Molecular and Cellular Neuroscience 49 (2012) 311321

Contents lists available at SciVerse ScienceDirect

Molecular and Cellular Neuroscience

journal homepage: www.elsevier.com/locate/ymcne

A role for interleukin-1 in determining the lineage fate of embryonic rat

hippocampal neural precursor cells
Holly F. Green, Eimear Treacy, Aoife K. Keohane, Aideen M. Sullivan, Gerard W. O'Keeffe, Yvonne M. Nolan
Department of Anatomy and Neuroscience, University College Cork, Ireland

a r t i c l e

i n f o

Article history:
Received 25 July 2011
Revised 1 December 2011
Accepted 4 January 2012
Available online 16 January 2012
Keywords:
IL-1
IL-1R1
Neurogenesis
Neural precursor cell
Hippocampus

a b s t r a c t
Neurogenesis occurs in the hippocampus of the developing and adult brain due to the presence of multipotent stem cells and restricted precursor cells at different stages of differentiation. It has been proposed that
they may be of potential benet for use in cell transplantation approaches for neurodegenerative disorders
and trauma. Prolonged release of interleukin-1 (IL-1) from activated microglia has a deleterious effect
on hippocampal neurons and is implicated in the impaired neurogenesis and cognitive dysfunction associated with aging, Alzheimer's disease and depression. This study assessed the effect of IL-1 on the proliferation
and differentiation of embryonic rat hippocampal NPCs in vitro. We show that IL-1R1 is expressed on proliferating NPCs and that IL-1 treatment decreases cell proliferation and neurosphere growth. When NPCs were
differentiated in the presence of IL-1, a signicant reduction in the percentages of newly-born neurons and
post-mitotic neurons and a signicant increase in the percentage of astrocytes was observed in these cultures. These effects were attenuated by IL-1 receptor antagonist. These data reveal that IL-1 exerts an
anti-proliferative, anti-neurogenic and pro-gliogenic effect on embryonic hippocampal NPCs, which is mediated by IL-1R1. The present results emphasise the consequences of an inammatory environment during NPC
development, and indicate that strategies to inhibit IL-1 signalling may be necessary to facilitate effective
cell transplantation approaches or in conditions where endogenous hippocampal neurogenesis is impaired.
2012 Elsevier Inc. All rights reserved.

Introduction
It is well established that the prototypic pro-inammatory cytokine interleukin-1 (IL-1) is a key mediator of cell death in acute
neurodegenerative conditions, such as stroke and head injury (Allan
et al., 2005). Likewise, sustained microglial activation in response to
chronic stress, infection, toxins, age or inltrating cytokines from
the periphery is responsible for prolonged release of IL-1 from
microglia, which can affect neuronal survival, growth, synaptic transmission and hippocampal-dependent memory processes (Yirmiya
and Goshen, 2011). In microglia, IL-1 is synthesised as inactive
pro-IL-1 and is cleaved by caspase-1 to generate mature active IL1. The responses to IL-1 are initiated by its binding to the cell surface IL-1 type-1 receptor (IL-1R1) (Greenfeder et al., 1995). The

Abbreviations: AD, Alzheimer's disease; bFGF, basic broblast growth factor; BrdU,
5-bromo-deoxyuridine; DG, dentate gyrus; DIV, days in vitro; DCX, doublecortin;
DMEM, Dulbecco's modied eagle's medium; E, embryonic age; EGF, epidermal growth
factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFAP, glial brillary acidic protein; IB, inhibitory kappa B; IL-1, interleukin-1; IL-1, interleukin-1; IL-1R1,
interleukin-1 type-1 receptor; IL-1R2, interleukin-1 type-2 receptor; IL-1RA, IL-1 receptor antagonist; IL-1RAcP, interleukin-1 receptor accessory protein; IL-6, interleukin-6; LPS, lipopolysaccharide; NFB, nuclear factor kappa B; NPC, neural precursor
cell; PBS-T, phosphate buffered saline-Tween 20; TNF, tumour necrosis factor-.
Corresponding author. Fax: + 353 21 427 3518.
E-mail address: y.nolan@ucc.ie (Y.M. Nolan).
1044-7431/$ see front matter 2012 Elsevier Inc. All rights reserved.
doi:10.1016/j.mcn.2012.01.001

resulting signalling cascade releases nuclear factor kappa-B (NFB)

from the inhibitory kappa B (IB) protein, allowing it to translocate
to the nucleus, and alter gene transcription (DiDonato et al., 1997).
IL-1 can also bind to a decoy receptor, interleukin-1 type-2 receptor
(IL-1R2) which does not induce signalling due to the lack of an intracellular domain (McMahan et al., 1991). The naturally occurring receptor antagonist of IL-1, IL-1 receptor antagonist (IL-1RA) is
structurally similar to IL-1 and can bind to IL-1R1 with almost
equal afnity to that of IL-1, however it does not induce any intracellular response (Hannum et al., 1990). Instead, IL-1RA prevents
the interaction of IL-1 with IL-1R1. In the rodent brain, the density
of IL-1R1 is highest in the hippocampus (Farrar et al., 1987; Parnet
et al., 1994). It is established that IL-1R1 is present on mature hippocampal rat neurons (Nolan et al., 2004) and that IL-1 signalling
causes the death of these neurons (Maher et al., 2005). While there
is also evidence to demonstrate that at low concentrations IL-1 contributes to the normal physiological functions of LTP and spatial
memory (Schneider et al., 1998), there is an accumulating array of
data showing that higher concentrations of IL-1 inhibits learning,
memory and long-term potentiation (Depino et al., 2004; Nolan et
al., 2005; Yirmiya et al., 2002). Hippocampal IL-1-mediated cognitive impairment is also associated with aging (Barrientos et al.,
2009; Nolan et al., 2005), Alzheimer's disease (AD) (Licastro et al.,
2000), stress (Goshen and Yirmiya, 2009; Vereker et al., 2001) and
depression (Goshen et al., 2007).

312

H.F. Green et al. / Molecular and Cellular Neuroscience 49 (2012) 311321

The embryonic brain and dened regions of the adult mammalian

brain, including the hippocampus, are capable of generating new neurons from multipotent stem cells (Gage, 2000). These cells can selfrenew through symmetric division, or give rise to lineage-restricted
daughter cells through asymmetric division. Lineage-restricted cells
still maintain progenitor properties, they are capable of selfrenewal, through symmetric division or can differentiate to become
mature and functioning cells of one distinct lineage (neuronal, astroglial or oligodendroglial). Together, central nervous system stem cells
and all progenitor types are broadly dened as neural precursor cells
(NPCs). Numerous studies have proposed that NPCs may be therapeutically benecial for a wide range of central nervous system disorders, including neurodegenerative disorders, demyelinating
disorders, stroke, and trauma (Dyson and Barker, 2011; Kan et al.,
2010; Lindvall and Kokaia, 2010; Martino et al., 2010). Moreover,
the knowledge that neurogenesis also occurs in the adult hippocampus raises the possibility that endogenous repair by these cells may
also be feasible. Indeed, adult hippocampal neurogenesis is involved
in learning and memory (Gould et al., 1999; Shors et al., 2001),
while impaired adult neurogenesis has been implicated in the cognitive decline observed in animal models of AD (Demars et al., 2010;
Verret et al., 2007) and depression (Jacobs et al., 2000). Observations
from transplantation experiments have elucidated that NPC biology is
regulated by the characteristics of the microenvironment in which
they reside (Herrera et al., 1999; Ma et al., 2005). Consequently, an
array of extrinsic signals has now been identied that regulates hippocampal neurogenesis (Ma et al., 2010), and information has accumulated proposing pro-inammatory cytokines as key players in
modulating NPCs development and survival. For example, in the
adult hippocampus, interleukin-6 (IL-6) has been reported to reduce
the number of proliferating cells in vivo (Vallieres et al., 2002) and decrease the number of newly-born neurons from adult hippocampal
cultures in vitro (Monje et al., 2003). Tumour necrosis factor-
(TNF) is reported to have a negative effect on both embryonic and
adult rat hippocampal neurogenesis, as shown by a reduction in neural precursor cell proliferation in vitro and in vivo (Iosif et al., 2006;
Keohane et al., 2010). It has been shown that adult mice chronically
exposed to IL-1 have impaired hippocampal neurogenesis (Goshen
et al., 2007) and that IL-1-induced inhibition of proliferation of
adult rat hippocampal progenitors was reversed by IL-1RA (Koo and
Duman, 2008). These studies support the premise of an antineurogenic role for IL-1 and introduce a potential for antiinammatory therapy for the restoration of impaired hippocampal
neurogenesis, and hence disorders involving a decit in adult hippocampal neurogenesis. While the effect of IL-1 on the proliferation of adult hippocampal NPCs has been well studied, little is
known about the effect of IL-1 on embryonic hippocampal NPC
lineage restriction, differentiation and thus cell development. Evidence now indicates that adult neurogenesis replicates essential
mechanisms involved in NPC development in the embryonic
brain (Hodge and Hevner, 2011; Kriegstein and Alvarez-Buylla,
2009; Liu and Zhao, 2009; Qu and Shi, 2009). Therefore, examining the effect of the pro-inammatory cytokine IL-1 on embryonic hippocampal neurogenesis will contribute to the information
needed to optimise the proliferation, migration, differentiation,
and survival of NPCs for the development of cell replacement
therapies, and also help us to understand the effects of inappropriate inammation in the adult brain.
Results
Proliferating and differentiated hippocampal NPCs express IL-1R1
To assess whether embryonic rat hippocampal NPCs could be a
target for IL-1, we analysed the expression of IL-1R1 and IL-1R2 on
these cells. RT-PCR analysis of NPC cultures treated with IL-1

