< Principles of Biochemistry

The history of biochemistry spans approximately 400 years. Although the term biochemistry
seems to have been first used in 1882, it is generally accepted that the word "biochemistry" was
first proposed in 1903 by Carl Neuberg, a German chemist. Biochemistry is the study of
chemical processes in living organisms. Biochemistry governs all living organisms and living
processes. By controlling information flow through biochemical signalling and the flow of
chemical energy through metabolism, biochemical processes give rise to the incredibly
complexity of life. Much of biochemistry deals with the structures and functions of cellular
components such as proteins, carbohydrates, lipids, nucleic acids and other biomolecules
although increasingly processes rather than individual molecules are the main focus. Over the
last 40 years biochemistry has become so successful at explaining living processes that now
almost all areas of the life sciences from botany to medicine are engaged in biochemical
research. Today the main focus of pure biochemistry is in understanding how biological
molecules give rise to the processes that occur within living cells which in turn relates greatly to
the study and understanding of whole organisms. Among the vast number of different
biomolecules, many are complex and large molecules (called polymers), which are composed of
similar repeating subunits (called monomers). Each class of polymeric biomolecule has a
different set of subunit types. For example, a protein is a polymer whose subunits are selected
from a set of 20 or more amino acids. Biochemistry studies the chemical properties of important
biological molecules, like proteins, and in particular the chemistry of enzyme-catalyzed
reactions. The biochemistry of cell metabolism and the endocrine system has been extensively
described. Other areas of biochemistry include the genetic code (DNA, RNA), protein synthesis,
cell membrane transport, and signal transduction.[1]

Contents

1 Enzymes

2 Metabolism

3 20th century

4 Bioenergetics
o 4.1 Entropy[21]
o 4.2 Enthalpy[24]
o 4.3 Gibbs free energy
o 4.4 Free energy of reactions
o 4.5 Useful identities

5 Cell The basic unit of life

o 5.1 Prokaryotes
o 5.2 Eukaryotic cell
o 5.3 Plant cell is different from animal cell
o 5.4 Origin of Eukaryotic organelles and endosymbiotic theory

5.4.1 Eukaryotic organelles

5.4.2 Prokaryotic organelles

6 E.coli as Model organism

7 Yeast in biological research

8 Refrences

Enzymes

Eduard Buchner
As early as the late 18th century and early 19th century, the digestion of meat by stomach
secretions[2] and the conversion of starch to sugars by plant extracts and saliva were known.
However, the mechanism by which this occurred had not been identified.[3]
In the 19th century, when studying the fermentation of sugar to alcohol by yeast, Louis Pasteur
came to the conclusion that this fermentation was catalyzed by a vital force contained within the
yeast cells called "ferments", which were thought to function only within living organisms. He

wrote that "alcoholic fermentation is an act correlated with the life and organization of the yeast
cells, not with the death or putrefaction of the cells."[4]
In 1878 German physiologist Wilhelm Khne (18371900) coined the term enzyme, which
comes from Greek "in leaven", to describe this process. The word enzyme was used later to refer
to nonliving substances such as pepsin, and the word ferment used to refer to chemical activity
produced by living organisms.
In 1897 Eduard Buchner began to study the ability of yeast extracts to ferment sugar despite the
absence of living yeast cells. In a series of experiments at the University of Berlin, he found that
the sugar was fermented even when there were no living yeast cells in the mixture.[5] He named
the enzyme that brought about the fermentation of sucrose "zymase".[6] In 1907 he received the
Nobel Prize in Chemistry "for his biochemical research and his discovery of cell-free
fermentation". Following Buchner's example; enzymes are usually named according to the
reaction they carry out. Typically the suffix -ase is added to the name of the substrate (e.g.,
lactase is the enzyme that cleaves lactose) or the type of reaction (e.g., DNA polymerase forms
DNA polymers).
Having shown that enzymes could function outside a living cell, the next step was to determine
their biochemical nature. Many early workers noted that enzymatic activity was associated with
proteins, but several scientists (such as Nobel laureate Richard Willsttter) argued that proteins
were merely carriers for the true enzymes and that proteins per se were incapable of catalysis.
However, in 1926, James B. Sumner showed that the enzyme urease was a pure protein and
crystallized it; Sumner did likewise for the enzyme catalase in 1937. The conclusion that pure
proteins can be enzymes was definitively proved by Northrop and Stanley, who worked on the
digestive enzymes pepsin (1930), trypsin and chymotrypsin. These three scientists were awarded
the 1946 Nobel Prize in Chemistry.[7] This discovery that enzymes could be crystallized
eventually allowed their structures to be solved by x-ray crystallography. This was first done for
lysozyme, an enzyme found in tears, saliva and egg whites that digests the coating of some
bacteria; the structure was solved by a group led by David Chilton Phillips and published in
1965.[8] This high-resolution structure of lysozyme marked the beginning of the field of structural
biology and the effort to understand how enzymes work at an atomic level of detail.[9]

Metabolism

Santorio Santorio in his steelyard balance, from Ars de statica medecina, first published 1614
The term metabolism is derived from the Greek Metabolismos for "change", or "overthrow".[10]
The history of the scientific study of metabolism spans 400 years. The first controlled
experiments in human metabolism were published by Santorio Santorio in 1614 in his book Ars
de statica medecina.[11] This book describes how he weighed himself before and after eating,
sleeping, working, sex, fasting, drinking, and excreting. He found that most of the food he took
in was lost through what he called "insensible perspiration".[12]

20th century
Since then, biochemistry has advanced, especially since the mid-20th century, with the
development of new techniques such as chromatography, X-ray diffraction, NMR spectroscopy,
radioisotopic labelling, electron microscopy and molecular dynamics simulations. These
techniques allowed for the discovery and detailed analysis of many molecules and metabolic
pathways of the cell, such as glycolysis and the Krebs cycle (citric acid cycle). One of the most
prolific of these modern biochemists was Hans Krebs who made huge contributions to the study
of metabolism.[13] He discovered the urea cycle and later, working with Hans Kornberg, the citric
acid cycle and the glyoxylate cycle.[14][15][16] In 1960, the biochemist Robert K. Crane revealed his
discovery of the sodium-glucose cotransport as the mechanism for intestinal glucose absorption.
[17]
This was the very first proposal of a coupling between the fluxes of an ion and a substrate that
has been seen as sparking a revolution in biology.Today, the findings of biochemistry are used in
many areas, from genetics to molecular biology and from agriculture to medicine.[18]

Bioenergetics
Bioenergetics is the part of biochemistry concerned with the energy involved in making and
breaking of chemical bonds in the molecules found in biological organisms. Growth,
development and metabolism are some of the central phenomena in the study of biological
organisms. The role of energy is fundamental to such biological processes. The ability to harness
energy from a variety of metabolic pathways is a property of all living organisms. Life is
dependent on energy transformations; living organisms survive because of exchange of energy
within and without. In a living organism, chemical bonds are broken and made as part of the

exchange and transformation of energy. Energy is available for work (such as mechanical work)
or for other processes (such as chemical synthesis and anabolic processes in growth), when weak
bonds are broken and stronger bonds are made. The production of stronger bonds allows release
of usable energy.[19]
Living organisms obtain energy from organic and inorganic materials. For example, lithotrophs
can oxidize minerals such as nitrates or forms of sulfur, such as elemental sulfur, sulfites, and
hydrogen sulfide to produce ATP. In photosynthesis, autotrophs can produce ATP using light
energy. Heterotrophs must consume organic compounds. These are mostly carbohydrates, fats,
and proteins. The amount of energy actually obtained by the organism is lower than the amount
present in the food; there are losses in digestion, metabolism, and thermogenesis. The materials
are generally combined with oxygen to release energy, although some can also be oxidized
anaerobically by various organisms. The bonds holding the molecules of nutrients together and
the bonds holding molecules of free oxygen together are all relatively weak compared with the
chemical bonds holding carbon dioxide and water together. The utilization of these materials is a
form of slow combustion. That is why the energy content of food can be estimated with a bomb
calorimeter. The materials are oxidized slowly enough that the organisms do not actually produce
fire. The oxidation releases energy because stronger bonds have been formed. This net energy
may evolve as heat, or some of which may be used by the organism for other purposes, such as
breaking other bonds to do chemistry.
Living organisms produce ATP from energy sources via oxidative phosphorylation. The terminal
phosphate bonds of ATP are relatively weak compared with the stronger bonds formed when ATP
is broken down to adenosine monophosphate and phosphate, dissolved in water. Here it is the
energy of hydration that results in energy release. This hydrolysis of ATP is used as a battery to
store energy in cells, for intermediate metabolism. Utilization of chemical energy from such
molecular bond rearrangement powers biological processes in every biological organism.[20]

Entropy[21]
The concept of entropy is defined by the second law of thermodynamics, which states that the
entropy of a closed system always increases or remains constant.
Entropy change When an ideal gas undergoes a change, its entropy may also change. For cases
where the specific heat doesn't change and either volume, pressure or temperature is also
constant, the change in entropy can be easily calculated.[22]
When specific heat and volume are constant, the change in entropy is given by:

.
When specific heat and pressure are constant, the change in entropy is given by:

.
When specific heat and temperature are constant, the change in entropy is given by:

.
In these equations
is the specific heat at constant volume,
is the specific heat at constant
pressure, is the ideal gas constant, and is the number of moles of gas.
For some other transformations, not all of these properties (specific heat, volume, pressure or
temperature) are constant. In these cases, for only 1 mole of an ideal gas, the change in entropy
can be given by[23] either:

or
.

Enthalpy[24]
Enthalpy is a measure of the total energy of a thermodynamic system. It includes the internal
energy, which is the energy required to create a system, and the amount of energy required to
make room for it by displacing its environment and establishing its volume and pressure.
The enthalpy of a system is defined as:

where
H is the enthalpy of the system (in joules),
U is the internal energy of the system (in joules),
p is the pressure at the boundary of the system and its environment, (in pascals), and
V is the volume of the system, (in cubic meters).
Note that the U term is equivalent to the energy required to create the system, and that the pV
term is equivalent to the energy which would be required to "make room" for the system if the
pressure of the environment remained constant.
The pV term may be understood by the following example of an isobaric process. Consider gas
changing its volume (by, for example, a chemical reaction) in a cylinder, pushing a piston,
maintaining constant pressure p. The force is calculated from the area A of the piston and

definition of pressure p = F/A: the force is F = pA. By definition, work W done is W = Fx, where
x is the distance traversed. Combining gives W = pAx, and the product Ax is the volume traversed
by the piston: Ax = V. Thus, the work done by the gas is W = pV, where p is a constant pressure
and V the expansion of volume. Including this pV term means that during constant pressure
expansion, any internal energy forfeited as work on the environment does not affect the value of
enthalpy. The enthalpy change can be defined H = U + W = U + (pV), where U is the
thermal energy lost to expansion, and W the energy gained due to work done on the piston.[25]

Gibbs free energy

In thermodynamics, the Gibbs free energy (IUPAC recommended name: Gibbs energy or Gibbs
function; also known as free enthalpy[1] to distinguish it from Helmholtz free energy) is a
thermodynamic potential that measures the "useful" or process-initiating work obtainable from
an isothermal, isobaric thermodynamic system.
The Gibbs free energy, originally called available energy, was developed in the 1870s by the
American mathematician Josiah Willard Gibbs. In 1873, Gibbs described this available energy
as the greatest amount of mechanical work which can be obtained from a given quantity of a
certain substance in a given initial state, without increasing its total volume or allowing heat to
pass to or from external bodies, except such as at the close of the processes are left in their initial
condition.[26]

Free energy of reactions

To derive the Gibbs free energy equation for an isolated system, let Stot be the total entropy of the
isolated system, that is, a system that cannot exchange heat or mass with its surroundings.
According to the second law of thermodynamics:

and if Stot = 0 then the process is reversible. The heat transfer Q vanishes for an adiabatic
system. Any adiabatic process that is also reversible is called an isentropic
process.
Now consider systems, having internal entropy Sint. Such a system is thermally connected to its
surroundings, which have entropy Sext. The entropy form of the second law applies only to the
closed system formed by both the system and its surroundings. Therefore a process is possible if
.
If Q is heat transferred to the system from the surroundings, so Q is heat lost by the
surroundings

so that
We now have:

corresponds to entropy change of the surroundings.

Multiply both sides by T:

Q is heat transferred to the system; if the process is now assumed to be isobaric, then Qp = H:

H is the enthalpy change of reaction (for a chemical reaction at constant pressure). Then

for a possible process. Let the change G in Gibbs free energy be defined as
(eq.1)
Notice that it is not defined in terms of any external state functions, such as Sext or Stot. Then
the second law becomes, which also tells us about the spontaneity of the reaction:
favoured reaction (Spontaneous)
Neither the forward nor the reverse reaction prevails (Equilibrium)
disfavoured reaction (Nonspontaneous)
Gibbs free energy G itself is defined as
(eq.2)
but notice that to obtain equation (2) from equation (1) we must assume that T is constant. Thus,
Gibbs free energy is most useful for thermochemical processes at constant temperature and
pressure: both isothermal and isobaric. Such processes don't move on a P-V diagram, such as
phase change of a pure substance, which takes place at the saturation pressure and temperature.
Chemical reactions, however, do undergo changes in chemical potential, which is a state
function. Thus, thermodynamic processes are not confined to the two dimensional P-V diagram.
There is a third dimension for n, the quantity of gas. For the study of explosive chemicals, the
processes are not necessarily isothermal and isobaric. For these studies, Helmholtz free energy is
used.[27]
If an isolated system (Q = 0) is at constant pressure (Q = H), then

Therefore the Gibbs free energy of an isolated system is:

and if G 0 then this implies that S 0, back to where we started the derivation of G

Useful identities
for constant temperature
(see Chemical equilibrium).

and rearranging gives

which relates the electrical potential of a reaction to the equilibrium coefficient for that reaction
(Nernst equation).
where
G = change in Gibbs free energy, H = change in enthalpy, T = absolute temperature, S =
change in entropy, R = gas constant, ln = natural logarithm, rG = change of reaction in Gibbs
free energy, rG = standard change of reaction in Gibbs free energy, K = equilibrium constant,
Qr = reaction quotient, n = number of electrons per mole product, F = Faraday constant
(coulombs per mole), and E = electrode potential of the reaction. Moreover, we also have:

which relates the equilibrium constant with Gibbs free energy.[28]

Cell The basic unit of life

The cell is the functional basic unit of life. Cell was discovered by Robert Hooke and is the
functional unit of all known living organisms. It is the smallest unit of life that is classified as a
living thing, and is often called the building block of life. Some organisms, such as most
bacteria, are unicellular (consist of a single cell). Other organisms, such as humans,cat,dogs and
birds, are multicellular. Humans have about 100 trillion or 10 14 cells; a typical cell size is 10 m
and a typical cell mass is 1 nanogram. The largest cells are about 135 m in the anterior horn
in the spinal cord while granule cells in the cerebellum, the smallest, can be some 4 m and
the longest cell can reach from the toe to the lower brain stem (Pseudounipolar cells).

The largest known cells are unfertilised ostrich egg cells which weigh 3.3 pounds. In 1835,
before the final cell theory was developed, Jan Evangelista Purkyn observed small "granules"
while looking at the plant tissue through a microscope. The cell theory, first developed in 1839
by Matthias Jakob Schleiden and Theodor Schwann, states that all organisms are composed of
one or more cells, that all cells come from preexisting cells, that vital functions of an organism
occur within cells, and that all cells contain the hereditary information necessary for regulating
cell functions and for transmitting information to the next generation of cells. The word cell
comes from the Latin cellula, meaning, a small room. The descriptive term for the smallest
living biological structure was coined by Robert Hooke in a book he published in 1665 when he
compared the cork cells he saw through his microscope to the small rooms monks lived in.There
are two types of cells: eukaryotic and prokaryotic. Prokaryotic cells are usually independent,
while eukaryotic cells are often found in multicellular organisms.[29]
Origin of life and Miller's experiment[30]

The experiment
Earth's early atmosphere Some evidence suggests that Earth's original atmosphere might have
contained fewer of the reducing molecules than was thought at the time of the MillerUrey
experiment. There is abundant evidence of major volcanic eruptions 4 billion years ago, which
would have released carbon dioxide, nitrogen, hydrogen sulfide (H2S), and sulfur dioxide (SO2)
into the atmosphere. Experiments using these gases in addition to the ones in the original Miller
Urey experiment have produced more diverse molecules. The experiment created a mixture that
was racemic (containing both L and D enantiomers) and experiments since have shown that "in
the lab the two versions are equally likely to appear."[31] However, in nature, L amino acids
dominate; later experiments have confirmed disproportionate amounts of L or D oriented
enantiomers are possible.[32] [33]

