Am J Respir Crit Care Med 2003.167:1316-1320.

Characterization of a Single Nucleotide Polymorphism

in the Lipopolysaccharide Binding Protein and
Its Association with Sepsis
Robert C. Barber and Grant E. OKeefe
Department of Surgery, University of Texas Southwestern Medical Center, Dallas, Texas; and Department of Surgery,
University of Washington and Harborview Medical Center, Seattle, Washington

We sought to characterize polymorphisms in the proximal coding

region of the lipopolysaccharide binding protein gene and to determine whether a previously reported variant was associated with sepsis complicated by organ failure or shock after trauma. We used
multiple analytical methods, including pyrosequencing, restriction
fragment length polymorphism, and sequencing to characterize the
proximal coding region. We also reexamined a prospective cohort
of severely injured patients and healthy control individuals. The single
nucleotide polymorphism at nucleotide 292 does not exist as previously reported. Instead, the adjacent nucleotide (291) was observed
to be polymorphic. In 151 trauma patients, 37 (25%) developed
severe sepsis, and 19 (13%) died. Thirteen of 50 (26%) C-allele carriers and 24 of 101 (24%) TT homozygotes developed severe sepsis.
Unadjusted and adjusted analyses did not demonstrate any associations between genotype and severe sepsis, septic shock, or death.
In conclusion, a single nucleotide polymorphism in the lipopolysaccharide binding protein coding region that was reported to exist at
the 292 position and to result in an amino acid substitution actually
exists at the adjacent 291 position and does not result in an amino
acid substitution. Furthermore, this polymorphism does not appear
to be associated with complicated sepsis after trauma.
Keywords: lipopolysaccharide; polymorphism; sepsis; gene

The lipopolysaccharide (LPS) binding protein (LBP) facilitates

the transfer of bacterial LPS to the LPS receptor, CD14, and
is important in the host response to LPS and gram-negative
bacteria (1, 2). Given the variability in the inflammatory response between individuals, it is important to consider genetic
differences in the inflammatory and innate immune responses
(LBP, CD14, various cytokines) as possible determinants of
outcomes after infectious and inflammatory conditions (3, 4).
In our investigations of such associations with severe sepsis
and septic shock, we have studied the proximal coding region
of the LBP gene. Other investigators have observed an association between a T G single nucleotide polymorphism (SNP)
at nucleotide 292 of this locus (GenBank #AF105067) and the
risk for sepsis among male but not female patients (5). This nonsynonymous transition would result in an amino acid substitution of cystine to glycine at the 98th residue in the LBP protein.
After examination of the nucleotide sequences published in
GenBank and EMBL and after careful examination of genetic
material from a cohort of injury victims and uninjured control
subjects, we observed that this previously reported T G SNP

(Received in original form September 17, 2002; accepted in final form February 8, 2003)
Supported by NIGMS grant #5P50GM021681370013 (G.E.O.).
Correspondence and requests for reprints should be addressed to Grant OKeefe,
MD, University of Washington, Department of Surgery, Box 359796, Harborview
Medical Center, 325 Ninth Avenue, Seattle, WA 981042499. E-mail: gokeefe@
u.washington.edu
Am J Respir Crit Care Med Vol 167. pp 13161320, 2003
Originally Published in Press as DOI: 10.1164/rccm.200209-1064OC on February 13, 2003
Internet address: www.atsjournals.org