(10 ng/mL) for 7 DIV while the NPCs are proliferating demonstrated
that IL-1R1 mRNA was expressed on untreated and IL-1-treated
NPCs (Fig. 1A). Real-time PCR revealed that IL-1 treatment signicantly increased IL-1R1 mRNA expression (p b 0.001) (Fig. 1B). IL1R2 mRNA was expressed at very low levels and IL-1 had no effect
on IL-1R2 mRNA expression (Fig. 1A). The expression of IL-1R1 protein on cells from untreated and IL-1 treated cultures under proliferation conditions was demonstrated immunocytochemically (Fig. 1C).
The percentage composition of cells expressing IL-1R1 was not altered by IL-1 treatment (Fig. 1D), however IL-1 induced an increase in the intensity of IL-1R1 expression within these cells
(Fig. 1C). The expression of IL-1R1 protein on untreated nestinpositive and BrdU-positive NPCs under proliferation conditions was
also demonstrated by immunocytochemical double-staining
(Fig. 1C). These data indicate that proliferating NPCs could be susceptible to an inammatory insult which may inuence their capability
to proliferate or differentiate. We next examined IL-1R1 mRNA expression in cells under differentiation conditions. RT-PCR for IL-1R1
and IL-1R2 was carried out on hippocampal NPCs that had been exposed to IL-1 (10 and 100 ng/mL) for 2 or 7 DIV under differentiating conditions (Fig. 1E). Real-time PCR analysis revealed that both
concentrations of IL-1 signicantly increased IL-1R1 mRNA expression after 2 (p b 0.01) and 7 (p b 0.001) DIV (Fig. 1F). IL-1R2 was not
expressed in hippocampal NPCs under basal conditions, for 2 or 7
DIV under differentiating conditions, and IL-1 (10 and 100 ng/mL)
did not induce its expression (Fig. 1E). Immunocytochemistry
revealed that IL-1R1 protein was present on cells in untreated and
IL-1 treated cultures after 7 DIV under differentiation conditions. Almost all cells expressed IL-1R1, and IL-1 treatment induced an increase in IL-1R1 protein expression in these cells (Fig. 1G). The
expression of IL-1R1 protein on untreated DCX-positive cells
(newly-born neurons), III-tubulin-positive cells (post-mitotic neurons) and GFAP-positive cells (astrocytes) after 7 DIV under differentiation conditions was demonstrated immunocytochemically
(Fig. 1H). These results suggest that IL-1 has the potential to inuence the lineage fate of NPCs as well as the function of their differentiated progeny.
IL-1 inhibits neurosphere formation, NPC proliferation and cell survival
To investigate the effect of IL-1 on embryonic rat hippocampal NPC neurosphere formation, cells were cultured in the presence or absence of IL-1 (10 ng/mL) under proliferating
conditions, and neurosphere size was quantied over 7 days. Neurospheres formed on day 1, and both untreated and IL-1-treated
neurospheres increased in size during the 7 DIV (Fig. 2A and B).
IL-1 treatment signicantly decreased neurosphere circumference compared to untreated cultures in a time-dependent manner.
Specically, there was no signicant difference in neurosphere circumference between the IL-1 and untreated cultures on days 1
to 3, however by day 4, IL-1 signicantly decreased neurosphere
circumference compared to untreated cultures (p b 0.01) and this
effect was maintained at all days analysed until 7 days
(p b 0.001) (Fig. 2A). We subsequently quantied the total cell
number in T25 asks after 4 DIV, as this was the earliest time
point at which IL-1 was exerting an effect. The total cell number
dissociated from oating neurospheres cultured in the presence or
absence of IL-1 was analysed to determine if the observed decrease in neurosphere size was due to a decreased number of
cells. IL-1-treated neurosphere cultures had signicantly fewer
cells after 4 days under proliferating conditions (p b 0.01)
(Fig. 2C). We assessed if this decrease was due to reduced cell
proliferation, reduced cell survival or as a result of the progenitor
cells starting to differentiate. To measure cell proliferation, BrdU
incorporation was quantied in neurospheres after 4 DIV. We
found that IL-1 treatment for 24 hours after 4 DIV signicantly

H.F. Green et al. / Molecular and Cellular Neuroscience 49 (2012) 311321

313

Fig. 1. Expression of IL-1R1 on proliferating and differentiated hippocampal NPCs. (A) RT-PCR of IL-1R1 expression in hippocampal NPCs proliferated for 7 DIV in untreated and IL1-treated (10 ng/mL) cultures. Ladder in lane one is 100 bp and PCR product of 641, 530 and 388 bp indicate IL-1R1, IL-1R2 and GAPDH mRNA expression, respectively (A and E).
(B) Real-time PCR analysis of IL-1R1 mRNA from three independent experiments in the presence or absence of IL-1. ***p b 0.001 (Student's t-test). (C) Representative photomicrographs of cells immunocytochemically stained for IL-1R1 in untreated and IL-1 treated cultures, with nestin (red) or BrdU (green) under proliferation conditions. (D) The percentage of IL-1R1-positive cells from untreated and IL-1-treated cultures proliferated for 7 DIV. (E) RT-PCR of IL-1R1, IL-1R2 and GAPDH expression in hippocampal NPCs
differentiated for 2 or 7 DIV in untreated and IL-1-treated (10 and 100 ng/mL) hippocampal NPCs. (F) Real time PCR analysis of IL-1R1 mRNA expression in response to IL-1 treatment after 2 and 7 DIV from three independent experiments. **p b 0.01, ***p b 0.001 vs. untreated cultures (ANOVA with post hoc Dunnett's test). (G) Representative photomicrographs of cells immunocytochemically stained for IL-1R1 in untreated and IL-1 treated cultures under differentiation conditions. (H) Representative photomicrographs of
differentiated cells immunocytochemically stained for DCX (green), III-tubulin (green), GFAP (green) and IL-1R1 (red) in untreated cultures under differentiation conditions.
All cultures were counterstained with bisbenzimide (blue). Scale bar = 50 m. Data in B, D and F are expressed as means SEM.

decreased cell proliferation (p b 0.05) (Fig. 2D) thus demonstrating

the detrimental effect of IL-1 on NPC proliferation. We further
show that the anti-proliferative effects of treatment with IL-1
for 4 DIV were mediated by IL-1R1 signalling; treatment with IL1RA in the presence of IL-1 signicantly attenuated the IL-1induced decrease in neurosphere circumference (p b 0.001)
(Fig. 2E) and cell proliferation as measured by BrdU incorporation
(p b 0.001) (Fig. 2F). An MTT assay was subsequently carried out
on cells cultured for 2, 4 and 7 DIV in the presence or absence
of IL-1 to measure cell viability. IL-1 treatment for 2 or 4 DIV
did not affect cell viability, however IL-1 treatment for 7 DIV
caused a signicant decrease in cell viability compared to
untreated cultures (p b 0.001) (Fig. 2G). PARP protein levels were
analysed to investigate if this decrease in cell viability was due
to apoptotic cell death. Indeed we found IL-1 treatment had no
effect on PARP after 4 DIV, however after 7 DIV neurosphere cultures treated with IL-1 had signicantly increased levels of
PARP compared to untreated cultures (p b 0.01) (Fig. 2H and I).
The reduction in neurosphere size, and the reduction in NPC proliferation, could also be explained if IL-1 induced the differentiation of proliferating NPCs. To assess this possibility, we examined
the percentage composition of DCX-positive and of nestin-positive
cells in proliferating conditions treated with IL-1. There was no
signicant difference in the percentage composition of DCXpositive cells (Fig. 2J) or nestin-positive cells (Fig. 2K) in the IL1 and untreated cultures after 7 DIV in proliferating conditions,
indicating that the reduction in NPC proliferation is not as a result

of increased differentiation, but rather most likely reects a reduction in the rate of NPC proliferation and NPC survival.
IL-1 affects the lineage fate of hippocampal NPCs
When proliferated for 7 DIV, all nestin-positive cells were found to
express IL-1R1. Therefore, we investigated whether IL-1 can affect
the potential of these cells to differentiate into a neuronal or astroglial
lineage. Hippocampal NPCs were exposed to IL-1 (10 and 100 ng/
mL) for 2 or 7 DIV under differentiating conditions. Semiquantitative RT-PCR analysis of neuronal markers DCX (Fig. 3A) and
III-tubulin (Fig. 3B) showed that only 100 ng/mL of IL-1 signicantly decreased DCX mRNA expression after 2 DIV (p b 0.05)
(Fig. 3D) and that neither concentration had an effect on IIItubulin mRNA expression after 2 DIV (Fig. 3E). In contrast to this,
both concentrations of IL-1 decreased both DCX and III-tubulin
mRNA expression after 7 DIV (p b 0.01) (Fig. 3D and E). Semiquantitative RT-PCR analysis of the astrocyte marker GFAP showed
that IL-1 treatment had no signicant effect on GFAP mRNA expression after 2 or 7 DIV (Fig. 3C and F). We subsequently quantitatively
analysed the cell fate determination of the differentiated hippocampal NPCs by immunocytochemistry. Quantication of neuronal phenotypes under differentiation conditions showed that for both
neuronal markers, there was a signicant increase in the percentage
of neurons in untreated cultures at 7 DIV compared to at 2 DIV
(p b 0.01) (Fig. 3J and K). Only the 100 ng/ml concentration of IL-1
signicantly decreased the percentage composition of III-tubulin-

