Journal of Applied Microbiology ISSN 1364-5072

ORIGINAL ARTICLE

Archaeal diversity in naturally occurring and impacted

environments from a tropical region
M.M. Clementino1, C.C. Fernandes1, R.P. Vieira2, A.M. Cardoso3, C.R. Polycarpo3 and O.B. Martins3
1 National Institute of Quality Control in Health, Department of Microbiology, FIOCRUZ, Rio de Janeiro, Brazil
2 Institute of Biology, Federal University of Rio de Janeiro, Rio de Janeiro, Brazil
3 Institute of Medical Biochemistry, Federal University of Rio de Janeiro, Rio de Janeiro, Brazil

Keywords
archaeal diversity, phylogenetic analysis,
tropical environments.
Correspondence
Maysa M. Clementino, Instituto Nacional de
Controle da Qualidade em Saude,
Departamento de Microbiologia, FIOCRUZ,
Avenida Brasil, 4365 Manguinhos,
CEP 21045-900, Rio de Janeiro RJ, Brazil.
E-mail: maysa@incqs.fiocruz.br

2006/1062: received 23 July 2006, revised 27

September 2006 and accepted 28 September
2006
doi:10.1111/j.1365-2672.2006.03230.x

Abstract
Aims: To evaluate archaeal diversity in natural and impacted habitats from Rio
de Janeiro state, Brazil, a tropical region of South America.
Methods and Results: 16S rRNA gene was amplified directly by polymerase
chain reaction (PCR) from genomic DNA, extracted from Guanabara Bay (GB)
water, halomarine sediment (HS), municipal landfill leachate, agricultural soil
and wastewater treatment (WT) system. Five archaeal 16S rDNA clone libraries
were constructed. A total of 123 clones, within the five libraries analysed, were
clustered into 29 operational taxonomic units, related to cultivated (24%) and
uncultivated (76%) organisms. Rarefaction analysis showed that the libraries
contained different levels of diversity. PCR-denaturing gradient gel electrophoresis (DGGE) of 16S23S intergenic spacer regions confirmed the presence
of a dominant phylotype, revealed by the WT system clone library.
Conclusions: Archaeal communities of impacted environments seem to be confined to specific ecosystems with similar physicochemical properties, while
communities from natural environments appear to be widely distributed. The
presence of a high number of phylotypes related to uncultivated organisms
suggests new archaeal lineages.
Significance and Impact of the Study: This study reports, for the first time, the
analysis of archaeal diversity in tropical environments from Brazil, and adds
sequences from this region to the developing database of 16S rRNA clone libraries from environmental samples.

Introduction
Microbial biodiversity has driven the evolution of life on
earth and the biogeochemical cycles, which are key to the
operation of the biosphere (Martiny et al. 2006).
During the last decade, studies investigating microbial
communities of tropical environments have shown that
they contain remarkable bacterial diversity (Moreira et al.
1998; Piza et al. 2004; Bossio et al. 2005; Lovelock and
Ewel 2005). Concerning archaeal diversity, a great number of phylotypes have been identified from a variety of
microbial habitats, including open ocean waters (Fuhrman et al. 1992; McInerney et al. 1997); coastal waters

(DeLong 1992; Preston et al. 1996; Massana et al. 1997);

sediments from continental shelf (Vetriani et al. 1998);
agricultural and forest soils, including the rhizosphere
(Bintrim et al. 1997; Borneman and Triplett 1997); alkaline and hypersaline lakes (Jones et al. 1998; Grant et al.
1999); and deep-sea hydrothermal vents (Takai and Horikoshi 1999).
Although there are some reports describing archaeal
diversity of tropical climatic zones (Leadbetter and Breznak 1996; Donovan et al. 2004; Winter et al. 2004), our
understanding about these communities and ecosystem
function is still poor. Archaeal organisms comprise a significant fraction of the total microbiota, typically 10% of

2006 The Authors

Journal compilation 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007) 141151

141

Archaeal diversity in environments from a tropical region

total rRNA phylotypes analysed, indicating that they may

have a large impact on global energy cycles (Robertson
et al. 2005).
The use of 16S rDNA clone libraries to map the
diversity of uncultivated prokaryotes from natural planktonic populations has provided a revolutionary advance
for interpreting microbial evolutionary relationships (for
a review, see DeLong 2005). One of the most significant
findings from the application of these methodologies
was the discovery of high numbers of novel and unexpected non-extreme archaeal phenotypes (DeLong
1998). These molecular surveys have produced almost
12 000 archaeal 16S rRNA gene sequences from environmental studies that have been deposited in the NCBI
(National Center of Biotechnology Information) database
to the present moment, extending the known groups
and increasing the number of novel lineages. Many of
those seem to be confined to specific geographical locations or to ecosystems that have similar geochemistry,
while others appear to be widely distributed (Schleper
et al. 2005). Even though Brazil is well known for its
diversity of flora and fauna, relatively few studies have
been published focusing on archaeal diversity. Borneman
and Triplett (1997) reported only two archaeal sequences
in Amazon basin among the 100 sequences of genes
coding for small-subunit rRNA obtained by polymerase
chain reaction (PCR) amplification with universal small
subunit rRNA primers. Therefore, the archaeal diversity
of this tropical region is an object of great interest for
microbiological studies. The overall aim of the research
described here was to obtain basic knowledge about the
archaeal diversity in Rio de Janeiro, Brazil, a coastal city,
near the Tropic of Capricorn (2254S4312W). For
our study, we selected natural environments, which
comprise the following three sites: seawater from coastal
Atlantic Ocean, agricultural soil (AS) and halomarine
sediment (HS). Because of the broad distribution and
abundance of archaea in these sites, they have been
extensively studied in other regions (Schleper et al.
2005). Impacted environments and samples from municipal leachate and wastewater treatment (WT) system
were analysed. Over the last few years, several studies
using 16S sequence analysis of microbial communities
have provided detailed insights into those environments
in other regions of the world (Godon et al. 1997; Sekiguchi et al. 1998; Wu et al. 2001; Huang et al. 2002).
We believe this work can be used as a starting point
for further investigations leading to a better understanding of the archaeal communities in natural and impacted
environments from tropical regions. In addition, our data
adds archaeal phylotypes from tropical environments to
the developing database of 16S rRNA from environmental
samples.
142

M.M. Clementino et al.