does not exist. Instead, a T C SNP at the adjacent nucleotide

291 was identified by direct sequencing and was confirmed by
additional techniques. This T C SNP is synonymous (proline proline) and therefore does not alter protein structure.
In this report, we describe these findings, explain how the previously reported restriction fragment length polymorphism
(RFLP) analysis resulted in inaccurate genotyping, and present
our observations of the lack of association between this SNP
and severe sepsis or septic shock in a cohort of trauma victims.
METHODS
Source of Genetic Material, DNA Extraction,
and Amplification
DNA was obtained from victims of traumatic injury who were admitted
to the trauma center at Parkland Memorial Hospital in Dallas, Texas.
We also obtained DNA from 133 uninjured control subjects. All study
subjects or their surrogate provided informed consent for blood sampling
and genotyping. The University of Texas Southwestern Medical Center
Institutional Review Board approved all procedures. Genomic DNA was
extracted from whole blood using the QIAamp DNA Blood Midi Kit
(Qiagen, Valencia, CA) according to manufacturers instructions, and
DNA was stored at 20C until amplification. The region spanning
nucleotides 200 through 317 of the LBP gene was amplified from genomic
DNA by polymerase chain reaction (PCR) using Taq DNA polymerase
(Roche Diagnostics, Indianapolis, IN) and a PTC 200 thermal cycler (MJ
Research, Watertown, MA). Published PCR primers and conditions were
used in all phases of this study (5), with the exception of pyrosequence
analysis, which required redesigned primer sequences and conditions
(Table 1).

Cloning and Sequence Analysis

HpaII digestion of the PCR-amplified fragment was used to identify individuals representing each genotype (Figures 1 and 2). Five individuals
for each genotype were subsequently amplified, and the PCR products
were inserted into the pCRII plasmid vector via TA cloning (Invitrogen,
Carlsbad, CA). Briefly, this technology takes advantage of the terminal
transferase activity of Taq DNA polymerase, which precipitates the
addition of a single A residue to the 3 ends of PCR-amplified DNA fragments (6, 7). The plasmid vector was constructed by enzymatic linearization within a multiple cloning site that contained a copy of the LacZ-
complement and further modification to contain single nucleotide T overhangs at the 3 ends. These modifications allowed a single base pair
(T/A) overlap during ligation that increased the efficiency of the cloning
reaction. Insertion of the PCR product into the multiple cloning site
interrupted the LacZ- gene and rendered it nonfunctional. The recircularized plasmids were then used to transform INVaF-competent
Escherichia coli cells, and the transformed bacteria were grown overnight on agar plates containing the lactose analogue X-Gal. The addition
of this reagent to the bacterial growth medium allowed for blue-white
screening of colonies that were likely to contain the fragment of interest.
Colonies that contained a pCRII plasmid with a PCR-amplified insert
were unable to cleave X-Gal, which gave the positive colonies a white,
rather than a blue, color. Three positive (white) colonies were selected
at random from each individual, and the plasmid DNA was isolated (8).
The DNA sequence of the plasmids was then determined by fluorescent
modification of the dideoxy chain termination sequencing method (9),
and SNPs were identified by visual inspection of the sequence electropherograms (Figure 3).

Downloaded from www.atsjournals.org by 39.209.14.160 on 06/06/13. For personal use only.

Am J Respir Crit Care Med 2003.167:1316-1320.

Barber and OKeefe: Genetic Polymorphism and Sepsis

1317

TABLE 1. PRIMER SEQUENCES AND CONDITIONS FOR PYROSEQUENCE ANALYSIS OF THE

LIPOPOLYSACCHARIDE BINDING PROTEIN 291 SINGLE NUCLEOTIDE POLYMORPHISM
Primer

Primer Sequences (5 to 3)

LBP-Pyro-For-biotin

CAGCCTGAACATCCACAGC

LBP-Pyro-Rev
LBP-Pyro-Seq

AAGAATGACTTGCGCACCTT
GCTGAGACTCAGGCCCTGGC

Cycling Conditions
95C for 5 min/35 cycles; 95C
for 30 s, 63C for 60 s, 72C
for 60 s/72C for 5 min.
NA

Definitions of abbreviations: LBP lipopolysaccharide binding protein; NA not applicable.

Pyrosequencing Analysis
All genotypes were determined by pyrosequencing analysis on a PSQ
96 Pyrosequencer (Pyrosequencing AB, Westborough, MA) according
to manufacturers specifications, and genotypes were resolved using PSQ
96 SNP Software, version 1.2 AQ. Each SNP was assayed with a specific
primer sequence (Table 1), which enabled the unambiguous scoring of
heterozygotes and alternate homozygotes (10). As a sequencing-based
technique, pyrosequencing is a rapid method that has been used for SNP
haplotyping and as a reliable alternative to microsatellite analysis for
chimerism (11, 12).

relative risk for severe sepsis with its associated 95% confidence interval
is also presented. We then conducted a logistic regression analysis, incorporating the LBP genotype in addition to the variables that we previously
identified to be risk factors for complicated sepsis. These variables
included age of 55 years or more, an arterial base deficit of 6 meq/L or
more measured between 624 hours after injury, and carriage of the
A-allele at the 308 position in the tumor necrosis factor- gene. The
adjusted odds ratios and associated 95% confidence intervals are also
presented. Adequate DNA was available from 151 of the 152 original
subjects, and these 151 are reported here.

