., 189
AFONSO, A.M.S., 292
AFONSO, L.A., 329
ALBUQUERQUE, P.L.M.M., 295, 347
ALFONSO, Y., 65
ALMEIDA, A.B.P.F., 287
ALMEIDA FILHO, G.L., 329
ALVAREZ, R.R.A., 173
ALVES, G.B.B., 105
AMARAL, C.T., 315
AMATO, V.S., 429
ANDRADE, G.B., 113
ANDRADE, L.D., 425
ANDRADE-FILHO, J.S., 68, 218,
290, 435
ANDRADE Jr., D.R., 341
ANDRADE Jr., H.F., 55
ANGELO, A.L.D., 323
ANZAI, M.C., 371
AQUINO, V.R., 145
ARAJO, C.W., 213
ARAJO, J.S.V., 145
ARAUJO, N., 75
ARAJO, P.S.R., 425
ARAUJO, S.M., 189
ARIAS, E., 167
ARRUDA, L.B., 91
ASSIS, D.C., 149
AVILA, L.F.C., 363
AZEVEDO, M.C.V.M., 61
BACILIO, M.L., 31
BAEZA, L.C., 385
BARRETO, W.T.G., 113
BARROS, M.J., 69
BASTOS, M.C., 323
BATISTA, J.F., 105
BELTRO, E.I.C., 213
BENEGA, M.A., 432
BERROZPE, P., 239
BERRUETA, L., 31
BEZERRA, F.S., 261
BIONDO, A.W., 335
BISORDI, I., 45
BIZAI, M.L., 167
BONFIM-MENDONA, P.S., 385
BRASIL, R.A., 45
BRAZ, L.M.A., 429
BRILHANTE, R.S.N., 261
BRITES, C., 323
BRONZONI, R.V.M., 275
BUSATTI, H., 69
CABRINE-SANTOS, M., 149
CADEMARTORI, B.G., 25
CALDEIRA, T.D.M., 315
CAMARGO, J.A.S.A., 193
CAMARGO, L.M.A., 193
CAMPOS, A.P., 105
CANELLO, T.B., 55
CARESTIATO, F.N., 329
CARISSIMI, M., 353
CARNEIRO, J.A., 283
CARVALHANAS, T.R.M.P., 432
CARVALHO, C.M.E., 113
CARVALHO, M.D.B., 407
CASTRO, A.C., 323
CATISTI, R., 185
CAVALCANTI, M.S.M., 213
CAVALCANTI, S.D.B., 7
CAVALCANTI, S.M.B., 329
CECI, L., 323
CELLA, W., 407
CESETTI, M.V., 173
CHANDRASHEKAR, R., 335
CHIEFFI, P.P., 51, 141, 291
CHIPPAUX, J.P., 13
COELHO, P.M.Z., 39, 75
COIMBRA, T.L.M., 45
COLOMBO, T.E., 275
CONCEIO, F.R., 363
CORBELLINI, V.A., 353
CORRAL, M.A., 141, 291
CORREIA, D., 149
CORRENTE, J.E., 245
COSTA E SILVA, A.M., 433
COSTA, F.A.L., 105
COSTA, R.T., 101
COSTA, S.F., 417
COSTA-CRUZ, J.M., 309
COTRIM, P.C., 393
COURA, J.R., 205
COUTO, J.M., 39
COX, R., 65
CRUZ, C., 197
CRUZ, L.E.A.A., 275
CRUZ, R.A.S., 287
CRUZ, R.C.B., 125
CUNHA, M.J.R., 19
CUNHA, V.O., 117
CUNHA FILHO, N.A., 25
CURSINO, A.E., 137
CURTI, S.P., 292, 432
CURY, A.A.F., 275
CURY, M.C., 19
DABOIT, T.C., 353
DAHER, E.F., 295, 347
DAL BELLO, A.G., 209
DAMAZIO, S.M., 179
DAS NEVES, B.C., 31
DAVILA, D.F., 31
DE ROODT, A.R., 13
DE TITTO, E., 13
DEL NEGRO, G.M.B., 1, 7
DELGADO-MURCIA, L.G., 357
DENNER, S., 167
DESHPANDE, P.S., 79
DIAS, A.L.T., 117
DOLAB, J.A., 13
DONIS, J.H., 31
DORINI, A.A., 245
DRACZ, R.M., 229
DUARTE, R.J., 137
DUTRA, V., 371
ERDMAN, D., 432
ESPRITO-SANTO, M.C.C., 129
FABBRO, D., 167
FAANHA, M.C., 261
FAGUNDES, A., 101
FALAVIGNA, D.L.M., 189
FALAVIGNA-GUILHERME, A.L., 189
FALAVIGNA-GUILHERME, G., 189
FARIA, E.S.M., 19
FARIAS, N.A.R., 25
FELICIANO, J.P.O., 283
FERNANDES, O., 101
FERNANDEZ, M.A., 385
FERNNDEZ, M.S., 239
FERRAZ, J.R., 417
FERREIRA, I.B., 155
FERREIRA, M.R., 61
FERRY, F.R.A., 61
FIGUEIREDO, C.A., 292
FIGUEIREDO, H.R., 113
FIORINI, A., 385
FONSECA, C., 75
FONSECA, T.V., 315
FONTES, G., 193
FRANA E SILVA, I.A., 417
FREITAS, N.R., 433
FUJII, Y., 401
FUKUMOTO, A.E.C.G., 267
GHAFFARIFAR, F., 79
GIL, F.F., 69
GIROTTO, K.G., 19
GLAESER, T.A., 363
GODOY, G., 197
GOLKAR, M., 79
GOMES, C.M., 173
GOMES, M.A., 69
GMEZ, A., 239
GMEZ-GALINDO, A.M., 357
GONALVES, C.V., 315
GONALVES, R., 315
GOTO, R.L., 245
GOTTARDI, M., 141, 291
GOULD, I.T., 239
GRACIA-PAEZ, J.I., 417
GRAMA, D.F., 19
GRENFELL, R., 75
GRYSCHEK, R.C.B., 129, 141, 291
GUAZZELLI, L.S., 145
GUERRA, F.Q.S., 377
GUILHEM, D., 159
GUILHERME, E.V., 189
HADDAD Jr., V., 125
HAHN, R.C., 371
HALLAL Jr., R.J., 209
HENRIQUES, R.M.S., 245
HOCHHEGGER, B., 121, 209
HONER, M.R., 113
HORA, V.P., 315
INOCNCIO, L.A., 323
JACINTO, C.N., 295, 347
JAUNE, F.W., 287
JNIOR, C.G.E., 69
JUNIOR, R.S., 323
KAISER, J., 185
KANEKO, S., 401
KAPOOR, S., 124
KARIM, I.Z.A., 79
KAWAKUBO, E.M., 91
KAWASATO, K.H., 1
KOTRESHA, D., 79
KRAWCZAK, F.S., 335
KUMAR, P., 303
LABRUNA, M.B., 335
LAZRA, M.S., 371
LEITO, T.M.J.S., 261
LEITE, F.P.L., 363
LEITE-JNIOR, D.P., 371
LEMOS, J.A.R., 323
LEMOS, X.R.M.R., 292
LESCANO, S.A.Z., 51
LEVIN, A.S., 417
LI, T., 217, 293, 366
LI, X., 366
LIMA, C.B., 347
LIMA, C.B.C., 341
LIMA, J.B., 295, 347
LIMA, M.S., 179
LIMA, W.S., 229
LIMA Jr., O.A., 185
LIMEIRA, O.M., 173
LIMONGI, J.E., 19, 85, 155
LINDOSO, J.A.L., 393
LOPES, C.L.R., 433
LOPES, P.O.M., 421
LPEZ, L., 197
LUNA, E.J.A., 55
MACEDO, N.A., 69
MACIEL, E., 39
MADEIRA, M.F., 287
MAEDA, A.Y., 45
MAGALHES, P.P., 137
MALAFAIA, G., 159
MALTA, F.M., 141
MARCHIORO, A.A., 189
MARCIANO, M.A.M., 232
MARCONDES, M., 335
MARQUES, D.P.A., 39
MARQUI, R., 407
MARTINEZ, A.M.B., 91, 315
MARTINS, L.H.R., 363
MARTINS, R.M.B., 433
MARTINS, T.F., 335
MARTINS, W., 75
MASSAFERA, R., 407
MATI, V.L.T., 133
MAUCH, R.M., 117
MEDEIROS, Z.M., 425
MELO, A.L., 133
MELO, S.C.C.S., 407
MENDES, E.N., 137
MENDONA, A.J., 287
MIGUEL, R.B., 205
MIURA, M., 401
MONDINI, A., 275
MONZOTE, L., 65
MORAIS, O.O., 173
MORAKOTE, N., 411
MOREIRA, F.G., 155
438
MORENO, E.S., 45
MOTA, D.J.G., 129
MOTA, R.M.S., 261
MOTTA, R.N., 61
MOURA, L.R., 433
MOYSS, N., 329
MOZZER, L.R., 229
NAKANO, E., 421
NAKAZATO, L., 287, 371
NASCIMENTO, D.A.G., 335
NASSAU, D.C., 283
NAVARRO, E.C., 245
NAVES, M.M., 309
NEGRO-CORRA, D.A., 39
NEHME, N., 101
NETTO, E.M., 323
NEVES, S.L., 245
NICODEMO, A.C., 429
NOGUEIRA, M.L., 275
NOORDIN, R., 79
NUNES, J.S., 193
NUEZ, T.J., 31
OKAY, T.S., 1, 429
OLIVEIRA, A.C., 377
OLIVEIRA, C.C., 267
OLIVEIRA, E., 75
OLIVEIRA, F.H., 275
OLIVEIRA, F.M., 121, 209
OLIVEIRA, G.R., 315
OLIVEIRA, L.C., 1
OLIVEIRA, M.I., 292, 432
OLIVEIRA-SILVA, M.B., 149
OLIVERA, V., 167
OSMAN, S., 79
OTTON, M.L.P., 287
OYAFUSO, L.K., 393
PADILHA, C.E., 425
PAIVA, T.M., 432
PAJUABA NETO, A.A., 85
PALMA, P.V.B., 323
PAPA, C.H.G., 51
PASQUALOTTO, A.C., 145
PAULA, C.R., 371
PAULA, D.A.J., 287, 371
PAULA, F.M., 141, 291
PAULA, M.B.C., 85
PAULINO, R.S., 432
PENNA, F.J., 137
PEREIRA, J.C., 432
PEREIRA, L.E., 45, 155
PEREIRA, P.A.R., 137
PEREIRA, P.C.M., 245
PERES, J.B., 155
PERET, T., 432
PRET-FILHO, L.A., 137
PESCADOR, C.A., 287
