Eur J Wildl Res (2005) 51: 8487

DOI 10.1007/s10344-005-0081-4

O R I GI N A L P A P E R

K. Luenser J. Fickel A. Lehnen S. Speck

A. Ludwig

Low level of genetic variability in European bisons (Bison bonasus)

from the Bialowieza National Park in Poland

Received: 20 December 2004 / Accepted: 25 January 2005 / Published online: 15 March 2005
Springer-Verlag 2005

Abstract Nuclear DNA markers (microsatellites) were

used to screen the genetic variability in the European
bison population of the Bialowieza National Park, Poland. The species is listed as endangered and the Bialowieza population is the largest one worldwide. Many
other herds were founded by individuals from Bialowieza. Out of 18 microsatellites, nine were polymorphic, ve were found to be homozygous, and four loci
did not amplify. No signicant deviation from Hardy
Weinberg-equilibrium (HWE) was observed, and the
average number of alleles was 2.3 per locus. Thus, the
European bison is characterized by a very low level of
genetic diversity, most likely resulting from the population decline in the nineteenth century. Nevertheless,
allelic variability derived from the nine polymorphic loci
established in this study allowed to identify each individual by its genotypic prole. This data is valuable for
conservation plans of this impressive species, especially
for the control of breeding success in these animals.
Keywords Inbreeding Microsatellites Pedigree
analysis STR genotyping

K. Luenser J. Fickel A. Ludwig (&)

Department of Evolutionary Genetics,
Leibniz-Institute for Zoo- and Wildlife Research,
10252 Berlin, Germany
E-mail: Ludwig@izw-berlin.de
Tel.: +49-30-5168206
Fax: +49-30-5126104
A. Lehnen S. Speck
Department of Wildlife Medicine,
Leibniz-Institute for Zoo- and Wildlife Research,
10252 Berlin, Germany
A. Ludwig
Leibniz-Institut fur Zoo- und Wildtierforschung,
FG Evolutionsgenetik, Alfred-Kowalke-Str. 17,
10315 Berlin, Germany

Introduction
The European bison (Bison bonasus Linnaeus,
1758)the largest herbivore in Europeis an early
Postglacial immigrant. The oldest European evidence
comes from sites in North Central Europe and South
Scandinavia dating back to the Preboreal. During the
Mid- and Late Holocene, European bison was widely
distributed on the European continent. Its range extended from France in the West to the Ukraine and
Russia in the East. Except for an area comprising East
Poland, Belarus, Lithuania and Latvia, European bison
was a rare species in most regions of its range. In the
Middle Ages, there is a shrinkage of the range of wisent
in its western parts resulting from habitat fragmentation
and overhunting. The archaeozoological records of this
time show that European bison obviously became a very
rare species in the western part of its former Central
European range after the tenth century and nally got
extinct there, while in East Europe its distribution remained more or less unchanged. High frequencies of
European bison among the bone nds have been reported from Late Holocene sites in East Poland, Belarus, Lithuania, and Latvia. At many sites of this region,
its bones constitute more than 20% of the remains of
wild ungulates. In contrast, European bison is only
represented by single records in most of the assemblages from Central and Southeast Europe (reviewed in
Benecke 2005).
Owing to its status as preferred game species, most
East European bison populations collapsed during last
century. In succession of World War I and the Russian
Civil War in 1917 only two relict populations survived,
one in the Bialowieza forest (Poland) and one in the
Caucasian Mountains. However, even these populations
collapsed during the 1920s; the last wild European
bison was shot in Poland in 1919 followed by the last
Caucasian animal in 1925.
After the World War I, survival of the species was
secured only in few European zoological gardens