Patient Recruitment, Data Presentation, and Analysis

RESULTS

We recruited injury victims admitted to the intensive care unit and included patients who were not brain dead, had an estimated injury severity
score of 16 or more, and were expected to be in the intensive care unit
for 24 hours or more. A detailed description of the study sample and
the end-point definitions has been previously published, and the important details are summarized here (13). Sepsis was defined according to
the ACCP/SCCM consensus definitions and required the simultaneous
presence of the systemic inflammatory response syndrome and a definite
source of infection based on a positive microbiologic culture (14). Severe
sepsis was defined as sepsis accompanied by organ failure such that the
organ failure was temporally related to sepsis. Organ failure was based
on our modification of the Multiple Organ Dysfunction Syndrome scoring
system, in which neurologic dysfunction is not scored and values measured
in the first 24 hours after injury are not included, to exclude transient
changes in organ function (13, 15). Septic shock required the presence
of a metabolic acidosis (a pH of 7.30 or less) or inotropic cardiac support
(excluding dopamine at 5 g/kg/minute or less) or vasopressor support
to maintain systolic blood pressure of 90 mm Hg or more. These criteria
are similar to those used by others in studies of genetic associations with
sepsis in adults (16).
In this report, our primary analysis was of the LPB genotype as a
risk factor for severe sepsis or septic shock that are referred to together
as complicated sepsis. We compared allele frequencies in patients with
and without complicated sepsis by Fishers exact test. The unadjusted

Identification of a T C SNP at the 291 Position

of the LBP Gene

Figure 1. PCR-RFLP with

HpaII of the region surrounding nucleotide 291
of the cDNA sequence of
the LBP gene. Lanes 1
and 12: 1-KB plus ladder;
lanes 2 and 11: undigested 118 bp PCR product; lanes 4, 7, 8, 10, and
11: individuals homozygous for absence of HpaII
site (undigested118 bp
PCR product); lane 6: individual homozygous for presence of HpaII site
(95-bp HpaII digest product*); lanes 3, 5, and 9: individuals heterozygous for the presence of the HpaII site (undigested 118-bp PCR product
as well as 95-bp HpaII digest product*). *The 23-bp HpaII digest product
is not visible.

DNA from 15 subjects, representing all three possible genotypes,

was subjected to sequencing of the forward and reverse strands.
Examination of the sequence data revealed that nucleotide 292
of the LBP cDNA was an invariant G. However, a T C transition
SNP was identified at the adjacent nucleotide 291 (Figure 3). This
synonymous SNP would result in alteration of an HpaII restriction
endonuclease recognition site but would not precipitate an amino
acid substitution. Pyrosequencing confirmed the results of sequencing in all 15 sequenced samples and was therefore used to
genotype this SNP in the remaining trauma and control individuals. A sample of each genotype was subjected to pyrosequencing
a second time, confirming the initial results in all cases. The allele
frequencies for patients and control subjects according to ethnicity
are shown in Table 2. Genotype frequencies were in Hardy
Weinberg equilibrium in both groups. There were significant differences in allele frequencies across ethnic groups, but within
ethnic groups, the allele frequencies were similar in the trauma
patients and the uninjured control subjects.
Characteristics of the Trauma Patient Cohort

The demographic, clinical, and outcome variables for this cohort

were previously reported in detail and are summarized here (13).
Most of the patients were men (112; 74%), and 27 (15%) were
55 years of age or more. The cohort was multiethnic, but the

Figure 2. Nucleotide
and
protein sequences for the region surrounding nucleotide
291 of the LBP gene as reported by the NCBI SNP database (dbSNP). (A) The
wild-type sequence of LBP
gene (GenBank accession
numbers; NT_011362.7, BC022256, NM_004139, and AF10567). (B) Sequence of the LPB gene reported as wild-type by Hubacek and colleagues
(5). (C) Variant sequence of the LBP gene, as determined here by sequencing and pyrosequencing (GenBank accession number; M335533).