Materials and methods

Sampling, DNA extraction and purification
All reference strains used in this study, summarized in
Table 1, were obtained from Deutscheon Sammlung von
Mikroorganismen und Zellkulturen GmbH (DSMZ) and
American Type Culture Collection (ATCC). They were
grown using the conditions and media recommended by
the manufacturer. Environmental samples of HS, Atlantic coastal seawater, Guanabara Bay (GB), activated
sludge, anaerobic biodigested sludges I and II, a municipal leachate, and soil CS6, CS13 and IV, were collected
in relatively close vicinity, located around the GB
(2247S4308W), an eutrophic estuarine system
located in a humid tropical region surrounded by the
second largest metropolitan area of Brazil. Samples were
gathered between January and July 2005 (Table 2). Sediment sample (2 g) was taken in sterile Nalgene highdensity polyethylene bottles at an average depth of 10
20 cm, washed twice with 1 ml of sodium phosphate
buffer (PBS) (012 mol l)1, pH 80) and stored at
)70C, till processed in the laboratory. Atlantic coastal
seawater and GB samples (2 l), obtained from superficial
water (1-m deep), were taken in sterile bottles and filtered through 022-lm Sterivex filter columns (Millipore). Subsequently, the filters were washed twice with
1 ml of PBS and stored at )70C. Activated sludge,
anaerobic biodigested sludge, leachate samples (10 ml)
and soil samples (2 g) were taken in sterile bottles, thoroughly homogenized in a Bead-Beater (Mini-Bead-Beater; Biospec Products, Bartlesville, Okla, USA) for 1 min
and harvested by centrifugation at 7000 g, 10 min at
room temperature. The pellet was washed and stored as

Table 1 Reference strains examined for primer set specificity

Species

Source

Halobacterium salinarum
Haloarcula marismortui
Haloferax volcanii
Pyrococcus furiosus
Pyrococcus horikoshii
Pyrococcus woesei
Methanobacterium arboriphilicus
Methanothermobacter termoautotrophicus
Methanocaldococcus jannaschii
Salmonella choleraesuis
Ensifer meliloti
Neisseria meningitidis
Candida albicans
Saccharomyces cerevisiae
Cryptococcus neoformans

DSMZ 3754
DSMZ 3752
DSMZ 3757
ATCC 43587
DSMZ 12428
DSMZ 3773
DSMZ 744
DSMZ 1053
DSMZ 2661
ATCC 10708
ATCC 9930
ATCC 13077
ATCC 10231
ATCC 9763
ATCC 32045

2006 The Authors

Journal compilation 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007) 141151

M.M. Clementino et al.

Archaeal diversity in environments from a tropical region

Table 2 Characteristics of environmental samples

Sample

Source

Sampling site

pH

Temp (C)

Halomarine sediment
Seawater
Guanabara Bay
Activated sludge
Anaerobic biodigest
Anaerobic biodigest
Leachate
Soil CS6
Soil CS13
Soil IV

Saline brine
Coastal Atlantic ocean
Urca beach
Penhas wastewater treatment
Penhas wastewater treatment
Alegrias wastewater treatment
Municipal landfill leachate
Herbage soil CS6
Agricultural soil CS13
Agricultural soil IV

2257S/4248W
2305S/4303W
2256S/4310W
2250S/4315W
2250S/4315W
2250S/4312W
2239S/4318W
2238S/4300W
2238S/4304W
2238S/4304W

65
70
68
85
85
80
75
62
65
68

260
225
235
230
240
220
250
265
275
280

described earlier. The procedure used for DNA extraction was a modified version of previously described protocols (Ogram et al. 1987; Smalla et al. 1993). Briefly,
pelleted cultures of reference strains and environmental
samples were submitted to three cycles of freezing and
thawing ()70C/2 min, 65C/2 min), an equal volume
of glass beads (01-mm diameter) was added, and the
suspension was shaken three times for 80 s at maximum
speed in a Bead-Beater. The liquid phase was extracted
with phenolchloroform [1 : 1 (v/v)] and chloroform
isoamyl alcohol [24 : 1 (v/v)]. The DNA was precipitated from the aqueous phase with three volumes of ethanol, and after being dried, was resuspended in 100 ll
of deionized water. For further purification of the DNA,
we used the Qiagen Kit Dneasy Tissue Kit (Qiagen
GmgH, Hildeitialln, Germany) according to the manufacturers instructions. The amount of DNA extracted
was estimated by electrophoresis on a 08% agarose gel
and comparison with a High-DNA Mass Ladder (Invitrogen Co. Carlsbad, CA, USA) after ethidium bromide
staining (Sandaa et al. 2001). The genomic DNA of fun-

gal strains were kindly provided by M. Nishikawa from

Mycology laboratory, INCQS, FIOCRUZ.
16S rDNA clone libraries and sequencing
The amplification of partial 16S rRNA genes was carried
out with primers 16SAf and 1400Ar (Table 3), resulting
in PCR fragments of 900 bp. Selected fragments with the
expected molecular weight were excised from the gel and
eluted with a Qiaex II gel extraction kit (Qiagen, Hilden,
Germany). These purified products were ligated into the
pGEM-T plasmid (Promega, Madison, WI, USA). The
ligation products were transformed into Escherichia coli
DH10B competent cells with ampicillin selection and
blue/white screening (Sambrook et al. 1989). Partial DNA
sequencing of at least 700 bp was performed for each
clone using primer 16SAf. The nucleotide sequence of the
inserts was determined by cycle sequencing with the Big
Dye reagent (Applied Biosystems, Foster City CA, USA)
and run in an Applied Biosystems ABI Prism 3730 automated DNA sequencer.

Table 3 Polymerase chain reaction primers used in this study

Primer*

Sequence (5 to 3)

Target

Position

References

16SAf
23SAr
1400Ar
1406Af
27Bf
1492ABr
U1
U2

TTATTGGGCCTAAAGCRTC
GCTTATCGCAGCTTGSGACG
CGGCGAATTCGTGCAAGGAGCAGGGAC
GC-clamp -TGCACACACCGCCCGT
AGAGTTTGATCATGGCTCAG
GGTTACCTTGTTACGACTT
GTGAAATTGTTGAAAGGGAA
GACTCCTTGGTCCGTGTT

SSU rRNA archaea

LSU rRNA archaea
SSU rRNA archaea
SSU rRNA archaea
SSU rRNA bacteria
SSUrRNA archaea/bacteria
LSU rRNA eucarya
LSU rRNA eucarya

499 to 517
52 to 71
1327 to 1343
1391 to 1406
8 to 27
1492 to 1512
403 to 422
645 to 662

This article
This article
(Kudo et al. 1997)
(DiRuggiero et al. 1995)
(Lane 1991)
(Lane 1991)
(Sandhu et al. 1995)
(Sandhu et al. 1995)

*r (reverse) and f (forward) designations refer to primer orientation in relation to the rDNA.
Based on Escherichia coli numbering.
Positions in Halobacterium salinarum 16S and 23S rRNA aligment.
GC-clamp CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCC (Muyzer et al. 1993).
Positions in Saccharomyces cerevisiae (U26912) alignment.
2006 The Authors
Journal compilation 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007) 141151