PETERSON, D.L., 31
PETRELLA, S., 45
PINTO, H.A., 133
PINTO, P.L.S., 129
PINTO, R.M.C., 19, 155
PIRES, K.L., 61
PONTES, L.R.A., 377
PONTES, Z.B.V.S., 377
POSWAR, F.O., 283
PRATA, A., 101
PRAVIA, C., 167
PRIANTI, M.G., 105
QUEIROZ, M.L., 51
RAMOS, A.P.G., 261
RAMOS Jr., A.N., 261
RAPADO, L.N., 421
REDOAN, R., 69
RGO, M.J.B.M., 213
REIS, A.A., 85
REIS, A.F.N., 275
RESENDE, D.V., 149
RIBEIRO, L.M., 229
RICOBONI, I.S., 245
RIGO, L., 113
RIGO, R.S., 113
ROBLEDO, S.M., 197
ROCCO, I.M., 45
ROCHA, E.M.M., 193
ROCHA, M.C., 393
RODRIGUES, E.A.S., 85
RODRIGUES, V., 101
RODRGUEZ, M., 65
ROMERO, H.D., 101
ROSA, F.M., 39
ROSSETTO, A.L., 125
ROSSI, F., 417
RUBINSKY-ELEFANT, G., 189
RUIZ, A.M., 167
SAADATNIA, G., 79
SALMEN, S., 31
SALOMON, O.D., 239
SAMUDIO, F., 205
SANTINI, M.S., 239
SANTOS, C.A.M.L., 219
SANTOS, F.L.N., 233
SANTOS, J.B., 39
SANTOS, J.F.G., 69
SANTOS, J.P., 377
SANTOS, K.C.O., 432
SANTOS, M., 91
SANTOS, R.V., 193
SANTOS, S.A., 341
SASAKI, N.A., 432
SATOW, M.M., 393
SCAINI, C.J., 363
SCROFERNEKER, M.L., 353
SEVERO, C.B., 145, 209
SEVERO, L.C., 121, 145, 209
SHINOBU-MESQUITA, C.S., 385
SICILIANO, M.M., 45
SILVA, D.B.G., 432
SILVA, E.D., 425
SILVA, F.G., 45
SILVA, G.A.R., 61
SILVA, I.S., 113
SILVA, L.A., 101
SILVA, L.S., 105
SILVA, M.A.L., 425
SILVA, M.O., 323
SILVA, M.S.A.C., 137
SILVA, N.M.M.G., 407
SILVA, P.E., 432
SILVA Jr., G.B., 295, 347
SILVA-MORAES, V., 75
SILVEIRA, V.M., 425
SILVEIRA, V.R., 45
SINGH, D.K., 251, 303
SINGH, V.K., 251, 303
SIQUEIRA, M.M., 292
SITTA, R.B., 141
SOARES, A.R., 179
SOARES, D.C.S., 61
SOARES, H.O., 433
SOARES, N.M., 233
SOLER, R.C., 393
SONGSANGCHUN, A., 411
SOUSA, M.G.T., 7
SOUSA, V.R.F., 287
SOUZA, A.A., 85
SOUZA, A.M.G.C., 233
SOUZA, D.F., 323
SOUZA, L.R., 267
SOUZA, M.A.A., 179
SOUZA, R.M., 429
SOUZA, R.P., 45, 155
SPINOLA, R., 45
STEFANI, V., 353
STOPIGLIA, C.D.O., 353
STUART, J.M., 283
SUREZ-MUTIS, M.C., 205
SUNITA, K., 303
SUZUKI, A., 45, 155
SVIDZINSKI, T.I.E., 385
TAKAHARA, D.T., 371
TALVANI, A., 159
TAN, S., 366
TANG, Z.-H., 144
TANIGAWA, C., 401
TASCA, K.I., 267
TELES, H.M.S., 39
TELMO, P.L., 363
TENGAN, C.H., 45
TEODORO, U., 407
TOME, A.C.N., 55
TORRES, A.J.L., 323
TRILLES, L., 371
TUON, F.F., 429
UNIS, G., 121
UPADHYAY, A., 251
UPARANUKRAW, P., 411
VEDOVELLO, D., 275
VELARDE, L.G.C., 329
VELAZQUEZ, E., 167
VLEZ, I.D., 197
VELHO, P.E.N.F., 1
VERAS, M.S.B., 295, 347
VIDAL, M.S.M., 7
VIDOTTO, O., 335
VIEIRA, R.F.C., 335
VIEIRA, R.H.S.F., 219
VIEIRA, T.S.W.J., 335
VIEIRA-DE-MELLO, G.S., 213
VIEL, T.A., 51
WANG, M., 293
WANKE, B., 261, 371
WANNASAN, A., 411
WEBER, L.I., 91
WIWANITKIT, V., 216
XAVIER, G.A., 25
XAVIER, M.O., 145
XAVIER, P.C.N., 148
YAMAGUCHI, L.F., 421
YAMAMOTO, L., 1
YAMASHIRO-KANASHIRO, E.H., 393
YANG, Z., 293
YU, A.L.F., 292
YU, Y.-S., 144
YUNUS, M.H., 79
ZANCOP-OLIVEIRA, R.M., 261
ZANG, G.-Q., 144
ZANINI, J.M., 245
ZHANG, Y., 144
439
SUBJECT INDEX - VOLUME 55
Africanized honeybees, 61
Envenoming syndrome, 61
Amer.Tegum.Leishmaniasis, 393, 407
kDNA-PCR, 393
Phlebotomine, 407
Animal envenomation, 13,61,295,347
Africanized honeybees, 61
Bothrops, 295,347
Crotalus, 295
Micrurus, 13
AIDS, 261, 283
Histoplasmosis, 261, 283
Angyostrongylus cantonensis, 129
Eosinophilic meningitis, 129
So Paulo, Br., 129
Aspergillosis, 145
Diagnosis, 145
Bacillus Calmette-Gurin, 173
Leprosy prophylaxis, 173
Bacterial infections, 219
Seafood, 219
Bartonella henselae, 1
Cat scratch disease, 1
Biomphalaria glabrata, 421
Piperaceae, 421
Ovicidal effect, 421
Biomphalaria tenagophila, 39
Breeding, 39
Blood donation, 245
Chagas disease, 245
Bothrops, 295
Kidney injury, 295
Candida albicans, 385
Molecular typing, 385
Cat scratch disease, 1
Centrocestus formosanus, 133
Swiss and AKR/J mice, 133
Chagas disease, 31,68,159,167,245
Analogies, 68
Blood donation, 245
ELISA-F29 test, 167
Chronic infections, 167
Ethical principles, 159
Infection in young, 245
S.Paulo, Br., 245
Muscarinic receptors, 31
Valsalva maneuver, 25
Chagasic infection, 245
Young, 245
S. Paulo, Br., 245
Coccidioides spp, 7
Culture collection, 7
Molecular authentication, 7
Crotalus, 295
Kidney injury, 295
Cryptococcus neoformans, 117, 371
Copper interference, 117
Pigeon excreta, 371
Cuiab, MG, Br., 371
Cryptosporidium, 149
HIV patients, 149
Cutaneous leishmaniasis, 197
Colombia, 197
Miltefosine, 197
Thermotherapy, 197
Cystoisospora belli, 149
HIV patients, 149
Cytomegalovirus 148
Neonatal patients, 148
Dengue, 275
Co-infection, 275
Serotypes 1 and 4, 275
Dermatophytes, 377
Soils, 377
Paraba State, Br., 377
Diptera:Psychodidae, 85
Minas Gerais State, Br., 85
DNA extraction methods, 205
Malaria, 205
DNA polymerases, 401
Direct PCR, 401
ELISA-F29 test, 167
Chagas disease, 167
Chronic infections, 167
Enteroparasites, 179
Quilombola community, 179
Eosinophilic meningitis, 129
Angyostrongylus cantonensis, 129
So Paulo, Br., 129
Ehrlichia spp, 335
Dogs, horses, humans, 335
Serological survey, 335
Entamoeba histolytica, 193
Occurrence, 193
Rondonia, Br., 193
Ethics in research, 159
Chagas disease, 159
Eumycetoma, 121
Scedosporium apiospermum, 121
Fascioliasis, 303
Active larvicides, 303
Free-living amoebae, 411
Chiang Mai ood, 411
Giardiasis, 185
Landless farm workers, 185
Araras, SP, Br., 185
Gp41, 91
HIV-1, 91
Hantavirus, 155
Rodents, 155
Uberlandia, MG, Br., 155
Hepatitis A, 433
Recyclable waste pickers, 433
Herpesvirus-2, 315
PCR, 315
Risk factors, 315
Histoplasmosis, 261,209,283
AIDS, 283
Septic shock, 283
HIV patients, 261
Northeastern Brazil, 261
Metastatic lesions, 209
Pulmonary nodules, 209
HIV/AIDS, 25, 267, 425, 429
Antiretroviral therapy, 267
Toxoplasmosis, 25
Visceral leishmaniasis, 425,429
HIV-1, 91
South Brazil, 91
HIV patients, 149, 261
Cryptosporidium, 149
Cystoisospora belli, 149
Histoplasmosis, 261
Northeastern Brazil, 261
Hookworm, 233
Eosinophilia, 233
Intestinal parasitism, 69,179,369
Hemodialysis patients, 69
Quilombola community, 179

