Journal of Environmental Radioactivity 160 (2016) 93e101

Contents lists available at ScienceDirect

Journal of Environmental Radioactivity

journal homepage: www.elsevier.com/locate/jenvrad

The chemical toxicity of cesium in Indian mustard (Brassica juncea L.)

seedlings
Jin-long Lai a, Zong-ya Tao a, *, Qian Fu a, Na Han a, Guo Wu a, Hong Zhang a, Hong Lu a,
Xue-gang Luo b
a
b

Life Science College, Sichuan Normal University, Chengdu, Sichuan, 610101, China
Engineering Research Center of Biomass Materials (SWUST), Ministry of Education, Mianyang, 621010, China

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 24 November 2015
Received in revised form
6 April 2016
Accepted 18 April 2016

To distinguish between the radiological and chemical effects of radiocesium, we study the chemical
toxicity of cesium in the seedlings of Indian mustard (Brassica juncea L.). In this study, the experiment
was designed in two factors and ve levels random block design to investigate the interaction effects of
Cs and K. Results showed that excessive Cs was one of the main factors inuence the growth of Brassica
juncea seedlings. And the toxicity of Cs in Brassica juncea is likely to be caused by Cs interacts with Kbinding sites in essential K-dependent protein, either competes with K for essential biochemical functions, causing intracellular metabolic disturbance. To test the hypothesis that the toxicity of Cs might
cause intracellular metabolic disturbance, next-generation sequencing (NGS)-based Illumina paired-end
Solexa sequencing platform was employed to analysis the changes in gene expression, and understand
the key genes in B. juncea seedlings responding to the toxicity of Cs. Based on the assembled de novo
transcriptome, 2032 DEGs that play signicant roles in the response to the toxicity of Cs were identied.
Further analysis showed that excessive Cs is disturbance the auxin signal transduction pathway, and
inhibited the indoleacetic acid-induced protein (AUX/IAA) genes expression eventually lead the seedlings
growth and development be inhibited. The results suggest that disturbances to tryptophan metabolism
might be linked to changes in growth.
2016 Elsevier Ltd. All rights reserved.

Keywords:
Cesium
Toxicity
Differentially expressed genes (DEGs)
Indian mustard (Brassica juncea L.)

1. Introduction
The contamination of soil and water by radionuclides due to the
development of the nuclear industry, the testing of nuclear
weapons, and sudden nuclear accidents, such as the 1986 nuclear
accident at Chernobyl in Ukraine and the 2011 Fukushima Daiichi
nuclear disaster, have potentially problems for biological systems
(Eapen et al., 2007; Saleh, 2012). The radioisotope of cesium (Cs),
Cs-137, which has a long half-life (30.17 years), caused serious
pollution within the ecosystem (White and Broadley, 2000; Zhu
and Smolders, 2000). Due to the fact that Cs-137 is easily transferred from soil to plants, high concentrations of 137Cs in ecosystems increase the risk of 137Cs entering the food chain, particularly
through agricultural crops grown in contaminated soils (Song et al.,
2012). Traditional soil cleaning techniques for 137Cs, e.g., removal of
topsoil, deep ploughing, draining suspended soil from paddies, are

* Corresponding author.
E-mail address: t89807596@163.com (Z.-y. Tao).
http://dx.doi.org/10.1016/j.jenvrad.2016.04.023
0265-931X/ 2016 Elsevier Ltd. All rights reserved.

quite expensive and unsuited to diffuse the pollution of large surfaces of soil (Isaure et al., 2006). So, the utilization of phytoremediation to restore contaminated areas of 137Cs has become the
focus of research. For example, some plants (e.g., napiergrass,
calendula alata, amaranthus chlorostachys, and chenopodium album)
had proven to have strong enrichment ability and transfer ability to
Cs. These plants may be candidate plants with high potential for the
phytoremediation of 137Cs from 137Cs -contaminated soil (Kang
et al., 2012; Roxana et al., 2011).
Previous research has shown that Cs uptake by plants, however,
there is no evidence that plants discriminate between stable versus
radioactive Cs isotopes (e.g. 133Cs vs. 134Cs, 137Cs), so plant responses
to stable Cs (133Cs) are representative of responses to radioactive
isotopes (Cook et al., 2007). However, Cs is not an essential nutrient
element for plants. It has two environmental effects: low doses of
Cs can maintain the balance of electrolytes in plant cells, while
excessive Cs can signicantly induce cytotoxicity and inhibit the
growth of plants (Ivshina et al., 2002); for instance, Cs is phytotoxic
at solution culture concentrations exceeding 200 mM (White and

