Professional Documents
Culture Documents
Sobrevia & Gonzalez 2009
Sobrevia & Gonzalez 2009
tion in Hyperglycaemia
I Cellular and Molecular Physiology LaboratOl:r (CI"fPL) and Perinatology Research LaboratOlY (PRL), Department
of
Obstetrics and Gynaecology, Medical Research Centre (Cn1), School of Medicine, Faculty of Medicine, Pontificia Universidad Catolica de Chile, P.O. Box 114-D, Santiago, Chile; 1Department of Physiology, Faculty of Biological Sciences, Universidad de Concepcion, Chile
Abstract: Endothelial cells are key in the regulation of vascular tone through the release of vasoactive molecules, including nitric oxide (NO). NO is a gas synthesized from the cationic amino acid L-arginine via the endothelial NO synthase
(eNOS). The semi-essential amino acid L-arginine is a taken up by endothelial cells via systems y+ and y+L in primary
cultures of human umbilical vein endothelial cells (HUVEC). System y+is a family of membrane transporters including at
least five transport systems for cationic amino acids (CAT) of which HUVEC express human CAT-I (hCAT-I) and
hCAT-2B. Exposure of HUVEC to high extracellular concentrations of D-glucose increases L-arginine transport, hCAT-l
mRNA expression and eNOS activity. These phenomena are also related with increased production of reactive oxygen
species (ROS), thus supporting the possibility that changes in L-argininelNO signalling pathway result from elevated
ROS. It has been shown that insulin blocks D-glucose-increased L-arginine transport and cGMP accumulation in
HUVEC, whereas in this cell type insulin also modulates high D-glucose effects by activating the transcriptional factors
Spl and NFKB.These transcription factors have response elements in SLC7A] (for hCAT-I) gene promoter region, thus
representing 2 possible targets for regulation of the expression of this transporter by D-glucose and/or insulin in this cell
type. Recent evidences suggest that insulin blocks the stimulatory effect of D-gJucose on L-arginine transport by reducing
the transcriptional activity of SLC7A] via Spl-, NFKB-and ROS-dependent mechanisms. Thus, a role for these transcription factors in response to insulin is proposed in fetal endothelial cells exposed to hyperglycaemia.
Keywords: Glucose, hyperglycaemia,
in pathological conditions such as intrauterine growth restriction (IUGR) [11], diabetes mellitus [9,12] or atherosclerosis
[13 ].
The signalling mechanisms involved in NO synthesis
have been studied in several cell types including human umbilical vein endothelial cells (HUVEC). The gas NO is synthesized from the cationic, semi-essential amino acid Larginine in a metabolic reaction leading to equimolar formation of L-citrulline and NO [6, 14]. This reaction requires the
activity of endothelial NO synthases (NOS), a group of enzymes conformed by at least three isoforms i.e. neuronal
NOS (nNOS or Type I), inducible NOS (iNOS or type II)
and endothelial NOS (eNOS or Type III) [15]. In fact, there
is evidence that NOS activity may depend on the ability of
endothelial cells to take up its specific substrate L-arginine
via a variety of membrane transport systems [6, 10, 11, 1416]. L-Arginine is taken up by endothelial cells via membrane transport systems grouped as systems l, y+L, bO,+and
BO.+[6, 16-18]. It is well known that system y+ conforms a
family of proteins known as cationic amino acid transporters
(CATs) family (hereafter referred as 'CATs family'), conformed by CAT-I, CAT-2A, CAT-2B, CAT-3 and CAT-4
[17, 19]. CAT-l is ubiquitously expressed, while CAT-2A
and CAT -3 are constitutively expressed in liver and brain,
respectively, and CAT-2B is induced in a variety of cell
types in response to bacterial endotoxins and proinflammatory cytokines [6,17, 19-21]. CAT-4 derives from
r..-:;.
a sequence of cDNA that is 41-42% identical to other members of CATs family, but no transport activity has been yet
described [6,17]. CAT-I, CAT-2B and CAT-3 are functionally characterized as high affinity (Km ~100-400 f.lM), Na+..
independent transporters, while CAT-2A has a relatively low
affinity for cationic amino acids (Km ~2-5 mM). Interestingly, only 2 members of the CATs family have been functionally characterized in primary cultures of HUVEC i.e.
human CAT-l (hCAT-l) and hCAT-2B, while hCAT-2A
seems not to be expressed in this cell type [6, 10, 11, 17, 18].