Intestinal Protozoa, 19
Elderly, 19
kDNA-PCR, 393, 429
Amer.Tegum.Leishman., 393
Visceral leishmaniasis, 429
440
Klebsiella pneumonia, 144
Liver abscess, 144
Leishmania infection, 101
PCR, 101
Leishmania (V.) panamensis, 357
Hamsters, 357
Leishmaniasis, 85,239
Insect vectors, 85
Leprosy, 173
Mycobacterium leprae, 173
Prevention, diagnosis, 173
Lymnaea acuminata, 251, 303
Fascioliasis, 303
Momordica charantia, 251
Moringa oleifera, 251
Malaria, 205
Malassezia furfur, 218
Malignant tumors, 124
Staurosporine, 124
Measles virus, 292
Molecular epidemiology, 291
Micrurus, 13
Argentina, 13
Momordica charantia, 251
Molluscicidal, 251
Lymnaea acuminata, 251
Moringa oleifera, 251
Molluscicidal, 251
Lymnaea acuminata, 251
Nosocomial infections, 385
Candida albicans, 385
P16INK4A, 329
Methylation, 329
Papillomavirus, 329
Cervical cancer, 329
16INK4A, 329
PCR, 1,91,101,315,401
Bartonellosis, 1
DNA polymerases, 401
Herpesvirus-2, 315
HIV-1, 91
Leishmania infection, 101
Phlebotomines, 85, 239, 407
Argentina-Brazil-Paraguay, 239
Minas Gerais State, Br., 85
Rural locations, 407
Paran State, Br., 407
Phytotherapy, 303,421
Piperaceae, 421
Biomphalaria glabrata, 421
Snail control, 303
Plasmodium infection, 205
Rattus norvegicus, 51
Behavior, 51
Toxocara canis, 51
Toxoplasma gondii, 51
Renal alterations, 105
Renal histopathology, 113
Rotavirus, 137
Belo Horizonte, Br., 137
RT-PCR, 432
Respiratory viruses, 432