Originally it was thought that the primitive secondary atmosphere contained mostly ammonia
and methane. However, it is likely that most of the atmospheric carbon was CO2 with perhaps
some CO and the nitrogen mostly N2. In practice gas mixtures containing CO, CO2, N2, etc. give
much the same products as those containing CH4 and NH3 so long as there is no O2. The
hydrogen atoms come mostly from water vapor. In fact, in order to generate aromatic amino
acids under primitive earth conditions it is necessary to use less hydrogen-rich gaseous mixtures.
Most of the natural amino acids, hydroxyacids, purines, pyrimidines, and sugars have been made
in variants of the Miller experiment.[34]
More recent results may question these conclusions. The University of Waterloo and University
of Colorado conducted simulations in 2005 that indicated that the early atmosphere of Earth
could have contained up to 40 percent hydrogenimplying a possibly much more hospitable
environment for the formation of prebiotic organic molecules. The escape of hydrogen from
Earth's atmosphere into space may have occurred at only one percent of the rate previously
believed based on revised estimates of the upper atmosphere's temperature.[35] One of the authors,
Owen Toon notes: "In this new scenario, organics can be produced efficiently in the early
atmosphere, leading us back to the organic-rich soup-in-the-ocean concept... I think this study
makes the experiments by Miller and others relevant again." Outgassing calculations using a
chondritic model for the early earth complement the Waterloo/Colorado results in re-establishing
the importance of the MillerUrey experiment.[36]
Conditions similar to those of the MillerUrey experiments are present in other regions of the
solar system, often substituting ultraviolet light for lightning as the energy source for chemical
reactions. The Murchison meteorite that fell near Murchison, Victoria, Australia in 1969 was
found to contain over 90 different amino acids, nineteen of which are found in Earth life. Comets
and other icy outer-solar-system bodies are thought to contain large amounts of complex carbon
compounds (such as tholins) formed by these processes, darkening surfaces of these bodies.[37]
The early Earth was bombarded heavily by comets, possibly providing a large supply of complex
organic molecules along with the water and other volatiles they contributed. This has been used
to infer an origin of life outside of Earth: the panspermia hypothesis. The Miller and Urey
experiment[38] (or UreyMiller experiment)[39] was an experiment that simulated hypothetical
conditions thought at the time to be present on the early Earth, and tested for the occurrence of
chemical origins of life. Specifically, the experiment tested Alexander Oparin's and J. B. S.
Haldane's hypothesis that conditions on the primitive Earth favored chemical reactions that
synthesized organic compounds from inorganic precursors. Considered to be the classic
experiment on the origin of life, it was conducted in 1952[40] and published in 1953 by Stanley
Miller and Harold Urey at the University of Chicago.[41][42][43]
After Miller's death in 2007, scientists examining sealed vials preserved from the original
experiments were able to show that there were actually well over 20 different amino acids
produced in Miller's original experiments. That is considerably more than what Miller originally
reported, and more than the 20 that naturally occur in life. Moreover, some evidence suggests
that Earth's original atmosphere might have had a different composition than the gas used in the
MillerUrey experiment. There is abundant evidence of major volcanic eruptions 4 billion years
ago, which would have released carbon dioxide, nitrogen, hydrogen sulfide (H2S), and sulfur

dioxide (SO2) into the atmosphere. Experiments using these gases in addition to the ones in the
original MillerUrey experiment have produced more diverse molecules.[31]
Experiment
The experiment used water (H2O), methane (CH4), ammonia (NH3), and hydrogen (H2). The
chemicals were all sealed inside a sterile array of glass tubes and flasks connected in a loop, with
one flask half-full of liquid water and another flask containing a pair of electrodes. The liquid
water was heated to induce evaporation, sparks were fired between the electrodes to simulate
lightning through the atmosphere and water vapor, and then the atmosphere was cooled again so
that the water could condense and trickle back into the first flask in a continuous cycle.
At the end of one week of continuous operation, Miller and Urey observed that as much as 10
15% of the carbon within the system was now in the form of organic compounds. Two percent of
the carbon had formed amino acids that are used to make proteins in living cells, with glycine as
the most abundant. Sugars, liquids, were also formed. Nucleic acids were not formed within the
reaction. But the common 20 amino acids were formed, but in various concentrations.
In an interview, Stanley Miller stated: "Just turning on the spark in a basic pre-biotic experiment
will yield 11 out of 20 amino acids."[44]
As observed in all subsequent experiments, both left-handed (L) and right-handed (D) optical
isomers were created in a racemic mixture.
The original experiment remains today under the care of Miller and Urey's former student
Professor Jeffrey Bada at the University of California, San Diego, Scripps Institution of
Oceanography.[45]
One-step reactions among the mixture components can produce hydrogen cyanide (HCN),
formaldehyde (CH2O),[46] and other active intermediate compounds (acetylene, cyanoacetylene,
etc.):
CO2 CO + [O] (atomic oxygen)
CH4 + 2[O] CH2O + H2O
CO + NH3 HCN + H2O
CH4 + NH3 HCN + 3H2 (BMA process)
The formaldehyde, ammonia, and HCN then react by Strecker synthesis to form amino acids and
other biomolecules:
CH2O + HCN + NH3 NH2-CH2-CN + H2O
NH2-CH2-CN + 2H2O NH3 + NH2-CH2-COOH (glycine)
Furthermore, water and formaldehyde can react via Butlerov's reaction to produce various sugars
like ribose.

Other experiments This experiment inspired many others. In 1961, Joan Or found that the
nucleotide base adenine could be made from hydrogen cyanide (HCN) and ammonia in a water
solution. His experiment produced a large amount of adenine, which molecules were formed
from 5 molecules of HCN.[47] Also, many amino acids are formed from HCN and ammonia under
these conditions.[48] Experiments conducted later showed that the other RNA and DNA
nucleobases could be obtained through simulated prebiotic chemistry with a reducing
atmosphere.[49]
There also had been similar electric discharge experiments related to the origin of life
contemporaneous with MillerUrey. An article in The New York Times (March 8, 1953:E9), titled
"Looking Back Two Billion Years" describes the work of Wollman (William) M. MacNevin at
The Ohio State University, before the Miller Science paper was published in May 1953.
MacNevin was passing 100,000 volt sparks through methane and water vapor and produced
"resinous solids" that were "too complex for analysis." The article describes other early earth
experiments being done by MacNevin. It is not clear if he ever published any of these results in
the primary scientific literature.[citation needed]
K. A. Wilde submitted a paper to Science on December 15, 1952, before Miller submitted his
paper to the same journal on February 14, 1953. Wilde's paper was published on July 10, 1953.[50]
Wilde used voltages up to only 600 V on a binary mixture of carbon dioxide (CO2) and water in a
flow system. He observed only small amounts of carbon dioxide reduction to carbon monoxide,
and no other significant reduction products or newly formed carbon compounds. Other
researchers were studying UV-photolysis of water vapor with carbon monoxide. They have
found that various alcohols, aldehydes and organic acids were synthesized in reaction mixture.[51]
More recent experiments by chemist Jeffrey Bada at Scripps Institution of Oceanography (in La
Jolla, CA) were similar to those performed by Miller. However, Bada noted that in current
models of early Earth conditions, carbon dioxide and nitrogen (N2) create nitrites, which destroy
amino acids as fast as they form. However, the early Earth may have had significant amounts of
iron and carbonate minerals able to neutralize the effects of the nitrites. When Bada performed
the Miller-type experiment with the addition of iron and carbonate minerals, the products were
rich in amino acids. This suggests the origin of significant amounts of amino acids may have
occurred on Earth even with an atmosphere containing carbon dioxide and nitrogen.[52].

Prokaryotes

The sizes of prokaryotes relative to other organisms and biomolecules

Prokaryotes are single-cell organisms that do not have a nucleus, mitochondria, or any other
membrane-bound organelles. In other words, neither their DNA nor any of their other sites of
metabolic activity are collected together in a discrete membrane-enclosed area. Instead,
everything is openly accessible within the cell, some of which is free-floating[3]. A distinction
between prokaryotes and eukaryotes (meaning true kernel, also spelled "eucaryotes") is that
eukaryotes do have "true" nuclei containing their DNA. Unlike prokaryotes, eukaryotic
organisms may be unicellular, as in amoebae, or multicellular, as in plants and animals. The
difference between the structure of prokaryotes and eukaryotes is so great that it is sometimes
considered to be the most important distinction among groups of organisms. The cell structure of
prokaryotes differs greatly from that of eukaryotes. The defining characteristic is the absence of a
nucleus. Also the size of Ribosomes in prokaryotes is smaller than that in eukaryotes, which is
now where respiration takes place. The genomes of prokaryotes are held within an irregular
DNA/protein complex in the cytosol called the nucleoid, which lacks a nuclear envelope. [53]
In general, prokaryotes lack the following membrane-bound cell compartments: mitochondria
and chloroplasts. Instead, processes such as oxidative phosphorylation and photosynthesis take
place across the prokaryotic plasma membrane. However, prokaryotes do possess some internal
structures, such as cytoskeletons, and the bacterial order Planctomycetes have a membrane
around their nucleoid and contain other membrane-bound cellular structures. Both eukaryotes
and prokaryotes contain large RNA/protein structures called ribosomes, which produce protein.
Prokaryotes are usually much smaller than eukaryotic cells. Prokaryotes also differ from
eukaryotes in that they contain only a single loop of stable chromosomal DNA stored in an area
named the nucleoid, whereas eukaryote DNA is found on tightly bound and organized
chromosomes. Although some eukaryotes have satellite DNA structures called plasmids, in
general these are regarded as a prokaryote feature, and many important genes in prokaryotes are
stored on plasmids. Prokaryotes have a larger surface-area-to-volume ratio giving them a higher
metabolic rate, a higher growth rate, and, as a consequence, a shorter generation time compared
to Eukaryotes. A criticism of this classification is that the word "prokaryote" is based on what
these organisms are not (they are not eukaryotic), rather than what they are (either archaea or
bacteria). In 1977, Carl Woese proposed dividing prokaryotes into the Bacteria and Archaea
(originally Eubacteria and Archaebacteria) because of the major differences in the structure and

genetics between the two groups of organisms. This arrangement of Eukaryota (also called
"Eukarya"), Bacteria, and Archaea is called the three-domain system, replacing the traditional
two-empire system.[54]

Eukaryotic cell

The cells of eukaryotes (left) and prokaryotes (right)

The origin of the eukaryotic cell was a milestone in the evolution of life, since they include all
complex cells and almost all multi-cellular organisms. The timing of this series of events is hard
to determine; Knoll (2006) suggests they developed approximately 1.6 2.1 billion years ago.
Some acritarchs are known from at least 1,650 million years ago, and the possible alga Grypania
has been found as far back as 2,100 million years ago. Fossils that are clearly related to modern
groups start appearing around 1.2 billion years ago, in the form of a red alga, though recent work
suggests the existence of fossilized filamentous algae in the Vindhya basin dating back to 1.6 to
1.7 billion years ago. Biomarkers suggest that at least stem eukaryotes arose even earlier. The
presence of steranes in Australian shales indicates that eukaryotes were present 2.7 billion years
ago.[55]
There are many different types of eukaryotic cells, though animals and plants are the most
familiar eukaryotes, and thus provide an excellent starting point for understanding eukaryotic
structure. Fungi and many protists have some substantial differences, however.
Animal cell
An animal cell is a form of eukaryotic cell that makes up many tissues in animals. The animal
cell is distinct from other eukaryotes, most notably plant cells, as they lack cell walls and
chloroplasts, and they have smaller vacuoles. Due to the lack of a rigid cell wall, animal cells can
adopt a variety of shapes, and a phagocytic cell can even engulf other structures.
There are many different cell types. For instance, there are approximately 210 distinct cell types
in the adult human body.[56]
Plant cell
Plant cells are quite different from the cells of the other eukaryotic organisms. Their distinctive
features are: A large central vacuole (enclosed by a membrane, the tonoplast), which maintains

the cell's turgor and controls movement of molecules between the cytosol and sap A primary cell
wall containing cellulose, hemicellulose and pectin, deposited by the protoplast on the outside of
the cell membrane; this contrasts with the cell walls of fungi, which contain chitin, and the cell
envelopes of prokaryotes, in which peptidoglycans are the main structural molecules The
plasmodesmata, linking pores in the cell wall that allow each plant cell to communicate with
other adjacent cells; this is different from the functionally analogous system of gap junctions
between animal cells. Plastids, especially chloroplasts that contain chlorophyll, the pigment that
gives plants their green color and allows them to perform photosynthesis Higher plants,
including conifers and flowering plants (Angiospermae) lack the flagellae and centrioles that are
present in animal cells.
Fungal cell
Fungal cells are most similar to animal cells, with the following exceptions: A cell wall that
contains chitin Less definition between cells; the hyphae of higher fungi have porous partitions
called septa, which allow the passage of cytoplasm, organelles, and, sometimes, nuclei. Primitive
fungi have few or no septa, so each organism is essentially a giant multinucleate supercell; these
fungi are described as coenocytic. Only the most primitive fungi, chytrids, have flagella.[57]
Other eukaryotic cells Eukaryotes are a very diverse group, and their cell structures are equally
diverse. Many have cell walls; many do not. Many have chloroplasts, derived from primary,
secondary, or even tertiary endosymbiosis; and many do not. Some groups have unique
structures, such as the cyanelles of the glaucophytes, the haptonema of the haptophytes, or the
ejectisomes of the cryptomonads. Other structures, such as pseudopods, are found in various
eukaryote groups in different forms, such as the lobose amoebozoans or the reticulose
foraminiferans.
Table 1: Comparison of features of Prokaryotic and Eukaryotic cells

Prokaryotes

Typical organisms Bacteria, archaea

Typical size

Type of nucleus

Eukaryotes

Protists, Fungi, Plants, Animals

~ 110 m

~ 10100 m (sperm cells, apart from the tail, are

smaller)

nucleoid region; no
real nucleus

real nucleus surrounded by double membrane

circular (usually)

linear molecules (chromosomes) with histone

proteins

coupled in cytoplasm

RNA-synthesis inside the nucleus

protein synthesis in cytoplasm

50S+30S

60S+40S

Cytoplasmatic
structure

very few structures

highly structured by endomembranes and a

cytoskeleton

Cell movement

flagella made of
flagellin

flagella and cilia containing microtubules;

lamellipodia and filopodia containing actin

Mitochondria

none

one to several thousand (though some lack

mitochondria)

Chloroplasts

none

in algae and plants

Organization

usually single cells

single cells, colonies, higher multicellular organisms

with specialized cells

Cell division

Binary fission (simple Mitosis (fission or budding)

division)
Meiosis

DNA

RNA-/proteinsynthesis

Ribosomes

Plant cell is different from animal cell

Structure of a typical animal cell

Structure of a typical plant cell

Plant cells are eukaryotic cells that differ in several key respects from the cells of other
eukaryotic organisms. Their distinctive features include: A large central vacuole, a water-filled
volume enclosed by a membrane known as the tonoplast maintains the cell's turgor, controls
movement of molecules between the cytosol and sap, stores useful material and digests waste
proteins and organelles.
A cell wall composed of cellulose and hemicellulose, pectin and in many cases lignin, are
secreted by the protoplast on the outside of the cell membrane. This contrasts with the cell walls
of fungi (which are made of chitin), and of bacteria, which are made of peptidoglycan.
Specialised cell-cell communication pathways known as plasmodesmata, pores in the primary
cell wall through which the plasmalemma and endoplasmic reticulum of adjacent cells are
continuous.

Plastids, the notables one being the chloroplasts, which contain chlorophyll and the biochemical
systems for light harvesting and photosynthesis, but also amyloplasts specialized for starch
storage, elaioplasts specialized for fat storage, and chromoplasts specialized for synthesis and
storage of pigments. As in mitochondria, which have a genome encoding 37 genes, plastids have
their own genomes of about 100-120 unique genes and, it is presumed, arose as prokaryotic
endosymbionts living in the cells of an early eukaryotic ancestor of the land plants and algae.
Unlike animal cells, plant cells are stationary. Cell division by construction of a phragmoplast as
a template for building a cell plate late in cytokinesis is characteristic of land plants and a few
groups of algae, the notable one being the Charophytes and the Order Trentepohliales. The sperm
of bryophytes have flagellae similar to those in animals,but higher plants, (including
Gymnosperms and flowering plants) lack the flagellae and centrioles that are present in
animal cells.[58]

Table 2: Comparison of structures between animal and plant cells

Typical animal cell

Organelle
s

Nucleus

Typical plant cell

o Nucleolus (within nucleus)

Rough endoplasmic reticulum

(ER)

Smooth ER

Ribosomes

Cytoskeleton

Golgi apparatus

Cytoplasm

Mitochondria

Vesicles

Nucleus
o Nucleolus (within nucleus)

Rough ER

Smooth ER

Ribosomes

Cytoskeleton

Golgi apparatus (dictiosomes)

Cytoplasm

Mitochondria

Plastids and its derivatives

Lysosomes

Vacuole(s)

Centrosome

Cell wall

o Centrioles

Origin of Eukaryotic organelles and endosymbiotic theory

The endosymbiotic (from the Greek: endo- meaning inside and -symbiosis meaning cohabiting)
theory was first articulated by the Russian botanist Konstantin Mereschkowski in 1905.
Mereschkowski was familiar with work by botanist Andreas Schimper, who had observed in
1883 that the division of chloroplasts in green plants closely resembled that of free-living
cyanobacteria, and who had himself tentatively proposed (in a footnote) that green plants had
arisen from a symbiotic union of two organisms. Ivan Wallin extended the idea of an
endosymbiotic origin to mitochondria in the 1920s.These theories were initially dismissed or
ignored. More detailed electron microscopic comparisons between cyanobacteria and
chloroplasts (for example studies by Hans Ris), combined with the discovery that plastids and
mitochondria contain their own DNA (which by that stage was recognized to be the hereditary
material of organisms) led to a resurrection of the idea in the 1960s. The endosymbiotic theory
was advanced and substantiated with microbiological evidence by Lynn Margulis in a 1967
paper, The Origin of Mitosing Eukaryotic Cells.[59]
In her 1981 work Symbiosis in Cell Evolution she argued that eukaryotic cells originated as
communities of interacting entities, including endosymbiotic spirochaetes that developed into
eukaryotic flagella and cilia. This last idea has not received much acceptance, because flagella
lack DNA and do not show ultrastructural similarities to bacteria or archaea. According to
Margulis and Dorion Sagan, "Life did not take over the globe by combat, but by networking"
(i.e., by cooperation). The possibility that peroxisomes may have an endosymbiotic origin has
also been considered, although they lack DNA. Christian de Duve proposed that they may have
been the first endosymbionts, allowing cells to withstand growing amounts of free molecular
oxygen in the Earth's atmosphere. However, it now appears that they may be formed de novo,
contradicting the idea that they have a symbiotic origin.
It is believed that over millennia these endosymbionts transferred some of their own DNA to the
host cell's nucleus during the evolutionary transition from a symbiotic community to an instituted
eukaryotic cell (called "serial endosymbiosis"). This hypothesis is thought to be possible because
it is known today from scientific observation that transfer of DNA occurs between bacteria
species, even if they are not closely related. Bacteria can take up DNA from their surroundings
and have a limited ability to incorporate it into their own genome.[60]
Eukaryotic organelles