Downloaded from www.atsjournals.org by 39.209.14.160 on 06/06/13. For personal use only.

Am J Respir Crit Care Med 2003.167:1316-1320.

1318

AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE VOL 167 2003
TABLE 2. ALLELE FREQUENCIES IN TRAUMA PATIENTS
AND UNINJURED CONTROL SUBJECTS ACCORDING
TO ETHNICITY

White
T-allele
C-allele
African American
T-allele
C-allele
Hispanic
T-allele
C-allele

Trauma Patients
(n 145)

Uninjured Control Subjects

(n 133)

144 (84%)
28 (16%)

103 (90%)
11 (10%)

0.11

12 (50%)
12 (50%)

43 (48%)
47 (52%)

0.84

81 (86%)
13 (14%)

70 (90%)
8 (10%)

0.48

p Value

Patients with sox trauma who did not belong to the three indicated ethnic
groups were excluded. In both trauma patients (p 0.001) and uninjured control
subjects (p 0.001), the allele frequencies differed across ethnicity. Within each
ethnic group (p value shown for each group), there were no differences in allele
frequencies, and overall, after adjusting for ethnic group, there were no differences
(Mantel-Haenzel adjusted -square p value 0.88).

Figure 3. Electropherograms illustrating the DNA sequence described

in Figure 1. (A ) Variant C-allele (HpaII positive). (B ) Wild-type T-allele
(HpaII negative).

majority were white (86; 57%), followed by Hispanic (47; 31%)

and African American (12; 8%) according to self-report.
Shock, defined by a base deficit of 6 meq/L or more measured
from 6 to 24 hours postinjury, was common, occurring in 40 (27%)
patients. The majority of patients developed a nosocomial infection while in the intensive care unit (96; 64%). Sepsis was complicated by organ failure or shock in 37 (25%) patients, and 19 (13%)
patients died.
Analysis of LBP 291 Genotype and Risk for Severe Sepsis

For the entire cohort, the frequency of the LBP 291 alleles did not
significantly differ between the patients with and without severe
sepsis (Table 2). When men and women were analyzed separately,
no association between carriage of the C-allele and severe sepsis
was observed.
Logistic regression revealed that carriage of the A-allele at the
LBP 291 SNP was not associated with an increased risk for severe
sepsis after trauma (odds ratio 1.157; 95% confidence interval,
0.4632.891). The inclusion of the LBP genotype did not markedly
alter the results of our previously reported analysis of this patient
cohort. This original report did not include the LBP SNP but did
include a SNP at nucleotide 308 of the tumor necrosis factor-
promoter and additional clinical risk factors for sepsis. The results
of the analysis, including the LBP SNP, are shown in Tables 3
and 4.
We conducted a series of additional, secondary analyses. First

we examined the association between the LBP 291 C-allele and

septic shock, the most severe manifestation of sepsis, and with
death. Few patients (18; 12%) developed septic shock, and there
was a similar risk across LBP genotypes. Of the C-allele carriers,
7 (14%) developed septic shock, and of the TT homozygotes, 11
(11%) developed septic shock. There was no association between
the 291 C-allele and death. We then limited our analysis to the 96
patients who developed a nosocomial infection and similarly found
no association between the 291 C-allele and either severe sepsis
or septic shock. We finally limited the analyses to the 86 white
patients and did not observe any associations between the 291
C-allele and severe sepsis, septic shock, or death (data not shown).