85

(Sztolcman 1924). In total, only 54 individuals with

proved pedigrees remained (29 males and 25 females),
originating from 12 founder animals (Slatis 1960; Raczynski 1978; Pucek 1991). After a period of intensive
breeding in zoological gardens, the rst animals were
released in 1952 into the Bialowieza National Park,
which is the core of the Bialowieza Primeval Forest,
stretching across eastern Poland and western Belarus.
With approximately 540 animals, the Bialowieza bison
population is the largest globally (Kita et al. 2003;
European Bison Pedigree Book - EBPB 2001). In 2000,
2864 individuals were registered worldwide (EBPB 2001;
Hilton-Taylor 2000). Currently, the European bison is
listed as endangered (EN A2ce, C2a) in the IUCN Red
List of Threatened Species (http://www.redlist.org,
2004).
Seven hundred individuals of uncertain pedigree,
which are suspected to have been crossbreds or introgressed by domestic cattle or American bison, Bison
bison (Ward et al. 1999), are not listed in the EBPB.
Although representing a large bison gene pool, these
animals are unfortunately of no value for the conservation of European bison. Despite a raised stock, the
European bison is still on the brink of extinction due to
increased inbreeding as a consequence of the very recent
bottleneck.
Inbreeding occurs by reproduction of related individuals sharing one or more common ancestors (Oosterhout et al. 2000). Such mating concentrates similar
alleles in the ospring, and if continued, also in the
whole population. In cases of deleterious recessive alleles, inbreeding will coincide with a reduction of the
mean phenotypic value shown by characters connected
with reproductive capacity or physiological eciency
(Falconer and Mackay 1996). Consequently, the loss of
genetic and phenotypic plasticity becomes more inuential in highly endangered species which are as per
denition already below a critical population size
threshold and thus very susceptible to environmental
Table 1 Microsatellite loci,
respective primer sequences
(forw forward primer; rev
reverse primer), and annealing
temperatures (Ta) of
polymorphic loci

changes. The impact of inbreeding depends mainly on

the eective population size (number of breeders per
generation time). Recognizing these causalities, it becomes common practice to include pedigree analyses in
management programs to conserve as much genetic
variability as possible and to control the reproductive
success of the dierent breeders.
Therefore, our study focused on the adaptation of
domestic cattle microsatellite loci to develop a
method to facilitate the individual identication of each
specimen using genetic markers.

Methods
Samples
Thirty-eight animals (20 males, 18 females), randomly of
age, were sampled during hunting seasons from 2001 to
2004. Depending on ambient temperature, culling normally started in November and ended in March or April.
Only samples from the Polish part of the National park
were available depending on political conditions.
Microsatellites
All 18 investigated microsatellite loci were originally
developed for pedigree analyses in domestic cattle. Primer sequences and annealing-temperatures of the nine
polymorphic successfully amplied loci are listed in
Table 1. Detailed locus information can be retrieved
from the BOVMAP database. The PCR reaction was
carried out in a total volume of 25 ll. Amplication
consisted of 35 cycles of each composed of 45 s at 95C
(denaturation), 45 s at specic annealing temperature
(Table 1), and 30 s at 72C (extension) in the presence of
2.0 mM MgCl2 and 1.25 U of Taq polymerase (Roche).
Loci from which polymorphic PCR products were

Locus

Primers

Annealing
temperature (C)

BTJAB1

forw: CATTAAGGGCTGGGATTCCT
forw: AGATTTCTGGAGGAGGCTCACAGCA
forw: TGTATGATCACCTTCTATGCTTC
forw: GCTTTAGGTAATCATCAGATAGC
forw: TTGAGCACAGACACAGACTGG
forw:ACTGAATGCCTCCTTTGTGC
forw: AATGGGCGTATAAACACAGATG
rev: TGAGTCCTGTCACCATCAGC
forw: TTTCTCAACAGAGGTGTCCAC
rev: ACCCCTATCACCATGCTCTG
forw: AGCTGGGAATATAACCAAAGG
rev: AAGTGCTTTCAAGGTCCATGC
forw: CCCTCCTCCAGGTAAATCAGC
rev: AATCACATGGCAAATAAGTACATAC
forw: TTGGTCTCTATTCTCTGAATATTCC
rev: TTGGTCTCTATTCTCTGAATATTCC
forw: GTTCAGGACTGGCCCTGCTAACA
rev: CCTCCAGCCCACTTTCTCTTCTC