Eukaryotes are one of the structurally complex cell type, and by definition are in part organized
by smaller interior compartments, that are themselves enclosed by lipid membranes that
resemble the outermost cell membrane. The larger organelles, such as the nucleus and vacuoles,
are easily visible with the light microscope. They were among the first biological discoveries
made after the invention of the microscope.[61]
Not all eukaryotic cells have each of the organelles listed below. Exceptional organisms have
cells which do not include some organelles that might otherwise be considered universal to
eukaryotes (such as mitochondria).[62] There are also occasional exceptions to the number of
membranes surrounding organelles, listed in the tables below (e.g., some that are listed as
double-membrane are sometimes found with single or triple membranes). In addition, the
number of individual organelles of each type found in a given cell varies depending upon the
function of that cell.
Major eukaryotic organelles
Organelle
Main function
Structure
Organisms
Notes
has some genes; theorized
plants,
doubleChloroplast
protists (rare to be engulfed by the
photosynthesis
membrane
(plastid)
ancestral eukaryotic cell
kleptoplastic
compartment organisms)
(endosymbiosis)
translation and folding of
rough endoplasmic
new proteins (rough
reticulum is covered with
singleEndoplasmic endoplasmic reticulum),
ribosomes, has folds that
membrane
all eukaryotes
reticulum
expression of lipids
are flat sacs; smooth
compartment
(smooth endoplasmic
endoplasmic reticulum
reticulum)
has folds that are tubular
cis-face (convex) nearest
to rough endoplasmic
singleGolgi
sorting and modification
reticulum; trans-face
membrane
all eukaryotes
apparatus
of proteins
(concave) farthest from
compartment
rough endoplasmic
reticulum
energy production
(house), Mitochondria are
has some DNA; theorized
self-replicating organelles doublemost
to be engulfed by an
Mitochondria that occur in various
membrane
eukaryotes ancestral eukaryotic cell
numbers, shapes, and
compartment
(endosymbiosis)
sizes in the cytoplasm of
all eukaryotic cells.
singlestorage, helps maintain
Vacuole
membrane
eukaryotes
homeostasis
compartment
Nucleus
It houses the cell's
doubleall eukaryotes contains bulk of genome
chromosomes, and is the membrane
place where almost all
compartment
DNA replication, RNA

transcription take place

Mitochondria and chloroplasts, which have double-membranes and their own DNA, are believed
to have originated from incompletely consumed or invading prokaryotic organisms, which were
adopted as a part of the invaded cell. This idea is supported in the Endosymbiotic theory.
Minor eukaryotic organelles and cell components
Organelle/Macromolecule
Main function
Structure
Organisms
singlehelps spermatoza fuse
Acrosome
membrane
many animals
with ovum
compartment
vesicle which sequesters doubleAutophagosome
cytoplasmic material and membrane
all eukaryotic cells
organelles for degradation compartment
anchor for Cytoskeleton, Microtubule
Centriole
animals
helps in cell division
protein
movement in or of
external medium; "critical Microtubule
animals, protists, few
cilium
developmental signaling protein
plants
pathway".[63]
green algae and other
unicellular
detects light, allowing
eEyespot apparatus
photosynthetic
phototaxis to take place
organisms such as
Euglenids
singleSome protozoa, such as
Glycosome
carries out glycolysis
membrane
Trypanosomes.
compartment
singleconversion of fat into
Glyoxysome
membrane
plants
sugars
compartment
doubleenergy & hydrogen
a few unicellular
Hydrogenosome
membrane
production
eukaryotes
compartment
breakdown of large
singleLysosome
molecules (e.g., proteins + membrane
most eukaryotes
polysaccharides)
compartment
singleMelanosome
pigment storage
membrane
animals
compartment
doublea few unicellular
Mitosome
not characterized
membrane
eukaryotes
compartment
bundled
Myofibril
muscular contraction
animals
filaments

protein-DNAmost eukaryotes
RNA
not
fungi
characterized
singlemembrane
all eukaryotes
compartment

Nucleolus

ribosome production

Parenthesome

not characterized

Peroxisome

breakdown of metabolic
hydrogen peroxide

Ribosome

translation of RNA into

proteins

RNA-protein

eukaryotes, prokaryotes

material transport

singlemembrane
compartment

all eukaryotes

vesicle

(A) Electron micrograph of Halothiobacillus neapolitanus cells, arrows highlight carboxysomes.

(B) Image of intact carboxysomes isolated from H. neapolitanus. Scale bars are 100 nm.[64]
Prokaryotic organelles
Prokaryotes are not as structurally complex as eukaryotes, and were once thought not to have any
internal structures enclosed by lipid membranes. In the past, they were often viewed as having
little internal organization; but, slowly, details are emerging about prokaryotic internal structures.
An early false turn was the idea developed in the 1970s that bacteria might contain membrane
folds termed mesosomes, but these were later shown to be artifacts produced by the chemicals
used to prepare the cells for electron microscopy.[65] [66]
However, more recent research has revealed that at least some prokaryotes have
microcompartments such as carboxysomes. These subcellular compartments are 100 - 200 nm in
diameter and are enclosed by a shell of proteins.[67] Even more striking is the description of
membrane-bound magnetosomes in bacteria,[68][69] as well as the nucleus-like structures of the
Planctomycetes that are surrounded by lipid membranes.[70]
Prokaryotic organelles and cell components
Organelle/Macromolecule
Main function
Structure
protein-shell
Carboxysome
carbon fixation
compartment
Chlorosome
photosynthesis
light harvesting

Organisms
some bacteria
green sulfur bacteria

complex
Flagellum

movement in external
medium

protein filament

Magnetosome

magnetic orientation

inorganic crystal,
lipid membrane

Nucleoid
Plasmid
Ribosome
Thylakoid

some prokaryotes
and eukaryotes
magnetotactic
bacteria

DNA maintenance,
DNA-protein
prokaryotes
transcription to RNA
DNA exchange
circular DNA
some bacteria
translation of RNA into
eukaryotes,
RNA-protein
proteins
prokaryotes
photosystem proteins
photosynthesis
mostly cyanobacteria
and pigments

E.coli as Model organism

E. coli is frequently used as a model organism in microbiology studies. Cultivated strains (e.g. E.
coli K12) are well-adapted to the laboratory environment, and, unlike wild type strains, have lost
their ability to thrive in the intestine. Many lab strains lose their ability to form biofilms. These
features protect wild type strains from antibodies and other chemical attacks, but require a large
expenditure of energy and material resources. In 1946, Joshua Lederberg and Edward Tatum first
described the phenomenon known as bacterial conjugation using E. coli as a model bacterium,
and it remains the primary model to study conjugation.[citation needed] E. coli was an integral
part of the first experiments to understand phage genetics, and early researchers, such as
Seymour Benzer, used E. coli and phage T4 to understand the topography of gene structure. Prior
to Benzer's research, it was not known whether the gene was a linear structure, or if it had a
branching pattern. E. coli was one of the first organisms to have its genome sequenced; the
complete genome of E. coli K12 was published by Science in 1997.
The long-term evolution experiments using E. coli, begun by Richard Lenski in 1988, have
allowed direct observation of major evolutionary shifts in the laboratory. In this experiment, one
population of E. coli unexpectedly evolved the ability to aerobically metabolize citrate. This
capacity is extremely rare in E. coli. As the inability to grow aerobically is normally used as a
diagnostic criterion with which to differentiate E. coli from other, closely related bacteria such as
Salmonella, this innovation may mark a speciation event observed in the lab. By combining
nanotechnologies with landscape ecology complex habitat landscapes can be generated with
details at the nanoscale. On such synthetic ecosystems evolutionary experiments with E. coli
have been performed in order to study the spatial biophysics of adaptation in an island
biogeography on-chip.
Because of its long history of laboratory culture and ease of manipulation, E. coli also plays an
important role in modern biological engineering and industrial microbiology. The work of
Stanley Norman Cohen and Herbert Boyer in E. coli, using plasmids and restriction enzymes to
create recombinant DNA, became a foundation of biotechnology. Considered a very versatile
host for the production of heterologous proteins, researchers can introduce genes into the
microbes using plasmids, allowing for the mass production of proteins in industrial fermentation

processes. Genetic systems have also been developed which allow the production of recombinant
proteins using E. coli. One of the first useful applications of recombinant DNA technology was
the manipulation of E. coli to produce human insulin. Modified E. coli have been used in vaccine
development, bioremediation, and production of immobilised enzymes. E. coli cannot, however,
be used to produce some of the more large, complex proteins which contain multiple disulfide
bonds and, in particular, unpaired thiols, or proteins that also require post-translational
modification for activity. Studies are also being performed into programming E. coli to
potentially solve complicated mathematics problems such as the Hamiltonian path problem.

Yeast in biological research

The yeast cell's life cycle:

1. Budding
2. Conjugation
3. Spore
A model organism
When researchers look for an organism to use in their studies, they look for several traits. Among
these are size, generation time, accessibility, manipulation, genetics, conservation of
mechanisms, and potential economic benefit. The yeast species S. pombe and S. cerevisiae are
both well studied; these two species diverged approximately 300 to 600 million years before
present, and are significant tools in the study of DNA damage and repair mechanisms. The alphafactor of S. cerevisiae, has been compared to the liphophilic peptide created by the fungus
Tremella mesenterica. S. cerevisiae has developed as a model organism because it scores
favorably on a number of these criteria. As a single celled organism S. cerevisiae is small with a
short generation time (doubling time 1.252 hours at 30 C (86 F)) and can be easily cultured.
These are all positive characteristics in that they allow for the swift production and maintenance
of multiple specimen lines at low cost. S. cerevisiae can be transformed allowing for either the
addition of new genes or deletion through homologous recombination. Furthermore, the ability to
grow S. cerevisiae as a haploid simplifies the creation of gene knockouts strains. As a eukaryote,
S. cerevisiae shares the complex internal cell structure of plants and animals without the high
percentage of non-coding DNA that can confound research in higher eukaryotes. S. cerevisiae
research is a strong economic driver, at least initially, as a result of its established use in industry.
[71]

Genome sequencing S. cerevisiae was the first eukaryotic genome that was completely
sequenced. The genome sequence was released in the public domain on April 24, 1996. Since
then, regular updates have been maintained at the Saccharomyces Genome Database (SGD). This
database is a highly annotated and cross-referenced database for yeast researchers. Another
important S. cerevisiae database is maintained by the Munich Information Center for Protein
Sequences (MIPS). The genome is composed of about 12,156,677 base pairs and 6,275 genes,
compactly organized on 16 chromosomes. Only about 5,800 of these are believed to be true
functional genes. Yeast is estimated to share about 23% of its genome with that of humans.
The availability of the S. cerevisiae genome sequence and the complete set of deletion mutants
has further enhanced the power of S. cerevisiae as a model for understanding the regulation of
eukaryotic cells. A project underway to analyze the genetic interactions of all double deletion
mutants through synthetic genetic array analysis will take this research one step further.
Approaches that can be applied in many different fields of biological and medicinal science have
been developed by yeast scientists. These include yeast two-hybrid for studying protein
interactions and tetrad analysis.

Principles of Biochemistry/Water: The solvent of the cell

< Principles of Biochemistry

Water is a chemical substance with the chemical formula H2O. Its molecule contains one oxygen
and two hydrogen atoms connected by covalent bonds. Water is a liquid at ambient conditions,
but it often co-exists on Earth with its solid state, ice, and gaseous state (water vapor or steam).
Water is widely distributed on Earth as freshwater and salt water in the oceans. The Earth is often
referred to as the "blue planet" because when viewed from space it appears blue. This blue color
is caused by reflection from the oceans which cover roughly 70% of the area of the Earth. The
oceanic crust is young, thin and dense, with none of the rocks within it dating from any older
than the breakup of Pangaea. Because water is much denser than any gas, this means that water
will flow into the "depressions" formed as a result of the high density of oceanic crust. (On a
planet like Venus, with no water, the depressions appear to form a vast plain above which rise
plateaux). Since the low density rocks of the continental crust contain large quantities of easily
eroded salts of the alkali and alkaline earth metals, salt has, over billions of years, accumulated
in the oceans as a result of evaporation returning the fresh water to land as rain and snow. As a
result, the vast bulk of the water on Earth is regarded as saline or salt water, with an average
salinity of 35 (or 3.5%, roughly equivalent to 35 grams of salts in 1kg of seawater), though
this varies slightly according to the amount of runoff received from surrounding land. In all,
oceanic water, saline water from marginal seas, and water from saline closed lakes amounts to
over 98% of the water on Earth, though no closed lake stores a globally significant amount of
water. Renewable saline groundwater is believed to total at least 100 km globally, but is seldom

considered except when evaluating water quality in arid regions. The remainder of the Earth's
water constitutes the planet's fresh water resource. Typically, fresh water is defined as water with
a salinity of less than 1 percent that of the oceans - i.e. below around 0.35. Water with a
salinity between this level and 1 is typically referred to as marginal water because it is
marginal for many uses by humans and animals. The planet's fresh water is also very unevenly
distributed. Although in warm periods such as the Mesozoic and Paleogene when there were no
glaciers anywhere on the planet all fresh water was found in rivers and streams, today the
distribution is approximately as follows: Ice caps and glaciers - 68.7%, of which Antarctic ice
cap - 90%, 9700 years renewal interval Greenland ice cap - 9% Other glaciers - <1%, 1600 years
renewal interval Groundwater - 30.1%, 1400 year renewal interval Surface water - 0.3%, of
which Freshwater lakes - 87%, 17 years renewal interval Swamps - 11% Rivers - 2%, 16 days
renewal interval Ground ice and permafrost - 0.86% Atmosphere 0.04% Of these sources, only
river water is generally valuable. Most water in lakes is in very inhospitable regions such as
glacial lakes of Canada. Lake Baikal and Lake Khvsgl, both protected from Quaternary
glaciation by aridity, have equivalent amounts of water, and the latter has been used in Mongolia
as a source of drinking water.. Although the total volume of groundwater is known to be much
greater than that of river runoff, a large proportion of this groundwater is saline and should
therefore be classified with the saline water above. There is also a lot of fossil groundwater in
arid regions that has never been renewed for thousands of years; this must not be seen as
renewable water. However, fresh groundwater is of great value, especially in arid countries such
as India. Its distribution is broadly similar to that of surface river water, but it is easier to store in
hot and dry climates because groundwater storages are much more shielded from evaporation
than are dams. In countries such as Yemen, groundwater from erratic rainfall during the rainy
season is the major source of irrigation water. Because groundwater recharge is much more
difficult to accurately measure than surface runoff, groundwater is not generally used in areas
where even fairly limited levels of surface water are available. Even today, estimates of total
groundwater recharge vary greatly for the same region depending on what source is used, and
cases where fossil groundwater is exploited beyond the recharge rate (including the Ogallala
Aquifer) are very frequent and almost always not seriously considered when they were first
developed.[1]
Contents

1 Properties of water

2 Hydrogen bonding in water

3 Strong acids and bases

o

3.1 Weak acids and weak bases

4 Acid dissociation constant and pKa

4.1 HendersonHasselbalch equation

5 pKa and gibbs free energy

6 Buffers
o

6.1 Common buffer compounds used in biology [23]

7 What is pH?
o

7.1 Mathematical definition

7.2 p[H]

7.3 pOH

8 References

Properties of water

Water appears in nature in all three common states of matter and may take many different forms
on Earth: water vapor and clouds in the sky; seawater and icebergs in the polar oceans; glaciers
and rivers in the mountains; and the liquid in aquifers in the ground. At high temperatures and
pressures, such as in the interior of giant planets, it is argued that water exists as ionic water in
which the molecules break down into a soup of hydrogen and oxygen ions, and at even higher
pressures as superionic water in which the oxygen crystallises but the hydrogen ions float around
freely within the oxygen lattice. The major chemical and physical properties of water are: Water
is a liquid at standard temperature and pressure. It is tasteless and odorless. The intrinsic color of
water and ice is a very slight blue hue, although both appear colorless in small quantities. Water
vapor is essentially invisible as a gas. Water is transparent in the visible electromagnetic
spectrum. Thus aquatic plants can live in water because sunlight can reach them. Ultra-violet and
infrared light is strongly absorbed.[2]
Since the water molecule is not linear and the oxygen atom has a higher electronegativity than
hydrogen atoms, it carries a slight negative charge, whereas the hydrogen atoms are slightly
positive. As a result, water is a polar molecule with an electrical dipole moment. Water also can
form an unusually large number of intermolecular hydrogen bonds (four) for a molecule of its
size. These factors lead to strong attractive forces between molecules of water, giving rise to
water's high surface tension and capillary forces. The capillary action refers to the tendency of
water to move up a narrow tube against the force of gravity. This property is relied upon by all
vascular plants, such as trees.[3]
Water is a good solvent and is often referred to as the universal solvent. Substances that dissolve
in water, e.g., salts, sugars, acids, alkalis, and some gases especially oxygen, carbon dioxide

(carbonation) are known as hydrophilic (water-loving) substances, while those that do not mix
well with water (e.g., fats and oils), are known as hydrophobic (water-fearing) substances.
All the major components in cells (proteins, DNA and polysaccharides) are also dissolved in
water.
Pure water has a low electrical conductivity, but this increases significantly with the dissolution
of a small amount of ionic material such as sodium chloride.
The boiling point of water (and all other liquids) is dependent on the barometric pressure. For
example, on the top of Mt. Everest water boils at 68 C (154 F), compared to 100 C (212 F) at
sea level. Conversely, water deep in the ocean near geothermal vents can reach temperatures of
hundreds of degrees and remain liquid.
Water has the second highest molar specific heat capacity of any known substance, after
ammonia, as well as a high heat of vaporization (40.65 kJmol1), both of which are a result of
the extensive hydrogen bonding between its molecules. These two unusual properties allow
water to moderate Earth's climate by buffering large fluctuations in temperature.

Density of ice and water as a function of temperature

The maximum density of water occurs at 3.98 C (39.16 F). It has the anomalous property of
becoming less dense, not more, when it is cooled down to its solid form, ice. It expands to
occupy 9% greater volume in this solid state, which accounts for the fact of ice floating on liquid
water. Its Density is 1,000 kg/m3 liquid (4 C), and weighs 62.4 lb/ft.3 (917 kg/m3, solid). It
weighs 8.3454 lb/gal. (US, liquid)

ADR label for transporting goods dangerously reactive with water

Water is miscible with many liquids, such as ethanol, in all proportions, forming a single
homogeneous liquid. On the other hand, water and most oils are immiscible usually forming
layers according to increasing density from the top. As a gas, water vapor is completely miscible
with air.

Water forms an azeotrope with many other solvents.