In addition, hCAT-l protein and mRNA, and only hCAT-2B
mRNA have been detected in this cell type [17].
described
Th -.. ~. now suggested that SLC7Ai could
be formed by I xo -. \yhere transcription start site (ATG)
is located in exon -_ [_ ]. \- e have recently cloned a fragment of -6"0'
u ~
the ATG of SLC7 Ai in primary
cultures of HC\"EC and detected that this fragment of the
potential promo er of SCL Al contains several consensus
sequences for transcription factors that may be critical for the
regulation of its expression by insulin and/or D-glucose [23,
24] (Fig. 1).
Phylogenetically, the SLC7 ('solute carrier') family consists of 2 subfamilies formed by CATs and the amino acid
transporters associated to glycoproteins (HATs, heterodimeric amino acid transporters). CATs family members are
encoded by genes SLC7Ai, 2, 3 and 4, whose protein products contain 14 transmembrane domains [19]. Specifically,
the gene encoding hCAT -1 protein i.e. SLC7 Ai (located on
chromosome 13q 12-q 14), consists of an open reading frame
with 11 exons and 10 introns. However, towards the 5'-end
two additional untranslatable exons (-2 and -1) have been
L-Arginine Transport
-650
-581
-512
-443
-374
-305
-236
-167
-98
ON ENDOTHE-
Incubation of HUVEC primary cultures in an euglycaemic culture medium (i.e. containing -5 mM D-glucose) with
physiological resting concentrations of insulin (-0.1 nM)
increased the maximal transport velocity (Vmax) without significant changes in the apparent Km for L-arginine transport
[23]. This phenomenon was seen as a higher maximal transport capacity (i.e. ~naJKm) [17, 20, 25, 26] of the involved
membrane transporters for cationic amino acids [23]. The
--.
GTTAAGGTGAACTGCGCTCCAGCCTGGGCAATAGAGTAACACCCTGTCTCTAAAATGAAAAGAAAACAG
TTTAAACCTTTTAAGTGCATACCAAATCTTTTATTTTGGAGAAGGAAAACTGGTCTCGAGTTCCGTGTG
P53
AGCTCCCTGGGGCCCGCCGGGAGGGGGTTGGCACGGCCGGACCTGCAGCACTAGTTCTGGCCAGGGCGC
TGTGGGATCTGCAGGGGACCACAGGATGCTGTGGCGCGGTGCGCTCAGATTGGCGGAGAAACGGCCACA
EGR-1
NFKB (p50)
CGCCTACGGAGCTACTGAGAAGGCGAGCGGAGGCGCAGCCCGCCCGCCCGCCGCGGGAACCCCAGGTTG
GGGCGCTGGGCGCGCGAAGACTCAGCCGCCCCGCCCACCAAGGGCGCGTCGGTCCCCGGCCGCAGCCTC
CREB
Sp1
TGGGCTGGCAGCCGCCGCCGCGCCGCGCTCCCATTGGTGCCCGGCGGTGACGCGGCCGAGCGGGCCGGG
Sp1
Sp1
Sp1
GCTGCCTGGTCCGGGGGCGGGCGTGGGGCGCGGGGCGCGGAGCGCGAGGGGCGGGGGCCGGGCGCACTG
Elk-1
CTGATGAAACCTGGCGCCGGAACCCGCCAGCCCTCGGCGCCCATTCAGTCCGCGCAGGCAGGTGTGAGC
+109
GAGCGCGTCCGACAGTCTGTCTGTTCGCGATCCTGCCGGAGCCCCGCCGCCGCCGGCTTG
Fig. (1). Scheme of the -650 bp region from proposed transcription start site at SLC7 AI. The sequence of the region -650 bp from the
proposed transcription start site (*) of the potential promoter of the gene SLC7 A I (for human cationic amino acid transporter 1, hCAT-1) that
has been cloned is shown. Proposed first exon of the transcript extends between -650 to + 142 bp. The location of primers used to amplifYthi
region of the promoter is indicated by the arrows and corresponded to: sense ACG CGT TAA GGT GAA CTG CGC TCC, antisense CCA
TGG ATC GCG AAC AGA CAG ACT. Underlined are binding sites for transcription factors such as stimulatory protein 1 (Spl), nuclear
factor kappa B (NFKB), p53 tumor repressor factor, early growth response factor 1 (EGR-l), cyclic AMP response element-binding (CREB)
and the transcription factor with ETS domain (Elk- J).