60

BOVIRBP
BM6438
BM2830
BM1225
BM1818
TGLA122
TGLA126
ETH10

60
60
50
50
50
50
50
50

86

obtained were identied by capillary electrophoresis on

an ABI 3100 Genetic Analyzer (Applied Biosystems).
PCR products of polymorphic loci were sequenced
bidirectionally using the same primers as for amplication (BigDye cycle sequencing kit, Applied Biosystems,
Weiterstadt, Germany), and also analysed on an ABI
3100 Genetic Analyzer (Applied Biosystems).
Statistical analysis
We tested for genotypic disequilibria and calculated
numbers of alleles per locus (N a), observed (H o) and
calculated expected heterozygocity (H e) using GENEPOP3.1c (Raymond and Rousset 1995). We also tested
for HardyWeinberg equilibria genotypic proportions
(HWE) using a Markov chain approach (5,000 dememorization steps, 1,000 batches, 5,000 iterations per
batch) implemented in GENEPOP. We also applied a
multisample score test (Raymond and Rousset 1995) to
test for either heterozygote decit or excess and to assess
the signicance of deviations from HWE.

Results and discussion

Despite the large number of loci investigated, only nine
proved to be polymorphic (Table 1). The following ve
loci were found to be monomorphic: BL42, BTJAB3,
BM2113, BM203, BM4107. Four loci (VH110, BM1824,
TGLA227, BOVILS65) did not amplify in European
bison.
Alleles per polymorphic locus and individual are listed in Table 2. Comparison of observed (Ho) and expected heterozygosity (He) showed no signicant
deviation from HardyWeinberg-equilibrium (HWE)
(Table 2). BTJAB, with four alleles, was the most
polymorphic locus, but the average of only 2.3 alleles
across all loci indicated a very low degree of allelic
variability. However, such low level of genetic diversity,
as seen in the European bison, is extreme, especially in
comparison to its sister species, the American bison
(Bison bison). Similar to its European relative, the
Table 2 Characteristics of nine polymorphic microsatellite loci
measured in a sample of 38 European bisons from Bialowieza
National Park (Poland): number of alleles per locus (N a), observed (Ho) and expected heterozygosity (He), detected allele

American bison also decreased drastically from millions

of animals to approximately 300 individuals in the late
1800s (Coder 1975; Dary 1989). Nevertheless, the number of alleles per locus, measured at 15 microsatellites,
ranged from 5 to 16 (Schnabel et al. 2000). For the
European bison population, the bottleneck was even
more severe. Only 54 individuals stemming from 12
founder animals were available for restoration (Slatis
1960; Raczynski 1978; Pucek 1991), thus the observed
low level of genetic variability is not surprising.
In small populations, even though individuals may
mate randomly, loss of genetic diversity is unavoidable
due to genetic drift and the increased probability of
mating between related individuals (inbreeding). A major consequence of inbreeding is depression caused by
xation of deleterious alleles (Frankham et al. 2002).
Because selection acts against them, such deleterious
alleles exist only in small frequencies in each population.
Decline of eective population size, however, increases
their chance to become inuential. The loss of genetic
variability also results in an overall increase in homozygosity. This homogenization can reduce tness
parameters such as reproduction. However, reproduction success of the Bialowieza population during the last
21 years was impressive. The population grew from 13
to 540 animals (Pucek et al. 2004). Obviously, there is no
evidence for fecundity or fertility losses. A similar
observation was already made in the 1950s by examining
population dynamics and relatedness in the Bialowieza
population (Slatis 1960). Nevertheless, inbreeding may
have favoured manifestation of balanoposthitis, an illness aecting the reproduction capacity of bulls. In
1980, rst indications of a new imminence to the bison
population appeared: two bulls were diagnosed with
balanoposthitis, a disease characterized by inammation
of external genital organs including the penis prepuce.
The clinical signs and lesions were described several
times by Polish investigators (Kita et al. 1990; Piusinski
et al. 1997). Between 1980 and 1997, 133 diseased males
were identied in the Bialowieza population (Jakob et al.
2000). With progressing stage of the illness, there is the
chance for the infected bulls to reproduce plummets. In
addition, lot of males with urogenital disorder were
sizes in base pairs (bp), and estimated frequency in %. None of
the loci investigated showed signicant deviations from Hardy
Weinberg-equilibrium (P > 0.05)