Saccharomyces boulardii, 363
Toxocara canis, 363
Saxophone penis, 290
Scedosporium apiospermum, 121
Voriconazole, 121
Schistosomiasis, 75, 213, 421
Lectin histochemistry, 213
Piperaceae, 421
Serological diagnosis, 75
Schistosomula antigens, 75
Scrub typhus, 293
Guangzhou, China, 293
Seafood safety, 219
Risk factors, 219
Serological diagnosis, 75
Schistosomula antigen, 75
Shigella exneri, 341
Hypoxia, 341
Smqnr variants, 417
Stenotrophomonas maltophilia, 417
Snakebite accidents, 347
Northeast Brazil, 347
Soil contamination, 229
Dogs parasites, 229
Sporothrix schenckii, 353
Enzymatic activity, 353
Stenotrophomonas maltophilia, 417
Smqnr variants, 417
Strongyloides stercoralis, 233,291,309
Agarplate culture, 291
Elderly, 309
Eosinophilia, 233
Strongyloides venezuelensis, 141
Molecular diagnosis, 141
Tinea nigra plantaris, 125
Antifungal agents, 125
Double-blind study, 125
Tinea verscolor, 218
T lymphocytes, 323
Reference values, 323
Toxocara canis, 51, 363
Larvicidal action, 363
Toxocariasis, 189
Children, 189
Paran, Br., 189
Toxoplasma gondii, 51,65,79,232
IgG, 232
IgG avidity, 79
Protease inhibitors, 65
Toxoplasmosis, 25
HIV/AIDS patients, 25
Travelers disease, 55, 216
Epidemiology, 55
Trypanosoma cruzi, 287
Dog, 287
Cuiab, Br., 287
Tuberculosis infection, 366
Varicella vaccination, 217
Violin strings adhesion, 435
Laparoscopy, 435
Visceral leishmaniasis, 101,105,113,425,429
Co-infection, 425
HIV-AIDS, 425
HIV co-infection, 429
kDNA PCR, 429
PCR, 101
Renal alterations, 105
Dogs, 105
Renal histopathology, 113
Dogs, 113