94

J.-l. Lai et al. / Journal of Environmental Radioactivity 160 (2016) 93e101

Broadley, 2000). Thus, these plants were observed obvious toxic

symptom including root black, leaves grey-green, and slow growth
when they uptake excessive Cs. In recent years, the mechanism(s)
of the chemical toxicity of Cs in Arabidopsis has led to some preliminary research achievements (Hampton et al., 2004; Sahr et al.,
2005a, 2005b). For example, previous research consider three hypotheses: (1) Cs inhibits plant growth because it reduces K uptake
and causes K starvation; (2) intracellular Cs is toxic per se, perhaps
due to irreversible binding to essential K-dependent proteins; and
(3) Cs competes with K for essential biochemical functions and,
therefore, Cs toxicity is related to the [Cs]shoot/[K]shoot quotient
(Hampton et al., 2004). However, the chemical effects of Cs and the
mechanism(s) of Cs toxicity in these plants (e.g., Brassica juncea)
have been rarely reported. Meanwhile, to distinguish between the
radiological and chemical effects of radiocesium, in this study, we
adopt the stable isotope (133Cs) of simulated radioactive pollutants
to be clear what its chemical toxicity effects. So, in order to
demonstrate the mechanism of Cs chemical toxicity in Brassica
juncea, such as the interaction effects of Cs and K in the medium on
plant growth and cesium-affected gene expression in Brassica
juncea was considered to be essential.
Our previous studies have proved that Indian mustard (Brassica
juncea L.) had stronger capacity of enriching available Cs (Fu et al.,
2016). So, it may be one of the candidate accumulators to research
the toxicity mechanism of Cs. We hypothesized that the toxicity of
Cs in Brassica juncea is likely to be caused by excessive Cs interacts
with K-binding sites in essential K-dependent protein, either Cs
competes with K for essential biochemical functions, thereby
altering their activities, causing intracellular metabolic disturbance,
due to its chemical similarities with potassium.
In recent years, next generation sequencing (NGS)-based RNAseq technology has proven to be an inexpensive and quick method
for understanding the complexity of gene expression and regulation networks in several species of plant responding to many kinds
of biotic and abiotic stresses, such as lead (Pb) stress (Yan et al.,
2013), waterlogging stress (Zou et al., 2013), and salinity-tolerant
(Sharma et al., 2015). To study the molecular mechanisms and
identify genes involved in Cs toxicity response to Brassica juncea, in
this study, an NGS-based Illumina paired-end Solexa sequencing
platform was employed to characterize the de novo transcriptome
of two Brassica juncea seedling cDNA samples: one untreated
control (CK) and one Cs-toxicity with CsCl at 100 mg$L
1. The
analysis of differentially expressed genes related to Cs toxicity
mechanisms. Additionally, expression proling of some key abiotic
responsive genes was validated by qRT-PCR under Cs. In general,
this work is helping to distinguish between the radiological and
chemical effects of radiocesium. And the results can provide theoretical basis for the further study on the mechanism of radiocesium
toxicity.
2. Materials and methods
2.1. Plant materials and growth conditions
The Indian mustard seeds (Brassica juncea L.; variety: Brassica
juncea Garden PangentMix) purchased from Anggun Agricultural
Science and Technology Co., Ltd. in Wuhan, China. Seeds were
sterilized with 2% H2O2 for 10 min, and rinsed with deionized
water. The seeds transplanted and grown hydroponically in 0.5 L
containers lled with improved Hoagland's nutrient solution (with
K concentration at 1 mM) with 50 plants per container; and
renewed the solution every two days. The composition of improved
Hoagland's nutrient solution per 6 L was as follows: Ca(NO3)2$4H2O
1.18 g, KNO3 0.51 g, MgSO4$7H2O 0.49 g, KH2PO4 0.14 g, iron salt
solution 2.5 mL (including: FeSO4$7H2O 2.78 g, EDTA-Na2 3.73 g,

dH2O 500 mL, pH 5.5), micro elements solution 5 mL (including:

H3BO4 0.6 g, MnCl2$4H2O 0.4 g, ZnSO4 0.05 g, CuSO4$5H2O 0.05 g,
H2MoO4$4H2O 0.02 g, dH2O 1000 mL), pH 5.5e5.8. Plant culture
was performed in a greenhouse (25  C; the light intensity: 3500
lux; 12 h$d
1 light).
2.2. The interaction effects of Cs and K
The experimentation was designed in random block design of
two factors and ve levels. The seeds transplanted and grown hydroponically in 0.5 L containers lled with improved Hoagland's
nutrient solution (with K concentration at 1 mM) with 50 plants
per container. KNO3 was added into improved Hoagland's nutrient
solution at a K concentration of 1 mM (control), 5 mM, 10 mM,
20 mM, and 30 mM. CsCl (Cs stable isotope: 133Cs) was added into
improved Hoagland's nutrient solution at a Cs concentration of
0 mg$L
1 (control), 25 mg$L
1, 50 mg$L
1, 100 mg$L
1and
200 mg$L
1. Each treatment was conducted with three repeated
trials. At the end of the experiment (after 7 days of exposure to the
Cs solution), one part of the seedlings (randomly selected) were
used to analysis shoot length by Image-J software. Another part of
the seedlings were harvested and separated into root and shoot.
The roots were washed with running deionized water and soaked
in 20 mmol$L
1 Na2-EDTA for 20 min to remove the Cs adhering to
the root surface. The fresh tissues (0.500 g) were transferred to a
150 mL conical ask and digested with 10 mL of mixed acid
[HNO3 HClO4 (3:1, v/v)]. The concentrations of Cs and K were
determined by ame atomic absorption spectrometry (FAAS).
2.3. Transcriptome sequencing
The seeds transplanted and grown hydroponically in 0.5 L
containers lled with improved Hoagland's nutrient solution (with
K concentration at 1 mM) with 50 plants per container, the solution
was renewed every two days. Plant were cultured in a greenhouse
(25  C; the light intensity: 3500 lux; 12 h$d
1 light) and subjected
to different treatments as soon as the seedlings sprouted their
second real leaf. CsCl was added into improved Hoagland's nutrient
solution at a concentration of 0 mg$L
1 (Control, B.j-A) and
100 mg$L
1(Treatment, B.j-B). Each treatment was conducted with
three repeated trials. For Illumina analysis and qRT-PCR verication, plant seedlings were harvested when they were treated with
Cs after 48 h. All samples were washed with sterilized deionized
water and immediately frozen in liquid nitrogen and stored
at
80  C for RNA extraction.
2.3.1. RNA extraction, library preparation, and sequencing
Total RNA was extracted from these plant seedlings using TRIzol Reagent (Invitrogen, USA) according to the manufacturer's
instructions. The quality of total RNA was determined using
Nanodrop2000 (Thermo, USA) (used to detect the concentration
and purity of RNA), agarose gel electrophoresis (used to detect the
integrity of RNA), and Agilent2100 (Agilent, USA) (used to detect
RIN values). When the total content of RNA, and RNA concentration
was no less than 5 mg, and 200 ng$mL
1, respectively, the RNA
samples were selected for the next analysis. Two plant samples'
cDNA libraries were constructed using a TruseqTM RNA sample
prep kit (Illumina), including the enrichment of mRNA by Oligo
(dT), the fragmentation of mRNA, the inversion of synthetic cDNA,
and a linking adaptor, which was performed using the Shanghai
Majorbio Biopharm Technology Co., Ltd. (Shanghai, China). The library was enriched by PCR amplication (15 cycles), and the target
band was recycled using 2% agarose gel (Certied Low Range Ultra
Agarose). After quantitation using a TBS380 Picogreen (Invitrogen),
the samples were clustered (cBot Truseq PE Cluster Kit v3-cBot-HS;