143

Archaeal diversity in environments from a tropical region

Phylogenetic analysis and tree construction

The base identification and quality score of each position
in a sequence was made by the Phred software (Ewing
et al. 1998). Sequences were also checked for chimeric
amplicons by using CHIMERA_CHECK of the Ribosomal
Database Project (RDPII) (Cole et al. 2003). Nucleotide
similarity sequence searches were carried out online with
BLAST (Altschul et al. 1997). In addition, the sequences
were analysed via RDPII, using sequence match to identify most closely related database sequences. Multiple
alignments of nucleotides were performed using ClustalX.
The clones were clustered into operational taxonomic
units (OTU) at an overlap per cent identity cutoff of 97
using CAP3 program (Huang and Madan 1999). Evolutionary distances were calculated by the Kimura-2-parameter (Kimura 1980) algorithm, and the phylogenetic
trees were determined by the neighbour-joining method
(Saitou and Nei 1987), using MEGA2 program, version
21 (Kumar et al. 2001). Bootstrap analyses with 1000
replications of all phylogenetic trees were used to determine the confidence of a monophyletic association of the
sequences within a lineage. The diversity of the phylotypes was further examined using rarefaction analysis
(Hurlbert 1971; Simberloff 1978). Rarefaction calculations
were performed using the program aRarefactWin, version
12 (http://www.uga.edu/Strata/AnRareReadme.html).
Primer development
16S23S intergenic sequence region (ITS) region
Primer design was performed based on multiple alignments
of archaeal 16S and 23S rDNA sequences available in the
public database. The sequences were downloaded from
GenBank and aligned using ClustalX (Thompson et al.
1997). Consensus regions were used for primer design with
amplicon sizes ranging from 1200 to 2000 bp (Fig. 3a,d).
Specificity and PCR conditions
The specificity and coverage of the primer pairs across
sequences in RDP database release 81 was checked using
OligoCheck program (Cole et al. 2003). The parameters
defining a primer match allowed 63 primertarget mismatches, except for the last three bases of the 3 end.
Sequences for phylogenetic distinct groups, including Methanomicrobiales (n 33), Methanosarcinales (n 34) and
crenarchaeotal (n 33) had that parameter extended for
64 primer template mismatches. Archaeal, eubacterial,
fungal and environmental DNA were amplified using specific primers (Table 3). PCR errors were minimized using
Platinum Taq DNA Polymerase High Fidelity (Invitrogen
Co., Carlsbad, CA, USA) with proofreading 3 5 exonuclease activity. Amplifications were done in 50-ll reac144

M.M. Clementino et al.

tion volumes containing 50100 ng of DNA, 50 pmol of

each primer, 200 lmol l)1 of each deoxynucleotide triphosphate, 20-mmol l)1 MgCl2, 5% acetamide (w/v), 5 ll
of 10 Taq buffer and 25 U of Platinum Taq DNA Polymerase High Fidelity. Amplifications were done on an MJ
PT-200 thermal cycler, and the program consisted of an
initial denaturation at 94C for 3 min, followed by denaturation at 94C for 1 min 30 s, annealing at 50C for
1 min 30 s, and extension at 72C for 1 min 30 s for 30
cycles, with an additional extension at 72C for 15 min.
The primers were obtained from Invitrogen (Carlsbad, CA,
USA). PCR products were loaded onto a 1% (v/v) agarose
gel, and were separated by electrophoresis at 70 V for 2 h
in 1 TAE (40-mmol l)1 Tris base, 20-mmol l)1 sodium
acetate, 1-mmol l)1 EDTA, pH 80) buffer with a 100-bp
DNA ladder as molecular weight standard (Invitrogen co.
Carlsbad, CA, USA). The gels were stained with ethidium
bromide, and the gel images were digitalized with the
Video Documentation System and analysed with ImageMaster software (Amersham Pharmacia Biotech).
Denaturing gradient gel electrophoresis
PCR products of ITS regions from environmental samples
were analysed by PCR-denaturing gradient gel electrophoresis (DGGE), as described previously (Muyzer et al.
1993). A GC-clamp (Table 1) was added to the 5 end of
1406fAc, and DGGE was performed with D-Code system
(Bio-Rad, Inc., Richmond, CA, USA). PCR samples were
applied directly onto 6% (w/v) polyacrylamide gels in 1%
TAE, with denaturant gradient from 20% to 60% (where
100% denaturant contains 7-mol l)1 urea and 40% formamide). Electrophoresis was performed at 200 V and
60C for 18 h. After electrophoresis, the gels were incubated for 15 min in SYBR green (FMC Bioproducts, Rockland, ME, USA) 1, and photographed with Video
Documentation System (Amersham Pharmacia Biotech,
Little Chalfont, UK). Representative bands were excised
from gel, reanalysed by PCR-DGGE to ensure that they
consisted of a single DNA sequence, and reamplified for
sequencing with 1406fAc.
Nucleotide sequence accession numbers
The sequences of the 16S rRNA genes reported in
this study were submitted to GenBank/NCBI database
under accession numbers DQ182465-DQ182481 (AS),
DQ186682-DQ186709 (GB water), DQ186710-DQ186730
(HS), DQ186731-DQ186754 [municipal landfill (ML)
leachate] and DQ186755-DQ186787 (WT system).
DQ186680 and DQ186681 are 16S23S intergenic region
sequences from anaerobic digestor and activated sludge,
respectively.

2006 The Authors

Journal compilation 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007) 141151

M.M. Clementino et al.

Results
16S rDNA clone libraries and sequencing
In order to evaluate the archaeal diversity, five clone libraries of archaeal 16S rDNA genes from HS, GB water,
WT system, ML leachate and AS were constructed using
primers 16SAf and 1400Ar, which amplified a 900-bp
fragment. A total of 192 clones were randomly picked
from the five libraries constructed. The sequences were
analysed online with Blastn for nucleotide similarity with
archaeal sequences and were checked for PCR artifacts.
The generated alignments were inspected by eye and
manually edited. Eleven putative chimeras and all ambiguous sites of the alignments and cloning vector
sequences were removed from further analysis. The final
123 sequences, containing at least 700 bp constituted by
nucleotides with Phred scores 20, were used for database
query. All sequences analysed were exclusively related to
archaeal sequences, and the presence of any bacterial
sequences was not observed.
Phylogenetic analysis and tree construction
The phylogenetic position of archaeal rDNA sequences
and their relationship with other archaeal strains, including environmental sequences, was determined by the
construction of five distinct phylogenetic trees (Fig. 1).
Representative rDNA sequences from major archaeal
groups obtained at GenBank were incorporated into the
trees. The sequences analysed clustered into 29 OTU, on
the basis of having 97% sequence identity, which were
distributed across the five libraries analysed. GB and ML
clone libraries revealed a similar proportion of clones distributed within the Euryarchaeota and Crenarchaeota
phyla (Fig. 1b,d). On the other hand, most OTU from
the HS belong to the Euryarchaeota phylum related to
Halobacteriales order (Fig. 1e), while the majority of the
OTU from the AS library branch within the Crenarchaeota (Fig. 1c). The WT clone library had extremely
low phylotype richness. Only two OTU, belonging to the
Euryarchaeota phylum, were observed. The dominant
OTU, comprising 32 of the 33 clones was thus affiliated
with sequences belonging to the Methanomicrobiales
order, recovered from anaerobic granular sludge systems,
and the second OTU, comprising 1 of the 33 clones, was
related to Methanosaeta spp. (Fig. 1a). The phylogenetic
analysis of 16S rDNA clones from the ML clone library
revealed a significant degree of archaeal diversity
(Fig. 1b). The leachate OTU 4 was closely related to
the cultivated organism Methanobacterium formicicum
(AY196659). OTU 1 was related to clones retrieved from
anaerobic granular sludge clones NOBI (AB162774) and