Western blot, 79
Toxoplasma gondii, 79
Yellow fever, 45
Non-human primates, 45
So Paulo State, Br., 45
REVISTA
DO
INSTITUTO DE MEDICINA TROPICAL
DE SO PAULO
VOLUME 55
2013
Rev. Inst. Med. Trop. Sao Paulo, vol. 55 n. 1-6 p. 1-440 January-December, 2013
II
CONTENTS OF VOLUME 55
No. 1 - January/February, 2013
MICROBIOLOGY
Detection of Bartonella henselae DNA in clinical samples including peripheral blood of immune competent and immune compromised
patients by three nested amplications - K.H. KAWASATO, L.C. OLIVEIRA, P.E.N.F. VELHO, L. YAMAMOTO,
G.M.B. DEL NEGRO & T.S. OKAY ..................................................................................................................................................................................1
MYCOLOGY
Viability and molecular authentication of Coccidioides spp. isolates from the Instituto de Medicina Tropical de So Paulo culture collection,
Brazil - S.D.B. CAVALCANTI, M.S.M. VIDAL, M.G.T. SOUSA

& G.M.B. DEL NEGRO ...........................................................................................7
ANIMAL ENVENOMATION
Envenoming by coral snakes (Micrurus) in Argentina, during the period between 1979-2003 - A.R. de ROODT, E. DE TITTO,
J.A. DOLAB & J.-P. CHIPPAUX .....................................................................................................................................................................................13
EPIDEMIOLOGY
Prevalence and risk factors for intestinal protozoa infection in elderly residents at Long Term Residency Institutions in Southeastern Brazil -
K.G. GIROTTO, D.F. GRAMA, M.J.R. CUNHA, E.S.M. FARIA, J.E. LIMONGI, R.M.C. PINTO & M.C. CURY ....................................................19
TOXOPLASMOSIS
Evaluation of seroepidemiological toxoplasmosis in HIV/AIDS patients in the south of Brazil - G.A. XAVIER, B.G. CADEMARTORI,
N.A. CUNHA FILHO & N.A.R. FARIAS........................................................................................................................................................................25
CHAGAS DISEASE
Muscarinic antibodies and heart rate responses to dynamic exercise and to the Valsalva maneuver in chronic chagasic patients -
B.C. DAS NEVES, M.L. BACILIO, L. BERRUETA, S. SALMEN, D.L. PETERSON, J.H. DONIS, T.J. NUEZ & D.F. DAVILA ..........................31
SCHISTOSOMIASIS
Breeding of Biomphalaria tenagophila in mass scale - F.M. ROSA, D.P.A. MARQUES, E. MACIEL, J.M. COUTO,
D.A. NEGRO-CORRA, H.M.S. TELES, J.B. SANTOS & P.M.Z. COELHO ............................................................................................................39
YELLOW FEVER
Yellow fever epizootics in non-human primates, So Paulo State, Brazil, 2008-2009 - E.S. MORENO, R. SPINOLA, C.H. TENGAN,
R.A. BRASIL, M.M. SICILIANO,

