127

NOTES & TIPS

postblot staining with either Coomassie blue or silver

did not enhance the pattern. Less than 0.2 mg of the
smaller subunits of the E. coli ATPase was detected
(Fig. 2, II); this amount could be lowered at least by a
factor of 20, using less protein, but increased exposure
times of blots treated with the ECL reagents (not
shown).
We were able to confirm that long transfer times are
necessary and that low transfer efficiency ensues, when
stained wet gels are used for blotting, as has been
pointed out previously (2). With dried, rehydrated gels,
though, these problems were completely eliminated.
This was likely due to an efficient removal of acetic
acid and other volatile substances during gel drying,
which is usually carried out at 80C under reduced
pressure. Thus, if a fast analysis of samples from
stained gels is desired, it would even be advisable to
include drying with a vacuum gel dryer (required time:
about 1 h for 0.75-mm gels) and rehydrating (1 h or
less), before performing Western blotting. Transfer
times can be as short as 30 min with most gels, containing up to 12% acrylamide; we also used TrisTricine gels (8), with acrylamide concentrations of about
16.5%, which required 2 h for efficient transfer (not
shown).
N-terminal sequencing by Edman degradation of
blotted bacterial ATPase subunits from dried and
stained gels was not possible, presumably because Ntermini became acetylated during the staining procedure. Although we did not attempt to solve this problem, it may be possible to avoid blockage by using
alternative staining methods, omitting the acetic acid.
Conclusions. We show that electrophoretically separated proteins can be analyzed by Western blotting,
following rehydration of dried polyacrylamide gels.
This procedure allows multiple uses of a single polyacrylamide gel electrophoresis run: after recording the
protein pattern of the Coomassie blue or silver-stained
gel, the dried gel may be stored for extended periods,
until antibodies to proteins of interest become available
or until immunodetection of minute quantities of proteins is attempted with highly sensitive novel methods,
as for instance chemiluminescence-based procedures
combined with light enhancement (3). Rehydration of
gels and subsequent blotting yield sharp patterns in
the case of Coomassie blue-stained gels, whereas silverstained proteins transfer in the colorless form, but
leave a phantom pattern in the spent gel. Immunodetection can be carried out with any customary detection
system with blots from silver-stained proteins; proteins
stained with Coomassie blue must be detected by a
nonchromogenic method, e.g., by ECL.
Acknowledgments. This work was supported by the Austrian Science Foundation (FWF), Project P 9144-MOB, and by NASA Cooperative Agreement NCC 2-578, while H.S.L. was a Principal Investigator
with SETI Institute. We thank Dr. L. I. Hochstein for a gift of H.

saccharovorum, C. Radax for the preparation of ATPase from T. scotoductus, and A. Mayer for a critical reading of the manuscript.

REFERENCES
1. Gershoni, J. M., and Palade, G. E. (1983) Anal. Biochem. 131,
115.
2. Ranganathan, V., and De, P. K. (1996) Anal. Biochem. 234, 102
104.
3. Whitehead, T. P., Thorpe, G. H. G., Carter, T. J. N., Groucutt,
C., and Kricka, L. J. (1983) Nature 305, 158159.
4. Stan-Lotter, H., and Hochstein, L. I. (1989) Eur. J. Biochem.
179, 155160.
5. Yokoyama, K., Oshima, T., and Yoshida, M. (1990) J. Biol. Chem.
265, 2194621950.
6. Loo, T. W., Stan-Lotter, H., MacKenzie, D., Molday, R. S., and
Bragg, P. D. (1983) Biochim. Biophys. Acta 733, 274282.
7. Laemmli, U. K. (1970) Nature 227, 680685.
8. Schagger, H., and von Jagow, G. (1987) Anal. Biochem. 166,
368379.
9. Dunn, S. D. (1986) Anal. Biochem. 157, 144153.
10. Bradford, M. M. (1976) Anal. Biochem. 72, 248254.