Archaeal diversity in environments from a tropical region

TAO3 (AF229776). OTU 3 with one clone and OTU 6,

comprising eleven clones, clustered within Euryarchaeota
and Crenarchaeota phyla respectively. Interestingly, they
were phylogenetically similar to the uncultured archaeon
clones GZK72 and GZK15, isolated from the leachate of a
closed municipal solid waste landfill (Huang et al. 2003).
A total of 32 clones were sequenced from the AS library
that resulted in 17 clones clustering into seven OTU. Soil
OTU 1 and 4 were affiliated with expected environments
like mesophilic soil ecosystems (Bintrim et al. 1997; Sliwinski and Goodman 2004), meanwhile soil OTU 5 is
distantly related to those sequences. Interestingly, soil
OTU 3 and 6 showed relationships with the uncultured
clone Amsterdam-1A-02 (AY592231) isolated from deepsea mud volcano sediment and clone LC1231a82
(AY505052) from the subseafloor, of the phylum Crenarchaeota (Fig. 1c). OTU 7, representing three sequences,
was closely related to uncultured clones isolated from the
continental shelf sediments (Bowman and McCuaig 2003)
and deep oceanic regions (Lopez-Garcia et al. 2001),
while soil OTU 2 formed a clade that was consistently
placed (98% bootstrap support) within uncultured archaeal sequences from anaerobic granular sludge related with
Euryarchaeota (Wu et al. 2001). The archaeal clone library
of GB, represented by five OTU (28 clones), distributed
within the Euryarchaeota and Crenarchaeota phyla, was
not closely related to any cultivated organism, and all
of them showed sequences identified with uncultured
archaeon clones recovered from marine environments
(Fig. 1d). The 22 sequences from HS clone library were
not confined to a specific lineage within the tree, but
rather were dispersed into nine OTU (Fig. 1e). Seventeen
clones representing 81% of this library, distributed in
eight marine OTU, belonged to the phylum Euryarchaeota. Halomarine OTU 6, 1 and 2 were closely related with Haloarcula hispanica (AB09016), Haloarcula
marismourtii (X61688) and Halobacterium saccharovorum
(U17364), respectively. OTU 9 and 8 showed relationships with uncultured organisms retrieved from saline
brine sediments (Eder et al. 1999) and continental shelf
sediments (Bowman and McCuaig 2003) and yet uncharacterized isolates. Within the Crenarchaeota, OTU 7, comprising four clones, was closely related with uncultured
clones from deep-sea hydrothermal vent environments
(Takai and Horikoshi 1999) and from marine archaeal
group I (Eder et al. 2002).
Rarefaction analyses
Rarefaction curves were obtained by plotting the number
of OTU, clustered at 97% similarity, against the number
of sequenced clones (Fig. 2). The decline in the rate of
OTU detection, shown by the curves, indicated that most

2006 The Authors

Journal compilation 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007) 141151

145

Archaeal diversity in environments from a tropical region

(a)

Wastewater treatment

M.M. Clementino et al.

Anaerobic digested sludge (AB162774)

Anaerobic granular sludge (AF229776)
WT_OTU 1 (32 clones) (DQ186767)

81

83
64

Toluene-degrading methanogenic (AF423187)

Methanoculleus sp. (AJ133793)
Methanospirillum hungatei (M60880)
Methanosarcina barkeri (AY196682)

100
74

Euryarchaeota

WT_OTU 2 (1 clone) (DQ186773)

Uncultured Methanosaeta sp. (AY454757)
100 Wastewater sludge (AF424772)

91

002

(b)

Landfill leachate
Anaerobic digested sludge (AB162774)
Anaerobic granular sludge (AF229776)

96
99

ML_OTU 1 (9 clones) (DQ186752)

89

Methanoculleus bourgensis (AY196674)

Methanoculleus palmaeoli (Y16382)

100
99

95

ML_OTU 2 (1 clone) (DQ186743)

ML_OTU 3 (1 clone) (DQ186732)
Landfill
leachate
(AJ576239)
100
Methanobrevibacter sp. . (AJ009959)
ML_OTU 4 (1 clone) (DQ186737)
Methanobacterium formicicum (AY196659)
ML_OTU 5 (1 clone) (DQ186739)
Wastewater sludge (AF424768)
100
ML_OTU 6 (11 clones) (DQ186736)
100
Solid
waste landfill (AJ576215)
99

100
100

Euryarchaeota

Crenarchaeota

005

(c)

Agricultural soil

Mesophilic soil ecosystems (AY522869)

AS_OTU 1 (5 clones) (DQ182480)
Archaea
from soil (U62816)
81
AS_OTU 4 (1 clone) (DQ182477)
100
Mesophilic soil ecosystems (AY522872)
61
AS_OTU 5 (1 clone) (DQ182479)
Acid mine drainage system (AY082452)
98
Deep-sea mud volcanoes (AY592231)
AS_OTU 3 (2 clones) (DQ182481)
98
Subseafloor (AY505052)
100
60
AS_OTU 6(2 clones)(DQ182467)
Anaerobic granular sludge system (AF229776)
AS_OTU 2 (3 clones) (DQ182471)
Methanomicrobiales archaeon (AY454748)
Methanoculleus bourgensis (AY196674)
Shelf Sediment (AF424533)
90
AS_OTU 7 (3 clones)(DQ182469)
Deep
oceanic regions (AF257277)
100
99

98

100

98
100
94

Crenarchaeota

Euryarchaeota

005

(d)

Guanabara Bay
GB_OTU 5 (1 clone) (DQ186682)
Deep oceanic water (AF257277)

99
99

GB_OTU 4 (2 clones) (DQ186685)

Continental shelf sediment (AF424533)

73

GB_OTU 3 (9 clones) (DQ186691)

Marine planktonic archaea (U78206)

91

100

GB_OTU 1 (4 clones) (DQ186684)

Continental shelf sediment (AF424516)
Methanotrophic communities (AF419636)

100
82
51
72

005

(e) Halomarine sediment

Euryarchaeota

100
100

Crenarchaeota

GB_OTU 2 (12 clones) (DQ186706)

Cariaco continental shelf sediment (AF224859)
Brine sea water (AJ347776)

Halorubrum coriense (S70839)