Water can be split by electrolysis into hydrogen and oxygen. As an oxide of hydrogen, water is
formed when hydrogen or hydrogen-containing compounds burn or react with oxygen or
oxygen-containing compounds. Water is not a fuel, it is an end-product of the combustion of
hydrogen. The energy required to split water into hydrogen and oxygen by electrolysis or any
other means is greater than the energy that can be collected when the hydrogen and oxygen
recombine. Elements which are more electropositive than hydrogen such as lithium, sodium,
calcium, potassium and caesium displace hydrogen from water, forming hydroxides. Being a
flammable gas, the hydrogen given off is dangerous and the reaction of water with the more
electropositive of these elements may be violently explosive.
Water is fundamental to photosynthesis and respiration. Photosynthetic cells use the sun's energy
to split off water's hydrogen from oxygen. Hydrogen is combined with CO2 (absorbed from air
or water) to form glucose and release oxygen. All living cells use such fuels and oxidize the
hydrogen and carbon to capture the sun's energy and reform water and CO2 in the process
(cellular respiration).
Water is also central to acid-base neutrality and enzyme function. An acid, a hydrogen ion (H+,
that is, a proton) donor, can be neutralized by a base, a proton acceptor such as hydroxide ion
(OH) to form water. Water is considered to be neutral, with a pH (the negative log of the
hydrogen ion concentration) of 7. Acids have pH values less than 7 while bases have values
greater than 7.[4]
Hydrogen bonding in water

Crystal structure of hexagonal ice. Gray dashed lines indicate hydrogen bonds

Model of hydrogen bonds between molecules of water

The most ubiquitous, and perhaps simplest, example of a hydrogen bond is found between water
molecules. In a discrete water molecule, there are two hydrogen atoms and one oxygen atom.
Two molecules of water can form a hydrogen bond between them; the simplest case, when only
two molecules are present, is called the water dimer and is often used as a model system. When
more molecules are present, as is the case of liquid water, more bonds are possible because the
oxygen of one water molecule has two lone pairs of electrons, each of which can form a
hydrogen bond with a hydrogen on another water molecule. This can repeat such that every
water molecule is H-bonded with up to four other molecules, as shown in the figure (two through
its two lone pairs, and two through its two hydrogen atoms). Hydrogen bonding strongly affects
the crystal structure of ice, helping to create an open hexagonal lattice. The density of ice is less
than water at the same temperature; thus, the solid phase of water floats on the liquid, unlike
most other substances. Liquid water's high boiling point is due to the high number of hydrogen
bonds each molecule can form relative to its low molecular mass. Owing to the difficulty of
breaking these bonds, water has a very high boiling point, melting point, and viscosity compared
to otherwise similar liquids not conjoined by hydrogen bonds. Water is unique because its
oxygen atom has two lone pairs and two hydrogen atoms, meaning that the total number of
bonds of a water molecule is up to four. For example, hydrogen fluoridewhich has three lone
pairs on the F atom but only one H atomcan form only two bonds; (ammonia has the opposite
problem: three hydrogen atoms but only one lone pair). H-F...H-F...H-F The exact number of
hydrogen bonds formed by a molecule of liquid water fluctuates with time and depends on the
temperature. From TIP4P liquid water simulations at 25 C, it was estimated that each water
molecule participates in an average of 3.59 hydrogen bonds. At 100 C, this number decreases to
3.24 due to the increased molecular motion and decreased density, while at 0 C, the average
number of hydrogen bonds increases to 3.69. A more recent study found a much smaller number
of hydrogen bonds: 2.357 at 25 C. The differences may be due to the use of a different method
for defining and counting the hydrogen bonds. Where the bond strengths are more equivalent,
one might instead find the atoms of two interacting water molecules partitioned into two
polyatomic ions of opposite charge, specifically hydroxide (OH) and hydronium (H3O+).
(Hydronium ions are also known as 'hydroxonium' ions.) H-O H3O+ Indeed, in pure water

under conditions of standard temperature and pressure, this latter formulation is applicable only
rarely; on average about one in every 5.5 108 molecules gives up a proton to another water
molecule, in accordance with the value of the dissociation constant for water under such
conditions. It is a crucial part of the uniqueness of water.[5]
Strong acids and bases

Strong acids and bases are those that, for practical purposes, completely dissociated (ionize) in
water. Hydrochloric acid (HCl) is a good example of a strong acid.
A commonly encountered problem is to calculate the pH of a solution of a given concentration of
a strong acid. Normally, the concentration of the acid will be very high compared to the baseline
concentration of H+ ions in pure water, which is 107 molar. Under these conditions, the H+ ion
concentration is very nearly that of the acid concentration, and the pH is calculated simply by
taking the negative logarithm of that value[6]
For example, for a 0.01M solution of HCl, the H+ concentration can be taken as 0.01M, and the
pH is log(0.01). That is, pH = 2.
For very weak concentrations, i.e. concentrations around 106M or less, the baseline
concentration of H+ ions in pure water becomes significant, and must be taken into account.[7] A
method of solution is as follows. At equilibrium, any aqueous solution must satisfy the
dissociation equilibrium equation for water[8],

Another constraint is that the nominal concentration of the acid must be preserved. The nominal
concentration is designated Ca, and is equivalent to the amount of acid that is initially added to
the reaction. This is known as the mass balance equation, and can be written,

Where "HA" refers to the protonated form of the acid, and "A" to the conjugate base anion.
Note that for a given reaction, Ca is constant. This equation is merely saying that the molecules
of acid can either be protonated or ionized, but that the total number will stay the same.
For a strong acid which is completely dissociated, [A] >> [HA], and the [HA] term can be
dropped:

Another relationship that must be satisfied is known as the electroneutrality principle, or the
charge balance equation, and is the statement that the total charge of the solution must be zero.
So the sum of all the negative ion charges must equal the sum of the positive ion charges. This
can be written,

For a strong acid, one can use Ca in place of [A], and eliminate [OH] from this equation by
substituting the value derived from the equilibrium equation for water, [OH] = Kw / [H+]. Thus,

Putting this into the form of a quadratic equation,

Which is readily solved for [H+].

For example, to find the pH of a solution of 5108M of HCl, first note that this concentration is
small compared to the baseline concentration of [H+] in water (107). So the quadratic equation
derived above should be used.

Weak acids and weak bases

The problem in this case would be to determine the pH of a solution of a specific concentration
of an acid, when that acid's pKa or Ka (acid dissociation constant) is given.
In this case, the acid is not completely dissociated, but the degree of dissociation is given by the
equilibrium equation for that acid:

The mass balance and charge balance equations can be applied here as well, but in the case of a
weak acid, the acid is not completely dissociated, and thus the assumption [A] >> [HA] is not
valid. Therefore the mass balance equation is

Unless the acid is very weak, or the concentration is very dilute, it it reasonable to assume that
the concentration of [H+] is much greater than the concentration of [OH]. This assumption
simplifies the calculation and can be verified after the result is found. Note that this is equivalent
to the assumption that the pH value is lower than about 6. With this assumption, the charge
balance equation is

There are three equations with three unknowns ([H+], [A], and [HA]), which need to be solved
for [H+]. The mass balance equation allows to solve for [HA] in terms of [H+]:

And then plug these into the equilibrium equation for the acid

Rearrange this to put it in the form of a quadratic equation,

The ICE table allows to evaluate the differences in concentrations before and after the reaction
basically, it is a mnemonic device for implementing the mass balance and charge balance
equations for a given reaction, by accounting for the movements of the acid molecules and the
charges. The equation derived by using the ICE table is the same as the quadratic equation given
above[9].
For example, consider a problem of finding the pH of a 0.01M solution of benzoic acid, given
that, for this acid, Ka = 6.5105 (pKa = 4.19).
The equilibrium equation for this reaction is

One can neglect the [OH] concentration, hoping that the final answer will by pH < 6. Then [H+]
= [A], and the equilibrium equation becomes

The mass balance equation is

Solving for [HA] yields

and plugging that into the equilbrium equation, results in the quadratic equation

Which gives the answer

Thus the assumption that pH < 6 was valid, and the [OH] concentration might well be ignored.

Acetic acid, a weak acid, donates a proton (hydrogen ion, highlighted in green) to
water in an equilibrium reaction to give the acetate ion and the hydronium ion. Red:
oxygen, black: carbon, white: hydrogen.
[10]

Acid dissociation constant and pKa

An acid dissociation constant, Ka, (also known as acidity constant, or acid-ionization

constant) is a quantitative measure of the strength of an acid in solution. It is the equilibrium
constant for a chemical reaction known as dissociation in the context of acid-base reactions. The
equilibrium can be written symbolically as:

HA = A + H+,

where HA is a generic acid that dissociates by splitting into A, known as the conjugate base of
the acid, and the hydrogen ion or proton, H+, which, in the case of aqueous solutions, exists as a
solvated hydronium ion. In the example shown in the figure, HA represents acetic acid, and A
the acetate ion. The chemical species HA, A and H+ are said to be in equilibrium when their
concentrations do not change with the passing of time. The dissociation constant is usually
written as a quotient of the equilibrium concentrations (in mol/L), denoted by [HA], [A] and
[H+]:

Due to the many orders of magnitude spanned by Ka values, a logarithmic measure of the acid
dissociation constant is more commonly used in practice. pKa, which is equal to log10 Ka, may
also be (incorrectly) referred to as an acid dissociation constant:
In the case of multiple pK values they are designated by indices: pK1, pK2, pK3 and so on. For
amino acids, the pK1 constant refers to its carboxyl (-COOH) group, pK2 refers to its amino (NH3) group and the pK3 is the pK value of its side chain.

According to Arrhenius's original definition, an acid is a substance that dissociates in aqueous

solution, releasing the hydrogen ion H+ (a proton):[11]
HA = A + H+.

The equilibrium constant for this dissociation reaction is known as a dissociation constant. The
liberated proton combines with a water molecule to give a hydronium (or oxonium) ion H3O+,
and so Arrhenius later proposed that the dissociation should be written as an acidbase reaction:

HA + H2O = A + H3O+.

Brnsted and Lowry generalised this further to a proton exchange reaction:[12][13][14]

acid + base = conjugate base + conjugate acid.

The acid loses a proton, leaving a conjugate base; the proton is transferred to the base, creating a
conjugate acid. For aqueous solutions of an acid HA, the base is water; the conjugate base is A
and the conjugate acid is the hydronium ion. The BrnstedLowry definition applies to other
solvents, such as dimethyl sulfoxide: the solvent S acts as a base, accepting a proton and forming
the conjugate acid SH+.
In solution chemistry, it is common to use H+ as an abbreviation for the solvated hydrogen ion,
regardless of the solvent. In aqueous solution H+ denotes a solvated hydronium ion rather than a
proton.[15][16]
The designation of an acid or base as "conjugate" depends on the context. The conjugate acid
BH+ of a base B dissociates according to
BH+ + OH = B + H2O

which is the reverse of the equilibrium

H2O (acid) + B (base) = OH (conjugate base) + BH+ (conjugate acid).

The hydroxide ion OH, a well known base, is here acting as the conjugate base of the acid
water. Acids and bases are thus regarded simply as donors and acceptors of protons respectively.
A broader definition of acid dissociation includes hydrolysis, in which protons are produced by
the splitting of water molecules. For example, boric acid (B(OH)3) acts as a weak acid, even
though it is not a proton donor, because of the hydrolysis equilibrium
B(OH)3 + 2 H2O = B(OH)4 + H3O+.

Similarly, metal ion hydrolysis causes ions such as [Al(H2O)6]3+ to behave as weak acids:[17]
[Al(H2O)6]3+ +H2O =} [Al(H2O)5(OH)]2+ + H3O+.

pKa values of different amino acids are given in the table.

Amino Acid
Alanine

Short Abbrev. Avg. Mass (Da)

A

Ala

89.09404

pI
6.01

pK1
pK2
(-COOH) (-+NH3)
2.35

9.87

Amino Acid

Short Abbrev. Avg. Mass (Da)

pI

pK1
pK2
(-COOH) (-+NH3)

Cysteine

Cys

121.15404

5.05

1.92

10.70

Aspartic acid

Asp

133.10384

2.85

1.99

9.90

Glutamic acid

Glu

147.13074

3.15

2.10

9.47

Phenylalanine

Phe

165.19184

5.49

2.20

9.31

Glycine

Gly

75.06714

6.06

2.35

9.78

Histidine

His

155.15634

7.60

1.80

9.33

Isoleucine

Ile

131.17464

6.05

2.32

9.76

Lysine

Lys

146.18934

9.60

2.16

9.06

Leucine

Leu

131.17464

6.01

2.33

9.74

Methionine

Met

149.20784

5.74

2.13

9.28

Asparagine

Asn

132.11904

5.41

2.14

8.72

Pyrrolysine

Pyl

Proline

Pro

115.13194

6.30

1.95

10.64

Glutamine

Gln

146.14594

5.65

2.17

9.13

Arginine

Arg

174.20274

10.76

1.82

8.99

Serine

Ser

105.09344

5.68

2.19

9.21

Threonine

Thr

119.12034

5.60

2.09

9.10

Selenocysteine

Sec

168.053

Valine

Val

117.14784

6.00

2.39

9.74

Tryptophan

Trp

204.22844

5.89

2.46

9.41

Tyrosine

Tyr

181.19124

5.64

2.20

9.21

HendersonHasselbalch equation

Lawrence Joseph Henderson wrote an equation, in 1908, describing the use of carbonic acid as a
buffer solution. Karl Albert Hasselbalch later re-expressed that formula in logarithmic terms,
resulting in the HendersonHasselbalch equation . Hasselbalch was using the formula to study
metabolic acidosis.

The HendersonHasselbalch equation is derived from the acid dissociation constant equation by
the following steps[18][19]:

or

The ratio

is unitless, and as such, other ratios with other units may be used. For

example, the mole ratio of the components,

where
are more convenient to use.

or the fractional concentrations

will yield the same answer. Sometimes these other units

pKa and gibbs free energy

An equilibrium constant is related to the standard Gibbs energy change for the reaction, so for an
acid dissociation constant
G

= RT ln Ka.

R is the gas constant and T is the absolute temperature. Note that pKa= log Ka and 2.303 ln 10.
At 25 C G in kJmol1 = 5.708 pKa (1 kJmol1 = 1000 Joules per mole). Free energy is made
up of an enthalpy term and an entropy term.[20]
G

= H

TS

The standard enthalpy change can be determined by calorimetry or by using the van 't Hoff
equation, though the calorimetric method is preferable. When both the standard enthalpy change
and acid dissociation constant have been determined, the standard entropy change is easily
calculated from the equation above. In the following table, the entropy terms are calculated from
the experimental values of pKa and H . The data were critically selected and refer to 25 C
and zero ionic strength, in water.[20]
Acids
Compound

Equilibrium

pKa

G
/kJmol1

H
/kJmol1

TS
/kJmol1

HA = Acetic
acid

HA = H+ + A

4.75
6

22.147

0.41

22.56

H2A+ =
GlycineH+

H2A+ = HA + H+

2.35
1

13.420

4.00

9.419

HA = H+ + A

9.78

55.825

44.20

11.6

H2A = HA + H+

1.92

10.76

1.10

9.85

HA = H+ + A2

6.27

35.79

3.60

39.4

H3A = H2A + H+

3.12
8

17.855

4.07

13.78

H2A = HA2 + H+

4.76

27.176

2.23

24.9

HA2 = A3 + H+

6.40

36.509

3.38

39.9

Boric acid

B(OH)3 + H2O
9.23
Template:Eqm [B(OH)4]- +
7
H+

52.725

13.80

38.92

H 3A =
Phosphoric
acid

H3A Template:Eqm H2A + 2.14

H+
8

12.261

8.00

20.26

H2A = HA2 + H+

7.20

41.087

3.60

37.5

HA2 = A3 + H+

12.3
5

80.49

16.00

54.49

HA Template:Eqm A2 +
H+

1.99

11.36

22.40

33.74

H2A = Maleic
acid

H3A = Citric
acid

Hydrogen
sulfate

H2A = Oxalic
acid

TS

H2A Template:Eqm HA +
H+

1.27

7.27

3.90

11.15

HA = A2 + H+

4.26
6

24.351

7.00

31.35

= 2.303RT pKa
= G

Buffers

Buffer solutions achieve their resistance to pH change because of the presence of an equilibrium
between the acid HA and its conjugate base A-. HA = H+ + A- When some strong acid is added
to an equilibrium mixture of the weak acid and its conjugate base, the equilibrium is shifted to
the left, in accordance with Le Chatelier's principle. Because of this, the hydrogen ion
concentration increases by less than the amount expected for the quantity of strong acid added.
Similarly, if strong alkali is added to the mixture the hydrogen ion concentration decreases by
less than the amount expected for the quantity of alkali added. The effect is illustrated by the
simulated titration of a weak acid with pKa = 4.7. The relative concentration of undissociated
acid is shown in blue and of its conjugate base in red. The pH changes relatively slowly in the
buffer region, pH = pKa 1, centered at pH = 4.7 where [HA] = [A-], but once the acid is more
than 95% deprotonated the pH rises much more rapidly.[21]
Buffer solutions are necessary to keep the correct pH for enzymes in many organisms to work.
Many enzymes work only under very precise conditions; if the pH moves outside of a narrow
range, the enzymes slow or stop working and can denature, thus permanently disabling their
catalytic activity. A buffer of carbonic acid (H2CO3) and bicarbonate (HCO3) is present in
blood plasma, to maintain a pH between 7.35 and 7.45. Industrially, buffer solutions are used in
fermentation processes and in setting the correct conditions for dyes used in colouring fabrics.
They are also used in chemical analysis and calibration of pH meters. The majority of biological
samples that are used in research are made in buffers, especially phosphate buffered saline (PBS)
at pH 7.4.[22]
Common buffer compounds used in biology [23]
Temp
pKa Buffe
Effect Mol.
Common at
r
dpH/dT Weig
Name 25 Rang
in (1/K) ht
C
e
**
TAPS

8.43 7.7
9.1

0.018 243.3

Full Compound Name

3{[tris(hydroxymethyl)methyl]amino}propane

sulfonic acid
Bicine

8.35

7.6
9.0

0.018 163.2

Tris

8.06

7.5
9.0

0.028

Tricine

8.05

7.4
8.8

0.021 179.2

TAPSO

7.63
5

7.08.2

259.3

HEPES

7.55

6.8
8.2

0.014 238.3

TES

6.8
7.40
8.2

121.1
4

N,N-bis(2-hydroxyethyl)glycine
tris(hydroxymethyl)methylamine
N-tris(hydroxymethyl)methylglycine
3-[N-Tris(hydroxymethyl)methylamino]-2hydroxypropanesulfonic Acid
4-2-hydroxyethyl-1-piperazineethanesulfonic
acid

2229.2
0.020
{[tris(hydroxymethyl)methyl]amino}ethanes
0
ulfonic acid

MOPS

7.20

6.5
7.9

0.015 209.3

3-(N-morpholino)propanesulfonic acid

PIPES

6.76

6.1
7.5

0.008 302.4

piperazine-N,N-bis(2-ethanesulfonic acid)

Cacodylat
5.0
6.27
e
7.4

138.0

dimethylarsinic acid
saline sodium citrate

SSC

7.0

6.57.5

189.1

MES

6.15

5.5
6.7

0.011 195.2

2-(N-morpholino)ethanesulfonic acid

** Values are approximate.

What is pH?