314

H.F. Green et al. / Molecular and Cellular Neuroscience 49 (2012) 311321

Fig. 2. Effect of IL-1 on neurosphere formation and NPC proliferation. (A) Circumference of neurospheres from IL-1-treated (10 ng/mL) and untreated cultures. ** p b 0.01,
***p b 0.001 vs. untreated cultures (ANOVA with post hoc Dunnett's test; n = 3). (B) Representative photomicrographs of untreated and IL-1-treated neurospheres on days 2, 4
and 7. Scale bar = 200 m. (C) The total number of NPCs per T25 culture ask, after 4 DIV under proliferating conditions. **p b 0.01 (Student's t-test; n = 3). (D) The percentage
of BrdU-positive cells from untreated and IL-1 treated (10 ng/mL; 4 DIV) neurosphere cultures pulsed with BrdU for the nal 24 hours of culture. *p b 0.05 (Student's t-test;
n = 3). Circumference of neurospheres (E) and percentage composition of BrdU-positive cells (F) in untreated, IL-1-treated, IL-1RA-treated and IL-1 + IL-1RA-treated cultures
after 4 DIV under proliferation conditions. *** p b 0.001 vs. control; +++p b 0.001 vs. IL-1 treatment (ANOVA with Newman-Keuls post hoc test; n = 3). (G) MTT metabolism of
untreated and IL-1 treated (10 ng/mL) HNPC cultures after 2, 4 and 7 DIV during proliferation. *** p b 0.001 vs. untreated cultures (ANOVA with post hoc Tukey's multiple comparison test; n = 3). (H) Relative expression of the cell death marker poly-ADP-ribose polymers (PARP) in untreated and IL-1 treated (10 ng/mL) cultures after 4 and 7 DIV under
proliferation conditions. ** p b 0.01 vs. untreated cultures (ANOVA with post hoc Tukey's multiple comparison test; n = 3). (I) Representative western blots showing antibody detection of PARP (62 kDa) and -Actin (42 kDa) in untreated and IL-1 treated (10 ng/mL) cultures after 4 or 7 DIV. The percentages of DCX-positive cells (J) and nestin-positive cells
(K) from untreated and IL-1-treated cultures proliferated for 7 DIV and plated at equal densities. Data are expressed as means SEM.

positive cells at 2 DIV (p b 0.05) (Fig. 3K), while there was no signicant difference in the percentage of DCX-positive cells between either
of the IL-1-treated and untreated cultures at 2 DIV (Fig. 3J). Both

concentrations of IL-1 signicantly decreased the percentage composition of DCX-positive cells (p b 0.001) (Fig. 3J) and III-tubulinpositive cells (p b 0.01) (Fig. 3K) after 7 DIV. Quantication of GFAP-

H.F. Green et al. / Molecular and Cellular Neuroscience 49 (2012) 311321

315

Fig. 3. Effect of IL-1 on lineage fate of hippocampal NPCs under differentiation conditions. RT-PCR analysis of DCX (A), III-tubulin (B) and GFAP (C) mRNA expression from hippocampal NPCs differentiated for 2 or 7 DIV in untreated and IL-1-treated (10 and 100 ng/mL) cultures. PCR product of 301, 92, 219 and 388 bp indicates DCX, III-tubulin, GFAP
and GAPDH mRNA expression, respectively. Mean densitometry values for DCX (D), III-tubulin (E) and GFAP (F) mRNA equalised to GAPDH, in response to IL-1 treatment after 2
and 7 DIV from three independent experiments. *p b 0.05, **p b 0.01 vs. untreated cultures at the same time-point (ANOVA with post hoc Dunnett's test; n = 3). Representative photomicrographs of differentiated cells immunocytochemically stained for DCX (green) (G), III-tubulin (red) (H) and GFAP (green) (I) in untreated and IL-1 (10 ng/mL) cultures
under differentiation conditions for 7 DIV. All cultures were counterstained with bisbenzimide (blue). Scale bar = 50 m. The percentage of DCX-positive cells (J), III-tubulinpositive neurons (K) and GFAP-positive astrocytes (L) in cultures exposed to IL-1 (10 and 100 ng/mL) for 2 or 7 DIV. *p b 0.05, ** p b 0.01, ***p b 0.001 vs. untreated cultures at
the same time-point; ++ vs. untreated cultures at 2 DIV (ANOVA with post hoc NeumannKeuls test; n = 3). Data in DF and JL are expressed as means SEM.

positive cells under differentiation conditions revealed that there was

no signicant difference in the percentage composition of GFAP positive cells in untreated cultures at 7 DIV compared to at 2 DIV
(Fig. 3L). However, the percentage composition of GFAP-positive
cells was signicantly increased after 2 DIV when cultures were treated with 100 ng/mL of IL-1 (p b 0.01). After 7 DIV, both concentrations of IL-1 signicantly increased the percentage composition of
GFAP positive cells (p b 0.01). The percentage composition of myelin
basic protein (MBP)-positive oligodendrocytes was quantied at 2
and 7 DIV; after 2 DIV the cultures contained less than 1% of MBPpositive cells and after 7 DIV the cultures contained 6.8% MBPpositive cells. IL-1 had no effect on the percentage composition of
MBP-positive cells (data not shown). There was no signicant difference in the total number of cells after 7 DIV under differentiation conditions, as determined by bisbenzimide staining, between any of the
IL-1-treated and untreated cultures (data not shown).
IL-1 inhibits neurite branching of hippocampal newly-born neurons
To examine if IL-1 affected the neuronal architecture of the
newly-born neurons, we measured the number of neurites on DCXpositive cells in cultures of hippocampal NPCs exposed to IL-1 (10
and 100 ng/mL) for 7 DIV. IL-1 treatment signicantly decreased
the total number of neurites and the degree of branching of DCXpositive neurons compared to untreated cultures of DCX-positive
neurons (p b 0.01) (Fig. 4).

Fig. 4. Effect of IL-1 on neurite branching of hippocampal newly-born neurons under

differentiation conditions. (A) The total number of neurites and number of primary,
secondary and tertiary neurites in untreated and in IL-1-treated (10 and 100 ng/
mL) DCX-positive cells after 7 DIV under differentiation conditions. Data are expressed
as means SEM. ** p b 0.01 vs. untreated cultures (ANOVA with post hoc Dunnett's test;
n = 3). Representative photomicrographs of cells immunocytochemically stained for
DCX in untreated (B), 10 ng/mL (C) and 100 ng/mL (D) IL-1-treated cultures. Scale
bar = 50 m.

316

H.F. Green et al. / Molecular and Cellular Neuroscience 49 (2012) 311321

IL-1 affects the lineage fate of hippocampal NPCs through IL-1R1

To investigate if the anti-neurogenic and pro-gliogenic effects of
IL-1 during NPC differentiation were mediated by IL-1R1 signalling,
we assessed if IL-1RA could prevent these effects of IL-1. NPCs were
exposed to IL-1 (10 ng/mL) in the presence or absence of IL-1RA
(1 g/mL) for 7 DIV under differentiating conditions. After 7 DIV IL1 signicantly decreased the percentage composition of DCXpositive neurons (p b 0.05) (Fig. 5I) and III-tubulin-positive
neurons (p b 0.001) (Fig. 5J) compared to untreated cultures.
However, pre-treatment and subsequent co-treatment with IL-1RA
abolished this anti-neurogenic effect of IL-1 (Fig. 5I, J). IL-1 treatment signicantly increased the percentage composition of GFAPpositive cells (p b 0.05) and the effect was prevented by IL-1RA
(p b 0.05) (Fig. 5K).
Discussion
The present study raises the possibility that IL-1 may exert an
anti-neurogenic effect and potentially affect how new neurons integrate into the hippocampal formation during acute or chronic CNS inammation. Specically, we have demonstrated that IL-1 treatment
exerts negative effects on embryonic NPC proliferation, NPC survival,
neuronal differentiation and neurite growth in vitro. We show that IL1 treatment decreases cell self-renewal and favours glial differentiation. Given that IL-1R1 is expressed on proliferating and differentiating NPCs, and although IL-1R2 can bind IL-1, its extremely low