Halophilic archaeon (AJ400624)

HS_OTU 2 (3 clones) (DQ186714)

99
100

Halobacterium saccharovorum (U17364)

HS_OTU 3 (1 clone) (DQ186730)

52
93
99

100

Natrinema ajinwuensis (AY570917)

Halobacteriaceae sp. (AF478471)

HS_OTU 4 (2 clones) (DQ186726)

HS_OTU 5 (1 clone) (DQ186724)
100

91

Euryarchaeota

Haloarcula mukohataei (D50850)

96

Haloarcula marismourti (X61688)

HS_OTU 1 (2 clones) (DQ186711)

Haloarcula hispanica (AB090167)

67

HS_OTU 6 (1 clone) (DQ186715)

100
99

Saline brine sediments (AJ133625)

HS_OTU 9 (1 clone) (DQ186725)

Deep oceanic regions (AF257277)

100

HS_OTU 8 (6 clones) (DQ186716)

100
99
55
100
60
84

Cont. shelf sediment (AF424533)

Deep-sea archaeon (AY592231)
Deep-sea hydrothermal vent (AB019723)

HS_OTU 7 (4 clones) (DQ186728)

Marine archaeal group I (AJ347774)
Hydrothermal sediments (AF419636)

Crenarchaeota

005

146

2006 The Authors

Journal compilation 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007) 141151

M.M. Clementino et al.

Archaeal diversity in environments from a tropical region

10

Halomarine sediment
8
OTUs

Agricultural soil
6

Landfill leachate
Guanabara Bay

4
2
0
0

when tested with their specific primers (Fig. 3b,c). The

new primer set was highly suitable to retrieve archaeal
16S23S intergenic spacer region using DNA from different environmental samples yielding unique PCR products
varying in size (Fig. 3d). This is most attributed probably
to the differences in the length of ITS from different
organisms.

Wastewater treatment

DGGE analysis of the 16S23S intergenic region

10

20
30
16S rDNA clones

40

Figure 2 Rarefaction curves representing expected diversity of 16S

rDNA clones for each clone library. (d) Wastewater treatment system;
(r) municipal landfill leachate; ( ) agricultural soil; ( ) Guanabara
Bay water; (.) halomarine sediment.

diversities in the WT system and GB libraries have been

detected. On the other hand, diversity curves for the 16S
rDNA clone libraries generated from HS, AS and landfill
leachate libraries show that more clones have to be sequenced and analysed in order to achieve saturation. This
result agrees with phylogenetic analysis, which showed
that the Archaea population has the lowest diversity in
the WT and the highest in the HS library.
Exploring archaeal diversity within the OTU
In order to inquire further into the OTU composition,
we decided to analyse 16S23S intergenic regions, as these
spacers can be a powerful tool to discern the relationship
among micro-organisms at species or even strain levels
(Clementino et al. 2001; Blank et al. 2002). For this purpose, we designed a primer targeting the 23S rRNA,
which was used together with the 16SAf for PCR
(Table 3). The 16SAf and 23SAr primers were validated
against 15 DNA, isolated from reference strains, representatives of Archaea, Bacteria and Eucarya domains. Archaeal fragments from three Halobacteria, three Pyrococcus,
one Methanococcus and two Methanobacteriales yielded
single PCR products varying in size from 1450 to 2000 bp
(Fig. 3a). Eubacterial DNA of Salmonella choleraesuis,
Ensifer meliloti and Neisseria meningitidis, represented
alpha-, beta- and gammaproteobacteria, respectively.
Three fungal DNA (Table 1), under the conditions outlined for the PCR, did not generate products. Eubacterial
and fungal DNA yielded fragments with expected size

In order to better characterize differences at a microdiversity scale and to allow the fine discrimination within
OTU, we amplified 16S23S intergenic region fragments,
generated by nested PCR, using 16SAf and 23SAr primers
in the first stage and 1406Af CG-clamp and 23SAr primers in the second stage, generating a fragment of 430 bp
(Table 3). Occasionally, the restricted diversity at the 16S
rRNA gene level may not reflect differences occurring at
species or strain level. In this study, the intergenic regions
of four environmental samples were analysed by the
application of PCR-DGGE analyses. Activated sludge and
anaerobic digestor samples from the same WT system
revealed a dominant band along with a faint one; GB presented a major band and at least six weak bands; and the
soil sample showed eight weak bands (Fig. 4). Activated
sludge and anaerobic digestor samples were chosen to initiate our microdiversity investigation owing to the presence of a considerable number of identical clone
sequences grouped in a unique OTU. To determine the
identity of the organisms represented in the DGGE profiles, the dominant bands, from these two samples of the
wastewater system, were excised from the gels, reamplified
and sequenced. Surprisingly, the sequences presented
100% identity between both the samples analysed. It is
significant to remember that members of the phylum Crenarchaeota have intergenic regions lacking tRNA genes,
while members of Euryarchaeota carry tRNAAla gene, for
example (Boyer et al. 2001). The two sequences are most
closely related (98% identity) to methanogenic Archaea,
and the tRNAala gene region presented a good alignment
with sequences available in the database. Intergenic spacer
regions of WT system, presented a main archaeal
sequence, suggesting the presence of a predominant species or population in agreement with the 16S rRNA clone
library that resulted in a dominant OTU, comprising 32
of the 33 clones analysed.

Figure 1 Phylogenetic relationship of archaeal communities from five distinct environments. Archaeal 16S rDNA operational taxonomic units
(OTU) (shown in bold) isolated from wastewater treatment (a), landfill laechate (b), agricultural soil (c), Guanabara Bay (d) and halomarine sediment (e). The trees were constructed by the neighbour-joining method from a similarity matrix based on the Kimura-2-parameter algorithm. The
number of closely related clones found among the rDNA clones analysed and the accession numbers retrieved from database are indicated at the
end of the corresponding sequence typed in parentheses. Bootstrap values are reported as percentages of 1000 bootstrap replications. The scale
bar represents the substitutions per nucleotide position. The trees were arbitrarily rooted between Crenarchaeota and Euryarchaeota.
2006 The Authors
Journal compilation 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007) 141151

147

Archaeal diversity in environments from a tropical region

(a)
bp

M.M. Clementino et al.

Archaea
M

1
6

10

1500
600
100
(b)
bp

(c)

Bacteria

Eucarya

bp

M 1 2 3 4 5 6 7

1500

1500

600

600

100

100

(d)
bp

M 1 2 3 4 5 6 7

Environmental
M

10 11

Figure 4 Polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) analysis of 16S23S intergenic spacer region
fragments amplified using primers 1406Afc-23SAr (450 bp) with DNA
collected from: (1) Guanabara Bay water, (2) activated sludge, (3)
anaerobic biodigest from Penhas wastewater treatment and (4) agricultural soil.