The concept of p[H] was first introduced by Danish chemist Sren Peder Lauritz Srensen at the
Carlsberg Laboratory in 1909 and revised to the modern pH in 1924 after it became apparent that
electromotive force in cells depends on activity rather than concentration of hydrogen ions. In
the first papers, the notation had the H as a subscript to the lowercase p, like so: pH. It is
unknown what the exact definition of 'p' in pH is. A common definition often used in schools is
"percentage". However some references suggest the p stands for Power, others refer to the
German word Potenz (meaning power in German), still others refer to potential. Jens Norby
published a paper in 2000 arguing that p is a constant and stands for negative logarithm; H

then stands for Hydrogen. According to the Carlsberg Foundation pH stands for "power of
hydrogen". Other suggestions that have surfaced over the years are that the p stands for
puissance (also meaning power, but, then, the Carlsberg Laboratory was French-speaking) or that
pH stands for the Latin terms pondus Hydrogenii or potentia hydrogenii. It is also suggested that
Srensen used the letters p and q (commonly paired letters in mathematics) simply to label the
test solution (p) and the reference solution (q)[24].

Some typical pH values

Pure (neutral) water has a pH around 7 at 25 C (77 F); this value varies with temperature.
When an acid is dissolved in water, the pH will be less than 7 (if at 25 C (77 F)). When a base,
or alkali, is dissolved in water, the pH will be greater than 7 (if at 25 C (77 F)). A solution of a
strong acid, such as hydrochloric acid, at concentration 1 mol dm3 has a pH of 0. A solution of a
strong alkali, such as sodium hydroxide, at concentration 1 mol dm3, has a pH of 14. Thus,
measured pH values will lie mostly in the range 0 to 14. Since pH is a logarithmic scale, a
difference of one pH unit is equivalent to a tenfold difference in hydrogen ion concentration[25].
Because the glass electrode (and other ion selective electrodes) responds to activity, the electrode
should be calibrated in a medium similar to the one being investigated. For instance, if one
wishes to measure the pH of a seawater sample, the electrode should be calibrated in a solution
resembling seawater in its chemical composition, as detailed below.

An approximate measure of pH may be obtained by using a pH indicator. A pH indicator is a

substance that changes color around a particular pH value. It is a weak acid or weak base and the
color change occurs around 1 pH unit either side of its acid dissociation constant, or pKa, value.
For example, the naturally occurring indicator litmus is red in acidic solutions (pH<7 at 25 C
(77 F)) and blue in alkaline (pH>7 at 25 C (77 F)) solutions. Universal indicator consists of a
mixture of indicators such that there is a continuous color change from about pH 2 to pH 10.
Universal indicator paper is simple paper that has been impregnated with universal indicator.[26]
Universal indicator components
Indicator

Low pH
color

Transition pH
range

High pH
color

Thymol blue (first transition)

Red

1.2 2.8

Yellow

Methyl red

Red

4.4 6.2

Yellow

Bromothymol blue

Yellow

6.0 7.6

Blue

Thymol blue (second transition) Yellow

8.0 9.6

Blue

Phenolphthalein

8.3 10.0

Fuchsia

Colorless

A solution whose pH is 7 (at 25 C (77 F)) is said to be neutral, that is, it is neither acidic nor
basic. Water is subject to a self-ionization process.
H2O = H+ + OH

The dissociation constant, KW, has a value of about 1014, so, in neutral solution of a salt, both the
hydrogen ion concentration and hydroxide ion concentration are about 107 mol dm3. The pH of
pure water decreases with increasing temperatures. For example, the pH of pure water at 50 C is
6.55. Note, however, that water that has been exposed to air is mildly acidic. This is because
water absorbs carbon dioxide from the air, which is then slowly converted into carbonic acid,
which dissociates to liberate hydrogen ions:
CO2 + H2O = H2CO3 = HCO3 + H+
Mathematical definition

pH is defined as a negative decimal logarithm of the hydrogen ion activity in a solution.[27]

where aH is the activity of hydrogen ions in units of Mol/L (molar concentration). Activity has a
sense of concentration, however activity is always less than the concentration and is defined as a

concentration (Mol/L) of an ion multiplied by activity coefficient. The activity coefficient for
diluted solutions is a real number between 0 and 1 (for concentrated solutions may be greater
than 1) and it depends on many parameters of a solution, such as nature of ion, ion force,
temperature, etc. For a strong electrolyte, activity of an ion approaches its concentration in
diluted solutions. Activity can be measured experimentally by means of an ion-selective
electrode that responds, according to the Nernst equation, to hydrogen ion activity. pH is
commonly measured by means of a glass electrode connected to a milli-voltmeter with very high
input impedance, which measures the potential difference, or electromotive force, E, between an
electrode sensitive to the hydrogen ion activity and a reference electrode, such as a calomel
electrode or a silver chloride electrode. Quite often, glass electrode is combined with the
reference electrode and a temperature sensor in one body. The glass electrode can be described
(to 9599.9% accuracy) by the Nernst equation[28]:

where E is a measured potential , E0 is the standard electrode potential, that is, the electrode
potential for the standard state in which the activity is one. R is the gas constant, T is the
temperature in kelvins, F is the Faraday constant, and n is the number of electrons transferred
(ion charge), one in this instance. The electrode potential, E, is proportional to the logarithm of
the hydrogen ion activity.
This definition, by itself, is wholly impractical, because the hydrogen ion activity is the product
of the concentration and an activity coefficient. To get proper results, the electrode must be
calibrated using standard solutions of known activity.
The operational definition of pH is officially defined by International Standard ISO 31-8 as
follows:[29] For a solution X, first measure the electromotive force EX of the galvanic cell
reference electrode|concentrated solution of KCl || solution X|H 2|Pt

and then also measure the electromotive force ES of a galvanic cell that differs from the above
one only by the replacement of the solution X of unknown pH, pH(X), by a solution S of a
known standard pH, pH(S). The pH of X is then

The difference between the pH of solution X and the pH of the standard solution depends only on
the difference between two measured potentials. Thus, pH is obtained from a potential measured
with an electrode calibrated against one or more pH standards; a pH meter setting is adjusted
such that the meter reading for a solution of a standard is equal to the value pH(S). Values pH(S)

for a range of standard solutions S, along with further details, are given in the IUPAC
recommendations.[30] The standard solutions are often described as standard buffer solution. In
practice, it is better to use two or more standard buffers to allow for small deviations from
Nernst-law ideality in real electrodes. Note that, because the temperature occurs in the defining
equations, the pH of a solution is temperature-dependent.
Measurement of extremely low pH values, such as some very acidic mine waters,[31] requires
special procedures. Calibration of the electrode in such cases can be done with standard solutions
of concentrated sulfuric acid, whose pH values can be calculated with using Pitzer parameters to
calculate activity coefficients.[32]
pH is an example of an acidity function. Hydrogen ion concentrations can be measured in nonaqueous solvents, but this leads, in effect, to a different acidity function, because the standard
state for a non-aqueous solvent is different from the standard state for water. Superacids are a
class of non-aqueous acids for which the Hammett acidity function, H0, has been developed.[33]
p[H]

This was the original definition of Srensen, which was superseded in favour of pH in 1924.
However, it is possible to measure the concentration of hydrogen ions directly, if the electrode is
calibrated in terms of hydrogen ion concentrations. One way to do this, which has been used
extensively, is to titrate a solution of known concentration of a strong acid with a solution of
known concentration of strong alkali in the presence of a relatively high concentration of
background electrolyte. Since the concentrations of acid and alkali are known, it is easy to
calculate the concentration of hydrogen ions so that the measured potential can be correlated
with concentrations. The calibration is usually carried out using a Gran plot.[34] The calibration
yieds a value for the standard electrode potential, E0, and a slope factor, f, so that the Nernst
equation in the form

can be used to derive hydrogen ion concentrations from experimental measurements of E. The
slope factor is usually slightly less than one. A slope factor of less than 0.95 indicates that the
electrode is not functioning correctly. The presence of background electrolyte ensures that the
hydrogen ion activity coefficient is effectively constant during the titration. As it is constant, its
value can be set to one by defining the standard state as being the solution containing the
background electrolyte. Thus, the effect of using this procedure is to make activity equal to the
numerical value of concentration.[35]

The difference between p[H] and pH is quite small. It has been stated Section 13.23,
"Determination of pH"</ref> that pH = p[H] + 0.04. It is common practice to use the term "pH"
for both types of measurement.
pH in living systems[36]
Compartment

pH

Gastric acid

Lysosomes

4.5

Granules of chromaffin cells

5.5

Human skin

5.5

Urine

6.0

Neutral H2O at 37 C

6.81

Cytosol

7.2

Cerebrospinal fluid (CSF)

7.3

Blood

7.347.45

Mitochondrial matrix

7.5

Pancreas secretions

8.1

pOH

pOH is sometimes used as a measure of the concentration of hydroxide ions, OH, or alkalinity.
pOH is not measured independently, but is derived from pH. The concentration of hydroxide ions
in water is related to the concentration of hydrogen ions by
[OH] = KW /[H+]

where KW is the self-ionisation constant of water. Taking cologarithms

pOH = pKW pH.

So, at room temperature pOH 14 pH. However this relationship is not strictly valid in other
circumstances, such as in measurements of soil alkalinity.

General symptoms of acidosis,resulting from decrease in body pH.

The pH of different cellular compartments, body fluids, and organs is usually tightly regulated in
a process called acid-base homeostasis.
The pH of blood is usually slightly basic with a value of pH 7.365. This value is often referred to
as physiological pH in biology and medicine.
Plaque can create a local acidic environment that can result in tooth decay by demineralisation.
Enzymes and other proteins have an optimum pH range and can become inactivated or denatured
outside this range.
The most common disorder in acid-base homeostasis is acidosis, which means an acid overload
in the body, generally defined by pH falling below 7.35.
In the blood, pH can be estimated from known base excess (be) and bicarbonate concentration
(HCO3) by the following equation:[37]

Principles of Biochemistry/Chromosome and its structure

< Principles of Biochemistry

In a series of experiments beginning in the mid-1880s, Theodor Boveri gave the definitive
demonstration that chromosomes are the vectors of heredity. His two principles were the

continuity of chromosomes and the individuality of chromosome. It is the second of these

principles that was so original.Wilhelm Roux suggested that each chromosome carries a different
genetic load. Boveri was able to test and confirm this hypothesis. Aided by the rediscovery at the
start of the 1900s of Gregor Mendel's earlier work, Boveri was able to point out the connection
between the rules of inheritance and the behaviour of the chromosomes. Boveri influenced two
generations of American cytologists: Edmund Beecher Wilson, Walter Sutton and Theophilus
Painter were all influenced by Boveri (Wilson and Painter actually worked with him). In his
famous textbook The Cell in Development and Heredity, Wilson linked together the independent
work of Boveri and Sutton (both around 1902) by naming the chromosome theory of inheritance
the "Sutton-Boveri Theory" (the names are sometimes reversed). Ernst Mayr remarks that the
theory was hotly contested by some famous geneticists: William Bateson, Wilhelm Johannsen,
Richard Goldschmidt and T.H. Morgan, all of a rather dogmatic turn-of-mind. Eventually,
complete proof came from chromosome maps in Morgan's own lab.[1]

Human chromosomes during metaphase.

Chromatin on the phases of the cell cycle (1) double chain of deoxyribonucleic acid
(DNA). (2) chromatin (deoxyribonucleic acid single chain and histones) (3)
chromatin in interphase (blue) and centromere (red) (4) dense chromatin during
prophase (5) Chromosomes at metaphase
Contents

1 Chromosome
o

1.1 Chromatin

1.2 Packaging of DNA in chromatin

2 Histone:The DNA binding protein

o

2.1 The nucleosome and "beads-on-a-string"

2.2 30 nm chromatin fibre

2.3 Spatial organization of chromatin in the cell nucleus

2.4 Human chromosomes

3 What is nucleoid?
o

1.2.1 Chromatin and Watson/Crick base pairing

3.1 Circular bacterial chromosome

4 Structure of Eukaryotic chromosome

o

4.1 Centromere

4.2 Centromere positions

4.3 Metacentric

4.4 Submetacentric

4.5 Acrocentric

4.6 Telocentric

4.7 Subtelocentric

4.8 Holocentric

4.9 Telomere

4.10 Structure and functions of telomere

4.11 Human telomeres and cancer

4.12 Mini and micro satellite

4.12.1 Types of satellite DNA

5 Number of chromosomes in various organisms

o

5.1 Eukaryotes

5.2 Prokaryotes

6 chromosome anomaly, abnormality or aberration

7 Lampbrush chromosomes

8 Polytene chromosomes

9 B chromosomes
o

9.1 Supernumerary chromosomes in fungi

10 Refrences

Chromosome

A chromosome is an organized structure of DNA and protein that is found in nucleus of the cell.
It is a single piece of coiled DNA containing many genes, regulatory elements and other
nucleotide sequences. Chromosomes also contain DNA-bound proteins, which serve to package
the DNA and control its functions. Chromosomes vary widely between different organisms. The
DNA molecule may be circular or linear, and can be composed of 10,000 to 1,000,000,000
nucleotides in a long chain. Typically, eukaryotic cells (cells with nuclei) have large linear
chromosomes and prokaryotic cells (cells without defined nuclei) have smaller circular
chromosomes, although there are many exceptions to this rule. Also, cells may contain more than
one type of chromosome; for example, mitochondria in most eukaryotes and chloroplasts in
plants have their own small chromosomes.[2]
In eukaryotes, nuclear chromosomes are packaged by proteins into a condensed structure called
chromatin. This allows the very long DNA molecules to fit into the cell nucleus. The structure of
chromosomes and chromatin varies through the cell cycle. Chromosomes are the essential unit
for cellular division and must be replicated, divided, and passed successfully to their daughter
cells so as to ensure the genetic diversity and survival of their progeny. Chromosomes may exist
as either duplicated or unduplicated. Unduplicated chromosomes are single linear strands,
whereas duplicated chromosomes (copied during synthesis phase) contain two copies joined by a
centromere. Compaction of the duplicated chromosomes during mitosis and meiosis results in
the classic four-arm structure (pictured to the right). Chromosomal recombination plays a vital
role in genetic diversity. If these structures are manipulated incorrectly, through processes known
as chromosomal instability and translocation, the cell may undergo mitotic catastrophe and die,

or it may unexpectedly evade apoptosis leading to the progression of cancer. In practice

"chromosome" is a rather loosely defined term. In prokaryotes and viruses, the term genophore is
more appropriate when no chromatin is present. However, a large body of work uses the term
chromosome regardless of chromatin content. In prokaryotes, DNA is usually arranged as a
circle, which is tightly coiled in on itself, sometimes accompanied by one or more smaller,
circular DNA molecules called plasmids. These small circular genomes are also found in
mitochondria and chloroplasts, reflecting their bacterial origins. The simplest genophores are
found in viruses: these DNA or RNA molecules are short linear or circular genophores that often
lack structural proteins. The word chromosome comes from the Greek (chroma, colour)
and (soma, body) due to their property of being very strongly stained by particular dyes.[3]
Chromatin

Chromatin is the combination of DNA, histone, and other proteins that make up chromosomes. It
is found inside the nuclear envelope of eukaryotic cells. It is divided between heterochromatin
(condensed) and euchromatin (extended) forms. The functions of chromatin are to package DNA
into a smaller volume to fit in the cell, to strengthen the DNA to allow mitosis and meiosis, and
to control gene expression and DNA replication. Changes in chromatin structure are affected by
chemical modifications of histone proteins, such as methylation and acetylation, and by other
DNA-binding proteins.
Packaging of DNA in chromatin

Chromatin undergoes various forms of change in its structure. Histone proteins, the foundation
blocks of chromatin, are modified by various post-translational modification to alter DNA
packing. Acetylation results in the loosening of chromatin and lends itself to replication and
transcription. When certain residues are methylated they hold DNA together strongly and restrict
access to various enzymes. A recent study showed that there is a bivalent structure present in the
chromatin: methylated lysine residues at location 4 and 27 on histone 3. It is thought that this
may be involved in development; there is more methylation of lysine 27 in embryonic cells than
in differentiated cells, whereas lysine 4 methylation positively regulates transcription by
recruiting nucleosome remodeling enzymes and histone acetylases[4].[5]
Polycomb-group proteins play a role in regulating genes through modulation of chromatin
structure.[6]
Chromatin and Watson/Crick base pairing

Crick and Watson's famous structure of DNA (called B-DNA) is only one of three possible
structural forms.

For the C-N bond between a base and its sugar there are two different conformations. The anticonformation occurs in all A- and B-DNAs as well as in Z-DNA where a Cytosine is present. In
case of a Guanine Z-DNA takes the syn-conformation. The periodic change between a purine and
pyrimidine along the strand of a Z-DNA accomplishes the alternating syn-anti-conformation
characteristic of the zigzag structure of the Z-DNA helix.

A cartoon representation of the nucleosome structure. From pdb.