DISCUSSION
By direct sequencing of the cloned DNA fragment containing the
proximal LPB gene coding region, we have determined that the
HpaII RFLP site, thought to be due to a T G SNP at the 292
nucleotide, is in fact the result of a T C SNP at the adjacent
291 position. Either of these substitutions would result in the generation of the HpaII restriction site, allowing differentiation of the
wild-type and variant alleles by RFLP analysis. However, this
method of detection is unable to distinguish the sequence of the
underlying polymorphism. This information is crucial, as the alternative SNPs would have substantially different effects on the resulting amino acid sequence. A T G transition at the 292 position
would be nonsynonymous and would result in the replacement of
cystine with glycine at amino acid residue 98. In contrast, the T
C substitution at 291 is silent, with both variants encoding the
amino acid proline at residue 97. We have used a third genotyping
method, pyrosequencing, to confirm our findings. This technique
directly sequences a short DNA fragment (510 bases), including
the polymorphic region of interest, and provides a visual display
of that sequence. Like RFLP, pyrosequencing requires prior knowledge of the nucleotide sequence adjacent to the SNP, but unlike
RFLP, pyrosequencing reveals the exact sequence change or polymorphism. The HpaII enzyme recognizes the nucleotide sequence
CCGG. Therefore, whereas either of the substitutions at nucleotide
291 or 292 would result in the generation of a restriction site that
appears identical by RFLP analysis, the SNPs would easily be
differentiated by sequencing or pyrosequencing. The results of
pyrosequencing correspond exactly to the results of sequencing in
our samples, identifying the SNP at the 291 position. Figure 3
illustrates the three variations on the nucleotide sequence of this

Downloaded from www.atsjournals.org by 39.209.14.160 on 06/06/13. For personal use only.

Am J Respir Crit Care Med 2003.167:1316-1320.

Barber and OKeefe: Genetic Polymorphism and Sepsis

1319

TABLE 3. SUMMARY OF GENOTYPING DATA FOR THE LIPOPOLYSACCHARIDE BINDING PROTEIN

291 SINGLE NUCLEOTIDE POLYMORPHISM FOR 151 TRAUMA PATIENTS WITH AND
WITHOUT SEVERE SEPSIS
LBP 291 SNP

No/Uncomplicated Sepsis
(n 114)

Severe Sepsis
(n 37)

77 (76)
37 (74)

24 (24)
13 (26)

0.456

58 (74)
25 (74)
83 (74)

20 (26)
9 (26)
29 (26)

0.927

19 (83)
12 (75)
31 (79)

4 (17)
4 (25)
8 (21)

0.563

All patients
Homozygous TT, n 101
C-allele carrier, n 50
Men
Homozygous TT, n 78
C-allele carrier, n 34
Total, n 112
Women
Homozygous TT, n 23
C-allele carrier, n 16
Total, n 39

p Value*

Definition of abbreviations: LBS lipopolysaccharide binding protein; SNP single nucleotide polymorphism.
* p values are for Fishers exact test.

region. The synonymous substitution at 291 would not directly alter

the protein structure, whereas the previously reported SNP at 292
would precipitate the replacement of cystine with glycine. This
amino acid substitution would have the potential to disrupt disulfide
bonds and lead to altered function of the LBP protein (5).
The association between this SNP and severe sepsis that was
previously reported was observed only in a subgroup analysis of
patients with sepsis (males but not females), was not strong, and
was only one positive association of five polymorphisms that were
tested (5). These previously reported findings of an association
between the erroneously located nonsynonymous SNP may represent a false-positive association but may also represent a true
association in which this polymorphism is part of an extended
haplotype of genetically linked SNPs and may thus be a marker
for other functional variations (17, 18). In the previously reported
cohorts of patients with sepsis and healthy control subjects, this
polymorphism was linked to another SNP in the LBP gene. Therefore, the possibility remains that the 291 SNP is a marker for, but
not a functional contributor to, adverse outcomes. Thus, additional
investigation into identifying other SNPs in this region and defining haplotypes may prove important. However, coupled with our
determination that this coding region SNP is synonymous, a marginal association should not be considered definitive and excludes
any functional importance of this particular variant. Our study
had fewer subjects than the report referred to previously here but
included a similar number of men. As they observed the association between LBP polymorphism and sepsis in only males, it is