1500
600
100

Figure 3 Polymerase chain reaction amplifications of reference strains

and environmental samples with Archaea-, Bacteria- and Eucarya-specific primers. Lane M, molecular size marker (100-bp DNA ladder). (a)
(primers16SAf/23Ar) lane 1, Halobacterium salinarum; lane 2, Haloarcula marismortui; lane 3, Haloferax volcanii; lane 4, Pyrococcus furiosus; lane 5, Pyrococcus horikoshii; lane 6, Pyrococcus woesei; lane 7,
Methanobacterium arboriphilicus; lane 8, Methanobacterium thermoautotrophicus; lane 9, Methanocaldococcus jannaschii; lane 10,
negative control with no added template DNA. (b) Lanes 13 (primers
16SAf/23SAr) and 46 (primers 27Bf/1492ABr): lanes 1 and 4 Salmonella choleraesuis; lanes 2 and 5, Ensifer meliloti; and lanes 3 and 6,
Neisseria meningitidis; lane 7, negative control with no added template DNA. (c) Lanes 13 (primers 16SAf/23SAr) and 45 (primers U1/
U2): lanes 1 and 4, Candida albicans; lanes 2 and 5, Saccharomyces
cerevisiae and lanes 3 and 6, Cryptococcus neoformans; lane 7, negative control with no added template DNA. (d) (primers 16SAf/23SAr)
lane 1, halomarine sediment; lane 2, seawater; lane 3, Guanabara
Bay; lane 4, activated sludge; lane 5, anaerobic digested; lane 6,
wastewater treatment; lane 7, landfill leachate; lane 8, herbage soil
CS6; lane 9, agricultural soil CS13; lane 10, agricultural soil IV; lane
11, negative control with no added template DNA.

Discussion
This study reports, for the first time, an analysis of archaeal biodiversity in tropical habitats of Rio de Janeiro,
148

Brazil. After grouping the clones into the OTU, a

phylogenetic analysis showed that the sequences obtained,
from the five different habitats, clustered with sequences
from cultivated and uncultivated organisms, retrieved
from the analysis of similar habitats (Fig. 1). The
sequences exhibited in WT and ML clone libraries
grouped largely with sequences from uncultivated organisms retrieved from anoxic environments. Although we
know little about the physiological characteristics of Archaea in the environment, some particularities of these
organisms can be inferred on the basis of their phylogenetic position and the properties of their relatives.
Thus, environmental rDNA sequences that fall into a
clade, populated by known menthanogens, are likely to
represent another methanogen in the environment
(Robertson et al. 2005). The presence of Methanomicrobiales-related sequences in WT clone library suggests a
predominantly H2/CO2 utilizing population (Banning
et al. 2005), while the occurrence of Methanosaeta spp.
has been observed in other environments with high
methane flux, and may be affiliated with anaerobic oxidation of methane (Orphan et al. 2002). Similar scales of
diversity have been previously obtained by other comparable studies of archaea communities in anaerobic digesters (Godon et al. 1997; Leclerc et al. 2001). Given the
limited number of substrates, low growth rate of archaeal
methanogens and that the members of the bacteria
domain are responsible for the majority of carbon
removal in aerated activated sludge process (Gray et al.
2002), this low diversity exhibited in archaeal populations

2006 The Authors

Journal compilation 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007) 141151

M.M. Clementino et al.

is expected. There is an increasing body of evidence

indicating that crenarchaeotal sequences detected in AS
library could be ammonia oxidizers. The identification
of two genes, in the large genome fragment of
crenarchaeota, encoding proteins related to the subunits
of ammonia mono-oxygenases (AmoAB), led to the speculation that nonthermophilic crenarchaeota use ammonia as their primary energy source (Schelper 2004). We
believe that the presence of several species of the Halobacteriales order in HS clone library is suggestive of the
biogeochemical characteristics of that suitable environment for the halophilic Archaea. On the other hand, the
clones representing GB library were identified with uncultured archaeon clones recovered from marine environments, providing more data to the argument that many
sequences occur worldwide, and indicating the possible
presence of new archaeal lineages. Our results are consistent with those from a large number of other studies
which indicate that environmental archaeal communities
reveal patterns of ecological differentiation with regard to
the eury- and crenarchaeal lineages present in particular
habitats (Lueders and Friedrich 2000; Teske et al. 2002;
Srensen et al. 2004). Furthermore, rarefaction analysis
indicates that the number of sequenced clones from each
library allowed us to obtain a suitable coverage of the five
environments studied, and to estimate archaeal diversity
present at these communities (Fig. 2). In contrast, bacterial libraries demand higher clone numbers to make a visible representation of the environmental biodiversity
(Engel et al. 2004). The new set of archaeal primers targeting 16S and 23S rRNA genes encompassing full-length
sequences of archaeal 16S23S ITS were successfully used
to retrieve archaeal sequences from several environmental
sites. At microdiversity scale, the wastewater diversity, as
measured by different techniques, appeared to be very
low; the clone library provided two phylotypes that could
be confirmed by the sequences of the ITS regions
obtained from DGGE bands. OTU 1 appeared to be the
most abundant group, suggesting that these organisms are
important components of the WT system in Rio de
Janeiro.
Moreover, new studies are needed to examine archaeal
diversity in other environments located in temperate and
tropical areas of Brazil. Hopefully, additional information
will increase our understanding of the effect of different
climates and environments on archaeal diversity and biogeography distribution.
Acknowledgements
We gratefully acknowledge Genome Sequencing CorePDTIS/FIOCRUZ and M.M. Nishikawa from the Mycology Laboratory for kindly providing the fungal DNA. We