expression coupled with the fact that it acts as a decoy receptor for
IL-1, strongly suggests that the effects of IL-1 on NPCs are mediated
by IL-1R1. This is furthered supported by the fact that the effects of IL1 on NPCs under proliferation and differentiation conditions can be
prevented by IL-1RA, which prevents the binding of IL-1 to IL-1R1
(Arend et al., 1990).
In order for IL-1 to induce intracellular signalling and resultant
NFB-mediated gene transcription within the cell, it rst binds to
the cell surface receptor IL-1R1. Thus, to examine the effects of IL1 on embryonic hippocampal NPCs proliferation, we investigated if
IL-1R1 is expressed on hippocampal NPCs under proliferation conditions. IL-1R1 has previously been detected on adult rat granule cells
of the DG (Cunningham et al., 1992; Farrar et al., 1987). More recently, studies have demonstrated that IL-1R1 is evident on neural progenitors in the DG of the hippocampus in adult rats (Koo and
Duman, 2008), E18 rat hippocampal neurons (Friedman, 2001),
NPCs from E16 rat forebrain (Wang et al., 2007) and E13.5 mouse cortex (Ajmone-Cat et al., 2010), and at very low levels in glia from E21
rat hippocampi (Friedman, 2001). We found that IL-1R1 is expressed
on nestin-positive and BrdU-positive (proliferating) NPCs within
neurospheres from E18 rat hippocampi after 7DIV under proliferation
conditions, at both the transcriptional and translational level. Thus,
IL-1 can bind to IL-1R1 on hippocampal NPCs, leaving them susceptible to an inammatory insult. We show that when hippocampal
NPCs are allowed to differentiate into GFAP-positive glia and postmitotic III-tubulin-positive neurons, they retain expression of IL1R1. This indicates that mature differentiated NPCs are also

Fig. 5. The effect of IL-1RA treatment on IL-1-induced changes on the lineage fate of hippocampal NPCs. Representative photomicrographs of cells immunocytochemically stained
for DCX (green) in untreated (A), IL-1-treated (B), IL-1RA-treated (C) and IL-1 + IL-1RA-treated (D) cultures and for III-tubulin (red) and GFAP (green) in untreated (E), IL-1treated (F), IL-1RA-treated (G) and IL-1 + IL-1RA-treated (H) cultures after 7 DIV under differentiation conditions. All cells were counterstained with bisbenzimide (blue). Scale
bar = 50 m. Percentage composition of DCX-positive cells (I), III-tubulin-positive neurons (J) and GFAP-positive astrocytes (K) in untreated, IL-1-treated, IL-1RA-treated and IL1 + IL-1RA-treated cultures after 7 DIV under differentiation conditions. Data are expressed as means SEM. *p b 0.05, ** p b 0.01 vs. control; + p b 0.05, ++p b 0.01 vs. IL-1 treatment (ANOVA with NewmanKeuls post hoc test; n = 3).

H.F. Green et al. / Molecular and Cellular Neuroscience 49 (2012) 311321

susceptible to an inammatory insult, which may affect their cell fate

specication during differentiation, or the functioning of the differentiated mature cell. We suggest from quantitative analysis of IL-1R1
mRNA that IL-1 treatment up-regulated the transcription of IL-1R1
mRNA in neurosphere cultures. At a translational level, IL-1 did
not alter the percentage of cells expressing IL-1R1, however, the intensity of IL-1R1 protein expression within cells was increased, thus
facilitating increased IL-1-IL-1R1 binding and resultant intracellular
signalling. Expression of IL-1R1 has previously been shown to be upregulated on mature hippocampal neurons and in astrocytes in the
presence of IL-1 (Friedman, 2001; Nolan et al., 2004). Here we
show that IL-1 treatment during differentiation increased the
mRNA and protein expression of IL-1R1 in mixed cultures derived
from hippocampal NPCs. Thus IL-1 is inducing a positive feedback
loop, inducing IL-1R1 production and facilitating its own binding
and thus detrimental downstream effects in differentiated cells.
IL-1 can also bind to IL-1R2, a decoy receptor, which obstructs IL1-IL-1R1 binding, thus preventing the inammatory actions of IL-1.
There was a very low basal level expression of IL-1R2 mRNA in NPCs
in vitro under proliferation conditions and we did not identify IL-1R2
expression in differentiated cultures. IL-1 treatment did not increase
IL-1R2 transcription in cultures under proliferating or differentiating
conditions. Previously, IL-1R2 expression was not detected at basal
levels in the adult rat hippocampus (Nishiyori et al., 1997), however
expression was detected in NPCs from embryonic rat forebrain
(Wang et al., 2007). The lack of an IL-1-induced increase in IL-1R2
expression suggests that upon an inammatory insult, IL-1 is not
being sequestered by the decoy receptor and it is able to bind to the
self-perpetuated elevated levels of IL-1R1, increasing downstream
signalling, challenging their proliferation capabilities and inuencing
their cell fate specication.
Because NPCs proliferate in vitro as neurospheres and retain their
self-renewal and differentiation capabilities, we investigated whether
IL-1 affects neurosphere size, BrdU incorporation (as a measure of
NPC proliferation), or cell death. We observed that IL-1 signicantly
decreased neurosphere size from day 4 onwards, compared to
untreated cultures on that day, indicating that IL-1 is exerting a negative effect on cell proliferation and/or increasing cell death. In support of this result we found that the total number of cells after 4
DIV in culture vessels was decreased signicantly in IL-1-treated
asks compared to untreated asks. To examine if this decrease was
due to decreased cell proliferation, we quantied BrdU incorporation.
Cells were plated at equal densities to eliminate the possibility of unequal cell numbers skewing BrdU percentages, and indeed the percentage composition of BrdU positive cells was signicantly
decreased in IL-1-treated asks. Moreover, treatment with the IL1R1 receptor antagonist prevented the IL-1-induced effects on
both neurosphere circumference and cell proliferation. In accordance
with these results, Wang et al. found that IL-1 signicantly decreased the number of proliferating cells from E16 forebrain NPCs,
as indicated by a reduction in thymidine incorporation and showed
that this effect was mediated via IL-1R1 signalling, as it was blocked
by IL-1RA treatment. Other studies on adult NPCs have also found
that IL-1 signicantly decreased the number of proliferating cells
from adult rat hippocampus in vitro (Koo and Duman, 2008) and in
vivo studies have shown that IL-1 decreases BrdU incorporation in
the DG of the adult rat hippocampus (Goshen et al., 2007), and that
this effect can be blocked by inhibiting IL-1 signalling using the IL1R1 antagonist, IL-1RA (Koo and Duman, 2008).
Having shown that IL-1 exerted a negative effect on NPC proliferation, we sought to examine if cell death was contributing to the observed decrease in sphere size from days 47. Our results showed that
after 4 DIV there was no increase in cell death in IL-1-treated neurosphere cultures. We found no difference in the number of
metabolically-active cells, nor in the levels of the apoptotic marker
PARP in IL-1-treated neurosphere cultures compared to untreated