J.-l. Lai et al. / Journal of Environmental Radioactivity 160 (2016) 93e101

Illumina) and sequenced on the HiSeq4000 platform (300 bp Illumina PE library, 2  151 bp sequencing; Hiseq4000 Truseq SBS Kit
v3-HS, 200 cycles; Miseq Reagent Kit V2, 500 cycles/600 cycles;
Illumina).
2.3.2. Sequence cleaning and de novo assembly
The raw sequence data contain the characteristics of an adapter
sequence, low-quality reads, a high N rate, and a sequence length
that is too short (<20 bp). To guarantee the accurate analysis of
biological information, the raw sequence data were trimmed using
SeqPrep (https://github.com/jstjohn/SeqPrep), and Sickle (https://
github.com/najoshi/sickle). The RNA-seq clean data de novo assembly was carried out using the short-read assembling program
Trinity (http://trinityrnaseq.sourceforge.net/, version number:
trinityrnaseq-r2013-02-25). The basic principle of trinity assembly
was divided into three steps: inchworm, chrysalis, and buttery
models (Grabherr et al., 2011). The de novo assembly results were
dened as unique transcripts. Then, the non-redundant full-length
transcriptome (unigenes) was further assembled on the basis of the
unique assembled transcripts through the process of sequence
splicing redundancy removal with sequence clustering software.
Finally, the clean reads were mapped to an assembled transcriptome using Bowtie software (http://bowtie-bio.sourceforge.
net/index.shtml) (Langmead and Pop, 2009; Langmead and
Salzberg, 2012).
2.3.3. Transcripts annotation
Functional annotation for all the unique assembled transcripts
was done using BLASTX (BLAST Version 2.2.25) search against the
NCBI non-redundant (NR); Gene Ontology (GO, http://www.
geneontology.org/); the Search Tool for the Retrieval of Interacting Genes (String); Clusters of Orthologous Groups of proteins
(COG, http://www.ncbi.nlm.nih.gov/COG/), and the Kyoto encyclopedia of genes and genomes (KEGG) databases (Camacho et al.,
2009; Conesa et al., 2005).
2.3.4. Differential expression analysis involved in the response to Cs
To analyze the differential expression genes (DEGs) of the two
different treatments, the expression level for each gene was
calculated using the fragments per kilobase of exon model per
million mapped reads (FRKM) method (software: RSEM, http://
deweylab.biostat.wisc.edu/rsem/) (Li and Dewey, 2011). Finally,
the edgeR software (http://www.bioconductor.org/packages/2.12/
bioc/html/edgeR.html) was employed to quantify DEGs (Robinson
et al., 2009; Tang et al., 2008). In the study, DEGs was identied
when the false discovery rate (FDR) was less than 0.05. In addition,
GO terms of DEGs were performed using blast2go (http://www.
blast2go.com/b2ghome). The functional enrichment analyses of
DEGs, including GO terms and metabolic pathways, were

95

performed
using
Goatools
(https://github.com/tanghaibao/
GOatools), and KOBAS (http://kobas.cbi.pku.edu.cn/home.do),
respectively. DEGs were signicantly enriched in GO terms and
metabolic pathways at the uncorrected P-value < 0.05 (using four
corrected methods: Bonferroni, Holm, Sidak, and the FDR)
compared with the whole-transcriptome background using the
formula described in the previous studies (Aickin and Gensler,
1996; Benjamini and Hochberg, 1995; Westfall and Young, 1989;
Xie et al., 2011).
2.4. Validation of Illumina expression patterns using qRT-PCR
analysis
The gene-specic primers for qPCR were designed using Beacon
Designer 7.9 software and CAC was selected as the internal control
gene according to a previous report (Ruby et al., 2012) (see Table 1).
Quantitative real-time PCR was performed on a Bio-rad MiniOpticon (Bio-Rad) platform using the SuperReal PreMix Plus (SYBR
Green) (TIANGEN, China) following the manufacturer's instructions. The amplication was achieved by the following PCR
program of a rst denaturation at 95  C for 15 min, then 40 cycles of
denaturation at 95  C for 10 s, annealing and extension at 60  C for
32 s. The relative expression levels of the selected transcripts
normalized to CAC were calculated using the 2
DDCt method. All
reactions were performed with three replicates, and the data were
analyzed using Bio-Rad CFX Manager software.
2.5. Statistical analysis
The data obtained in the experiments were subjected to a oneway analysis of variance (ANOVA), and an LSD test was performed
to determine the signicance of the difference between the mean
values using SPSS software (SPSS Inc., Chicago, IL, Version 18.0). The
graphs were drawn by Origin 9.0 software and excel.
3. Results and discussion
3.1. K dependence of shoot growth
The Brassica juncea grown for 7 days in improved Hoagland's
nutrient solution containing a complete mineral supplement with
K concentrations between 1 mM and 30 mM. As shown in Fig. 1,
shoot length was signicantly increased with an increasing concentration of K (P < 0.05). Shoot length is between 7.70 cm and
10.08 cm in Brassica juncea when K concentrations was
5 mMe30 mM, while shoot length only reached 6.95 cm in control
(1 mM) (see Fig. 1). Results indicate that supplying potassium was
advantageous to the seedlings shoot growth.