T.L.M. COIMBRA, V.R. SILVEIRA, I.M. ROCCO, I. BISORDI, R.P. SOUZA, S. PETRELLA,
L.E. PEREIRA, A.Y. MAEDA, F.G. SILVA & A. SUZUKI .............................................................................................................................................45
BRIEF COMMUNICATION
Behavioral changes in Rattus norvegicus coinfected by Toxocara canis and Toxoplasma gondii - M.L. QUEIROZ, T.A. VIEL, C.H.G. PAPA,
S.A.Z. LESCANO & P.P. CHIEFFI ..................................................................................................................................................................................51
PRELIMINARY REPORT
Health problems awareness during travel among faculty members of a large university in Latin America. Preliminary report - A.C.N. TOME,
T.B. CANELLO, E.J.A. LUNA & H.F. ANDRADE JUNIOR .........................................................................................................................................55
CASE REPORT
RRH: envenoming syndrome due to 200 stings from Africanized honeybees - G.A.R. SILVA, K.L. PIRES, D.C.S. SOARES,
M.R. FERREIRA, F.R.A. FERRY, R.N. MOTTA & M.C.V.M. AZEVEDO ...................................................................................................................61
TECHNICAL REPORT
Antiretroviral activity of protease inhibitors against Toxoplasma gondii - L. MONZOTE, M. RODRGUEZ, Y. ALFONSO & R. COX .....................65
Analogies in medicine: Gimlet in Chagas disease - J.S. ANDRADE FILHO ..................................................................................................................68
No. 2 - March/April, 2013
PARASITOLOGY
Prevalence of intestinal parasitism and associated symptomatology among hemodialysis patients - F.F. GIL, M.J. BARROS, N.A. MACEDO,
C.G.E. JNIOR, R. REDOAN, H. BUSATTI, M.A. GOMES & J.F.G. SANTOS ..........................................................................................................69
SCHISTOSOMIASIS
The schistosomula tegument antigen as a potential candidate for the early serological diagnosis of schistosomiasis mansoni - R. GRENFELL,
W. MARTINS, V. SILVA-MORAES, N. ARAUJO, E. OLIVEIRA, C. FONSECA & P.M.Z. COELHO. ......................................................................75
TOXOPLASMOSIS
IgG avidity Western blot using Toxoplasma gondii rGRA-7 cloned from nucleotides 39-711 for serodiagnosis of acute toxoplasmosis -
P.S. DESHPANDE, D. KOTRESHA, R. NOORDIN, M.H. YUNUS, G. SAADATNIA, M. GOLKAR, S. OSMAN, I.Z.A. KARIM &
F. GHAFFARIFAR ............................................................................................................................................................................................................79
III
EPIDEMIOLOGY
Survey of sandy fauna (Diptera: Psychodidae) in Uberlndia, Minas Gerais State, Brazil, 2003 - 2004 - M.B.C. PAULA, A.A. SOUZA,
A.A. REIS, J.E. LIMONGI, A.A. PAJUABA NETO & E.A.S. RODRIGUES ................................................................................................................85
HIV
Testing a subtype-specic gp41 amplication method for genotyping individuals infected by human immunodeciency virus type-1 in the
Brazilian population of Itaja, South Brazil - L.B. ARRUDA, L.I.WEBER, M. SANTOS, E.M. KAWAKUBO & A.M.B. MARTNEZ .....................91
LEISHMANIASIS
Use of polymerase chain reaction for the diagnosis of asymptomatic Leishmania infection in a visceral leishmaniasis-endemic area -
L.A. SILVA, H.D. ROMERO, A. FAGUNDES, N. NEHME, O. FERNANDES, V. RODRIGUES, R.T. COSTA & A. PRATA ..................................101
The serum-conversion and evaluation of renal alterations in dogs infected by Leishmania (Infantum) chagasi - G.B.B. ALVES,
L.S. SILVA, J.F. BATISTA, A.P. CAMPOS, M.G. PRIANTI & F.A.L. COSTA ............................................................................................................105
Renal histopathological ndings in dogs with visceral leishmaniasis - R.S. RIGO, C.M.E. CARVALHO, M.R. HONER, G.B. ANDRADE,
I.S. SILVA, L. RIGO, H.R. FIGUEIREDO & W.T.G. BARRETO .................................................................................................................................113
MYCOLOGY
The copper interference with the melanogenesis of Cryptococcus neoformans - R.M. MAUCH, V.O. CUNHA & A.L.T. DIAS ................................117
CASE REPORT
Scedosporium apiospermum eumycetoma successfully treated with oral voriconazole: report of a case and review of the Brazilian reports
on scedosporiosis - F.M. OLIVEIRA, G. UNIS, B. HOCHHEGGER & L.C.SEVERO ................................................................................................121
Double-blind study with topical Isoconazole and Terbinane for the treatment of one patient with bilateral Tinea nigra plantaris, and
suggestions for new differential diagnosis - A.L. ROSSETTO, R.C.B. CRUZ & V. HADDAD JUNIOR.....................................................................125
First case of Angiostrongylus cantonensis eosinophilic meningitis diagnosed in the city of So Paulo, Brazil - M.C.C. ESPRITO-SANTO,
P.L.S. PINTO, D.J.G. MOTA & R.C.B. GRYSCHEK ....................................................................................................................................................129
BRIEF COMMUNICATION
Experimental infection of Swiss and AKR/J mice with Centrocestus formosanus (Trematoda: Heterophyidae) - V.L.T. MATI, H.A. PINTO &
A.L.MELO ......................................................................................................................................................................................................................133
Shift in human rotavirus distribution in Belo Horizonte, Brazil detected by ribonucleic acid electrophoresis - M.S.A.C. SILVA, F.J. PENNA,
R.J. DUARTE, P.A.R. PEREIRA, A.E. CURSINO, L.A. PRET-FILHO, E.N. MENDES & P.P. MAGALHES .....................................................137
Parasitological and molecular diagnosis in experimental Strongyloides venezuelensis infection - F.M. PAULA, R.B. SITTA, F.M. MALTA,
M. GOTTARDI, M.A.CORRAL, R.C.B. GRYSCHEK & P.P. CHIEFFI .......................................................................................................................141
Staurosporine and its evolving role in inhibition of growth in malignant tumors S. KAPOOR ..................................................................................124
Fatal gas-forming pyogenic liver abscess due to Klebsiella pneumoniae - Y. ZHANG, G.-Q. ZANG, Z.-H. TANG & Y.S. YU ..................................144
No. 3 - May/June, 2013
ACKNOWLEDGEMENT TO REVIEWRS ...................................................................................................................................................................... V
MYCOLOGY
Variability in Galactomannan detection by platelia Aspergillus EIA
TM
according to the Aspergillus species - M.O. XAVIER,
J.S.V. ARAUJO, V.R. AQUINO, C.B. SEVERO, L.S. GUAZZELLI, L.C. SEVERO & A.C. PASQUALOTTO .........................................................145
HIV
Prevalence and genetic characterization of Cryptosporidium spp. and Cystoisospora belli in HIV-infected patients - D.C. ASSIS,
D.V. RESENDE, M. CABRINE-SANTOS, D. CORREIA & M.B. OLIVEIRA-SILVA ...............................................................................................149
VIROLOGY
Serological survey of hantavirus in rodents in Uberlandia, Minas Gerais, Brazil - J.E. LIMONGI, F.G. MOREIRA, J.B. PERES, A. SUZUKI,
I.B. FERREIRA, R.P. SOUZA, R.M.C. PINTO & L.E. PEREIRA ...............................................................................................................................155
ETHICS
Do Brazilian scientic journals promote the adherence of Chagas disease researchers to international ethical principles? - G. MALAFAIA,
D. GUILHEM & A. TALVANI .......................................................................................................................................................................................159
CHAGAS DISEASE
Evaluation of the Elisa-F29 test as an early marker of therapeutic efcacy in adults with chronic Chagas disease - D. FABBRO,
E. VELAZQUEZ, M.L. BIZAI, S. DENNER, V. OLIVERA, E. ARIAS, C. PRAVIA & A.M. RUIZ ..........................................................................167
LEPROSY
Active search for leprosy cases in Midwestern Brazil: a serological evaluation of asymptomatic household contacts before and after prophylaxis
with Bacillus Calmette-Gurin - O.M. LIMEIRA, C.M. GOMES, O.O. MORAIS, M.V. CESETTI & R.R.A. ALVAREZ .........................................173
IV
PARASITOLOGY
Intestinal parasites in a quilombola community of the Northern State of Esprito Santo, Brazil - S.M. DAMAZIO, M.S. LIMA,
A.R. SOARES & M.A.A. SOUZA .................................................................................................................................................................................179
High occurrence of giardiasis in children living on a landless farm workers settlement in Araras, So Paulo, Brazil - O.A. LIMA Jr.,
J. KAISER & R. CATISTI ..............................................................................................................................................................................................185
Toxocariasis in children attending a Public Health Service Pneumology Unit in Paran State, Brazil - E.V. GUILHERME, A.A. MARCHIORO,
S.M. ARAUJO, D.L.M. FALAVIGNA, C. ADAMI, G. FALAVIGNA-GUILHERME, G. RUBINSKY-ELEFANT &
A.L. FALAVIGNA-GUILHERME .................................................................................................................................................................................189
High occurrence of Entamoeba histolytica in the municipalities of Ariquemes and Monte Negro, State of Rondnia, Western Amazonia, Brazil -
R.V. SANTOS, J.S. NUNES, J.A.S.A. CAMARGO, E.M.M. ROCHA, G. FONTES & L.M.A. CAMARGO ............................................................193
LEISHMANIASIS
Thermotherapy effective and safer than miltefosine in the treatment of cutaneous leishmaniasis in Colombia - L. LPEZ, C. CRUZ,
G. GODOY, S.M. ROBLEDO & I.D. VLEZ ................................................................................................................................................................197
TECHNICAL REPORT
Evaluation of three different DNA extraction methods from blood samples collected in dried lter paper in Plasmodium subpatent infections
from the Amazon region in Brazil - R.B. MIGUEL, J.R. COURA, F. SAMUDIO & M.C. SUREZ-MUTIS ............................................................205
CASE REPORT
Histoplasmosis presenting with multiple pulmonary nodules. A case mimicking radiological features of pulmonary metastasis -
A.G. DAL BELLO, C.B. SEVERO, F.M. OLIVEIRA, R.J. HALLAL JUNIOR, B. HOCHHERGGER & L.C. SEVERO .........................................209
BRIEF COMMUNICATION
Evaluation of WGA and Concanavalin A (Con A) lectin as biomarkers of hepatosplenic schistosomiasis in human biopsies with no evidence
of egg-granuloma system - M.J.B.M. RGO, G.S. VIEIRA-DE-MELLO, C.W. ARAJO, M.S.M. CAVALCANTI & E.I.C. BELTRO ................213
Health problems awareness during travel among faculty members - V. WIWANITKIT ................................................................................................216
Varicella emergency vaccination seemed instrumental in declining chickenpox incidence in Guangzhou, southern China - L. TIEGANG ................217
Analogies in medicine: spaghetti and meatballs - J. S. ANDRADE FILHO ..................................................................................................................218
SUMMARY OF THESIS
Cytomegalovirus infection in neonatal patients in units of Campo Grande, MS, Brazil - P.C.N. XAVIER ...................................................................148
No. 4 - July/August, 2013
REVIEW
Bacteriological hazards and risks associated with seafood consumption in Brazil - C.A.M.L. SANTOS & R.H.S.F. VIEIRA ....................................219
PARASITOLOGY
Soil contamination in public squares in Belo Horizonte, Minas Gerais, by canine parasites in different developmental stages -
L.M. RIBEIRO, R.M. DRACZ, L.R. MOZZER & W.S. LIMA .....................................................................................................................................229
Hookworm and threadworm infections and their association with hemoglobin and eosinophil concentrations in residents of
Salvador-Bahia, Brazil - F.L.N. SANTOS, A.M.G.C. SOUZA & N.M. SOARES ........................................................................................................233
PHLEBOTOMUS
Spatial distribution of Phlebotominae in Puerto Iguaz-Misiones, Argentina-Brazil-Paraguay border area - M.S. SANTINI,
I.T. GOULD, M.M. ACOSTA, P. BERROZPE, S.A. ACARDI, M.S. FERNNDEZ, A. GMEZ