TABLE 4. RESULTS OF MULTIVARIATE ANALYSIS OF RISK

FOR SEVERE SEPSIS AFTER TRAUMA
Risk Factor
LBP 291 C-allele carrier
TNF- 308 C-allele carrier
Arterial base deficit of more
than 6 meq/L at 624
hours after injury
Age of more than 55 years
Sex, male

p Value

Odds Ratio

95% Confidence Interval

0.755
0.000

1.2
5.8

0.532.9
2.215.0

0.003
0.075
0.094

3.8
2.6
2.6

1.69.4
0.917.6
0.857.9

Definition of abbreviations: LBP lipopolysaccharide binding protein; TNF-

tumor necrosis factor-.
Forward stepwise logistic regression was performed and the results are summarized in the table. In addition to the variables indicated in the table above, ethnicity
was included in the analysis. There was no association between ethnicity and
outcome.

unlikely that our observation of no association is due a function

of inadequate sample size.
Of interest is our observation of a marked ethnic variation in
allele frequencies. In both trauma victims and uninjured control
subjects, the C-allele was significantly more common in the African
American subjects. Whether this simply reflects the occurrence of
a random mutation or whether this SNP is part of a biologically
important haplotype that influences survival remains to be determined. It is thus important to identify and begin to explore ethnic
differences such as observed here, rather than to avoid them
through restricting studies such as this to individual ethnic groups
(19, 20).
These observations raise a number of important issues surrounding the study of genetic associations with complex disease,
such as sepsis. First, our characterization of this subtle difference
in published gene sequence reflects the importance of careful attention to genotyping methods in such studies, which are increasingly
frequent in the medical literature. Inaccurate reporting of genotypes and associations can have a considerable negative impact,
in part by directing time and resources along incorrect lines of
investigation. Additionally, genotyping is likely to become increasingly important in clinical medicine, and maximizing the benefit
to individual patients will require careful attention to genotype
assignment (21). Although RFLP has often been replaced with
newer and more rapid genotyping methods, it is an inexpensive
and easily learned technique that remains in widespread use. Furthermore, errors are not specific to this technique. Numerous sequencing errors have been intermittently identified in the public
sequence databases. For example, recent resequencing of the fibrinogen cluster gene on chromosome 4 has identified nine likely
sequencing errors (22). It appears that a possible sequencing error
may have in part contributed to the erroneous characterization of
the LBP nucleotide. The second issue relates to the threshold
significance level for genotypephenotype associations. There is no
consensus on how to deal with this issue, with a number of options
that at least provide a framework in which to consider the issue
(23, 24).
In summary, the HpaII RFLP site in the LPB gene, which was
previously reported to be due to a T G SNP at nucleotide 292,
occurred because of a T C SNP at the adjacent 291 position.
This polymorphism does not precipitate an amino acid substitution
and was not associated with severe sepsis, septic shock, or death
in our cohort of trauma victims. SNPs in inflammation and immunerelated genes such as LBP must be examined in large cohorts,
using objectively defined end points. However, this SNP, which is

Downloaded from www.atsjournals.org by 39.209.14.160 on 06/06/13. For personal use only.

Am J Respir Crit Care Med 2003.167:1316-1320.

1320

AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE VOL 167 2003

functionally silent, should receive lower priority than coding region

variants that change the amino acid sequence or SNPs that may
alter the expression of the gene (3, 25).

13.