Table 1
The gene-specic primers used for qRT-PCR.
Genes ID

Primer name

Primer (50 -30 )

Swissprot description

>c41729_g1

CHAg1

Cation/H() antiporter

>c30506_g1

OCT

>c41729_g2

CHAg2

>c44829_g1

PCAKT

>c27630_g1

TDT

Internal control gene

CAC

CTCCTACTTCTCCCTCTTC
ATGTTGTATCGTTCGTTCC
GAAGAGGATTGTGATGGTTAT
AAGTAGAGATTGAAGTTGAGATT
AAGGCGATTACAATAACC
TGGAAACAGAACATAAGG
ATCTTCCTATCAACTTGTTCTTC
GCCATTGTTATCCGATTCAT
TGTGTTGTATTGTCCTAA
GAAACTCATTGGTCCTAA
GCGAATCAGCAATGTCTA
CAGCCTCAACAACGAAT

Organic cation/carnitine transporter

Cation/H() antiporter
Potassium channel AKT1
Tonoplast dicarboxylate transporter

96

J.-l. Lai et al. / Journal of Environmental Radioactivity 160 (2016) 93e101

Fig. 1. The relationship between shoot lengths versus the K concentration in the
medium. Notes: the different lower case letters indicate that signicant differences
(P < 0.05) exist between treatment groups with different K levels in Brassica juncea
(LSD test).

3.2. K alleviates the inhibition of shoot growth by Cs

To study the interaction effects of Cs and K in plant seedlings,
plants grown for 7 days in improved Hoagland's nutrient solution
containing different K (between 1 mM and 30 mM) and Cs (between 0 and 200 mg$L
1) concentrations. As shown in Fig. 2A, Cs
obviously inhibited the growth and development of Brassica juncea
seedlings with the increase of Cs concentration. The relationship
between shoot length and Cs concentration was tted the equation
of a linear relation (Fig. 2B). However, with the increase of K concentration in solution, exogenous K obviously alleviated the inhibition of Brassica juncea seedlings growth under Cs (Fig. 2A).

3.3. K reduces Cs accumulation in seedlings

As shown in Fig. 3, the content of Cs in seedlings were signicantly increased with an increasing of Cs concentration when K was
1 and 20 mM (P < 0.05). When Cs concentration was 200 mg$L
1,
the highest accumulation level of Cs in the entire plant of seedlings
were as much as 5730.69 mg$kg
1 FW (with K concentration at
1 mM) and 2431.66 mg$kg
1 FW (with K concentration at 20 mM),
respectively (see Fig. 3). Further analysis shows that with the increase of K concentration in the solution, exogenous K signicantly
reduces Cs accumulation in seedlings (P < 0.01). When K concentration was 20 mM, as composed with 1 mM K, the content of Cs
averagely decreased 82.17% (Cs 25 mg$L
1), 76.72% (Cs 50 mg$L
1),
80.11% (Cs 100 mg$L
1) and 57.57% (Cs 200 mg$L
1) (see Fig. 3).
Previous research has shown that Cs enters plants principally via K
transport systems. For example, rst, owing to the plant's highafnity K transporter, the uptake permeases family (KUPs) of K
has been demonstrated to mediate high-afnity Cs uptake across
the plasma membrane (White and Broadley, 2000). The absorption
of Cs in high-afnity K transporter 5 (HAK5) and KUP9 has also
been demonstrated in relation to Arabidopsis thaliana (Kobayashi

Fig. 2. The interaction effects of Cs and K in shoot lengths (A), the relationship between shoot length versus the Cs concentration in the medium was analyzed when K
concentration maintain at 1 mM and 20 mM (B).

et al., 2010; Qi et al., 2008). Another way of absorbing Cs is via

the plants low-afnity system, such as voltage-insensitive cation
channels (VICCs) (White and Broadley, 2000) and cyclic nucleotidegated ion channels 1(CNGC1) (Kanter et al., 2010). Our results
indicate that Cs competes with K for transport systems, and root
uptake of Cs or K depends primarily on the concentration of free
metal ion. Therefore, excessive Cs accumulation intracellular was
one of the main factors inuencing the growth of seedling when K
was 1 mM in the medium.
3.4. Low Cs increases K accumulation in seedlings
Hampton et al., research also shows that the [K]shoot of plants
grown at low [Cs]agar (<0.01 mM [Cs] at 2 mM [K]agar, or <2 mM
[Cs]agar at 20 mM [K]agar) were greater than those grown in the
absence of Cs for Arabidopsis (Hampton et al., 2004). It is consistent
with our results. Increasing the Cs concentration increased the
content of K when Cs was less than 200 mg$L
1 (1.50 mM [Cs]) at
1 mM [K] and 20 mM [K] (see Fig. 4A). In general, the content of K
was smaller in plants grown in the presence of 1 mM [K] than those
grown in the presence of 20 mM [K] at the same [Cs] (see Fig. 4A).
Intriguingly, when [Cs]agar was increased beyond these concentrations, [K]shoot declined in Arabidopsis (Hampton et al., 2004).