(NT
1
ONOO.
L-Arginine
hCAT-1
Spl
NF,B
protein
"
Insulin
! j~
-- .....
/..
ROS
heAT'
mRNA
Fig. (2). Proposed regulatory mechanisms of hCAT-I expression and activity by high D-glucose and insulin in HUVEC. Exposure of
HUVEC to an elevated extracellular level of D-glucose (High D-glucose) increases the intracellular level of reactive oxygen species (ROS)
likely derived from NAD(P)H oxidase. ROS formation may stimulate via Sp I and NFkB transcription factors the SLC7 A I gene promoter
activity leading to increased hCAT-1 mRNA expression and protein abundance. These events result in an increased L-arginine transport via
heAT-I and nitric oxide (NO) and L-citrulline synthesis via the endothelial NO synthase (eNOS). The NO could rapidly react with ROS to
fonn peroxynitrite (ONOO) contributing to endothelial dysfunction. Insulin is proposed to protect the endothelial cell by blocking the effect
of D-glucose on the generation of intracellular ROS, reducing the effect of these molecules on SLC7Al expression and L-arginine transport.
Insulin under hyperglycaemia could also act as a repressor of D-glucose activated ROS generation protecting the endothelial cells from this
abnormal environment.
reported magnitude of the insulin stimulatory effect on Larginine transport (~5 fold) was comparable to the trans-rimulatory effect of L-lysine on L-arginine transport measured under zero-trans conditions for L-lysine in this cell type
[II, 23] (see Fig. (2. These results are complemented and
supported by parallel studies showing that insulin increased
dle hCAT-I mRNA number of copies [23] and protein abunance (Gonzalez M, Sobrevia L, unpublished data). These
-rudies suggest that insulin-induced L-arginine transport is
most likely due to increased expression and activity of
, CAT-! membrane transporters in HUVEC. In addition,
:l1Sulineffect on L-arginine transport was proposed as a phe:lOmenon resulting from a sequential activation of cell sig:1alling molecules, including phosphatidylinositol 3 kinase
PI3k), protein kinase C (PKC), NOS and mitogen-activated
rotein kinases p42 and p44 (p42/44mapk), which are known
to be involved also in the modulation of several other memrane transport systems in mammalian cells [6, 17].
ported that longer incubation periods (24 h) with high concentrations of extracellular D-glucose (~25 mM) increases
the ~nax of the L-arginine transport, an effect blocked by
inhibition of protein synthesis or when cells are preincubated with 1 nM insulin for 8 h [16]. The increase of Larginine transport induced by chronic incubation with Dglucose was also associated with increased hCAT-l mRNA
level and L_[3H] citrulline synthesis from L-eH] arginine
[24]. In preliminary assays, we have been able to detect a
potential effect of D-glucose at a transcriptional level modulating hCAT-! expression, a phenomenon that is also
blocked by insulin (Gonzalez M, Sobrevia L, unpublished
data). Thus, it is feasible that insulin could be triggering signalling pathways that will potentially interfere with an increased SLC7 Ai transcriptional activity in response to a high
D-glucose environment.
eNOS Expression
and Activity
D-GLUCOSE
EFFECT
ON
ROS
ON Spl ACTI-
VITY
Within a region of ~4000 bp upstream from the transcription start site of SLC7 AI, multiple consensus sites of various
transcription factors have been identified by in silica analysis
of sequence. Within d1ese factors, it is possible to identify
consensus sites for Smad-4, NFKB and Spl, among others,
which are regulated by insulin or D-glucose. Within this region d1ere are at least four consensus sites for Spl close to
the transcription start site of SLC7 AI. These sites could play
key roles as regulators of the transcription of this gene since
it lacks of TAT A box [22]. Also, there are 2 consensus sites
for NFKB around -3200 and -600 bp region from the transcription start site, which are potentially regulated by ROS.