Archaeal diversity in environments from a tropical region

would also like to thank Dr R.M. Albano from the

Department of Biochemistry/UERJ and Cristine Goldberg
for their critical reading of the manuscript. This work
was supported by INCQS/FIOCRUZ, FECD/FINEP/
CTPetro 21.01.0278.00, and FAPERJ (OBM).
References
Altschul, S.F., Maddyn, T.L., Schaffer, A.A., Zhang, J.,
Zhang, Z., Miller, W. and Lipman, D.J. (1997) Gapped
BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic Acids Res 25,
33893402.
Banning, N., Brock, F., Fry, J.C., Parkes, R.J., Hornibrook, E.R.
and Weightman, A.J. (2005) Investigation of the methanogen population structure and activity in a brackish lake
sediment. Environ Microbiol 7, 947960.
Bintrim, S.B., Donohue, T.J., Handelsman, J., Roberts, G.P.
and Goodman, R.M. (1997) Molecular phylogeny of Archaea from soil. Proc Nat Acad Sci USA 94, 277282.
Blank, C.E., Cady, S.L. and Pace, N.R. (2002) Microbial composition of near-boiling silica-depositing thermal springs
throughout Yellowstone National Park. Appl Environ
Microbiol 68, 123135.
Borneman, J. and Triplett, E.W. (1997) Molecular microbial
diversity in soils from Eastern Amazonia: evidence for
unusual microorganisms and microbial population shifts
associated with deforestation. Appl Environ Microbiol 63,
26472653.
Bossio, D.A., Girvan, M.S., Verchot, L., Bullimore, J., Borelli,
T., Albrecht, A., Scow, K.M., Ball, A.S. et al. (2005) Soil
microbial community response to land use change in an
agricultural landscape of western Kenya. Microb Ecol 49,
5062.
Bowman, J.P. and McCuaig, R.D. (2003) Biodiversity community structural shifts, and biogeography of prokaryotes
within Antarctic continental shelf sediment. Appl Environ
Microbiol 69, 24632483.
Boyer, S.L., Flechtner, V.R. and Johansen, J.R. (2001) Is 16S23S rRNA internal transcribed spacer region a good tool
for use in molecular systematics and population genetics?
A case study in cyanobacteria. Mol Biol Evol 18, 1057
1069.
Clementino, M.M., de Filippis, I., Nascimento, C.R., Branquinho, R., Rocha, C.L. and Martins, O.B. (2001) PCR
analyses of tRNA intergenic transcribed spacer, and randomly amplified polymorphic DNA reveal inter- and intraspecific relationships of Enterobacter cloacae strains. J Clin
Microbiol 39, 38653870.
Cole, J.R., Chai, B., Marsh, T.L., Farris, R.J., Wang, Q., Kulam,
S.A., Chandra, S., Mc Garrell, D.M. et al. (2003) The ribosomal database Project (RPD-II): previewing a new autoaligner that allows regular updates and the new
prokaryotic taxonomy. Nucleic Acids Res 31, 442443.

2006 The Authors

Journal compilation 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007) 141151

149

Archaeal diversity in environments from a tropical region

DeLong, E.F. (1992) Archaea in coastal marine environments.

Proc Natl Acad Sci USA 89, 56855689.
DeLong, E.F. (1998) Everything in moderation Archaea as
non-extremophiles. Curr Opin Genet Dev 8, 649654.
DeLong, E.F. (2005) Microbial community genomics in the
ocean. Nat Rev Microbiol 3, 459469.
DiRuggiero, J., Tuttle, J.H. and Robb, F.T. (1995) Rapid differentiation of hyperthermophilic Archaea by restriction
mapping of the intergenic spacer regions of the ribosomal
RNA operons. Mol Mar Biol Biotec 4, 123127.
Donovan, S.E., Purdy, K.J., Kane, M.D. and Eggleton, P.
(2004) Comparison of Euryarchaea strains in the guts and
food-soil of the soil-feeding termite Cubitermes fungifaber
across different soil types. Appl Environ Microbiol 70,
38843892.
Eder, W., Ludwig, W. and Huber, R. (1999) Novel 16S rRNA
gene sequences retrieved from highly saline brine sediments of Kebrit deep, red Sea. Arch Microbiol 172, 213
218.
Eder, W., Schimidt, M., Koch, M., Garbe-Schonberg, D. and
Huber, R. (2002) Prokaryotic phylogenetic diversity and
corresponding geochemical data of brine-seawater interface
of the Shaban Deep. Red Sea Environ Microbiol 4, 758763.
Engel, A.S., Porter, M.L., Stern, L.A., Quinlan, S. and Bennett,
P.C. (2004) Bacterial diversity and ecosystem function of
filamentous microbial mats from aphotic (cave) sulfidic
springs dominated by chemolithoautotrophic Epsilonproteobacteria. FEMS Microbiol Ecol 51, 3153.
Ewing, B., Hillier, L., Wendl, M.C. and Green, P. (1998) Basecalling of automated sequencer traces using phred. 1. Accuracy assessment. Genome Res 8, 175185.
Fuhrman, J.A., McCallum, K. and Davis, A.A. (1992) Novel
major archaebacterial group from marine plankton. Nature
356, 148149.
Godon, J.J., Zumstein, E., Dabert, P., Habouzit, F. and
Moletta, R. (1997) Molecular microbial diversity of an
anaerobic digestor as determined by small-subunit
rDNA sequence analysis. Appl Environ Microbiol 63,
28022813.
Grant, S., Grant, W.D., Jones, B.E., Kato, C. and Li, L. (1999)
Novel archaeal phylotypes from an East African alkaline
saltern. Extremophiles 3, 139145.
Gray, N.D., Miskin, I.P., Kornilova, O., Curtis, T.P. and Head,
I.M. (2002) Occurrence and activity of Archaea in aerated
activated sludge wastewater treatment plants. Environ
Microbiol 4, 158168.
Huang, X. and Madan, A. (1999) CAP3: A DNA sequence
assembly program. Genome Res 9, 868877.
Huang, L.N., Chen, Y.Q., Zhou, H., Luo, S., Lan, C.Y. and
Qu, L.H. (2003) Characterization of methanogenic Archaea
in the leachate of a closed municipal solid waste landfill.
FEMS Microbiol Ecol 46, 171177.
Huang, L.N., Zhou, H., Chen, Y.Q., Luo, S., Lan, C.Y. and
Qu, L.H. (2002) Diversity and structure of the archaeal
community in the leachate of a full-scale recirculating

150

M.M. Clementino et al.

landfill as examined by direct 16S rRNA gene sequence

retrieval. FEMS Microbiol Lett 214, 235240.
Hurlbert, S.H. (1971) The nonconcept of species diversity: a
critique and alternative parameters. Ecology 52, 577586.
Jones, B.E., Grant, W.D., Duckworth, A.W. and Owenson,
G.G. (1998) Microbial diversity of soda lakes. Extremophiles 2, 191200.
Kimura, M. (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies
of nucleotide sequences. J Mol Evol 16, 111120.
Kudo, Y., Nakajima, T., Miyaki, T. and Oyaizu, H. (1997)
Methanogen flora of paddy soils in Japan. FEMS Microbiol
Ecol 22, 3948.
Kumar, S., Tamura, K., Jakobsen, I.B. and Nei, M. (2001)
MEGA2: Molecular evolutionary genetics analysis software.
Bioinformatics 17, 12441245.
Lane, D.J. (1991) 16S/23S rRNA sequencing. In: Nucleic Acid
Techniques in Bacterial Systematics. ed. Stackebrandt,
E. and Goodfellow, M. pp. 115175. New York: Wiley.
Leadbetter, J.R. and Breznak, J.A. (1996) Physiological ecology
of Methanobrevibacter cuticularis sp. nov. and Methanobrevibacter curvatus sp. nov., isolated from the hindgut of
the termite Reticulitermes flavipes. Appl Environ Microbiol
62, 36203631.
Leclerc, M., Delbes, C., Moletta, R. and Godon, J.J. (2001) Single strand conformation polymorphism monitoring of 16S
rDNA Archaea during start-up of an anaerobic digester.
FEMS Microbiol Ecol 34, 213220.
Lopez-Garcia, P., Moreira, D., Lopez-Lopez, A. and RodriguezValera, F.A. (2001) Novel haloarchaeal-related lineage is
widely distributed in deep oceanic regions. Environ Microbiol 3, 7278.
Lovelock, C.E. and Ewel, J.J. (2005) Links between tree species, symbiotic fungal diversity and ecosystem functioning in simplified tropical ecosystems. New Phytol 167,
219228.
Lueders, T. and Friedrich, M. (2000) Archaeal population
dynamics during sequential reduction processes in rice
field soil. Appl Environ Microbiol 66, 27322742.
Martiny, J.B., Bohannan, B.J, Brown, J.H., Colwell, R.K.,
Fuhrman, J.A., Green, J.L., Horner-Devine, M.C., Kane, M.
et al. (2006) Microbial biogeography: putting microorganism on the map. Nat Rev Microbiol 4, 102112.
Massana, R., Murray, A.E., Preston, C.M. and DeLong, E.F.
(1997) Vertical distribution and phylogenetic characterization of marine planktonic Archaea in the Santa Barbara
channel. Appl Environ Microbiol 63, 5056.
McInerney, J.O., Mullarkey, M., Wernecke, M.E. and Powell,
R. (1997) Phylogenetic analysis of Group I marine archaeal
rRNA sequences emphasizes the hidden diversity within
the primary group Archaea. Proc R Soc Lond Ser B Biol Sci
264, 16631669.
Moreira, F.M., Haukka, K. and Young, J.P.W. (1998) Biodiversity of rhizobia isolated from a wide range of forest legumes in Brazil. Mol Ecol 7, 889895.