J.-l. Lai et al. / Journal of Environmental Radioactivity 160 (2016) 93e101

97

Fig. 3. K reduces Cs accumulation in seedlings when K concentrations maintain at

1 mM and 20 mM. Notes: the different lower case letters indicate that signicant
differences (P < 0.05) exist between treatment groups with different Cs levels in
Brassica juncea (LSD test). ** indicate that signicant differences (P < 0.01) exist
between different K levels when Cs kept constant. The same below.

Through our analysis, the phenomenon was related to K transport

systems. Previous research has shown that K enters plants principally via K transport systems, namely K transporter (functioning at
low external K concentration) and channels (functioning at high
external K concentration) operating at different external K concentrations (Zhu and Smolders, 2000). In our study, K enters plants
principally via K transporter when K concentration was 1 mM. Due
to the amount of K transporter in plant is nite, so the content of K
showed saturation phenomenon. However, increasing the Cs concentration signicantly increased the content of K when Cs was
more than 50 mg$L
1 at 20 mM [K] (P < 0.05) (see Fig. 4A). This
result showed that plant alleviated the toxicity of Cs by increasing
the content of K. Meanwhile, this implies that Cs toxicity in Brassica
juncea is unlikely to be caused by K starvation alone, and is likely to
be caused by the intracellular excessive Cs interacts with K-binding
sites in essential K-dependent protein; either Cs competes with K
for essential biochemical functions. Further analysis shows that the
rate of increase in [Cs]seedlings/[K]seedlings with increasing Cs in the
solution was greater in plants grown with 1 mM [K] than those
grown with 20 mM [K] (see Fig. 4B). The results proved that the Cs
competes with K for essential biochemical functions, leading to
abnormal [Cs]seedlings/[K]seedlings quotient in cell.
3.5. DEGs involved in the response to Cs toxicity in B. juncea
seedlings
To test the hypothesis that Cs toxicity might cause intracellular
metabolic disturbance, investigate the changes in gene expression,
and understand the key genes in B. juncea seedlings responding to
Cs toxicity. We generated two cDNA libraries from the control (B.jA, untreated control) and Cs toxicity-treated (B.j-B, r(Cs)
100 mg$L
1) seedlings of B. juncea with the Illumina HiSeq 4000
sequencing. Clean reads of the Cs-100 (B.j-B) and the control (B.j-A)
libraries were mapped to the de novo assembly transcriptome
reference sequences with Bowtie and were assigned to unigenes
and isoforms using RNA-Seq by Expectation Maximization (RSEM)
software. The assigned unigene and isoform expression levels were
calculated using a normalizing statistic called FPKM. The DEGs
(including unigenes and isoforms) were determined when
FDRs < 0.05 and the log2-fold expression changes (log2 FCs) were
greater than 1 or less than
1 (log2jFCj > 1). The results indicate
that a total of 2032 DEGs were detected between the two libraries,

Fig. 4. Cs increase K accumulation in seedlings when K concentrations maintain at

1 mM and 20 mM (A); The relationships between the quotient of Cs to K concentrations in the seedlings ([Cs]seedlings/[K]seedlings) versus the Cs concentration in the
medium when K concentrations maintain at 1 mM and 20 mM (B).

and these DEGs included both upregulated (1044 genes) and

downregulated genes (988 genes) under Cs toxicity (see Fig. 5,
Table S1, and Table S2). GO assignments were used to classify the
functions of the DEGs under Cs toxicity. The results indicate that
2032 DEGs were assigned at least one GO term, including 51
functional groups at the second level. Among which, single-organism process, metabolic process, and cellular process were
primary in the biological process; cell, cell part, and organelle
were the most highly represented under the cellular component;
and binding, and catalytic activity were the most abundant
subcategories for the molecular function (see Fig. 6). The major
pathways in the DEGs were metabolic pathways [ko01100] (713,
9.87%), biosynthesis of secondary metabolites [ko01110] (562,
7.78%), and microbial metabolism in diverse environments
[ko01120] (369, 5.11%) for the following 22 KEGG pathways
showed in Fig. 7.
3.6. GO and pathway functional enrichment analysis of the DEGs
To explain the difference between the gene function level of the
control (B.j-A) and the Cs toxicity-treated (B.j-B) seedlings of
B. juncea, GO functional-enrichment analysis of DEGs was

98

J.-l. Lai et al. / Journal of Environmental Radioactivity 160 (2016) 93e101

Fig. 5. Scatter and volcano plots of the gene expression differences between B.j-A (CK) and B.j-B samples.

Fig. 6. GO classication of the upregulated and downregulated genes.

performed using Goatools software. The results indicate that a total

of 440 terms for the DEGs were signicantly enriched at a
Bonferroni-corrected P-value < 0.05 (see Table S3). The GO terms
predominantly enriched for the DEGs were related to biological
processes, including biological process (GO: 0008150, the ratio in
the study: 1296/2032, 63.78%), metabolic process (GO: 0008152,
ratio: 923/2032, 45.42%), single-organism process (GO: 0044699,
ratio: 885/2032, 43.55%), cellular process (GO: 0009987, ratio:
876/2032, 43.11%), and organic substance metabolic process (GO:
0071704, ratio: 719/2032, 35.38%). Those related to cellular

components include cellular component (GO: 0005575, ratio:

1184/2032, 58.27%), cell part (GO: 0044464, ratio: 1013/2032,
49.85%), intracellular part (GO: 0044424, ratio: 848/2032,
41.73%), intracellular organelle (GO: 0043229, ratio: 616/2032,
30.31%), and organelle (GO: 0043226, ratio: 616/2032, 30.31%).
The predominant GO terms identied as enriched among the molecular function related to molecular function (GO: 0003674, ratio: 1199/2032, 59.01%), catalytic activity (GO: 0003824, ratio:
784/2032, 38.58%), binding (GO: 0005488, ratio: 774/2032,
38.09%), heterocyclic compound binding (GO: 1901363, ratio:

J.-l. Lai et al. / Journal of Environmental Radioactivity 160 (2016) 93e101

99

Fig. 7. KEGG pathways were top 1 to 25 of the DEGs.