Since there is experimental evidence suggesting that Spl is
involved in gene-specific responses to a variety of cellular
signals independent of the interaction with other inducible
transcription factors, and since this transcription factor is
apparently involved in the regulation of membrane transporters expression, such as SLC29AI for the human equilibrative
nucleoside transporters type 1 (hENTl) in HUVEC [38], in
preliminary experiments we have studied a region of 650 bp
upstream of the transcription start site in SLC7AI [39]. Spl
is activated by phosphorylation of serine and threonine residues, a phenomenon altered in response to various stimuli
that activate different signalling pathways. The amino acid
sequence of Spl contains consensus phosphorylation sites
for numerous protein kinases, including calmodulin kinases
(CamKs), casein kinases (CK) 1 and 2, protein kinase A
(PKA), PKC, and p42/44mapk [40]. Interestingly, it has been
reported that increase in the transcriptional activity of plasminogen activator inhibitor-l (PAl-I) induced by insulin
(100 nM, 16 hours) in HepG2 cells transfected with PAI-l
promoter, involves activity of PI3k, PKC and p42/44map\
among other signalling molecules [41]. In PAI-I gene at
least three consensus sites for transcription factors induced
by insulin has been identified, all of which co-localize with
putative consensus sites for SpI [41]. Thus, a potential role
for Sp 1 as modulator of PAl -1 gene expression is suggested.
In addition, in the same cell type, D-glucose incubation (~23
mM, 24 and 48 h) decreases the level of apolipoprotein A 1
(apoA-I) mRNA, an effect that was blocked by insulin. This
phenomenon was dependent on a region of the promoter
where an insulin response core element (IRCE) is present
[42]. SpI binds to this element and the signallinp pathway
triggered by insulin appears to involve p42/44map and PKC
activity, and Spl phosphorylation [43].
There is also evidence that SpI is essential for basal transcription of calmodulin gene and for the increase of transcriptional activity of this gene induced by insulin [44]. In
addition, insulin increases the o-glycosylation and phosphorylation of SpI in the HAllE hepatoma cell line, which
is reduced when cells are from streptozotocin-induced diabetic rats [45]. Recently, it has been shown that insulin (100
) increases PKC8 expression, a phenomenon that is under
::cgulation by PKCa in the skeletal muscle cell line L6 via a
:;:nechanism requiring Sp 1 and NFKB activation [46]. Since in
rimary cultures of HUVEC it has been reported that insulin
srimulation of hCAT - I -mediated L-arginine transport de_ nds on PI3k, PKC and p42/44mapk activity [23], it is likely
:hat SpI would be acting as a key transcription factor modu~ -ng SLC7Ai expression by insulin or high extracellular
:uncentrations of D-glucose in HUVEC (Table 1).
Preliminary experiments performed in HUVEC incubated
mM D-glucose (24 hours) and I nM insulin (for last
h of the 24 h period of incubation with high D-glucose)
-' ow increased SpI protein abundance in nuclear protein
_ :::-acts (Gonzalez M, Sobrevia L, unpublished data). Co_ -ubation of HUVEC monolayers with D-glucose and insu-
'm 25
II
Stimuli
Gene Blank
Cell Type
Mechanism
Promoter
References
Activity
Insulin
PAl-l
Human hepatoblastoma
Increased
[41]
Increased
[42]
HepG2
Insulin
Apo-Al
Human hepatoblastoma
HepG2
Insulin
Apo-Al
Human hepatoblastoma
Increased
Phpsphorylation
HepG2
Insulin
Calmodulin
of Sp 1 and increase of
[43]
IRCE binding
Increased
II
[44]
be stimulated by insulin
Insulin
PKC15
Skeletal muscle L6
Increased
[46]
TGF-j3l PAl-l
Increased
[61]
lR-l
Rat hepatocytes
Increased
Effect ofD-glucose
on promoter was
[62]
Leptin
Increased
Acetyl-CoA
Mutation ofSpl
the D-glucose/insulin
Increased
[63]
effect
[64]
effect of D-glucose
H,O,
Spl
n.d.
[65]
n.d.
[66]
rat kidney
H,O,
Aldolase Pyruvate
kinase
Rat timocytes
INSULIN ~D
D-GLUCOSE
EFFECT
ON NFKB
Stimuli
Gene blank
Cell type
REMARKS
Mechanism
Effect on
References
mRNA level
D-Glucose
NFJd3
BAEC
n.d.
[56]
D-Glucose
COX-2
HUVEC
n.d.
[57]
D-Glucose
NFKB
HAEC
n.d.