Locus

Na

Ho

He

Allelic size in bp (frequency in %)

ETH10
BM1818
TGLA126
TGLA122
BM1225
BM2830
BTJAB1

3
2
3
2
3
3
4

0.632
0.500
0.500
0.289
0.568
0.737
0.421

0.638
0.478
0.518
0.251
0.663
0.638
0.351

BOVIREP
BM6438

2
2

0.474
0.432

0.505
0.520

208 (0.329), 210

260 (0.605), 264
111 (0.237), 115
140 (0.855), 164
254 (0.446), 258
143 (0.224), 153
206 (0.013), 218
228 (0.026)
126 (0.526), 142
264 (0.513), 274

(0.171),
(0.395)
(0.671),
(0.145)
(0.257),
(0.487),
(0.171),
(0.474)
(0.487)

212 (0.500)
122 (0.092)
260 (0.297)
163 (0.289)
224 (0.790),

87

culled. Therefore, most of the diseased individuals do

not participate in reproduction.
There are strong theoretical reasons to suspect that
inbreeding and concomitant loss of genetic diversity
reduces the ability of populations to cope with disease
(O Brien and Evermann 1988; Sorci et al. 1997;
Frankham et al. 2002). Inbreeding and low heterozygosity have been associated with decrease in resistance to
infectious pathogens in plants and animals (Ferguson
and Drahushchak 1990; Clay and Kover 1996; Coltman
et al. 1999). On the basis of the increased frequency of
balanoposthitis aecting the Bialowieza population and
the bottleneck responsible for the detected low genetic
diversity, we propose that this disease has a genetic
predisposition most likely resulting from the xation of
a deleterious recessive allele. Further investigations
of loci involved in immune defence are necessary in order to investigate genetic factors contributing to
balanoposthitis.
For management plans and the future conservation
of this impressive species, a control of breeding success
of each individual is proposed. Genetic markers used in
this study render such genetic management of the
Bialowieza population possible for the rst time. By
using the combination of loci shown in Table 1, individual genotyping as well as parentage determination is
practicable now.
Acknowledgments We thank our cooperative partners in Poland for
providing samples: M. Krasinska and Z. Krasinski as well as many
hunters, veterinarians, and scientists for their support. We are
grateful to G. Wibbelt and K. Frolich for their helpful discussions,
to A. Schmidt for technical assistance, to C. Kuhn for genetic
marker information as well as to two anonymous referees, and W.
Lutz for his helpful comments on an earlier draft. We also thank N.
Benecke for providing us with his submitted manuscript. The authors declare that the experiments comply with the current laws in
Germany.

References
Benecke N (2005) The Holocene distribution of European bisonthe archaeozoological record. Munibe (in press)
Clay K, Kover PX (1996) The red queen hypothesis and plant/
pathogen interactions. Annu Rev Phytopathol 34:2950
Coder GD (1975) The national movement to preserve the American bualo in the United States and Canada between 1880 and
1920. Ph.D. dissertation, The Ohio State University, OH
Coltman DW, Pilkington JG, Smith JM, Pemberton JM (1999)
Parasite-mediated selection against inbred Soay sheep in a freeliving island population. Evolution 53:12591267
Dary DA (1989) The bualo book. The Swallow Press Inc., Chicago