& O.D. SALOMON .............................................239
CHAGAS DISEASE
Seroprevalence of chagasic infection in young individuals in a blood center in the state of So Paulo, Brazil - E.C. NAVARRO,
R.L. GOTO, I.S. RICOBONI, J.E. CORRENTE, R.M.S. HENRIQUES, S.L. NEVES, J.M. ZANINI, A.A. DORINI & P.C.M. PEREIRA ..............245
MOLLUSCICIDES
Characterization of molluscicidal component of Moringa oleifera leaf and Momordica charantia fruits and their modes of action in
snail Lymnaea acuminata - A. UPADHYAY, V.K. SINGH & D.K. SINGH...................................................................................................................251
HIV/AIDS
Histoplasmin survey in HIV-positive patients: results from an endemic area in Northeastern Brazil - F.S. BEZERRA,
R.M. ZANCOP-OLIVEIRA, R.S.N. BRILHANTE, B. WANKE, R.M.S. MOTA, A.P.G. RAMOS, A.N. RAMOS Jr.,
M.C. FAANHA & T.M.J.S. LEITO ...........................................................................................................................................................................261
Evolution of patients with AIDS after cART. Clinical and laboratory evolution of patients with AIDS after 48 weeks of antiretroviral
treatment - A.E.C.G. FUKUMOTO, C.C. OLIVEIRA, K.I. TASCA & L.R. SOUZA ...................................................................................................267
V
CASE REPORTS
Co-infection of dengue virus by serotypes 1 and 4 in patient from medium sized city from Brazil - T.E. COLOMBO, D. VEDOVELLO,
A. MONDINI, A.F.N. REIS, A.A.F. CURY, F.H. OLIVEIRA, L.E.A.A. CRUZ, R.V.M. BRONZONI & M.L. NOGUEIRA .....................................275
Septic shock in patient with disseminated histoplasmosis associated with AIDS: a case report - F.O. POSWAR, J.A. CARNEIRO,
J.M. STUART, J.P.O. FELICIANO & D.C. NASSAU ...................................................................................................................................................283
Natural infection by Trypanosoma cruzi in one dog in Central Western Brazil: a case report - A.B.P.F. ALMEIDA, D.A.J. PAULA,
M.L.P. OTTON, F.W. JAUNE, R.A.S. CRUZ, M.F. MADEIRA, L. NAKAZATO,

A.J. MENDONA, C.A. PESCADOR & V.R.F. SOUSA ...........287
Analogies in medicine: saxophone penis - J.S. ANDRADE-FILHO ..............................................................................................................................290
Is the agar plate culture a good tool for the diagnosis of Strongyloides stercoralis in candidates for transplantation? - F.M. PAULA,
M. GOTTARDI, M.A. CORRAL, P.P. CHIEFFI & R.C.B. GRYSCHEK ......................................................................................................................291
Molecular epidemiology of a measles virus in Sao Paulo, Brazil: an imported case - M.I. OLIVEIRA, C.A. FIGUEIREDO,
A.M.S. AFONSO, M.M. SIQUEIRA, X.R.M.R. LEMOS, A.L.F. YU & S.P. CURTI ...................................................................................................292
Scrub typhus rapidly increased in Guangzhou, Southern China, 2007-2012 - T. LI, Z. YANG & M. WANG ...............................................................293
SUMMARY OF THESIS
Research of IgG anti-Toxoplasma gondii in exudate meat juice for monitoring the cattle beef quality - M.A.M. MARCIANO ..................................232
No. 5 - September/October, 2013
REVIEW
Acute kidney injury caused by Crotalus and Bothrops snake venom. A review of epidemiology, clinical manifestations and treatment -
P.L.M.M. ALBUQUERQUE, C.N. JACINTO, G.B. SILVA JUNIOR, J.B. LIMA, M.S.B. VERAS & E.F. DAHER ...................................................295
PARASITOLOGY
In vitro phytotherapy of vector snails by binary combinations of larvicidal active components in effective control of fascioliasis - K. SUNITA,
P. KUMAR, V.K. SINGH & D.K. SINGH ......................................................................................................................................................................303
High prevalence of Strongyloides stercoralis infection among the elderly in Brazil - M.M. NAVES & J.M. COSTA-CRUZ ......................................309
VIROLOGY
Prevalence of herpes simplex virus type 2 and risk factors associated with this infection in women in Southern Brazil - T.D.M. CALDEIRA,
C.V. GONALVES, G.R. OLIVEIRA, T.V. FONSECA, R. GONALVES, C.T. AMARAL, V.P. HORA & A.M.B. MARTINEZ ............................315
IMMUNOLOGY
Establishing the reference range for T lymphocytes subpopulations in adults and children from Brazil - A.J.L. TORRES, A.L.D. ANGELO,
M.O. SILVA, M.C. BASTOS, D.F. SOUZA, L.A. INOCNCIO, J.A.R. LEMOS, R.S. JUNIOR, A.C. CASTRO, P.V.B. PALMA, L. CECI,
E.M. NETTO & C. BRITES ...........................................................................................................................................................................................323
HPV
An upward trend in DNA P16INK4A methylation pattern and high risk HPV infection according to the severity of the cervical lesion -
F.N. CARESTIATO, L.A. AFONSO, N. MOYSS, G.L. ALMEIDA FILHO, L.G.C. VELARDE & S.M.B. CAVALCANTI....................................329
MICROBIOLOGY
Serological survey of Ehrlichia species in dogs, horses, and humans: zoonotic scenery in a rural settlement from southern Brazil -
R.F.C. VIEIRA, T.S.W.J. VIEIRA, D.A.G. NASCIMENTO, T.F. MARTINS, F.S. KRAWCZAK, M.B. LABRUNA, R. CHANDRASHEKAR,
M. MARCONDES, A.W. BIONDO & O. VIDOTTO ....................................................................................................................................................335
Hypoxic stress, hepatocytes and Caco-2 viability and susceptibility to Shigella exneri invasion - C.B.C. LIMA,