317

cultures. These results indicate that after 4 DIV, IL-1 is exerting an

anti-proliferative effect on NPCs. In contrast to the results obtained
after 4 DIV, after 7 DIV in the presence of IL-1, cell viability was reduced and an increased level of apoptosis was evident. These results
suggest that acute IL-1 treatment reduces proliferation, and a longer
exposure time may exacerbate the detrimental effect on NPCs, reducing cell proliferation and inducing apoptotic cell death, resulting in
smaller spheres and hence fewer cells. There is currently conicting
data on IL-1 and cell death, some studies show that IL-1 does not
affect cell death in adult hippocampal NPCs nor in embryonic mouse
cortical cultures, as shown by TUNEL analysis (Ajmone-Cat et al.,
2010; Koo and Duman, 2008). However, in accordance with our results, Wang et al., 2007 found that IL-1 treatment induced apoptosis
in E16 rat NPCs, they concluded that this is mediated via IL-1R1 signalling, as IL-1RA treatment blocked the IL-1-induced increase in
apoptosis. Our data are in agreement with Wang et al. as we demonstrated an anti-proliferative and apoptotic role for IL-1 after chronic
exposure. We have shown that IL-1R1 is present on NPCs, that IL-1R2
is present only at a very low level, and that blocking IL-1R1 abrogates
the detrimental effects of IL-1. We thus propose that the decrease in
neurosphere size and NPC proliferation are induced via IL-1R1
signalling.
We then explored the effect of IL-1 on the lineage fate of cells
under proliferation conditions. Lineage-restricted NPCs still retain
the ability to self-renew, however they are constricted to one cell
phenotype. We found that IL-1 treatment during proliferation had
no effect on neuronal lineage fate, and we have previously shown
that the pro-inammatory cytokine TNF had no effect on neuronal
lineage of NPCs from embryonic rat hippocampi under proliferation
conditions (Keohane et al., 2010). Our results suggest that IL-1 is
not altering the NPCs multipotent characteristics, nor it is causing
cells to exit the cell cycle to differentiate, rather it is having a negative
effect on their proliferative and survival capabilities.
We showed that undifferentiated nestin-positive cells express IL1R1 and that it is up-regulated in response to IL-1 treatment,
hence we sought to investigate if IL-1 treatment would alter NPC
cell fate specication of these nestin-positive cells under differentiation conditions. Bisbenzimide staining showed that IL-1 treatment
for 2 or 7 DIV did not affect cell viability under differentiation conditions (data not shown). In accordance with our results, Carlson et al.
found that IL-1 treatment did not induce cell death in embryonic
mouse cortical neuronal cultures after 2 DIV (Carlson et al., 1999).
To subsequently investigate NPC differentiation, we examined the
cell fate markers DCX, III-tubulin and GFAP, both semiquantitatively at the transcriptional level and then quantitatively at
the translational level using immunocytochemistry, in cells exposed
to IL-1 under differentiating conditions for 2 or 7 DIV. Treatment
with 100 ng/mL of IL-1 signicantly decreased DCX mRNA expression but not the percentage composition of DCX-positive cells when
examined immunocytochemically after 2 DIV. It is possible that the
DCX expression within the newly-born neurons is decreased but the
actual number of newly-born neurons is not. This concentration of
IL-1 signicantly decreased the percentage composition of postmitotic neurons in culture after 2 DIV, suggesting that the newlyborn neurons are less sensitive to an acute inammatory insult than
the post-mitotic neurons. However, a longer treatment with IL-1
(7 DIV), caused a decrease in the percentage composition of both
newly-born neurons and postmitotic neurons and this was accompanied by a decrease in DCX and III-tubulin mRNA expression. These
results suggest that chronic IL-1 treatment is detrimental to both
newly-born and post-mitotic neurons as shown by a reduced number
of neuronal phenotypes in culture. We have previously demonstrated
a similar anti-neurogenic effect of TNF (Keohane et al., 2010), while
Araju and Cotman found that IL-1 had no effect on neuronal survival
of embryonic rat hippocampal neuronal cultures after 1 DIV, but
caused a signicant decrease in neuronal survival after a longer

318

H.F. Green et al. / Molecular and Cellular Neuroscience 49 (2012) 311321

incubation with IL-1 of 3 DIV (Araujo and Cotman, 1995). In contrast, Ajmone-Cat et al. reported that neither IL-1 nor interleukin1 (IL-1) treatment affected III-tubulin positive cells (AjmoneCat et al., 2010). However, their results were obtained from early embryonic mouse cortical NPCs, which may account for the difference in
results. We found that the number of differentiated astrocytes was
signicantly increased in cultures treated acutely and chronically
with IL-1, although no change in GFAP mRNA expression after 2 or
7 DIV was evident. This is consistent with the ndings of AjmoneCat et al. who reported that IL-1 increased the percentage composition of GFAP-positive cells differentiating from embryonic cortical
NPCs (Ajmone-Cat et al., 2010). Moreover, it has been demonstrated
that IL-1 is mitogenic for embryonic rat cerebral cortical astrocytes
in vitro and increases GFAP expression in vivo (Giulian et al., 1988).
As there was no change in the total cell number over 7 DIV, we suggest that IL-1 is causing undifferentiated cells to follow a glial fate
rather than promoting an increase in glial cell proliferation. Under
basal conditions, the percentage composition of DCX-positive and
III-tubulin positive neurons increased signicantly from 2 days to
7 days but there was no change in the GFAP-positive cells. This result
suggests that over 7 days neurons are continuing to differentiate from
NPCs under basal conditions, but that glial cells differentiate from
NPCs within the rst 2 days, and do not change signicantly over
the further 5 DIV. These results demonstrate that IL-1 is inducing
non-lineage restricted, undifferentiated cells to follow a gliogenic
fate as opposed to a neurogenic fate, thus decreasing the overall neuronal population and increasing the glial population, and suggest that
even at low levels over a sustained period, IL-1 exerts antineurogenic effects.
As IL-1 decreased the birth of neurons in culture, and IL-1R1 was
present on differentiated neurons, we next investigated the effect of
IL-1 treatment on the morphology of the newly-born neurons present in culture. Endogenous or transplanted newly-born neurons extend axonal and dendritic projections to establish new synaptic
connections within the hippocampal circuitry in vivo (Laplagne et
al., 2007). However, there are currently no conclusive in vitro studies
investigating the direct effect of IL-1 on neurite outgrowth of newlyborn neurons derived from embryonic rat hippocampal NPCs. We
found that IL-1 caused a decrease in total neurites, and decreased
the number of primary secondary and tertiary neurites per neuron
in a dose-dependent manner. Other studies have found that embryonic murine neurons and embryonic rat hippocampal neurons exposed to TNF had reduced neurite branching (Keohane et al.,
2010; Neumann et al., 2002). In depressed patients, the volume of
the hippocampus has been found to be decreased, possibly due to decreased neurogenesis and due to a retraction of apical dendrites of
CA3 pyramidal neurons (Magarinos et al., 1996). Likewise, hippocampal volumes are used as clinical predictors of cognitive impairment
and AD (Fleisher et al., 2008), and alterations in dendritic morphology and decreased dendritic density are evident in the hippocampi of
AD patients (Fiala et al., 2002). Indeed animal studies have shown
that the hippocampal volume loss observed in depressed brain can
be partially explained by dendritic retraction and reduced cell proliferation (McEwen, 2000). An impairment in a hippocampusdependent learning task in aged mice also correlated with a decrease
in numbers and length of dendrites in dentate gyrus neurons (von
Bohlen und Halbach et al., 2006). The current results suggest that increased pro-inammatory cytokines in the hippocampal NPC microenvironment may contribute to the dendritic pathology observed in
the depressed and AD hippocampus.
To determine if the anti-neurogenic and pro-gliogenic effects of IL1 on NPC differentiation is mediated through IL- 1R1, cells were pretreated with IL-1RA, and then cotreated with both IL-1 and IL-1RA.
IL-1RA alone had no effect on NPC differentiation, and IL-1RA signicantly reversed the IL-1-induced decrease in the percentage composition of newly-born neurons and post-mitotic neurons, while also

inhibiting the IL-1-induced increase of astrocytes. These results indicate that the change in cell fate is due to IL-1R1 intracellular signalling, and that by blocking this, the detrimental effects of IL-1 can
be ameliorated. In accordance, it has been reported that IL-1RA treatment blocked the IL-1-induced decrease of III-tubulin and increase
of GFAP protein expression in fetal human cortical NPCs (Peng et al.,
2008). Previous results obtained from adult rat hippocampus show
that IL-1R1 null mice or treatment with IL-1RA abolished the antiproliferative effects of IL-1 (Koo and Duman, 2008; Yirmiya and
Goshen, 2011), and we now show that IL-1RA prevents the antineurogenic effects of IL-1 during differentiation also.
This study demonstrates that IL-1 exerts an anti-proliferative,
anti-neurogenic and pro-gliogenic effect on embryonic NPCs, and
negatively affects the morphology of newly-born neurons. IL-1
has detrimental effects in the short term at high concentrations
and over a sustained period of time at lower concentrations,
thus emphasising the importance of regulating an inammatory
environment during NPC development. Our results suggest that
anti-inammatory interventions for hippocampal-based neurological disorders which are aimed at restoring endogenous neurogenesis following damage, or improving cell transplantation strategies
are most effective in the temporal window during which NPCs are
undergoing differentiation. This knowledge contributes to a greater understanding of the mechanisms implicit in the microenvironment of NPCs, which will allow us to modulate this environment
for endogenous activation of NPCs, to optimally manipulate NPCs
in culture for exogenous transplantation, and ultimately to development pharmacological or regenerative interventions for neurodegenerative disorders and CNS trauma.
Experimental methods
Preparation and treatment of rat hippocampal NPC cultures
All scientic procedures were performed under a license issued by
the Department of Health and Children (Ireland) and in accordance
with the European Communities Council Directive (86/609/EEC). Hippocampi from embryonic age (E) 18 rat embryos (Biological Services
Unit, University College Cork) were dissected, and primary NPCs were
dissociated, passaged and cultured as neurospheres as we and others
have previously described (Keohane et al., 2010; O' Keeffe and
Sullivan, 2005; Wang et al., 2007). Cells in these neurospheres can
self-renew and upon stimulation can differentiate into glial and neuronal lineages, and thus were deemed to be NPCs. The cells were
seeded at a density of 2 10 6 cells per T25 ask in 10 mL of proliferation medium (Dulbecco's modied eagles's medium (DMEM)-F12
(Sigma); 1% antibioticantimycotic solution (Sigma); 200 mM L-glutamine (Sigma); 33 mM D-glucose (Sigma); 2% B-27 (Gibco), 20 ng/
mL epidermal growth factor (EGF; Sigma), 20 ng/mL basic broblast
growth factor (bFGF) (Chemicon) and cells were allowed to proliferate as neurospheres for 7 days in vitro (DIV) under a humidied atmosphere containing 5% CO2 at 37 C. Recombinant rat IL-1
(10 ng/mL, R&D Systems) was added to neurosphere cultures, either
on the day of seeding and supplemented every second day for 4 or
7 DIV. For proliferation studies, neurosphere cultures were pulsed
with 5-bromo-2-deoxyuridine (BrdU, 0.2 M) (Sigma-Aldrich) after
3 DIV for the nal 24 h of culture (Caldwell et al., 2005). For some experiments, NPCs were treated with IL-1 (10 ng/mL) in the presence
or absence of IL-1RA (1 g/ml, reconstituted in PBS and 7.5%BSA; 100fold in excess of concentration of IL-1 used (Arend et al., 1990) (R&D
Systems) for 4 DIV under proliferating conditions. For differentiation
studies, untreated neurospheres were dissociated to a single cell suspension after proliferation for 7 DIV, and seeded at a density of 5 10 4
cells/poly-D-lysine-coated 13 mm glass coverslip in 24-well tissue
culture plates. The cells were allowed to differentiate for 2 or 7 DIV
in differentiation medium (DMEM-F12; 1% antibiotic-antimycotic