509/2032, 25.05%), and organic cyclic compound binding (GO:

0097159, ratio: 509/2032, 25.05%) (see Table S3). Meanwhile, a
total of 29 pathways for the DEGs were signicantly enriched at a
Bonferroni-corrected P-value < 0.05. The results showed that the
KEGG pathways predominantly enriched for the DEGs were related
to organismal systems, including Plant-pathogen interaction
(ko04626, sample/background: 43/409). Those related to environmental information only included Plant hormone signal transduction (ko04075, sample/background: 41/530). The most
predominant GO terms identied as enriched among metabolic
pathway related to Phenylpropanoid biosynthesis (ko00940,
sample/background: 37/212), Biosynthesis of amino acids
(ko01230, sample/background: 34/480), and Carbon metabolism
(ko01200, sample/background: 32/478) (see Table S4). Results
indicate that Cs toxicity cause intracellular metabolic disturbance.
3.7. Identication of DEGs involved in plant growth
Given the morphological changes evident in plants suffering Cs
toxicity at high exposures (see Figs. 1 and 2), it is likely that signicant aspects of tryptophan metabolism, and the auxin metabolism dependent on it, are disturbed. Among them, the auxin
signal transduction pathway is closely related to plant growth.
Thus, we analyzed some key enzymes which are closely associated
with the auxin biosynthesis rstly. For example, in higher plants,
indole-3-acetaldehyde oxidase is a key enzyme in indole-pyruvic
acid metabolic pathways, catalyzing indole acetaldehyde dehydrogenation into indole acetic acid (IAA) (Sekimoto et al., 1998).
Meanwhile, for the cruciferous plants (e.g. B. juncea), nitrilase also
is a key enzyme in indole acetonitrile metabolic pathways, catalyzing indole acetonitrile into IAA (Normanly et al., 1997).
Comparative analysis of sequences from the two cDNA libraries
during Cs treatment condition revealed that six indole-3-

acetaldehyde oxidase genes and one nitrilase gene were signicantly up-regulated (see Table 2). The results suggest that Cs
toxicity can increase the level of auxin synthesis of B. juncea, then,
auxin is a signaling molecule activating the expression of the
backward genes. The results showed that auxin transporter-like
protein (AUX1) was signicantly up-regulated, which can receive
the signals caused by auxin and activate the expression of the
backward genes (e.g. protein AUXIN SIGNALING F-BOX 1, TIR1).
However, indoleacetic acid-induced protein (AUX/IAA) is not activated, but is signicantly repressed the expression of the gene.
Meanhhile, auxin-responsive protein (ARF) is the key factor in
auxin signal transduction pathway, which can receive the signals
caused by auxin and activate or repress the expression of the
backward genes (Liscum and Reed, 2002). The results showed that
one auxin-responsive protein gene were signicantly up-regulated.
Unfortunately, ARF is not fully activated the expression of the
backward genes, including four up-regulated genes, Indole-3acetic acid-amido synthetase GH3.6/GH3.17 (GH3), and Auxinresponsive family protein (SAUR), and three down-regulated
genes, Indoleacetic acid-induced protein 19 (AUX/IAA), Auxininduced protein 10A5 (GH3) and Auxin-responsive family protein
(SAUR) (see Fig 8 and Table 2). The results demonstrate that the
seedlings accumulation excessive Cs is disturbance the auxin signal
transduction pathway. And a higher dosage of Cs inhibited the
indoleacetic acid-induced protein (AUX/IAA) genes expression
eventually lead the seedlings growth and development be
inhibited.
3.8. Validation of Illumina expression patterns by qRT-PCR analysis
To validate the expression data obtained using transcriptome
sequencing, ve candidate DEGs were selected and their expression
was detected using qRT-PCR. As reported, CAC exhibiting the most

100

J.-l. Lai et al. / Journal of Environmental Radioactivity 160 (2016) 93e101

Table 2
Identication of DEGs involved in plant growth.
Transcript ID

LogFC

1. Indole-3-acetaldehyde oxidase
c26079_g1
7.73
c19002_g1
7.68
c28230_g1
7.28
c47553_g2
5.00
c32529_g1
4.19
c33136_g2
3.05
2. Nitrilase
c45026_g1
1.1
3. AUX1
c35384_g1
1.17
4. TIR1
c44184_g1
1.38
5. AUX/IAA
c35079_g1

1.4
6. ARF
c46087_g1
1.75
7. AUX/IAA
c35079_g1

1.4
8. GH3
c29549_g1
3.15
c39753_g1
3.75
c28244_g1

1.49
9. SAUR
c40563_g1
1.23
c31110_g1
1.83
c28244_g1

1.49

Signicant

Regulate

Swissprot or String description

yes
yes
yes
yes
yes
yes

up
up
up
up
up
up

Indole-3-acetaldehyde
Indole-3-acetaldehyde
Indole-3-acetaldehyde
Indole-3-acetaldehyde
Indole-3-acetaldehyde
Indole-3-acetaldehyde

yes

up

Nitrilase 2

yes

up

Auxin transporter-like protein 3

yes

up

Protein AUXIN SIGNALING F-BOX 1

yes

down

Indoleacetic acid-induced protein 19

yes

up

Auxin-responsive protein IAA21/IAA23/IAA25

yes

down

Indoleacetic acid-induced protein 19

yes
yes
yes

up
up
down

Indole-3-acetic acid-amido synthetase GH3.6

Indole-3-acetic acid-amido synthetase GH3.17
Auxin-induced protein 10A5

yes
yes
yes

up
up
down

Auxin-responsive family protein

Auxin-responsive family protein
Auxin-responsive family protein

oxidase,
oxidase,
oxidase,
oxidase,
oxidase,
oxidase,

Aldehyde
Aldehyde
Aldehyde
Aldehyde
Aldehyde
Aldehyde

oxidase
oxidase
oxidase
oxidase
oxidase
oxidase

1
1
1
1
1
1

Fig. 8. Expression pattern of genes involved in plant growth in the KEGG pathways. Notes: the red and green color in each column indicated up- and down-regulation genes. (For
interpretation of the references to colour in this gure legend, the reader is referred to the web version of this article.)