EBPB (2001) European bison pedigree book 2000. Bialowieza

National Park, Bialowieza Poland
Falconer DS, Mackay TFC (1996) Introduction to quantitative
genetics. Longman, Harlow
Ferguson MM, Drahushchak LR (1990) Disease resistance and
enzyme heterozygosity in rainbow trout. Heredity 64:413417
Frankham R, Briscoe DA, Ballou JD (2002) Introduction to conservation genetics. Cambridge University Press, Cambridge
Hilton-Taylor C (2000) IUCN red list of threatened species. IUCN,
Gland Switzerland
Jakob W, Schroder HD, Rudolph M, Krasinski ZA, Krasinska M,
Wolf O, Lange A, Cooper JE, Frolich K (2000) Necrobacillosis
in free-living male European bison in Poland. J Wildl Dis
36:248256
Kita J, Dziaba K, Piusinski W, Anusz K, Lenartowicz Z, Kowalski
B, Krasinski ZA, Krupa J, Lesniewski S (1990) A disease of
genital organs of free-roaming male European bison in the Bialowieza Primaval Forest (In Polish with English summary).
Medycyna Weterynaryjna 46:474476
Kita J, Anusz K, Zaleska M, Malicka E, Bielecki W, Osinska B,
Kowalski B, Krasinski Z, Demiaszkiewicz A, Rhyan J, Kolipinski M (2003) Relationships among ecology, demography
and diseases of European bison (Bison bonasus). Pol J Vet Sci
6:261266
OBrien SJ, Evermann JF (1988) Interactive inuence of infectious
disease and genetic diversity in natural populations. Trends
Ecol Evol 3:254259
Oosterhout van C, Zijlstra WG, van Heuven MK, Brakeeld PM
(2000) Inbreeding depression and genetic load in laboratory
metapopulations of the buttery Bicyclus anynana. Evol Int
J Org Evol 54:218225
Piusinski W, Bielecki W, Malecka E, Kita J, Dziaba K, Osinska B,
Anusz k, Kowalski B, Lenartowicz-Kubrat Z (1997) Patomorphology and pathogenesis of diseased genital organs (prepuce
and penis) of bison in the Bialowieza Forest. Medycyna Weterynaryjna 53:596600
Pucek Z (1991) History of the European bison and problems of its
protection and management. In: Bobeck B, Perzanowski K,
Regelin W (ed) Global trends in wildlife management. Trans
18th IUGB Congress. Swiat Press, Krakow-Warsaw, pp 1939
Pucek Z, Belousova P, Krasinska M, Krasinski ZA, Olech W
(2004) Status survey and conservation action plan: european
bison. IUCN, Gland Switzerland
Raczynski J (1978) Zubr [ European Bison]. Panstwowe Wydawnictwo Rolnicze i Lesne, Warsaw Poland, pp 1246
Raymond M, Rousset F (1995) GENEPOP (v.1.2): population
genetics software for exact test and ecumenicism. J Hered
86:248249
Schnabel RD, Ward TJ, Derr JN (2000) Validation of 15 microsatellites for parentage testing in North American bison, Bison
bison and domestic cattle. Anim Genet 31:360366
Slatis HM (1960) An analysis of inbreeding in the European bison.
Genetics 45:275287
Sorci G, Moller AP, Boulinier T (1997) Genetics of hostparasite
interaction. Trends Ecol Evol 12:196199
Sztolcman J (1924) Materiaux pour lhistoire naturelle et pour
lhistorique du Bison dEurope (Bison bonasus Linn.). Annales
Zoologoco Musei Polonici Historiae Naturalis 2:49136
Ward TJ, Bielawski JP, Davis SK, Templeton JW, Derr JN (1999)
Identication of domestic cattle hybrids in wild cattle and bison
species: a general approach using mtDNA markers and the
parametric bootstrap. Anim Conserv 2:5157