[58]
HUVEC
Increased
[67]
HAEC
Increased
[68]
HUVEC
Increased
[69]
L6 skeletal muscle
Increased
[46]
D-Glucose
Fibronectin
D-Glucose
VCAM-l
D-Glucose
Fibronectin
Insulin
?KCa
increase ofmRNA
Insulin
MC?-!
HAEC
Decreased
[59]
ROS
NFKB
HUVEC
n.d.
[70]
NFKB
HMEC.l
n.d.
LPS-increased
[71]
binding
BAEC: bovine artery endothelial cells, HUVEC: human umbilical vein endothelial cells, HAEC: human artery endotbelial cells, HMEC.I: human dermal microvascular endotheli2l
cells, LPS: lipopolysaccharide, ROS: reactive oxygen species, n.d.: not determined.
[20]
[21]
[22]
[23]
[24]
Fishman AP. Endothelium: A distributed organ of diverse capabilities. Ann NY Acad Sci 1982; 401: 1-8.
Galley H, Webster N. Physiology of the endothelium. Br J Anaesth
2004; 93: 105-13.
Moncada S, Palmer RMJ, Higgs EA. The discovery of nitric oxide
as the endogenous nitrovasodilator. Hypertension 1988; 12: 36572.
Yanagisawa M, Kurihara H, Kimura S, Tomobe Y. A novel potent
vasoconstrictor
peptide produced by vascular endotelial cells.
Nature 1988; 332: 411-5.
Ignarro LJ, Buga GM, Wood KS, Byrns RE, Chaudhuri G. Endothelium-derived relaxing factor produced and released from artery
and vein is nitric oxide. Proc Natl Acad Sci 1987; 84: 9265-9.
Mann GE, Yudilevich DL, Sobrevia L. Rel,'Ulation of amino acid
and glucose transporters in endothelial and smooth muscle cells.
Physiol Rev 2003; 83: 183-252.
Steinberg HO, Baron AD. Vascular function, insulin resistance and
fatty acids. Diabetologia 2002; 45: 623-34.
Kuboki K, Jiang ZY, Takahara N, Ha SW, Igarashi M, Yamauchi
T, et af. Regulation of endothelial constitutive nitric oxide synthase
geneexpression in endothelial cells and in vivo: a specific vascular
action of insulin. Circulation 2000; 101: 676-81.
Desoye G, Hauguel-de Mouzon S. The human placenta in gestational diabetes mellitus. The insulin and cytokine network. Diabetes Care 2007; 30: 120-6.
Flores C, Rojas S, Aguayo C, Parodi J, Mann G, Pearson JD, et al.
Rapid stimulation of L-arginine transport by D-glucose involves
p42/44mapk and nitric oxide in human umbilical vein endothelium.
Cir Res 2003; 92: 64-72.
Casanello P, Sobrevia L. Intrauterine growth retardation is associated with reduced activity and expression of the cationic amino
acid transport systems y+/hCA T-l and y+/hCAT-2B and lower activity of nitric oxide synthase in human umbilical vein endothelial
cells. Circ Res 2002; 91: 127-34.
Durante W, Sen AK, Sunahara FA. Impairment of endotheliumdependent relaxation in aortae from spontaneously diabetic rats. Br
J Pharmacol 1988; 94: 463-8.
Bossaller C, Habib GB, Yamamoto H, Williams C, Wells S, Henry
PD. Impaired muscarinic endothelium-dependent
relaxation and
cyclic guanosine 5' -monophosphate
formation in atherosclerotic
human coronary artery and rabbit aorta. J Clin Invest 1987; 79:
170-4.
Guyao W, Morris SM. Arginine metabolism: nitric oxide and beyond. Biochem J 1998336: 1-17.
Alderton WK, Cooper CE, Knowles RG. Nitric oxide synthases:
structure, function and inhibition. Biochem J 200 I; 357: 593-615.
Sobrevia L, Mann GE. Dysfunction of the nitric oxide signalling
pathway in diabetes and hyperglycaemia. Exp Physiol 1997; 82:
423-52.
Casanello P, Escudero C, Sobrevia L. Equilibrative Nucleoside
(ENTs) and Cationic Amino acid (CATs) Transporters: implications in foetal endothelial dysfunction in human pregnancy diseases. Curr Vasc Pharmacol2007;
5: 69-84.
Arancibia-Garavilla
Y, Toledo F, Casanello P, Sobrevia L. Nitric
oxide synthesis requires activity of the cationic and neutral amino
acid transport system y+L in human umbilical vein endothelium.