Histone:The DNA binding protein

Histones were discovered in 1884 by Albrecht Kossel. The word "histone" dates from the late
19th century and is from the German "Histon", of uncertain origin: perhaps from Greek histanai
or from histos. Until the early 1990s, histones were dismissed by most as inert packing material
for eukaryotic nuclear DNA, based in part on the "ball and stick" models of Mark Ptashne and
others who believed transcription was activated by protein-DNA and protein-protein interactions
on largely naked DNA templates, as is the case in bacteria. During the 1980s, work by Michael
Grunstein demonstrated that eukaryotic histones repress gene transcription, and that the function
of transcriptional activators is to overcome this repression. We now know that histones play both
positive and negative roles in gene expression, forming the basis of the histone code. The
discovery of the H5 histone appears to date back to 1970's, and in classification it has been
grouped with H1.[7]
Histones are found in the nuclei of eukaryotic cells, and in certain Archaea, namely Euryarchaea,
but not in bacteria. Archaeal histones may well resemble the evolutionary precursors to
eukaryotic histones. Histone proteins are among the most highly conserved proteins in
eukaryotes, emphasizing their important role in the biology of the nucleus.:939 In contrast
mature sperm cells largely use protamines to package their genomic DNA, most likely because
this allows them to achieve an even higher packaging ratio. Core histones are highly conserved
proteins, that is, there are very few differences among the amino acid sequences of the histone
proteins of different species. Linker histone usually has more than one form within a species and
is also less conserved than the core histones. There are some variant forms in some of the major
classes. They share amino acid sequence homology and core structural similarity to a specific
class of major histones but also have their own feature that is distinct from the major histones.
These minor histones usually carry out specific functions of the chromatin metabolism. For

example, histone H3-like CenpA is a histone only associated with the centromere region of the
chromosome. Histone H2A variant H2A.Z is associated with the promoters of actively
transcribed genes and also involved in the prevention of the spread of silent heterochromatin.
Another H2A variant H2A.X binds to the DNA with double strand breaks and marks the region
undergoing DNA repair. Histone H3.3 is associated with the body of actively transcribed genes.[8]
[9]

The nucleosome and "beads-on-a-string"

The basic repeat element of chromatin is the nucleosome, interconnected by sections of linker
DNA, a far shorter arrangement than pure DNA in solution.
In addition to the core histones, there is the linker histone, H1, which contacts the exit/entry of
the DNA strand on the nucleosome. The nucleosome core particle, together with histone H1, is
known as a chromatosome. Nucleosomes, with about 20 to 60 base pairs of linker DNA, can
form, under non-physiological conditions, an approximately 10 nm "beads-on-a-string" fibre.
The nucleosomes bind DNA non-specifically, as required by their function in general DNA
packaging. There are, however, large DNA sequence preferences that govern nucleosome
positioning. This is due primarily to the varying physical properties of different DNA sequences:
For instance, adenosine and thymine are more favorably compressed into the inner minor
grooves. This means nucleosomes can bind preferentially at one position approximately every 10
base pairs (the helical repeat of DNA)- where the DNA is rotated to maximise the number of A
and T bases that will lie in the inner minor groove.
What is a Nucleosome? Nucleosomes are the basic unit of DNA packaging in eukaryotes,
consisting of a segment of DNA wound around a histone protein core. This structure is often
compared to thread wrapped around a spool.
Nucleosomes form the fundamental repeating units of eukaryotic chromatin, which is used to
pack the large eukaryotic genomes into the nucleus while still ensuring appropriate access to it
(in mammalian cells approximately 2 m of linear DNA have to be packed into a nucleus of
roughly 10 m diameter). Nucleosomes are folded through a series of successively higher order
structures to eventually form a chromosome; this both compacts DNA and creates an added layer
of regulatory control which ensures correct gene expression. Nucleosomes are thought to carry
epigenetically inherited information in the form of covalent modifications of their core histones.
The nucleosome hypothesis was proposed by Don and Ada Olins in 1974 and Roger Kornberg.
The nucleosome core particle consists of approximately 147 base pairs of DNA wrapped in 1.67
left-handed superhelical turns around a histone octamer consisting of 2 copies each of the core
histones H2A, H2B, H3, and H4. Core particles are connected by stretches of "linker DNA",
which can be up to about 80 bp long. Technically, a nucleosome is defined as the core particle
plus one of these linker regions; however the word is often synonymous with the core particle.

Linker histones such as H1 and its isoforms are involved in chromatin compaction and sit at the
base of the nucleosome near the DNA entry and exit binding to the linker region of the DNA.
Non-condensed nucleosomes without the linker histone resemble "beads on a string of DNA"
under an electron microscope. In contrast to most eukaryotic cells, mature sperm cells largely use
protamines to package their genomic DNA, most likely to achieve an even higher packaging
ratio.Histone equivalents and a simplified chromatin structure have also been found in Archea,
proving that eukaryotes are not the only organisms that use nucleosomes.
30 nm chromatin fibre

Two proposed structures of the 30nm chromatin filament.

Left: 1 start helix "solenoid" structure.
Right: 2 start loose helix structure.
Note: the histones are omitted in this diagram - only the DNA is shown.

With addition of H1, the "beads-on-a-string" structure in turn coils into a 30 nm diameter helical
structure known as the 30 nm fibre or filament. The precise structure of the chromatin fibre in the
cell is not known in detail, and there is still some debate over this.
This level of chromatin structure is thought to be the form of euchromatin, which contains
actively transcribed genes. EM studies have demonstrated that the 30 nm fibre is highly dynamic
such that it unfolds into a 10 nm fiber ("beads-on-a-string") structure when transversed by an
RNA polymerase engaged in transcription.

Four proposed structures of the 30 nm chromatin filament for DNA repeat length per
nucleosomes ranging from 177 to 207 bp.
Linker DNA in yellow and nucleosomal DNA in pink.

The existing models commonly accept that the nucleosomes lie perpendicular to the axis of the
fibre, with linker histones arranged internally. A stable 30 nm fibre relies on the regular
positioning of nucleosomes along DNA. Linker DNA is relatively resistant to bending and
rotation. This makes the length of linker DNA critical to the stability of the fibre, requiring
nucleosomes to be separated by lengths that permit rotation and folding into the required
orientation without excessive stress to the DNA. In this view, different length of the linker DNA
should produce different folding topologies of the chromatin fiber. Recent theoretical work,
based on electron-microscopy images[10] of reconstituted fibers support this view.[11]
Spatial organization of chromatin in the cell nucleus

The layout of the genome within the nucleus is not random - specific regions of the genome have
a tendency to be found in certain spaces. Specific regions of the chromatin are enriched at the
nuclear membrane, while other regions are bound together by protein complexes. The layout of
this is not, however, well characterised apart from the compaction of one of the two X
chromosomes in mammalian females into the Barr body. This serves the role of permanently
deactivating these genes, which prevents females getting a 'double dose' relative to males. The
extent to which the inactive X is actually compacted is a matter of some controversy.

Scheme of the X chromatid

Human Y-chromatid
Human chromosomes

Chromosomes can be divided into two typesautosomes, and sex chromosomes. Certain genetic
traits are linked to your sex, and are passed on through the sex chromosomes. The autosomes
contain the rest of the genetic hereditary information. All act in the same way during cell
division. Human cells have 23 pairs of large linear nuclear chromosomes, (22 pairs of autosomes
and one pair of sex chromosomes) giving a total of 46 per cell. In addition to these, human cells
have many hundreds of copies of the mitochondrial genome. Sequencing of the human genome
has provided a great deal of information about each of the chromosomes. Below is a table
compiling statistics for the chromosomes, based on the Sanger Institute's human genome
information in the Vertebrate Genome Annotation (VEGA) database.[12] Number of genes is an
estimate as it is in part based on gene predictions. Total chromosome length is an estimate as
well, based on the estimated size of unsequenced heterochromatin regions.
An autosome is a chromosome that is not a sex chromosome; that is to say, there is an equal
number of copies of the chromosome in males and females.[13] For example, in humans, there are
22 pairs of autosomes. In addition to autosomes, there are sex chromosomes, to be specific: X
chromosome and Y chromosome. So, humans have 23 pairs of chromosomes.
Sex chromosomes The X chromosome is one of the two sex-determining chromosomes in many
animal species, including mammals (the other is the Y chromosome). It is a part of the XY sexdetermination system and X0 sex-determination system. The X chromosome was named for its
unique properties by early researchers, which resulted in the naming of its counterpart Y
chromosome, for the next letter in the alphabet, after it was discovered later.
The Y-chromosome is one of the two sex-determining chromosomes in most mammals, including
humans. In mammals, it contains the gene SRY, which triggers testis development if present. The
human Y-chromosome is composed of about 60 million base pairs. DNA in the Y-chromosome is
passed from father to son, and Y-DNA analysis may thus be used in genealogy research.

Human chromosomes

Female (XX)

Male (XY)

There are two copies of each autosome (chromosomes 1-22)

in both females and males. The sex chromosomes are
different: There are two copies of the X-chromosome in
females, but males have a single X-chromosome and a Ychromosome.

Chromosome

Genes

Total bases

Sequenced bases

4,220

247,199,719

224,999,719

1,491

242,751,149

237,712,649

1,550

199,446,827

194,704,827

446

191,263,063

187,297,063

609

180,837,866

177,702,766

2,281

170,896,993

167,273,993

2,135

158,821,424

154,952,424

1,106

146,274,826

142,612,826

1,920

140,442,298

120,312,298

10

1,793

135,374,737

131,624,737

11

379

134,452,384

131,130,853

12

1,430

132,289,534

130,303,534

13

924

114,127,980

95,559,980

14

1,347

106,360,585

88,290,585

15

921

100,338,915

81,341,915

16

909

88,822,254

78,884,754

17

1,672

78,654,742

77,800,220

18

519

76,117,153

74,656,155

19

1,555

63,806,651

55,785,651

20

1,008

62,435,965

59,505,254

21

578

46,944,323

34,171,998

22

1,092

49,528,953

34,893,953

X (sex chromosome)

1,846

154,913,754

151,058,754

Y (sex chromosome)

454

57,741,652

25,121,652

Total
What is nucleoid?

32,185

3,079,843,747

2,857,698,560

Prokaryote cell showing the nucleoid.

The nucleoid (meaning nucleus-like) is an irregularly-shaped region within the cell of

prokaryotes which has nuclear material without a nuclear membrane and where the genetic
material is localized. The genome of prokaryotic organisms generally is a circular, doublestranded piece of DNA, of which multiple copies may exist at any time. The length of a genome
widely varies, but generally is at least a few million base pairs. Storage of the genome within a
nucleoid can be contrasted against that within eukaryotes, where the genome is packed into
chromatin and sequestered within a membrane-enclosed organelle called the nucleus. A
genophore is the DNA of a prokaryote. This is commonly referred to as a prokaryotic
chromosome. The term chromosome is misleading for a genophore because the genophore lacks
chromatin. The genophore is compacted through a mechanism known as supercoiling, whereas a
chromosome is compacted via chromatin. The genophore is circular in most prokaryotes, and
linear in very few. The circular nature of the genophore allows replication to occur without
telomeres. Genophores are generally of a much smaller size than Eukaryotic chromosomes. A
genophore of a true organism can be as small as 580,073 base pairs (Mycoplasma genitalium).
Many eukaryotes (such as plants and animals) carry genophores in organelles such as
mitochondria and chloroplasts. These organelles are very similar to true prokaryotes.[14]
Experimental evidence suggests that the nucleoid is largely composed of DNA, about 60%, with
a small amount of RNA and protein. The latter two constituents are likely to be mainly
messenger RNA and the transcription factor proteins found regulating the bacterial genome.
Proteins helping to maintain the supercoiled structure of the nucleic acid are known as nucleoid
proteins or nucleoid-associated proteins and are distinct from histones of eukaryotic nuclei. In
contrast to histones, the DNA-binding proteins of the nucleoid do not form nucleosomes, in
which DNA is wrapped around a protein core. Instead, these proteins often use other mechanisms
to promote compaction such as DNA looping.[15]
Circular bacterial chromosome

Most bacterial chromosomes contain a circular DNA molecule - there are no free ends to the
DNA. Free ends would otherwise create significant challenges to cells with respect to DNA
replication and stability. Cells that do contain chromosomes with DNA ends, or telomeres (most
eukaryotes), have acquired elaborate mechanisms to overcome these challenges. However, a

circular chromosome can provide other challenges for cells. After replication, the two progeny
circular chromosomes can sometimes remain interlinked or tangled, and they must be resolved so
that each cell inherits one complete copy of the chromosome during cell division.[16]
Structure of Eukaryotic chromosome

Some sequences are required for a properly functioning chromosome: Centromere: Used during
cell division as the attachment point for the spindle fibers. Telomere: Used to maintain
chromosomal integrity by capping off the ends of the linear chromosomes. This region is a
microsatellite, but its function is more specific than a simple tandem repeat.
Centromere

A centromere is a region of DNA typically found near the middle of a chromosome where two
identical sister chromatids come closest in contact. It is involved in cell division as the point of
mitotic spindle attachment. The sister chromatids are attached all along their length, but they are
closest at the centromere.
The centromeric DNA is normally in a heterochromatin state, which is essential for the
recruitment of the cohesin complex that mediates sister chromatid cohesion after DNA
replication as well as coordinating sister chromatid separation during anaphase. In this
chromatin, the normal histone H3 is replaced with a centromere-specific variant, CENP-A in
humans. The presence of CENP-A is believed to be important for the assembly of the
kinetochore on the centromere. CENP-C has been shown to localise almost exclusively to these
regions of CENP-A associated chromatin. In human cells, the histones are found to be most
enriched for H4K20me3 and H3K9me3 which are known heterochromatic modifications. In the
yeast Schizosaccharomyces pombe (and probably in other eukaryotes), the formation of
centromeric heterochromatin is connected to RNAi. In nematodes such as Caenorhabditis
elegans, some plants, and the insect orders Lepidoptera and Hemiptera, chromosomes are
"holocentric", indicating that there is not a primary site of microtubule attachments or a primary
constriction, and a "diffuse" kinetochore assembles along the entire length of the chromosome.
Centromere positions

Each chromosome has two arms, labeled p (the shorter of the two) and q (the longer). The p arm
is named for "petit" meaning 'small'; the q arm is named q simply because it follows p in the
alphabet("q" refers to the French word "queue" meaning 'tail'.) They can be connected in either
metacentric, submetacentric, acrocentric or telocentric manner.
Metacentric

A chromosome is metacentric if its two arms are roughly equal in length. In some cases, a
metacentric chromosome is formed by balanced Robertsonian translocation: the fusion of two
acrocentric chromosomes to form one metacentric chromosome.
Submetacentric

If arms' lengths are unequal, the chromosome is said to be submetacentric

Acrocentric

If the p (short) arm is so short that is hard to observe, but still present, then the chromosome is
acrocentric (The "acro-" in acrocentric refers to the Greek word for "peak".). The human
genome includes five acrocentric chromosomes: 13, 14, 15, 21 and 22.
In an acrocentric chromosome the p arm contains genetic material including repeated sequences
such as nucleolar organizing regions, and can be translocated without significant harm, as in a
balanced Robertsonian translocation. The domestic horse genome includes one metacentric
chromosome that is homologous to two acrocentric chromosomes in the conspecific but
undomesticated Przewalski's horse.[17] This may reflect either fixation of a balanced Robertsonian
translocation in domestic horses or, conversely, fixation of the fission of one metacentric
chromosome into two acrocentric chromosomes in Przewalski's horses. A similar situation exists
between the human and great ape genomes; in this case, because more species are extant, it is
apparent that the evolutionary sequence is a reduction of two acrocentric chromosomes in the
great apes to one metacentric chromosome in humans.
Telocentric

A telocentric chromosome's centromere is located at the terminal end of the chromosome.