2006 The Authors

Journal compilation 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007) 141151

M.M. Clementino et al.

Muyzer, G., DeWaal, E.C. and Uitterlinden, A.G. (1993) Profiling of complex microbial-populations by denaturing chain
reaction-amplified genes-coding for 16S ribosomal-RNA.
App Environ Microbiol 59, 695700.
Ogram, A., Sayler, G.S. and Barkay, T. (1987) The extraction
and purification of microbial DNA from sediments.
J Microbiol Methods 7, 5766.
Orphan, V.J., House, C.H., Hinrichs, K-U., McKeegan, K.D.
and DeLong, E.F. (2002) Multiple archaeal groups mediate
methane oxidation in anoxic cold seep sediments. Proc
Natl Acad Sci USA 99, 76637668.
Piza, F.F., Prado, P.I. and Manfio, G.P. (2004) Investigation of
bacterial diversity in Brazilian tropical estuarine sediments
reveals high actinobacterial diversity. Antonie Van Leeuwenhoek 86, 317328.
Preston, C.M., Wu, K.Y., Molinski, T.F. and DeLong, E.F.
(1996) A psychrophilic crenarchaeon inhabits a marine
sponge: Crenarchaeum symbiosum gen. nov. sp. nov. Proc
Natl Acad Sci USA 93, 62416246.
Robertson, C.E., Harris, J.K., Spear, J.R. and Pace, N.R. (2005)
Phylogenetic diversity and ecology of environmental Archaea. Curr Opin Microbiol 8, 638642.
Saitou, N. and Nei, M. (1987) The neighbor-joining method: a
new method for reconstructing phylogenetic trees. Mol Biol
Evol 4, 406425.
Sambrook, J., Fritsh, E.F. and Maniats, T. (1989) A Laboratory
Manual, 2nd edn. vol. 2. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory Press.
Sandaa, R.A., Torsvik, V. and Enger, O. (2001) Influence of
long-term heavy-metal contamination on microbial communities in soil. Soil Biol Biochem 33, 287295.
Sandhu, G.S., Kline, B.C., Stockman, L. and Roberts, G.D.
(1995) Molecular probes for diagnosis of fungal infections.
J Clin Microbiol 33, 29132919.
Schleper, C. (2004) Population genomics of soil microbial communities. New Orleans, Lousiana: 104th general meeting of
the American Society for Microbiology.
Schleper, C., Jurgens, G. and Jonuscheit, M. (2005) Genomic
studies of uncultivated archaea. Nature 3, 479488.
Sekiguchi, Y., Kamagata, Y., Syutsubo, K., Ohashi, A., Harada,
H. and Nakamura, K. (1998) Phylogenetic diversity of mesophilic and thermophilic granular sludges determined by 16S
rRNA gene analysis. Microbiology 144, 26552665.

Archaeal diversity in environments from a tropical region

Simberloff, D. (1978) Use of rarefaction and related methods

in ecology. In Biological Data in Water Pollution Assessment: Quantitative and Statistical Analyses ed. Dickson,
K.L., Cairns, J. and Livingston, R.J. pp. 150165. Philadelphia, PA: ASTM STP 652. American Society for Testing
and Materials.
Sliwinski, M.K. and Goodman, R.M. (2004) Spatial heterogeneity of Crenarchaeal assemblages within mesophilic soil
ecosystems as revealed by PCR-single-stranded conformation polymorphism profiling. Appl Environ Microbiol
70, 18111820.
Smalla, K., Cresswell, N., Mendonca-Hagle, L.C., Wolters, A.
and van Elsas, J.D. (1993) Rapid DNA extraction protocol
from soil for polymerase chain reaction-mediated amplification. J Appl Bacteriol 74, 7885.
Srensen, K.B., Lauer, A. and Teske, A. (2004) Archaeal phylotypes in a metal-rich and low-activity deep subsurface
sediment of the Peru Basin, ODP Leg 201, Site 1231. Geobiology, 2, 151161.
Takai, K. and Horikoshi, K. (1999) Genetic diversity of archaea
in deep-sea hydrothermal vent environments. Genetics 152,
12851297.
Teske, A., Hinrichs, K.U., Edgcomb, V., Vera Gomez, A.,
Kysela, D., Sylva, S.P., Sogin, M.L. and Jannasch, H.W.
(2002) Microbial diversity of hydrothermal sediments in
the Guaymas basin: evidence for anaerobic methanotrophic
communities. Appl Environ Microbiol 68, 19942007.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F.
and Higgins, D.G. (1997) The ClustalX windows interface:
flexible strategies for multiple sequence alignment aided by
quality analysis tools. Nucleic Acids Res 24, 48764882.
Vetriani, C., Reysenbach, A.L. and Dore, J. (1998) Recovery
and phylogenetic analysis of archaeal rRNA sequences
from continental shelf sediments. FEMS Microbiol Lett 161,
8388.
Winter, C., Smit, A., Herndl, G.J. and Weinbauer, M.G. (2004)
Impact of virioplankton on archaeal and bacterial community richness as assessed in seawater batch cultures. Appl
Environ Microbiol 70, 804813.
Wu, J.H., Liu, W.T., Tseng, I.C. and Cheng, S.S. (2001) Characterization of microbial consortia in a terephthalatedegrading anaerobic granular sludge system. Microbiology
147, 373382.

2006 The Authors

Journal compilation 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 103 (2007) 141151

151