S.A. SANTOS

&
D.R. ANDRADE JNIOR ..............................................................................................................................................................................................341
ANIMAL ENVENOMATION
Epidemiological prole of snakebite accidents in a metropolitan area of Northeast Brazil - P.L.M.M. ALBUQUERQUE, G.B. SILVA JUNIOR,
C.N. JACINTO, C.B. LIMA, J.B. LIMA, M.S.B. VERAS & E.F. DAHER ...................................................................................................................347
MYCOLOGY
Application of 6-nitrocoumarin as a substrate for the uorescent detection of nitroreductase activity in Sporothrix schenckii -
C.D.O. STOPIGLIA, M. CARISSIMI, T.C. DABOIT, V. STEFANI, V.A. CORBELLINI & M.L. SCROFERNEKER ..............................................353
LEISHMANIASIS
Body weight as a determinant of clinical evolution in hamsters (Mesocricetus auratus) infected with Leishmania (Viannia) panamensis -
A.M. GMEZ-GALINDO & L.G. DELGADO-MURCIA ...........................................................................................................................................357
BRIEF COMMUNICATION
Protective effect of the probiotic Saccharomyces boulardii in Toxocara canis infection is not due to direct action on the larvae - L.F.C. AVILA,
P.L. TELMO, L.H.R. MARTINS, T.A. GLAESER, F.R. CONCEIO, F.P.L. LEITE & C.J. SCAINI .......................................................................363
VI
Males, ages 45 years, businessperson, oating population, and rural residents may be considered high-risk groups for tuberculosis
infection in Guangzhou, China: a review of 136,394 TB conrmed cases - X. LI, T. LI & S. TAN ..............................................................................366
CORRESPONDENCE .............................................................................................................................................................................................369
No. 6 - November/December, 2013
MYCOLOGY
First report on Cryptococcus neoformans in pigeon excreta from public and residential locations in the metropolitan area of Cuiab,
State of Mato Grosso, Brazil - D.T. TAKAHARA, M.S. LAZRA, B. WANKE, L. TRILLES, V. DUTRA, D.A.J. PAULA, L. NAKAZATO,
M.C. ANZAI, D.P. LEITE JNIOR, C.R. PAULA & R.C. HAHN ...............................................................................................................................371
Distribution of dermatophytes from soils of urban and rural areas of cities of Paraiba State, Brazil - Z.B.V.S. PONTES, A.C. OLIVEIRA,
Molecular typing of Candida albicans isolates from hospitalized patients - P.S. BONFIM-MENDONA, A. FIORINI,
LEISHMANIASIS
Applicability of kDNA-PCR for routine diagnosis of American tegumentary leishmaniasis in a tertiary reference hospital -
M.M. SATOW, E.H. YAMASHIRO-KANASHIRO, M.C. ROCHA, L.K. OYAFUSO, R.C. SOLER, P.C. COTRIM & J.A.L. LINDOSO ................393
PCR
Comparison of six commercially-available DNA polymerases for direct PCR - M. MIURA, C. TANIGAWA, Y. FUJII & S. KANEKO ...................401
PHLEBOTOMINES
Phlebotomine sandies in rural locations in the state of Parana, Southern Brazil - S.C.C.S. MELO, W. CELLA, R. MASSAFERA,
N.M.M.G. SILVA, R. MARQUI, M.D.B. CARVALHO & U. TEODORO ....................................................................................................................407
PARASITOLOGY
Potentially pathogenic free-living amoebae in some ood-affected areas during 2011 Chiang Mai ood - A. WANNASAN,
MICROBIOLOGY
Smqnr variants in clinical isolates of Stenotrophomonas maltophilia in Brazil - J.I. GRACIA-PAEZ, J.R. FERRAZ,
BRIEF COMMUNICATION
Ovicidal effect of Piperaceae species on Biomphalaria glabrata, Schistosoma mansoni host - L.N. RAPADO,

P.O.M. LOPES,
L.F. YAMAGUCHI

& E. NAKANO ...............................................................................................................................................................................421
CASE REPORT
Case study of a patient with HIV-AIDS and visceral leishmaniasis co-infection in multiple episodes - E.D. SILVA, L.D. ANDRADE,
Usefulness of kDNA PCR in the diagnosis of visceral leishmaniasis reactivation in co-infected patients - A.C. NICODEMO, V.S. AMATO,
F.F. TUON, R.M. SOUZA, T.S. OKAY & L.M.A. BRAZ .............................................................................................................................................429
D. ERDMAN & T.M. PAIVA..........................................................................................................................................................................................432
AUTHOR INDEX ......................................................................................................................................................................................................437
SUBJECT INDEX .....................................................................................................................................................................................................439

Dionisio, E Et Al 2013., REv Inst Med Trop SP PDF

Uploaded by

Copyright:

Available Formats

You might also like

Dionisio, E Et Al 2013., REv Inst Med Trop SP PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Dionisio, E Et Al 2013., REv Inst Med Trop SP PDF

Uploaded by

Copyright:

Available Formats

I

medium with chloramphenicol (0.05 mg mL

Candida and identified by

software version 4.6

). After the run, the gel was

0.5 units 2 units

), 1.25 units of i-Taq

) and 0.2 mM of each dNTP (Applied Biosystems). The

C incubation in all ood water samples.

C. This was unexpected as the previous

is the most important

) on Melanoides tuberculata (Thiaridae), a snail

You might also like