Telomeres may extend from both ends of the chromosome. For example, the standard house
mouse karyotype has only acrocentric chromosomes.[18] Humans do not possess telocentric
chromosomes. Some authors denote extreme acrocentric chromosomes as telocentric- 21, 22, Y.
Subtelocentric

If chromosome's centromere is located closer to its end than to its center, it may be described as
subtelocentric.
Holocentric

With holocentric chromosomes, the entire length of the chromosome acts as the centromere.
Examples of this type of centromere can be found scattered throughout the plant and animal
kingdoms[19] with the most well known example being in the nematode, Caenorhabditis elegans.
Telomere

A telomere is a short and specific region of repetitive DNA at the end of a linear eukaryotic
chromosome, which protects the end of the chromosome from deterioration. Its name is derived
from the Greek nouns telos "end" and mers "part". The telomere regions deter the degradation
of genes near the ends of chromosomes by allowing for the shortening of chromosome ends,
which necessarily occurs during chromosome replication.In 19751977, Elizabeth Blackburn,
working as a postdoctoral fellow at Yale University with Joseph Gall, discovered the unusual
nature of telomeres, with their simple repeated DNA sequences composing chromosome ends.
Their work was published in 1978. The telomere shortening mechanism normally limits cells to a
fixed number of divisions, and animal studies suggest that this is responsible for aging on the
cellular level and sets a limit on lifespans. Telomeres protect a cell's chromosomes from fusing
with each other or rearranging abnormalities that can lead to cancer and so cells are
destroyed when their telomeres are consumed. Most cancers are the result of "immortal" cells
that have ways of evading this programmed destruction.
The maintenance of tolomeres depends on a specialized ribonucleoprotein (RNP) which is
named tolomerase. Telomeres and tolomerase have different physical behavior but are given their
substrate-enzyme relation which forces them to establish a productive interaction. However, the
regulatory mechanism that controls their interaction still remains unknown.[20]
Elizabeth Blackburn, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize in
Physiology or Medicine for the discovery of how chromosomes are protected by telomeres and
the enzyme telomerase.
Structure and functions of telomere

Telomeres are repetitive DNA sequences located at the termini of linear chromosomes of most
eukaryotic organisms, and a few prokaryotes. Telomeres compensate for incomplete semiconservative DNA replication at chromosomal ends. The protection against homologous
recombination (HR) and non-homologous end joining (NHEJ) constitutes the essential capping
role of telomeres that distinguishes them from DNA double-strand breaks (DSBs).[21]
In most prokaryotes, chromosomes are circular and, thus, do not have ends to suffer premature
replication termination. A small fraction of bacteria l chromosomes (such as those in
Streptomyces and Borrelia) are linear and possess telomeres, which are very different from those
of the eukaryotic chromosomes in structure and functions. The known structures of bacterial
telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of
single-stranded DNA at the ends of the linear chromosomes.[22]
In most multicellular eukaryotic organisms, telomerase is active only in germ cells, stem cells
and certain white blood cells. There are theories that claim that the steady shortening of
telomeres with each replication in somatic (body) cells may have a role in senescence and in the
prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually

running out after a certain number of cell divisions and resulting in the eventual loss of vital
genetic information from the cell's chromosome with future divisions.
Telomere length varies greatly between species, from approximately 300 to 600 base pairs in
yeast[23] to many kilobases in humans, and usually is composed of arrays of guanine-rich, six- to
eight-base-pair-long repeats. Eukaryotic telomeres normally terminate with 3 single-strandedDNA overhang, which is essential for telomere maintenance and capping. Multiple proteins
binding single- and double-stranded telomere DNA have been identified.[24] These function in
both telomere maintenance and capping. Telomeres form large loop structures called telomere
loops, or T-loops. Here, the single-stranded DNA curls around in a long circle stabilized by
telomere-binding proteins.[25] At the very end of the T-loop, the single-stranded telomere DNA is
held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical
DNA and base pairing to one of the two strands. This triple-stranded structure is called a
displacement loop or D-loop.[26]
Telomere shortening in humans can induce replicative senescence, which blocks cell division.
This mechanism appears to prevent genomic instability and development of cancer in human
aged cells by limiting the number of cell divisions. However, shortened telomeres impair
immune function which might also increase cancer susceptibility.[27] Malignant cells that bypass
this arrest become immortalized by telomere extension due mostly to the activation of
telomerase, the reverse transcriptase enzyme responsible for synthesis of telomeres. However, 5
10% of human cancers activate the Alternative Lengthening of Telomeres (ALT) pathway, which
relies on recombination-mediated elongation.
Since shorter telomeres are thought to be a cause of poorer health and aging, this raises the
question of why longer telomeres are not selected for to ameliorate these effects. A prominent
explanation suggests that inheriting longer telomeres would cause increased cancer rates (e.g.
Weinstein and Ciszek, 2002). However, a recent literature review and analysis [27] suggests this is
unlikely, because shorter telomeres and telomerase inactivation is more often associated with
increased cancer rates, and the mortality from cancer occurs late in life when the force of natural
selection is very low. An alternative explanation to the hypothesis that long telomeres are
selected against due to their cancer promoting effects is the "thrifty telomere" hypothesis which
suggests that the cellular proliferation effects of longer telomeres causes increased energy
expenditures.[27] In environments of energetic limitation, shorter telomeres might be an energy
sparing mechanism.
Human telomeres and cancer

Human somatic cells lacking telomerase gradually lose telomeric sequences as a result of
incomplete replication (Counter et al., 1992). As human telomeres grow shorter, eventually cells
reach the limit of their replicative capacity and progress into senescence. Senescence involves

p53 and pRb pathways and leads to the arrest of cell proliferation. It is thought that senescence
plays an important role in suppression of emergence of cancer, although inheriting shorter
telomeres probably does not protect against cancer (Eisenberg, 2011).[28] With critically shortened
telomeres, further cell proliferation can be achieved by inactivation of p53 and pRb pathways.
Cells entering proliferation after inactivation of p53 and pRb pathways undergo crisis. Crisis is
characterized by gross chromosomal rearrangements and genome instability, and almost all cells
die. Rare cells emerge from crisis immortalized through telomere elongation by either activated
telomerase or ALT (Colgina and Reddel, 1999; Reddel and Bryan, 2003). The first description of
an ALT cell line demonstrated that the telomeres are highly heterogeneous in length and
predicted a mechanism involving recombination (Murnane et al., 1994). Subsequent studies have
confirmed a role for recombination in telomere maintenance by ALT (Dunham et al., 2000),
however the exact mechanism of this pathway is yet to be determined. ALT cells produce
abundant t-circles, possible products of intratelomeric recombination and t-loop resolution
(Tomaska et al., 2000; 2009; Cesare and Griffith, 2004; Wang et al., 2004).
Telomerase is a "ribonucleoprotein complex" composed of a protein component and an RNA
primer sequence that acts to protect the terminal ends of chromosomes. The actions of telomerase
are necessary because, during replication, DNA polymerase can synthesize DNA in only a 5' to 3'
direction and can do so only by adding polynucleotides to an RNA primer that has already been
placed at various points along the length of the DNA. These RNA strands must later be replaced
with DNA. This replacement of the RNA primers is not a problem at origins of replication within
the chromosome because DNA polymerase can use a previous stretch of DNA 5' to the RNA
template as a template to backfill the sequence where the RNA primer was; at the terminal end of
the chromosome, however, DNA polymerase cannot replace the RNA primer because there is no
position 5' of the RNA primer where another primer can be placed, nor is there DNA upstream
that can be used as a primer so that DNA polymerase can replace the RNA primer. Without
telomeres at the end of DNA, this genetic sequence at the end of the chromosome would be
deleted and the chromosome would grow shorter and shorter in subsequent replications. The
telomere prevents this problem by employing a different mechanism to synthesize DNA at this
point, thereby preserving the sequence at the terminal of the chromosome. This prevents
chromosomal fraying and prevents the ends of the chromosome from being processed as a
double-strand DNA break, which could lead to chromosome-to-chromosome telomere fusions.
Telomeres are extended by telomerases, part of a protein subgroup of specialized reverse
transcriptase enzymes known as Telomerase reverse transcriptase(TERT) (TElomerase Reverse
Transcriptases) that are involved in synthesis of telomeres in humans and many other, but not all,
organisms. However, because of DNA replication mechanisms, oxidative stress, and, because
TERT expression is very low in many types of human cells, the telomeres of these cells shrink a
little bit every time a cell divides, although, in other cellular compartments that require extensive
cell division, such as stem cells and certain white blood cells, TERT is expressed at higher levels
and telomere shortening is partially or fully prevented.

Structure of parallel quadruplexes that can be formed by human telomeric DNA.

Image created from NDB UD0017.

In addition to its TERT protein component, telomerase also contains a piece of template RNA
known as the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In humans, this
TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in
length. There are an additional 100-300 kilobases of telomere-associated repeats between the
telomere and the rest of the chromosome. Telomere sequences vary from species to species, but,
in general, one strand is rich in G with fewer Cs. These G-rich sequences can form four-stranded
structures (G-quadruplexes), with sets of four bases held in plane and then stacked on top of each
other with either a sodium or a potassium ion between the planar quadruplexes.
If telomeres become too short, they have the potential to unfold from their presumed closed
structure. It is thought that the cell detects this uncapping as DNA damage and then enters
cellular senescence, growth arrest, or apoptosis, depending on the cell's genetic background (p53
status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be
repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related
diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die
off or enter cellular senescence.
At the very distal end of the telomere is a 300 bp single-stranded portion, which forms the TLoop. This loop is analogous to a knot, which stabilizes the telomere, preventing the telomere
ends from being recognized as break points by the DNA repair machinery. Should nonhomologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop
is held together by seven known proteins, the most notable ones being TRF1, TRF2, POT1,
TIN1, and TIN2, collectively referred to as the shelterin complex.

A study published in the May 3, 2005 issue of the American Heart Association journal
Circulation found that weight gain and increased insulin resistance are correlated with greater
telomere shortening over time.
Some known telomere sequences
Group

Organism

Telomeric repeat (5' to 3'

toward the end)

Vertebrates

Human, mouse, Xenopus

TTAGGG

Filamentous fungi

Neurospora crassa

TTAGGG

Physarum, Didymium

TTAGGG

Dictyostelium

AG(1-8)

Trypanosoma, Crithidia

TTAGGG

Tetrahymena, Glaucoma

TTGGGG

Paramecium

TTGGG(T/G)

Oxytricha, Stylonychia,
Euplotes

TTTTGGGG

Apicomplexan
protozoa

Plasmodium

TTAGGG(T/C)

Higher plants

Arabidopsis thaliana

TTTAGGG

Green algae

Chlamydomonas

TTTTAGGG

Insects

Bombyx mori

TTAGG

Roundworms

Ascaris lumbricoides

TTAGGC

Fission yeasts

Schizosaccharomyces
pombe

TTAC(A)(C)G(1-8)

Slime moulds
Kinetoplastid
protozoa

Ciliate protozoa

Budding yeasts

TGTGGGTGTGGTG (from RNA

Saccharomyces cerevisiae template)
or G(2-3)(TG)(1-6)T (consensus)
Saccharomyces castellii

TCTGGGTG

Candida glabrata

GGGGTCTGGGTGCTG

Candida albicans

GGTGTACGGATGTCTAACTTCTT

Candida tropicalis

GGTGTA[C/A]GGATGTCACGATCATT

Candida maltosa

GGTGTACGGATGCAGACTCGCTT

Candida guillermondii

GGTGTAC

Candida pseudotropicalis

GGTGTACGGATTTGATTAGTTATGT

Kluyveromyces lactis

GGTGTACGGATTTGATTAGGTATGT

Mini and micro satellite

Satellite DNA consists of very large arrays of tandemly repeating, non-coding DNA. Satellite
DNA is the main component of functional centromeres, and form the main structural constituent
of heterochromatin. The name "satellite DNA" refers to how repetitions of a short DNA sequence
tend to produce a different frequency of the nucleotides adenine, cytosine, guanine and thymine,
and thus have a different density from bulk DNA - such that they form a second or 'satellite' band
when genomic DNA is separated on a density gradient.
Types of satellite DNA

Satellite DNA, together with minisatellite and microsatellite DNA, constitute the tandem repeats.
Some types of satellite DNA in humans are:
Type

Size of repeat
Location
unit (bp)

(alphoid
DNA)

171

All chromosomes

68

Centromeres of chromosomes 1, 9, 13, 14, 15, 21, 22

and Y

Satellite 1

25-48

Centromeres and other regions in heterochromatin of

most chromosomes

Satellite 2

Most chromosomes

Satellite 3

Most chromosomes

Minisatellite
A minisatellite is a section of DNA that consists of a short series of bases 1060 bp.These occur
at more than 1,000 locations in the human genome. Some minisatellites contain a central (or
"core") sequence of letters GGGCAGGANG (where N can be any base) or more generally a

strand bias with purines (adenosine (A) and guanine (G)) on one strand and pyrimidines
(cytosine (C) and thymine (T)) on the other. It has been proposed that this sequence per se
encourages chromosomes to swap DNA. In alternative models, it is the presence of a
neighbouring cis-acting meiotic double-strand break hotspot which is the primary cause of
minisatellite repeat copy number variations. Somatic changes are suggested to result from
replication difficulties (which might include replication slippage, among other phenomena).
When such events occur, mistakes are made, thus causing minisatellites at over 1000 locations in
a person's genome to have slightly different numbers of repeats, thereby making each individual
unique. The most highly mutable minisatellite locus described so far is CEB1 (D2S90) described
by Vergnaud.[29]Minisatellites have been associated with chromosome fragile sites and are
proximal to a number of recurrent translocation breakpoints. Some human minisatellites (~1%)
have been demonstrated to be hypermutable, with an average mutation rate in the germline
higher that 0.5% up to over 20%, making them the most unstable region in the human genome
known to date. While other genomes (mouse, rat and pig) contain minisatellite-like sequences,
none was found to be hypermutable. Since all hypermutable minisatellites contain internal
variants, they provide extremely informative systems for analyzing the complex turnover
processes that occur at this class of tandem repeat. Minisatellite variant repeat mapping by PCR
(MVR-PCR) has been extensively used to chart the interspersion patterns of variant repeats
along the array, which provides details on the structure of the alleles before and after mutation.
Studies have revealed distinct mutation processes operating in somatic and germline cells.
Somatic instability detected in blood DNA shows simple and rare intra-allelic events two to three
orders of magnitude lower than in sperm. In contrast, complex inter-allelic conversion-like
events occur in the germline.[6] Additional analyses of DNA sequences flanking human
minisatellites have also revealed an intense and highly localized meiotic crossover hotspot that is
centered upstream of the unstable side of minisatellite arrays. Repeat turnover therefore appears
to be controlled by recombinational activity in DNA that flanks the repeat array and results in a
polarity of mutation. These findings have suggested that minisatellites most probably evolved as
bystanders of localized meiotic recombination hotspots in the human genome.
Application Since the fortuitous discovery of the first human minisatellite in 1980 by A.R.
Wyman and R. White[30] and especially the discovery that the extreme polymorphism of
minisatellites made them superb for DNA fingerprinting by Alec Jeffreys,[31] this class of repeats
has been an intense focus of studies that have addressed the turnover mechanisms that provoke
their instability. Due to their high level of polymorphism, minisatellites have been extensively
used for DNA fingerprinting as well as for genetic markers in linkage analysis and population
studies.
Minisatellites have also been implicated as regulators of gene expression (e.g., at levels of
transcription, alternative splicing, or imprint control) or as part of bona fide open reading frames.
Microsatellites

Microsatellites, also known as Simple Sequence Repeats (SSRs), or sometimes Short Tandem
Repeats (STRs), are repeating sequences of 1-6 base pairs of DNA. Microsatellites are typically
neutral and co-dominant. They are used as molecular markers in genetics, for kinship, population
and other studies. They can also be used to study gene duplication or deletion.
One common example of a microsatellite is a (CA)n repeat, where n is variable between alleles.
These markers often present high levels of inter- and intra-specific polymorphism, particularly
when tandem repeats number ten or greater. The repeated sequence is often simple, consisting of
two, three or four nucleotides (di-, tri-, and tetranucleotide repeats respectively), and can be
repeated 10 to 100 times. CA nucleotide repeats are very frequent in human and other genomes,
and are present every few thousand base pairs. As there are often many alleles present at a
microsatellite locus, genotypes within pedigrees are often fully informative, in that the progenitor
of a particular allele can often be identified. In this way, microsatellites are ideal for determining
paternity, population genetic studies and recombination mapping. It is also the only molecular
marker to provide clues about which alleles are more closely related. Microsatellites owe their
variability to an increased rate of mutation compared to other neutral regions of DNA. These
high rates of mutation can be explained most frequently by slipped strand mispairing (slippage)
during DNA replication on a single DNA strand. Mutation may also occur during recombination
during meiosis.[4] Some errors in slippage are rectified by proofreading mechanisms within the
nucleus, but some mutations can escape repair. The size of the repeat unit, the number of repeats
and the presence of variant repeats are all factors, as well as the frequency of transcription in the
area of the DNA repeat. Interruption of microsatellites, perhaps due to mutation, can result in
reduced polymorphism. However, this same mechanism can occasionally lead to incorrect
amplification of microsatellites; if slippage occurs early on during PCR, microsatellites of
incorrect lengths can be amplified.
Limitations
Microsatellites have proved to be versatile molecular markers, particularly for population
analysis, but they are not without limitations. Microsatellites developed for particular species can
often be applied to closely related species, but the percentage of loci that successfully amplify
may decrease with increasing genetic distance. Point mutation in the primer annealing sites in
such species may lead to the occurrence of null alleles, where microsatellites fail to amplify in
PCR assays.[32] Null alleles can be attributed to several phenomena. Sequence divergence in
flanking regions can lead to poor primer annealing, especially at the 3 section, where extension
commences; preferential amplification of particular size alleles due to the competitive nature of
PCR can lead to heterozygous individuals being scored for homozygosity (partial null). PCR
failure may result when particular loci fail to amplify, whereas others amplify more efficiently
and may appear homozygous on a gel assay, when they are in reality heterozygous in the
genome. Null alleles complicate the interpretation of microsatellite allele frequencies and thus
make estimates of relatedness faulty. Furthermore, stochastic effects of sampling that occurs

during mating may change allele frequencies in a way that is very similar to the effect of null
alleles; an excessive frequency of homozygotes causing deviations from Hardy-Weinberg
equilibrium expectations. Since null alleles are a technical problem and sampling effects that
occur during mating are a real biological property of a population, it is often very important to
distinguish between them if excess homozygotes are observed.
When using microsatellites to compare species,homologous loci may be easily amplified in
related species, but the number of loci that amplify successfully during PCR may decrease with
increased genetic distance between the species in question. Mutation in microsatellite alleles is
biased in the sense that larger alleles contain more bases, and are therefore likely to be
mistranslated in DNA replication. Smaller alleles also tend to increase in size, whereas larger
alleles tend to decrease in size, as they may be subject to an upper size limit; this constraint has
been determined but possible values have not yet been specified. If there is a large size difference
between individual alleles, then there may be increased instability during recombination at
meiosis. In tumour cells, where controls on replication may be damaged, microsatellites may be
gained or lost at an especially high frequency during each round of mitosis. Hence a tumour cell
line might show a different genetic fingerprint from that of the host tissue.
Mechanisms for change
The most common cause of length changes in short sequence repeats is replication slippage,
caused by mismatches between DNA strands while being replicated during meiosis. Typically,
slippage in each microsatellite occurs about once per 1,000 generations (Weber 1993). Slippage
changes in repetitive DNA are orders of magnitude more common than point mutations in other
parts of the genome. Most slippage results in a change of just one repeat unit, and slippage rates
vary for different repeat unit sizes, and within different species.
Short sequence repeats are distributed throughout the genome. Presumably, their most probable
means of expression will vary, depending on their location.
In proteins
In mammals, 20% to 40% of proteins contain repeating sequences of amino acids caused by
short sequence repeats. Most of the short sequence repeats within protein-coding portions of the
genome have a repeating unit of three nucleotides, since that length will not cause frame-shift
mutations (Sutherland 1995). Each trinucleotide repeating sequence is transcribed into a
repeating series of the same amino acid. In yeasts, the most common repeated amino acids are
glutamine, glutamic acid, asparagine, aspartic acid and serine. These repeating segments can
affect the physical and chemical properties of proteins, with the potential for producing gradual
and predictable changes in protein action.