H.F. Green et al. / Molecular and Cellular Neuroscience 49 (2012) 311321

solution; 200 mM L-glutamine; 33 mM D-glucose; 1% B-27) supplemented with recombinant rat IL-1 (0, 10, 100 ng/mL), under a humidied atmosphere containing 5% CO2 at 37 C before analysis of
cell lineage by immunocytochemistry or RT-PCR. For some experiments, NPCs were treated with IL-1 (10 ng/mL) in the presence or
absence of IL-1RA (1 g/ml, reconstituted in PBS and 7.5%BSA; 100fold in excess of concentration of IL-1 used (Arend et al., 1990)
(R&D Systems) for 7 DIV under differentiating conditions.
Analysis of neurosphere circumference and cell proliferation
After 4 or 7 DIV under proliferation conditions neurospheres were
dissociated to a single cell suspension, and seeded at a density of
5 10 4 cells/poly-D-lysine-coated 13 mm glass coverslip in 24-well
tissue culture plates. Cells were plated in equal numbers per unit
area and allowed to adhere to glass coverslips for 1 hour prior to immunocytochemical analysis of BrdU incorporation. Neurospheres
were viewed under an inverted Olympus IX70 microscope each day
for 7 DIV and bright eld photomicrographs were taken at 4 magnication using an Olympus DP70 digital camera. At least four images
per ask, per time point were captured and at least 20 spheres were
analysed for each condition. Neurosphere circumference was quantied by measuring the perimeter of each sphere using Analysis D software. Each experiment was repeated 3 times.
Immunocytochemistry
Cells were xed with ice-cold methanol for 10 min at 20 C followed by 4% paraformaldehyde for 15 minutes at room temperature
(20 C) and washed in phosphate buffered solution containing
Tween 20 (0.02%) (PBS-T) three times for 5 min. Cells were incubated
in 5% normal horse serum in PBS-T overnight at 4 C, to attenuate
non-specic antibody binding. Cells were incubated with an antibody
that targets BrdU, containing DNase (1:10; mouse monoclonal; Amersham) for 1 hour, or antibodies that target nestin (1:200; goat polyclonal; Santa Cruz Biotechnology), III-tubulin (1:300; mouse
monoclonal; Promega), doublecortin (DCX) (1:200; goat polyclonal;
Santa Cruz Biotechnology), myelin basic protein (MBP) (1:200, rabbit
polyclonal; Sigma) and glial brillary acidic protein (GFAP) (1:300;
rabbit polyclonal; Dako) overnight at 4 C to identify proliferating
cells, NPCs, neurons, newly-born neurons and astrocytes respectively,
and as previously described (Keohane et al., 2010). For some experiments, cells were co-labelled with anti-IL-1R1 (1:200; rabbit polyclonal; Santa Cruz Biotechnology). Cells were washed in PBS-T three
times for 5 min and incubated for 1 hour at room temperature with
the appropriate secondary antibodies: Alexa Fluor 488 donkey antigoat IgG, Alexa Fluor 488 donkey anti-rabbit IgG or Alexa Fluor 594
donkey anti-mouse IgG (all 1:2000; Molecular Probes). Cells were
counterstained with bisbenzimide (1:2500; Sigma) to identify the
nuclei.
Cell counts and analysis of neuronal morphology
For each treatment condition, uorescent images of immunopositive cells were viewed under an Olympus Provis AX70 upright microscope, and photomicrographs were taken at 40 or 20
magnication using an Olympus DP50 digital camera and Studiolite TM software or an Olympus DP70 digital camera and Analysis D software, respectively. The number of total cells, and the numbers of each
cell phenotype were counted in 5 randomly-chosen elds of view per
coverslip. For each condition, cells from 4 coverslips were stained and
counted, and each experiment was repeated 3 times. The numbers of
primary, secondary and tertiary neurites of DCX-positive neurons
were calculated using Analysis D software where a primary process
is considered to be a branch from the cell body, secondary processes

319

are considered branches from primary processes and tertiary processes are considered branches from secondary processes.
RT-PCR
Total cellular RNA was extracted from hippocampal neurospheres
and differentiated NPCs using an RNeasy kit (Qiagen). cDNA synthesis
was performed on RNA using oligo (dT)s, random primers and reverse transcriptase (Promega) at 37 C for 1 hour. RNA was incubated
with DNase (Qiagen) for 30 minutes to exclude DNA contamination.
Amplication of IL-1R1, IL-1R2, DCX, III-tubulin, GFAP and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA by PCR was carried out using the following primers; IL-1RI, AGA TTG AAG GAC CTA
TGA TG (+), TGC AGC ATC TGA CGA CAG GA (); IL-1R2, GGC AAG
GAA TAC AAC ATC AC (+), TGG TTG TCA GTC GGT AGC TT ()
(Ben-Hur et al., 2003); nestin, CTG GGG GAG GAA AGT GTG AAG G
(+), AGG TAG AGG CCC AGG GGA GTA GAG (); DCX, CGA TCA
AAC TGG AAA CCG G (+), TTT GCG TCT TGG TCG TTA CC (); IIItubulin, TCA CAA GTA TGT GCC AGA GCC ATT (+), GCC TGA ATA
GGT GTC CAA AGG CCC C (); GFAP, ACA TCG AGA TCG CCA CCT
AC (+), ACA TCA CAT CCT TGT GCT CC (); GAPDH, TGG CAC AGT
CAA GGC TGA GA (+), CTT CTG AGT GGC AGT GAT GG (), and involved the following steps: denaturation for 2 min at 95 C, amplication for 30 cycles of; 95 C for 30 s, 55 C (IL-1R2 and GADPH), 54 C
(GFAP and IL-1RI), 57 C (III-tubulin) or 60 C (nestin) for 30 s and
72 C for 30 s. The nal extension was at 72 C for 5 min. To control
for genomic DNA contamination in each sample, RT-PCR using
GAPDH primers was performed on samples in which the cDNA synthesis reaction was carried out in the absence of reverse transcriptase.
During each PCR run H20 was used as a non-template control. The
amplication products were electrophoresed on a 1% agarose gel containing ethidium bromide and visualised on an ultraviolet transilluminator. A 100 base pair ladder was run on each gel to identify
bands of the correct size. Each experiment was carried out 3 times
and in triplicate.
Real time PCR
qPCR was carried out on a Light cycler 480 (Roche) using specic
primer/probe pairs designed using the universal probe library software. Amplication of IL-1R1 and the house keeping gene succinate
dehydrogenase A (SDHA) (Gubern et al., 2009) mRNA was carried out
using the following primer/probe combinations: IL-1R1 F: gcttgtgacatcttcggcta; R: aatgaacccaagtagcactttca; probe (no.80): cctggaga,
SDHA F: cccactaactacaagggacagg; R: ttggcaccatgcactgag; probe (no.
75): cagcctcc. Each qPCR run involved the following steps: 90 C for
10 min, then 45 cycles of 90 C for 10 s, 60 C for 30 s and 72 C for
1 s. Each reaction contained 2 l of cDNA (0.1 volume), primers
(0.5 m; Biomers) probes (0.1 m; universal probe library, Roche)
Light cycler master mix (0.2 volume; Roche) and made up to 20 l
with molecular grade H20. Samples from the cDNA synthesis step lacking the reverse transcriptase enzyme (RT-samples), were rst run to
ensure the samples contained no gDNA contamination. Each PCR run
contained a non template control (H20) to control for exogenous DNA
contamination. The crossing point (Cp) values were determined by
the Light Cycler 480 software, and Cp values were analyzed using the
Pfaf method (Pfaf, 2001) to measure fold change of IL-1R1 mRNA expression. Amplication specicity was checked by running the qPCR
products on a 1% agarose gel. Each experiment was carried out 3
times and in technical triplicate.
MTT Assay
After 2, 4 or 7 DIV under proliferation conditions, in the presence
or absence of IL-1, neurospheres were dissociated to a single cell
suspension, and seeded at a density of 2.5 10 4 cells in a 96-