stable expression in different treatments was used as the reference

for gene expression normalization (Ruby et al., 2012). All four
genes, cation/H antiporter (CHAg1, CHAg2), tonoplast dicarboxylate transporter (TDT), and organic cation/carnitine transporter
(OCT), that upregulated in response to Cs stress in transcriptome
sequencing experiments showed upregulation in qPCR data as well.
Meanwhile, the potassium channel AKT1 (PCAKT) showed downregulation in both transcriptome sequencing and qPCR experiments (see Fig. 9). Although the magnitude of the fold change
observed varied in different experiments, the overall regulation
patterns obtained with qPCR were in agreement with the RNAsequencing data (see Fig. 9).
4. Conclusion
This study analyzed the toxicity of cesium in the seedlings of
Indian mustard (Brassica juncea L.). Results showed that excessive
Cs was one of the main factors inuence the growth of Brassica
juncea seedlings. Though exogenous K obviously alleviated the inhibition of Brassica juncea seedlings growth under Cs toxicity, yet
the toxicity of Cs in Brassica juncea is likely to be caused by Cs interacts with K-binding sites in essential K-dependent protein,
either competes with K for essential biochemical functions, leading

Fig. 9. qRT-PCR analysis of ve selected DEGs with different concentration treatments

of Cs.

to abnormal [Cs]seedlings/[K]seedlings quotient in cell. Based on the

assembled de novo transcriptome, 2032 DEGs that play signicant
roles in the response to Cs toxicity were identied. The results

J.-l. Lai et al. / Journal of Environmental Radioactivity 160 (2016) 93e101

proved that excessive Cs is disturbance the auxin signal transduction pathway and inhibit the indoleacetic acid-induced protein
genes expression eventually lead the seedlings growth and development be inhibited.
Acknowledgments
This study was nancially supported by national key research
project of decommission of nuclear facilities and radioactive waste
management (No. 14ZG6101), Sichuan of education department
project of China (No. 14ZA0030), Key project from Sichuan Normal
University (No. 16ZP09) and student's platform for innovation and
entrepreneurship training program (No. 201510636001). In addition, we thank the anonymous reviewers for their valuable comments regarding the manuscript.
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.jenvrad.2016.04.023.
References
Aickin, M., Gensler, H., 1996. Adjusting for multiple testing when reporting research
results: the Bonferroni vs Holm methods. Am. J. Public Health 86, 726e728.
Benjamini, Y., Hochberg, Y., 1995. Controlling the false discovery rate: a practical
and powerful approach to multiple testing. J. R. Stat. Soc. 57, 289e300.
Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K.,
Madden, T.L., 2009. BLAST: architecture and applications. BMC Bioinformatics
10:421. Bmc Bioinforma. 10, 1e9.
Conesa, A., Gotz, S., Garcia-Gomez, J., Terol, J., Talon, M., Robles, M., 2005. Blast2GO:
a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 21, 3674e3676.
Cook, L.L., Inouye, R.S., Mcgonigle, T.P., White, G.J., 2007. The distribution of stable
cesium in soils and plants of the eastern Snake River Plain in southern Idaho.
J. Arid. Environ. 69, 40e64.
Eapen, S., Singh, S., Thorat, V., Kaushik, C.P., Raj, K., D'Souza, S.F., 2007. Phytoremediation of radiostrontium (Sr-90) and radiocesium (Cs-137) using giant
milky weed (Calotropis gigantea R.Br.) plants. Chemosphere 65, 2071e2073.
Fu, Q., Lai, J.L., Tao, Z.Y., Han, N., Wu, G., 2016. Characterizations of bio-accumulations, subcellular distribution and chemical forms of cesium in Brassica juncea,
and Vicia faba. J. Environ. Radioact. 154, 52e59.
Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I.,
Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q., 2011. Full-length transcriptome
assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 29,
644e652.
Hampton, C.R., Bowen, H.C., Broadley, M.R., Hammond, J.P., Andrew, M., Payne, K.A.,
Jeremy, P., White, P.J., 2004. Cesium toxicity in arabidopsis. Plant Physiol. 136,
3824e3837.
s, G., Lay, P.L., Fayard, B., Susini, J., Bourguignon, J.,
Isaure, M.P., Fraysse, A., Deve
Ortega, R., 2006. Micro-chemical imaging of cesium distribution in arabidopsis
thaliana plant and its interaction with potassium and essential trace elements.
Biochimie 88, 1583e1590.
Ivshina, I.B., Peshkur, T.A., Korobov, V.P., 2002. The efcient accumulation of cesium
ions by rhodococcus cells. Mikrobiologiia 71.
Kang, D.J., Seo, Y.J., Saito, T., Suzuki, H., Ishii, Y., 2012. Uptake and translocation of
cesium-133 in napiergrass (Pennisetum purpureum Schum.) under hydroponic
conditions. Ecotoxicol. Environ. Saf. 82, 122e126.
Kanter, U., Hauser, A., Michalke, B., Draxl, S., Schaffner, A.R., 2010. Caesium and
strontium accumulation in shoots of Arabidopsis thaliana: genetic and physiological aspects. J. Exp. Bot. 61, 3995e4009.