For example, length changes in tandemly repeating regions in the Runx2 gene lead to differences
in facial length in domesticated dogs (Canis familiaris), with an association between longer
sequence lengths and longer faces. This association also applies to a wider range of Carnivora
species . Length changes in polyalanine tracts within the HoxA13 gene are linked to hand-footgenital syndrome, a developmental disorder in humans . Length changes in other triplet repeats
are linked to more than 40 neurological diseases in humans [33].
Evolutionary changes from replication slippage also occur in simpler organisms. For example,
microsatellite length changes are common within surface membrane proteins in yeast, providing
rapid evolution in cell properties. Specifically, length changes in the FLO1 gene control the level
of adhesion to substrates. Short sequence repeats also provide rapid evolutionary change to
surface proteins in pathenogenic bacteria, perhaps so they can keep up with immunological
changes in their hosts. This is known as the Red Queen hypothesis. Length changes in short
sequence repeats in a fungus (Neurospora crassa) control the duration of its circadian clock
cycles [34].

The 23 human chromosome territories during prometaphase in fibroblast cells.[35]

Gene regulation
Length changes of microsatellites within promoters and other cis-regulatory regions can also
change gene expression quickly, between generations. The human genome contains many
(>16,000) short sequence repeats in regulatory regions, which provide tuning knobs on the
expression of many genes (Rockman 2002). Length changes in bacterial SSRs can affect
fimbriae formation in Haemophilus influenza, by altering promoter spacing (Moxon 1994).
Minisatellites are also linked to abundant variations in cis-regulatory control regions in the

human genome . And microsatellites in control regions of the Vasopressin 1a receptor gene in
voles influence their social behavior, and level of monogamy.
Within introns
Microsatellites within introns also influence phenotype, through means that are not currently
understood. For example, a GAA triplet expansion in the first intron of the X25 gene appears to
interfere with transcription, and causes Friedreich Ataxia (Bidichandani 1998). Tandem repeats
in the first intron of the Asparagine synthetase gene are linked to acute lymphoblastic leukemia.
A repeat polymorphism in the fourth intron of the NOS3 gene is linked to hypertension in a
Tunisian population (Jemaa 2008). Reduced repeat lengths in the EGFR gene are linked with
osteosarcomas.
Within transposons
Microsatellites are distributed throughout the genome . Almost 50% of the human genome is
contained in various types of transposable elements (also called transposons, or jumping
genes), and many of them contain repetitive DNA . It is probable that short sequence repeats in
those locations are also involved in the regulation of gene expression [36].
Number of chromosomes in various organisms
Eukaryotes

These tables give the total number of chromosomes (including sex chromosomes) in a cell
nucleus. For example, human cells are diploid and have 22 different types of autosome, each
present as two copies, and two sex chromosomes. This gives 46 chromosomes in total. Other
organisms have more than two copies of their chromosomes, such as bread wheat, which is
hexaploid and has six copies of seven different chromosomes 42 chromosomes in total.
Chromosome
numbers in
some plants
Plant
Species
Arabidopsis
thaliana
(diploid)[37]

Chromosome numbers
(2n) in some animals

Species

1
0

Common
8
fruit fly
Guppy

Specie
#
s
Guinea
64
Pig[43]

46 Garden 54

Chromosome numbers in other

organisms
Interme
Large
diate Microchro
Species Chromo
Chromo mosomes
somes
somes
Trypano 11
soma

~100

Rye (diploid) 1 (poecilia

[38]
4 reticulata)

brucei
snail

[45]

[44]

Domesti
Maize (diploid
c Pigeon
or
2 Earthwor
(Columb
18
palaeotetrapl 0 m
a livia
oid)[39]
(Octodrilu
Tibetan
domesti
36
36
s
fox
cs)[59]
complana
Einkorn
[46]
1 tus)
wheat
4
Chicken[
(diploid)[40]
8
60]
Domestic
Domest
38
38
cat[47]
ic pig
Durum wheat 2
(tetraploid)[40] 8
Laborator
Laborat
y
40 ory
42
Bread wheat 4
mouse[48]
[49]
[40]
rat
(hexaploid) 2 [49]
Cultivated
4 Rabbit
tobacco
Syrian
8 (Oryctolag
(tetraploid)[41]
us
44 hamste 44
cuniculus)
r[48]
Adder's
Tongue Fern
(diploid)[42]

[50]

}
Hares[51][52] 48

Human[
53]

46

Gorillas,
Domest
Chimpanz 48 ic
54
[53]
ees
sheep
Elephants[
54]

56 Cow

60

Donkey

62 Horse

64

59-63

2 sex
chromos 60
omes

Dog[55]

78

Kingfish 13
er[56]
2

10
0- Silkwor
Goldfish[57]
56
10 m[58]
4

Normal members of a particular eukaryotic species all have the same number of nuclear
chromosomes (see the table). Other eukaryotic chromosomes, i.e., mitochondrial and plasmidlike small chromosomes, are much more variable in number, and there may be thousands of
copies per cell.

Asexually reproducing species have one set of chromosomes, which are the same in all body
cells. However, asexual species can be either haploid or diploid.
sexual reproduction|Sexually reproducing species have somatic cells (body cells), which are
diploid [2n] having two sets of chromosomes, one from the mother and one from the father.
Gametes, reproductive cells, are haploid [n]: They have one set of chromosomes. Gametes are
produced by meiosis of a diploid germ line cell. During meiosis, the matching chromosomes of
father and mother can exchange small parts of themselves (crossover), and thus create new
chromosomes that are not inherited solely from either parent. When a male and a female gamete
merge (fertilization), a new diploid organism is formed.
Some animal and plant species are polyploid [Xn]: They have more than two sets of homologous
chromosomes. Plants important in agriculture such as tobacco or wheat are often polyploid,
compared to their ancestral species. Wheat has a haploid number of seven chromosomes, still
seen in some cultivars as well as the wild progenitors. The more-common pasta and bread wheats
are polyploid, having 28 (tetraploid) and 42 (hexaploid) chromosomes, compared to the 14
(diploid) chromosomes in the wild wheat.[61]
Prokaryotes

Prokaryote species generally have one copy of each major chromosome, but most cells can easily
survive with multiple copies.[62] For example, Buchnera, a symbiont of aphids has multiple
copies of its chromosome, ranging from 10400 copies per cell.[63] However, in some large
bacteria, such as Epulopiscium fishelsoni up to 100,000 copies of the chromosome can be
present.[64] Plasmids and plasmid-like small chromosomes are, as in eukaryotes, very variable in

copy number. The number of plasmids in the cell is almost entirely determined by the rate of
division of the plasmid fast division causes high copy number, and vice versa.
chromosome anomaly, abnormality or aberration

When the chromosome's structure is altered. This can take several forms:
Deletions: A portion of the chromosome is missing or deleted. Known disorders in humans
include Wolf-Hirschhorn syndrome, which is caused by partial deletion of the short arm of
chromosome 4; and Jacobsen syndrome, also called the terminal 11q deletion disorder.
Duplications: A portion of the chromosome is duplicated, resulting in extra genetic material.
Known human disorders include Charcot-Marie-Tooth disease type 1A which may be caused by
duplication of the gene encoding peripheral myelin protein 22 (PMP22) on chromosome 17.
Translocations: When a portion of one chromosome is transferred to another chromosome. There
are two main types of translocations. In a reciprocal translocation, segments from two different
chromosomes have been exchanged. In a Robertsonian translocation, an entire chromosome has
attached to another at the Centromere - in humans these only occur with chromosomes 13, 14,
15, 21 and 22.
Inversions: A portion of the chromosome has broken off, turned upside down and reattached,
therefore the genetic material is inverted.
Rings: A portion of a chromosome has broken off and formed a circle or ring. This can happen
with or without loss of genetic material.
Isochromosome: Formed by the mirror image copy of a chromosome segment including the
centromere.
Chromosome instability syndromes are a group of disorders characterized by chromosomal
instability and breakage. They often lead to an increased tendency to develop certain types of
malignancies.
Chromosomal aberrations are disruptions in the normal chromosomal content of a cell and are a
major cause of genetic conditions in humans, such as Down syndrome. Some chromosome
abnormalities do not cause disease in carriers, such as translocations, or chromosomal inversions,
although they may lead to a higher chance of birthing a child with a chromosome disorder.
Abnormal numbers of chromosomes or chromosome sets, aneuploidy, may be lethal or give rise
to genetic disorders. Genetic counseling is offered for families that may carry a chromosome
rearrangement.

The gain or loss of DNA from chromosomes can lead to a variety of genetic disorders. Human
examples include:
Cri du chat, which is caused by the deletion of part of the short arm of chromosome 5. "Cri du
chat" means "cry of the cat" in French, and the condition was so-named because affected babies
make high-pitched cries that sound like those of a cat. Affected individuals have wide-set eyes, a
small head and jaw, moderate to severe mental health issues, and are very short.
Down syndrome, usually is caused by an extra copy of chromosome 21 (trisomy 21).
Characteristics include decreased muscle tone, stockier build, asymmetrical skull, slanting eyes
and mild to moderate developmental disability.[49]
Edwards syndrome, which is the second-most-common trisomy; Down syndrome is the most
common. It is a trisomy of chromosome 18. Symptoms include motor retardation, developmental
disability and numerous congenital anomalies causing serious health problems. Ninety percent
die in infancy; however, those that live past their first birthday usually are quite healthy
thereafter. They have a characteristic clenched hands and overlapping fingers.
Idic15, abbreviation for Isodicentric 15 on chromosome 15; also called the following names due
to various researches, but they all mean the same; IDIC(15), Inverted duplication 15, extra
Marker, Inv dup 15, partial tetrasomy 15
Jacobsen syndrome, also called the terminal 11q deletion disorder. This is a very rare disorder.
Those affected have normal intelligence or mild developmental disability, with poor expressive
language skills. Most have a bleeding disorder called Paris-Trousseau syndrome.
Klinefelter's syndrome (XXY). Men with Klinefelter syndrome are usually sterile, and tend to
have longer arms and legs and to be taller than their peers. Boys with the syndrome are often shy
and quiet, and have a higher incidence of speech delay and dyslexia. During puberty, without
testosterone treatment, some of them may develop gynecomastia.
Patau Syndrome, also called D-Syndrome or trisomy-13. Symptoms are somewhat similar to
those of trisomy-18, but they do not have the characteristic hand shape.
Small supernumerary marker chromosome. This means there is an extra, abnormal chromosome.
Features depend on the origin of the extra genetic material. Cat-eye syndrome and isodicentric
chromosome 15 syndrome (or Idic15) are both caused by a supernumerary marker chromosome,
as is Pallister-Killian syndrome.
Triple-X syndrome (XXX). XXX girls tend to be tall and thin. They have a higher incidence of
dyslexia.

Turner syndrome (X instead of XX or XY). In Turner syndrome, female sexual characteristics

are present but underdeveloped. People with Turner syndrome often have a short stature, low
hairline, abnormal eye features and bone development and a "caved-in" appearance to the chest.
XYY syndrome. XYY boys are usually taller than their siblings. Like XXY boys and XXX girls,
they are somewhat more likely to have learning difficulties. Wolf-Hirschhorn syndrome, which is
caused by partial deletion of the short arm of chromosome 4. It is characterized by severe growth
retardation and severe to profound mental health issues.
Lampbrush chromosomes

Polytene chromosome

Lampbrush chromosomes (first seen by Flemming in 1882) are a special form of chromosomes
that are found in the growing oocytes (immature eggs) of most animals, except mammals.
Lampbrush chromosomes of tailed and tailless amphibians, birds and insects are described best
of all . Chromosomes transform into the lampbrush form during the diplotene stage of meiotic
prophase I due to an active transcription of many genes. They are highly extended meiotic halvebivalents, each consisting of 2 sister chromatids. Lampbrush chromosomes are clearly visible
even in the light microscope, where they are seen to be organized into a series of chromomeres
with large chromatin loops extended laterally. Amphibian and avian lampbrush chromosomes

can be microsurgically isolated form oocyte nucleus (germinal vesicle) with either forceeps or
needles.A given loop always contains the same DNA sequence, and it remains extended in the
same manner as the oocytes grows. These chromosomes are producing large amounts of RNA for
the oocyte, and most of the genes present in the DNA loops are being actively expressed. Each
lateral loop contains one or several transcription units with polarized RNP-matrix coating the
DNA axis of the loop. The majority of the DNA, however, is not in loops but remains highly
condensed in the chromomeres on the axis, where genes are generally not expressed. It is thought
that the interphase chromosomes of all eukaryotes are similarly arranged in loops. Although
these loops are normally too small and fragile to be easily observed in a light microscope, other
methods can be used to infer their presence. For example, it has become possible to assess the
frequency with which two loci along an interphase chromosome are paired with each other, thus
revealing candidates for the sites on chromatin that form the closely apposed bases of loop
structures. These experiments and others suggest that the DNA in human chromosomes is
organized into loops of different lengths. A typical loop might contain between 50,000 and
200,000 nucleotide pairs of DNA, although loops of a million nucleotide pairs have also been
suggested.[65]
Giant chromosomes in the lampbrush form are useful model for studying chromosome
organization, genome function and gene expression during meiotic prophase, since they allow
the individual transcription units to be visualized. Moreover lampbrush chromosomes are widely
used for high-resolution mapping of DNA sequences and construction of detail cytological maps
of individual chromosomes.[66] To increase cell volume, some specialized cells undergo repeated
rounds of DNA replication without cell division (endomitosis), forming a giant polytene
chromosome. Polytene chromosomes form when multiple rounds of replication produce many
sister chromatids that remain synapsed together. In addition to increasing the volume of the cells'
nuclei and causing cell expansion, polytene cells may also have a metabolic advantage as
multiple copies of genes permits a high level of gene expression. In Drosophila melanogaster, for
example, the chromosomes of the larval salivary glands undergo many rounds of
endoreplication, to produce large amounts of glue before pupation.[67]
Polytene chromosomes

Polytene chromosomes have characteristic light and dark banding patterns that can be used to
identify chromosomal rearrangements and deletions. Dark banding frequently corresponds to
inactive chromatin, whereas light banding is usually found at areas with higher transcriptional
activity. The banding patterns of the polytene chromosomes of Drosophila melanogaster were
sketched in 1935 by Calvin B. Bridges, in such detail that his maps are still widely used today.
The banding patterns of the chromosomes are especially helpful in research, as they provide an
excellent visualization of transcriptionally active chromatin and general chromatin structure.
Chromosome puffs are diffused uncoiled regions of the polytene chromosome that are sites of
RNA transcription. A Balbiani ring is a large chromosome puff. Polytene chromosomes were

originally observed in the larval salivary glands of Chironomus midges by Balbiani in 1881, but
the hereditary nature of these structures was not confirmed until they were studied in Drosophila
melanogaster in the early 1930s by Emil Heitz and Hans Bauer. They are known to occur in
secretory tissues of other dipteran insects such as the Malpighian tubules of Sciara and also in
protists, plants, mammals, or in cells from other insects. Some of the largest polytene
chromosomes described thus far occur in larval salivary gland cells of the Chironomid genus
Axarus. Another form of chromosomal enlargement that provides for increased transcription is
the lampbrush chromosome. Polytene chromosomes are also used to identify the species of
Chironomid larvae that are notoriously difficult to identify. Each morphologically distinct group
of larvae consists of a number of morphologically identical (sibling) species that can only be
identified by rearing adult males or by cytogenetic analysis of the polytene chromosomes of the
larvae. Karyotypes are used to confirm the presence of specific species and to study genetic
diversity in species with a wide range.[68]
B chromosomes

In addition to the normal karyotype, wild populations of many animal, plant, and fungi species
contain B chromosomes (also known as supernumerary or accessory chromosomes). By
definition, these chromosomes are not essential for the life of a species, and are lacking in some
(usually most) of the individuals. Thus a population would consist of individuals with 0, 1, 2, 3
(etc) supernumeraries. Most B chromosomes are mainly or entirely heterochromatic, (and so
would be largely non-coding) but some, such as the B chromosomes of maize, contain sizeable
euchromatic segments. In general it seems unlikely that supernumeraries would persist in a
species unless there was some positive adaptive advantage, which in a few cases has been
identified. For instance, the British grasshopper Myrmeleotettix maculatus has two structural
types of B chromosomes: metacentrics and submetacentrics. The supernumeraries, which have a
satellite DNA, occur in warm, dry environments, and are scarce or absent in humid, cooler
localities. In plants there is a tendency for B chromosomes to be present in the germ-line, but to
be lost from other tissues such as root tips and leaves. There is evidence of deleterious effects of
supernumeraries on pollen fertility, and favourable effects or associations with particular habitats
are also known in a number of species. The evolutionary origin of supernumerary chromosomes
is obscure, but presumably they must have been derived from heterochromatic segments of
normal chromosomes in the remote past. In general "we may regard supernumeraries as a very
special category of genetic polymorphism which, because of manifold types of accumulation
mechanisms, does not obey the ordinary Mendelian laws of inheritance." B chromosomes may
play a positive role on normal A chromosomes in some circumstances. The B chromosomes
suppress homologous pairing which reduces multiple pairing between homologous chromosomes
in allopolyploids. Bivalent pairing is ensured by a gene on chromosome 5 of the B genome
Phlocus. The B chromosomes also have the following effects on A chromosomes: increases
asymmetry chiasma distribution increases crossing over and recombination frequencies:
increases variation cause increased unpaired chromosomes: infertility B chromosomes have

tendency to accumulate in meiotic cell products resulting in an increase of B number over

generations. However this effect is counterbalanced for selection against infertility. B
chromosomes are not to be confused with marker chromosomes or additional copies of normal
chromosomes as they occur in Trisomies.[69][70]
Supernumerary chromosomes in fungi

Chromosome polymorphisms are very common among fungi. Different isolates of the same
species often have a different chromosome number, with some of these additional chromosomes
being unnecessary for normal growth in culture. The extra chromosomes are known as
conditionally dispensable, or supernumerary, because they are dispensable for certain situations,
but may confer a selective advantage under different environments. Supernumerary
chromosomes do not carry genes that are necessary for basic fungal growth, but may have some
functional significance. For example, it has been discovered that the supernumerary chromosome
of the pea pathogen Haematonectria haematococca carries genes that are important to the
disease-causing capacity of the fungus. This supernumerary DNA was found to code for a group
of enzymes that metabolize toxins, known as phytoalexins, that are secreted by the plant's
immune system. It is possible that these supernumerary elements originated in horizontal gene
transfer events because sequence analysis often indicates that they have a different evolutionary
history from essential chromosomal DNA.[71]