320

H.F. Green et al. / Molecular and Cellular Neuroscience 49 (2012) 311321

multiwell plate, in proliferation media. Cells were plated in equal

numbers per unit area, allowed to adhere to the plate for 1 h and incubated with 0.5 mg/mL Thiazolyl Blue Tetrazolium Bromide (Sigma)
in phenol-red free DMEM (Sigma) under a humidied atmosphere
containing 5% CO2 at 37 C for 3 hours. The solution was removed
and cells were lysed in dimethyl sulphoxide (Sigma). Lysates were
transferred to a fresh 96-multiwell plate and the absorbance was
read on a Tecan Sunrise spectrophotometer at an absorbance wavelength of 540 nm and a reference wavelength of 690 nm. Each experiment was carried out three times and in technical triplicate.
Immunoblotting experiments
Neurospheres cultured in the presence or absence of IL-1 for 4 or
7 DIV were lysed on ice using radioimmunoprecipitation assay (RIPA)
buffer (50 mM TrisHCl; pH 7.5), 150 mM NaCl, 1 mM EDTA, 1%
Triton-X, 0.1% SDS, 1% sodium deoxycholate, 1 mM sodium uoride,
1 mM Na3VO4, 1 g/ml leupeptin, 1 g/ml pepstatin and 1 mM
PMFS). Total protein concentration in each sample was quantied
using the Bradford method (Bradford, 1976) and equalised using
RIPA buffer. Protein samples were diluted 1:1 with 2x Laemmli loading buffer (126 mM TrisHCl, 20% glycerol, 4% SDS, 0.02% bromophenol blue) containing 2.5% beta-mercaptoethanol, and equal
concentrations of protein were separated by SDS-PAGE using 10%
separating gel and were electrophoretically transferred to a nitrocellulose membrane by wet transfer. For immunoblot detection, the
membrane was incubated in Tris-buffered saline containing 0.05%
tween (TBS-T) and 5% milk to attenuate non-specic antibody binding, and then in primary antibodies that target poly-ADP-ribose polymerase (PARP) (1:2000, mouse monoclonal, Millipore) and -actin
(mouse polyclonal, 1:500; Sigma) overnight at 4 C with constant agitation. The membrane was washed, incubated for one hour with antimouse IgG HRP conjugate (1:2500, Promega), detected by enhanced
chemiluminescence (GE Healthcare) and photographed using an automated MedRay developer. Protein molecular weights were estimated by comparison with pre-stained molecular weight standards
(BioRad, Ireland) and to control for loading discrepancies, protein expression was equalised to -actin. Densitometry was carried out
using Image J. software, each experiment was repeated 3 times and
in technical triplicate.
Statistical analyses
ANOVA with post hoc Dunnett's or NewmanKeuls test, or an unpaired Student's t-test was performed as appropriate, to determine
which conditions were signicantly different from each other. Results
were expressed as means with SEM and deemed signicant when
p b 0.05.
Acknowledgments
This work was funded by the Irish Research Council for Science,
Engineering and Technology (HG) and Science Foundation Ireland
(YN) who had no role in the conduct of the research or in the preparation of the article. The authors declare that there are no conicts of
interest.
References
Ajmone-Cat, M.A., Cacci, E., Ragazzoni, Y., Minghetti, L., Biagioni, S., 2010. Pro-gliogenic
effect of IL-1alpha in the differentiation of embryonic neural precursor cells in
vitro. J. Neurochem. 113, 10601072.
Allan, S.M., Tyrrell, P.J., Rothwell, N.J., 2005. Interleukin-1 and neuronal injury. Nat. Rev.
Immunol. 5, 629640.
Araujo, D.M., Cotman, C.W., 1995. Differential effects of interleukin-1beta and
interleukin-2 on glia and hippocampal neurons in culture. Int. J. Dev. Neurosci.
13, 201212.

Arend, W.P., Welgus, H.G., Thompson, R.C., Eisenberg, S.P., 1990. Biological properties
of recombinant human monocyte-derived interleukin 1 receptor antagonist. J.
Clin. Invest. 85, 16941697.
Barrientos, R.M., Frank, M.G., Hein, A.M., Higgins, E.A., Watkins, L.R., Rudy, J.W., Maier, S.F.,
2009. Time course of hippocampal IL-1 beta and memory consolidation impairments
in aging rats following peripheral infection. Brain Behav. Immun. 23, 4654.
Ben-Hur, T., Ben-Menachem, O., Furer, V., Einstein, O., Mizrachi-Kol, R., Grigoriadis, N.,
2003. Effects of proinammatory cytokines on the growth, fate, and motility of
multipotential neural precursor cells. Mol. Cell. Neurosci. 24, 623631.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem.
72, 248254.
Caldwell, M.A., He, X., Svendsen, C.N., 2005. 5-Bromo-2'-deoxyuridine is selectively
toxic to neuronal precursors in vitro. Eur. J. Neurosci. 22, 29652970.
Carlson, N.G., Wieggel, W.A., Chen, J.A., Bacchi, A., Rogers, S.W., Gahring, L.C., 1999. Inammatory cytokines IL-1 alpha, IL-1 beta, IL-6, and TNF-alpha impart neuroprotection to
an excitotoxin through distinct pathways. J. Immunol. 163, 39633968.
Cunningham, E., Wada, E., Carter, D., Tracey, D., Battey, J., De Souza, E., 1992. In situ histochemical localization of type I interleukin-1 receptor messenger RNA in the central nervous system, pituitary, and adrenal gland of the mouse. J. Neurosci. 12,
11011114.
Demars, M., Hu, Y.S., Gadadhar, A., Lazarov, O., 2010. Impaired neurogenesis is an early
event in the etiology of familial Alzheimer's disease in transgenic mice. J. Neurosci.
Res. 88, 21032117.
Depino, A.M., Alonso, M., Ferrari, C., del Rey, A., Anthony, D., Besedovsky, H., Medina,
J.H., Pitossi, F., 2004. Learning modulation by endogenous hippocampal IL 1: Blockade of endogenous IL 1 facilitates memory formation. Hippocampus 14, 526535.
DiDonato, J.A., Hayakawa, M., Rothwarf, D.M., Zandi, E., Karin, M., 1997. A cytokineresponsive I B kinase that activates the transcription factor NF- B. Nature 388,
548554.
Dyson, S.C., Barker, R.A., 2011. Cell-based therapies for Parkinson's disease. Expert Rev.
Neurother. 11, 831844.
Farrar, W., Kilian, P., Hill, J., Ruff, M., Pert, C., 1987. Visualization of cytokine and virus
receptors common to the immune and central nervous system. Lymphokine Res.
6, 2934.
Fiala, J.C., Spacek, J., Harris, K.M., 2002. Dendritic spine pathology: cause or consequence of neurological disorders? Brain Res. Brain Res. Rev. 39, 2954.
Fleisher, A.S., Sun, S., Taylor, C., Ward, C.P., Gamst, A.C., Petersen, R.C., Jack Jr., C.R.,
Aisen, P.S., Thal, L.J., 2008. Volumetric MRI vs clinical predictors of Alzheimer disease in mild cognitive impairment. Neurology 70, 191199.
Friedman, W., 2001. Cytokines regulate expression of the type 1 interleukin-1 receptor
in rat hippocampal neurons and glia. Exp. Neurol. 168, 2331.
Gage, F.H., 2000. Mammalian neural stem cells. Science 287, 14331438.
Giulian, D., Young, D.G., Woodward, J., Brown, D.C., Lachman, L., 1988. Interleukin-1 is
an astroglial growth factor in the developing brain. J. Neurosci. 8, 709714.
Goshen, I., Yirmiya, R., 2009. Interleukin-1 (IL-1): a central regulator of stress responses. Front. Neuroendocrinol. 30, 3045.
Goshen, I., Kreisel, T., Ben-Menachem-Zidon, O., Licht, T., Weidenfeld, J., Ben-Hur, T.,
Yirmiya, R., 2007. Brain interleukin-1 mediates chronic stress-induced depression
in mice via adrenocortical activation and hippocampal neurogenesis suppression.
Mol. Psychiatry 13, 717728.
Gould, E., Tanapat, P., Hastings, N.B., Shors, T.J., 1999. Neurogenesis in adulthood: a possible role in learning. Trends Cogn. Sci. 3, 186191.
Greenfeder, S.A., Nunes, P., Kwee, L., Labow, M., Chizzonite, R.A., Ju, G., 1995. Molecular
cloning and characterization of a second subunit of the interleukin 1 receptor complex. J. Biol. Chem. 270, 1375713765.
Gubern, C., Hurtado, O., Rodriguez, R., Morales, J.R., Romera, V.G., Moro, M.A., Lizasoain,
I., Serena, J., Mallolas, J., 2009. Validation of housekeeping genes for quantitative
real-time PCR in in-vivo and in-vitro models of cerebral ischaemia. BMC Mol.
Biol. 10, 57.
Hannum, C.H., Wilcox, C.J., Arend, W.P., Joslin, F.G., Dripps, D.J., Heimdal, P.L., Armes,
L.G., Sommer, A., Eisenberg, S.P., Thompson, R.C., 1990. Interleukin-1 receptor antagonist activity of a human interleukin-1 inhibitor. Nature 343, 336340.
Herrera, D.G., Garcia Verdugo, J.M., Alvarez Buylla, A., 1999. Adult derived neural precursors transplanted into multiple regions in the adult brain. Ann. Neurol. 46,
867877.
Hodge, R.D., Hevner, R.F., 2011. Expression and actions of transcription factors in adult
hippocampal neurogenesis. Dev. Neurobiol. 71, 680689.
Iosif, R.E., Ekdahl, C.T., Ahlenius, H., Pronk, C.J.H., Bonde, S., Kokaia, Z., Jacobsen, S.E.W.,
Lindvall, O., 2006. Tumor necrosis factor receptor 1 is a negative regulator of progenitor proliferation in adult hippocampal neurogenesis. J. Neurosci. 26,
97039712.
Jacobs, B., Van Praag, H., Gage, F., 2000. Adult brain neurogenesis and psychiatry: a
novel theory of depression. Mol. Psychiatry 5, 262269.
Kan, E.M., Ling, E.A., Lu, J., 2010. Stem cell therapy for spinal cord injury. Curr. Med.
Chem. 17, 44924510.
Keohane, A., Ryan, S., Maloney, E., Sullivan, A.M., Nolan, Y.M., 2010. Tumour necrosis
factor-alpha impairs neuronal differentiation but not proliferation of hippocampal
neural precursor cells: Role of Hes1. Mol. Cell. Neurosci. 43, 127135.
Koo, J.W., Duman, R.S., 2008. IL-1 is an essential mediator of the antineurogenic and anhedonic effects of stress. Proc. Natl. Acad. Sci. U. S. A. 105, 751756.
Kriegstein, A., Alvarez-Buylla, A., 2009. The glial nature of embryonic and adult neural
stem cells. Annu. Rev. Neurosci. 32, 149184.
Laplagne, D.A., Kamienkowski, J.E., Espsito, M.S., Piatti, V.C., Zhao, C., Gage, F.H., Schinder,
A.F., 2007. Similar GABAergic inputs in dentate granule cells born during embryonic
and adult neurogenesis. Eur. J. Neurosci. 25, 29732981.