References
1. Heumann D, Roger T. Initial responses to endotoxins and Gram-negative
bacteria. Clin Chim Acta 2002;323:5972.
2. Schumann RR, Leong SR, Flaggs GW, Gray PW, Wright SD, Mathison
JC, Tobias PS, Ulevitch RJ. Structure and function of lipopolysaccharide binding protein. Science 1990;249:14291431.
3. Mira JP, Cariou A, Grall F, Delclaux C, Losser MR, Heshmati F, Cheval
C, Monchi M, Teboul JL, Riche F, et al. Association of TNF2, a TNFalpha promoter polymorphism, with septic shock susceptibility and
mortality: a multicenter study. JAMA 1999;282:561568.
4. Knight JC, Kwiatkowski D. Inherited variability of tumor necrosis factor
production and susceptibility to infectious disease. Proc Assoc Am
Physicians 1999;111:290298.
5. Hubacek JA, Stuber F, Frohlich D, Book M, Wetegrove S, Ritter M,
Rothe G, Schmitz G. Gene variants of the bactericidal/permeability
increasing protein and lipopolysaccharide binding protein in sepsis patients: gender-specific genetic predisposition to sepsis. Crit Care Med
2001;29:557561.
6. Clark JM. Novel non-templated nucleotide addition reactions catalyzed
by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res
1988;16:96779686.
7. Mead DA, Pey NK, Herrnstadt C, Marcil RA, Smith LM. A universal
method for the direct cloning of PCR amplified nucleic acid. Biotechnology 1991;9:657663.
8. Sambrook J, Gething MJ. Protein structure: chaperones, paperones. Nature 1989;342:224225.
9. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 1977;74:54635467.
10. Alderborn A, Kristofferson A, Hammerling U. Determination of singlenucleotide polymorphisms by real-time pyrophosphate DNA sequencing. Genome Res 2000;10:12491258.
11. Odeberg J, Holmberg K, Eriksson P, Uhlen M. Molecular haplotyping
by pyrosequencing. Biotechniques 2002;33:1104, 1106, 1108.
12. Hochberg EP, Miklos DB, Neuberg D, Eichner DA, McLaughlin SF,
Mattes-Ritz A, Alyea EP, Antin JH, Soiffer RJ, Ritz J. A novel rapid
single nucleotide polymorphism (SNP)-based method for assessment

14.

15.

16.

17.

18.

19.
20.

21.

22.

23.
24.

25.

of hematopoietic chimerism after allogeneic stem cell transplantation.

Blood 2003;101:363369.
OKeefe GE, Hybki DL, Munford RS. The GA single nucleotide polymorphism at the 308 position in the tumor necrosis factor-alpha
promoter increases the risk for severe sepsis after trauma. J Trauma
2002;52:817826.
Rangel-Frausto MS, Pittet D, Costigan M, Hwang T, Davis CS, Wenzel
RP. The natural history of the systemic inflammatory response syndrome (SIRS): a prospective study. JAMA 1995;273:117123.
Cumming J, Purdue GF, Hunt JL, OKeefe GE. Objective estimates of
the incidence and consequences of multiple organ dysfunction and
sepsis after burn trauma. J Trauma 2001;50:510515.
Waterer GW, Quasney MW, Cantor RM, Wunderink RG. Septic shock
and respiratory failure in community-acquired pneumonia have different TNF polymorphism associations. Am J Respir Crit Care Med 2001;
163:15991604.
Terry CF, Loukaci V, Green FR. Cooperative influence of genetic polymorphisms on interleukin 6 transcriptional regulation. J Biol Chem
2000;275:1813818144.
Stephens JC, Schneider JA, Tanguay DA, Choi J, Acharya T, Stanley
SE, Jiang R, Messer CJ, Chew A, Han JH, et al. Haplotype variation
and linkage disequilibrium in 313 human genes. Science 2001;293:489
493.
Aldhous P. Geneticist fears race-neutral studies will fail ethnic groups.
Nature 2002;418:355356.
Jones CP, LaVeist TA, Lillie-Blanton M. Race in the epidemiologic
literature: an examination of the American Journal of Epidemiology,
19211990. Am J Epidemiol 1991;134:10791084.
Amano K, Nomura Y, Segawa M, Yamakawa K. R133C and R168X
mutations in Japanese Rett syndrome patients: a caution for misdiagnosis. Brain Dev 2001;23:S152S156.
Fellowes AP, Brennan SO, George PM. Identification and characterization of five new fibrinogen gene polymorphisms. Ann N Y Acad Sci
2001;936:536541.
Lander ES, Schork NJ. Genetic dissection of complex traits. Science
1994;265:20372048.
Ioannidis JP, Ntzani EE, Trikalinos TA, Contopoulos-Ioannidis DG.
Replication validity of genetic association studies. Nat Genet 2001;
29:306309.
Knight JC, Udalova I, Hill AV, Greenwood BM, Peshu N, Marsh K,
Kwiatkowski D. A polymorphism that affects OCT-1 binding to the
TNF promoter region is associated with severe malaria. Nat Genet
1999;22:145150.

Downloaded from www.atsjournals.org by 39.209.14.160 on 06/06/13. For personal use only.