101

Kobayashi, D., Uozumi, N., Hisamatsu, S.I., Yamagami, M., 2010. AtKUP/HAK/KT9, a
K transporter from Arabidopsis thaliana, mediates Cs uptake in Escherichia
coli. Biosci. Biotechnol. Biochem. 74, 203e205.
Langmead, B., Pop, M., 2009. Ultrafast and memory-efcient alignment of short
DNA sequences to the human genome. Genome Biol. 10, R25.
Langmead, B., Salzberg, S.L., 2012. Fast gapped-read alignment with Bowtie 2. Nat.
Methods 9, 357e359.
Li, B., Dewey, C.N., 2011. RSEM: accurate transcript quantication from RNA-Seq
data with or without a reference genome. BMC Bioinform 12:323. Bmc Bioinforma. 12, 93e99.
Liscum, E., Reed, J.W., 2002. Genetics of Aux/IAA and ARF action in plant growth and
development. Plant Mol. Biol. 49, 387e400.
Normanly, J., Grisa, P., Fink, G.R., Bartel, B., 1997. Arabidopsis mutants resistant to
the auxin effects of indole-3-acetonitrile are defective in the nitrilase encoded
by the NIT1 gene. Plant Cell 9, 1781e1790.
Qi, Z., Hampton, C.R.S.R., Barkla, B.J., White, P.J., Schachtman, D.P., 2008. The high
afnity K transporter AtHAK5 plays a physiological role in planta at very low
K concentrations and provides a caesium uptake pathway in Arabidopsis.
J. Exp. Bot. 59, 595e607 (513).
Robinson, M.D., Mccarthy, D.J., Smyth, G.K., 2009. edgeR: a Bioconductor package
for differential expression analysis of digital gene expression dataSMotn. Bioinformatics 26, 139e140.
Roxana, M., Mehdi, B., Reza, A., 2011. Phytoremediation of stable Cs from solutions
by Calendula alata, Amaranthus chlorostachys and Chenopodium album. Ecotoxicol. Environ. Saf. 74, 2036e2039.
Ruby, C., Rehna, A., Bisht, N.C., 2012. Evaluation of candidate reference genes for
gene expression normalization in Brassica juncea using real time quantitative
RT-PCR. PLoS One 7, 65e65.
Sahr, T., Voigt, G., Paretzke, H.G., Schramel, P., Ernst, D., 2005a. Caesium-affected
gene expression in Arabidopsis thaliana. New Phytol. 165, 747e754.
Sahr, T., Voigt, G., Schimmack, W., Paretzke, H.G., Ernst, D., 2005b. Low-level radiocaesium exposure alters gene expression in roots of Arabidopsis. New Phytol.
168, 141e148.
Saleh, H.M., 2012. Water hyacinth for phytoremediation of radioactive waste
simulate contaminated with cesium and cobalt radionuclides. Nucl. Eng. Des.
242c, 425e432.
Sekimoto, H., Seo, M., Kawakami, N., Komano, T., Desloire, S., Liotenberg, S., MarionPoll, A., Caboche, M., Kamiya, Y., Koshiba, T., 1998. Molecular cloning and
characterization of aldehyde oxidases in Arabidopsis thaliana. Plant Cell Physiol.
39, 433e442.
Sharma, R., Mishra, M., Gupta, B., Parsania, C., Singla-Pareek, S.L., Pareek, A., 2015.
De novo assembly and characterization of stress transcriptome in a salinitytolerant variety CS52 of Brassica juncea. PLoS One 10.
Song, N., Zhang, X., Wang, F., Zhang, C., Tang, S., 2012. Elevated CO2 increases Cs
uptake and alters microbial communities and biomass in the rhizosphere of
Phytolacca americana Linn (pokeweed) and Amaranthus cruentus L. (purple
amaranth) grown on soils spiked with various levels of Cs. J. Environ. Radioact.
112, 29e37.
Tang, H., Wang, X., Bowers, J.E., Ming, R., Alam, M., Paterson, A.H., 2008. Unraveling
ancient hexaploidy through multiply-aligned angiosperm gene maps. Genome
Res. 18, 1944e1954.
Westfall, P.H., Young, S.S., 1989. p Value adjustments for multiple tests in multivariate binomial models. J. Am. Stat. Assoc. 84, 780e786.
White, P.J., Broadley, M.R., 2000. Mechanisms of caesium uptake by plants. New
Phytol. 147, 241e256.
Xie, C., Mao, X., Huang, J., Ding, Y., Wu, J., Dong, S., et al., 2011. KOBAS 2.0: a web
server for annotation and identication of enriched pathways and diseases.
Nucl. Acids Res. 39, W316eW322.
Yan, W., Liang, X., Yinglong, C., Hong, S., Yiqin, G., Cecilia, L., Liwang, L., 2013.
Transcriptome proling of radish (Raphanus sativus L.) root and identication
of genes involved in response to lead (Pb) stress with next generation
sequencing. PLos One 8, 1475e1478.
Zhu, Y.G., Smolders, E., 2000. Plant uptake of radiocaesium: a review of mechanisms, regulation and application. J. Exp. Bot. 51, 1635e1645.
Zou, X., Tan, X., Hu, C., Zeng, L., Lu, G., Fu, G., Cheng, Y., Zhang, X., 2013. The transcriptome of Brassica napus L. Roots under waterlogging at the seedling stage.
Int. J. Mol. Sci. 14, 2637e2651.