H.F. Green et al. / Molecular and Cellular Neuroscience 49 (2012) 311321

Licastro, F., Pedrini, S., Caputo, L., Annoni, G., Davis, L.J., Ferri, C., Casadei, V., Grimaldi,
L.M., 2000. Increased plasma levels of interleukin-1, interleukin-6 and alpha-1antichymotrypsin in patients with Alzheimer's disease: peripheral inammation
or signals from the brain? J. Neuroimmunol. 103, 97102.
Lindvall, O., Kokaia, Z., 2010. Stem cells in human neurodegenerative disorderstime
for clinical translation? J. Clin. Invest. 120, 2940.
Liu, C., Zhao, X., 2009. MicroRNAs in adult and embryonic neurogenesis. Neuromolecular
Med. 11, 141152.
Ma, D.K., Ming, G.L., Song, H., 2005. Glial inuences on neural stem cell development:
cellular niches for adult neurogenesis. Curr. Opin. Neurobiol. 15, 514520.
Ma, D.K., Marchetto, M.C., Guo, J.U., Ming, G., Gage, F.H., Song, H., 2010. Epigenetic choreographers of neurogenesis in the adult mammalian brain. Nat. Neurosci. 13,
13381344.
Magarinos, A.M., McEwen, B.S., Flugge, G., Fuchs, E., 1996. Chronic psychosocial stress
causes apical dendritic atrophy of hippocampal CA3 pyramidal neurons in subordinate tree shrews. J. Neurosci. 16, 35343540.
Maher, F.O., Nolan, Y., Lynch, M.A., 2005. Downregulation of IL-4-induced signalling in
hippocampus contributes to decits in LTP in the aged rat. Neurobiol. Aging 26,
717728.
Martino, G., Franklin, R.J., Van Evercooren, A.B., Kerr, D.A., 2010. Stem cell transplantation in multiple sclerosis: current status and future prospects. Nat. Rev. Neurol. 6,
247255.
McEwen, B.S., 2000. Effects of adverse experiences for brain structure and function.
Biol. Psychiatry 48, 721731.
McMahan, C.J., Slack, J.L., Mosley, B., Cosman, D., Lupton, S., Brunton, L., Grubin, C.,
Wignall, J., Jenkins, N., Brannan, C., 1991. A novel IL-1 receptor, cloned from B
cells by mammalian expression, is expressed in many cell types. EMBO J. 10,
28212832.
Monje, M.L., Toda, H., Palmer, T.D., 2003. Inammatory blockade restores adult hippocampal neurogenesis. Science 302, 17601765.
Neumann, H., Schweigreiter, R., Yamashita, T., Rosenkranz, K., Wekerle, H., Barde, Y.A.,
2002. Tumor necrosis factor inhibits neurite outgrowth and branching of hippocampal neurons by a rho-dependent mechanism. J. Neurosci. 22, 854862.
Nishiyori, A., Minami, M., Takami, S., Satoh, M., 1997. Type 2 interleukin-1 receptor mRNA is induced by kainic acid in the rat brain. Mol. Brain Res. 50,
237245.
Nolan, Y., Martin, D., Campbell, V.A., Lynch, M., 2004. Evidence of a protective effect of
phosphatidylserine-containing liposomes on lipopolysaccharide-induced impairment of long-term potentiation in the rat hippocampus. J. Neuroimmunol. 151,
1223.

321

Nolan, Y., Maher, F.O., Martin, D.S., Clarke, R.M., Brady, M.T., Bolton, A.E., Mills, K.H.G.,
Lynch, M.A., 2005. Role of interleukin-4 in regulation of age-related inammatory
changes in the hippocampus. J. Biol. Chem. 280, 93549362.
O' Keeffe, G.W., Sullivan, A.M., 2005. Donor age affects differentiation of rat ventral
mesencephalic stem cells. Neurosci. Lett. 375, 101106.
Parnet, P., Amindari, S., Wu, C., Brunke-Reese, D., Goujon, E., Weyhenmeyer, J.A., Dantzer,
R., Kelley, K.W., 1994. Expression of type I and type II interleukin-1 receptors in mouse
brain. Mol. Brain Res. 27, 6370.
Peng, H., Whitney, N., Wu, Y., Tian, C., Dou, H., Zhou, Y., Zheng, J., 2008. HIV-1-infected
and/or immune-activated macrophage-secreted TNF-alpha affects human fetal
cortical neural progenitor cell proliferation and differentiation. Glia 56, 903916.
Pfaf, M.W., 2001. A new mathematical model for relative quantication in real-time
RT-PCR. Nucleic Acids Res. 29, e45.
Qu, Q., Shi, Y., 2009. Neural stem cells in the developing and adult brains. J. Cell. Physiol.
221, 59.
Schneider, H., Pitossi, F., Balschun, D., Wagner, A., del Rey, A., Besedovsky, H.O., 1998. A
neuromodulatory role of interleukin-1beta in the hippocampus. Proc. Natl. Acad.
Sci. U. S. A. 95, 77787783.
Shors, T.J., Miesegaes, G., Beylin, A., Zhao, M., Rydel, T., Gould, E., 2001. Neurogenesis in
the adult is involved in the formation of trace memories. Nature 410, 372376.
Vallieres, L., Campbell, I.L., Gage, F.H., Sawchenko, P.E., 2002. Reduced hippocampal
neurogenesis in adult transgenic mice with chronic astrocytic production of
interleukin-6. J. Neurosci. 22, 486492.
Vereker, E., O'Donnell, E., Lynch, A., Kelly, Nolan, Y., Lynch, M.A., 2001. Evidence that interleukin 1 and reactive oxygen species production play a pivotal role in stress induced
impairment of LTP in the rat dentate gyrus. Eur. J. Neurosci. 14, 18091819.
Verret, L., Trouche, S., Zerwas, M., Rampon, C., 2007. Hippocampal neurogenesis during
normal and pathological aging. Psychoneuroendocrinology 32, S26S30.
von Bohlen und Halbach, O., Zacher, C., Gass, P., Unsicker, K., 2006. Age-related alterations
in hippocampal spines and deciencies in spatial memory in mice. J. Neurosci. Res. 83,
525531.
Wang, X., Fu, S., Wang, Y., Yu, P., Hu, J., Gu, W., Xu, X.M., Lu, P., 2007. Interleukin-1beta
mediates proliferation and differentiation of multipotent neural precursor cells
through the activation of SAPK/JNK pathway. Mol. Cell. Neurosci. 36, 343354.
Yirmiya, R., Goshen, I., 2011. Immune modulation of learning, memory, neural plasticity and neurogenesis. Brain Behav. Immun. 25, 181213.
Yirmiya, R., Winocur, G., Goshen, I., 2002. Brain interleukin-1 is involved in spatial
memory and passive avoidance conditioning. Neurobiol. Learn. Mem. 78, 379389.