Exp Physiol2003; 88: 699-710.
Verrey F, Closs EI, Wagner CA, Palacin M, Endou H, Kanai Y.
CATs and HATs: the SLC7 family of amino acid transporters. Eur
J Physiol2003; 447: 532-42.
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
Baldwin AS Jr. The NF-kappa B and I kappa B proteins: new di;coveries and insights. Annu Rev Immunol1996; 14: 649-83.
Nishikawa T, Edelstein D, Du XL, Yamagishi S, Matsumura Kaneda Y, et al. Normalizing mitochondrial superoxide producti
blocks three pathways of hyperglycaemic damage. Nature 2000
404: 787-90.
Sheu ML, Ho FM, Yang RS, Chao KF, Lin WW, Lin-Shiau SY,
al. High glucose induces human endothelial cell apoptosis thro _
a phosphoinositide 3-kinase-regulated cyclooxygenase-2 pathwz;
Arterioscler Thromb Vasc BioI 2005; 25: 539-45.
Mohan S, Hamuro M, Koyoma K, Sorescu GP, Jo H, Natarajan . l
High glucose induced NF-kappaB DNA-binding activity in HAEC
is maintained under low shear stress but inhibited under high sh=
stress: role of nitric oxide. Atherosclerosis 2003; 171: 225-34.
Aljada A, Ghanim H, Saadeh R, Dandona P. Insulin inhibiNFkappaB and MCP-I expression in human aortic endothelia.
cells. J Clin Endocrinol Metab 2001; 86: 450-63.
Golovchenko I, Goalstone ML, Watson P, Brownlee M, Draznin B
Hyperinsulinemia enhances transcriptional activity of nuclear fa tor-kappaB induced by angiotensin II, hyperglycemia,
and advanced glycosylation end products in vascular smooth muscle cells.
Circ Res 2000; 87: 722-4.
Chae YM, Park KK, Magae J, Lee IS, Kim CH, Kim HC, el a~
Sp I-decoy oligodeoxynucleotide
inhibits high glucose-induced mesangial cell proliferation. Biochem Biophys Res Commun 200!
319: 550-5.
Fukuda H, Noguchi T, Iritani N. Transcriptional regulation of inS1..
lin receptor gene promoter in rat hepatocytes. Biochem Biophy:
Res Commun 2001; 280: 1274-8.
Fukuda H, Iritani N. Transcriptional regulation of leptin gene promoterinrat. FEBSLett 1999;455: 165-9.
Daniel S, Kim KH. Spl mediates glucose activation of the acetylCoA carboxylase promoter. J Bioi Chern 1996; 271: 1385-92.
Ammendola R, Mesuraca M, Russo T, Cimino F. The DNAbinding efficiency of Spl is affected by redox changes. Eur J Biochern 1994; 225: 483-9.
Schafer D, Hamm-Kunzelmann
B, Herrnfisse U, Brand K. Differences in DNA-binding efficiency of Sp I to aldolase and pyruva ~
kinase promoter correlate with altered redox states in resting ane
proliferating rat thymocytes. FEBS Lett 1996; 391: 35-8.
Xin X, Khan ZA, Chen S, Chakrabarti S. Glucose-induced AI..,:
activation mediates fibronectin synthesis in endothelial cells. Diabetologia 2005; 48: 2428-36.
Kouroedov A, Eto M, Joch H, Volpe M, Luscher TF, Cosentino F
Selective inhibition of protein kinase Cbeta2 prevents acute effec
of high glucose on vascular cell adhesion molecule-I expression human endothelial cells. Circulation 2004; 110: 91-6.
Chen S, Mukherjee S, Chakraborty C, Chakrabarti S. High gluco-~induced, endothelin-dependent
fibronectin synthesis is medial
via NF-kappa Band AP-l. Am J Physiol Cell Physiol 2003; 2
C263-72.
Matsunaga T, Hokari S, Koyama I, Harada T, Komoda T. 1\Tkappa B activation in endothelial cells treated with oxidized hig
density lipoprotein. Biochem Biophys Res Commun 2003; 30:'
313-9.
Chan EL, Murphy JT. Reactive oxygen species mediate endotoxIDinduced human dermal endothelial NF-kappaB activation. J SUl1"
Res 2003; III: 120-6.