Calcium-Modulated Proteins Change Their

Immunoreactivity in the Presence of Ca2/:
A Study of Antibody Recognition in a Dot
Immunoassay for Calmodulin, Calcineurin
(b-subunit), and S100B
Carlos. A. Goncalves, Carmem Gottfried,
TrB cia Kommers, and Richard Rodnight1
Departamento de BioquB mica, ICBS, UFRGS,
90035-003, Porto Alegre, Brazil
Received June 16, 1997

A recent study by Winsky and Kuznicki of neuronal

Ca2/ binding proteins (calbindin, parvalbumin, and
calretinin) showed that their immunoreactivity depends on their Ca2/ binding status (1). These authors
showed that some antibodies to Ca2/ binding proteins
preferentially recognize particular Ca2/-induced protein conformations. Such results could change the interpretation of results obtained in immunochemical
studies of EF-hand proteins such as calmodulin and
S1OO proteins (2, 3). In this work we investigated the
influence of Ca2/ on the immunoreactivity of three
other EF-hand proteins also found in brain: calmodu1

To whom correspondence should be addressed at Departamento

de BioquB mica, Instituto de Ciencias Basicas da Saude, UFRGS, Rua
Ramiro Barcelos 2600, 90.035.003 Porto Alegre RS, Brazil. Fax: /55
51 316 5535.
ANALYTICAL BIOCHEMISTRY

253, 127130 (1997)

AB972357

ARTICLE NO.

0003-2697/97 $25.00
Copyright 1997 by Academic Press
All rights of reproduction in any form reserved.

128

NOTES & TIPS

lin, the astrocytic protein S100B, and the b-subunit of

the protein phosphatase calcineurin.
Calmodulin and S100B are classical EF-hand proteins, but are distinct from those studied by Winsky
and Kuznicki (1) in that they are not classified as proteins that buffer Ca2/. On binding Ca2/, calmodulin
and S100B undergo a conformational change which results in the exposure of hydrophobic regions that allows
their interaction with target proteins. For this reason
they are classified as Ca2/-modulated proteins (4). The
b-subunit of calcineurin binds calmodulin, but is also
an EF-hand protein whose activity depends on Ca2/
binding (5).
Winsky and Kuznicki (1) also showed that protein
fixation in the presence of Ca2/ may preserve Ca2/
binding status for antibody recognition. However, protein fixation per se can alter the immunoreactivity of
Ca2/ binding proteins. For example, the immunodetection of S100B and calmodulin on nitrocellulose membranes is improved by glutaraldehyde fixation (6). On
the other hand, the immunoreactivity of S100B is reduced in tissues fixed for immunocytochemistry (7).
In this study we used hippocampal tissue from rat
brain as a source of these proteins and commercial
monoclonal antibodies to calmodulin, b-calcineurin,
and S100B. As control we used the non-EF-hand protein glial fibrillary acidic protein (GFAP).2 The effect
of Ca2/ on antibody recognition was also investigated
in glutaraldehyde-fixed samples and SDS-denatured
samples and using different blocking media.
Materials and methods. Monoclonal antibodies to
calmodulin (a mixture of clones 2D1, 1F11, and 6D4),
S100B (clones SH-B1 and SH-B4 whose immune recognition is Ca2/ independent and Ca2/ dependent, respectively), calcineurin (clone CN-B), GFAP (clone G-A-5),
and PVP-40 were obtained from Sigma; anti-mouse biotinylated antibody, streptavidin-biotinylated horseradish peroxidase complex, and reagents for detection by
the ECL method were obtained from Amersham International; 0.20 mm nitrocellulose was purchased from
Bio-Rad. Specific immunoreactivity of antibodies was
confirmed by immunoblotting using electrophoresis reagents from Sigma.
Rat hippocampal slices were obtained with a McIlwain chopper regulated to 0.4 mm. Two slices were
homogenized in 1 ml of TBS (20 mM TrisHCl, pH 7.5,
and 500 mM NaCl containing 1 mM EGTA and 1 mM
phenylmethylsulfonyl fluoride) using a Tissue Tearor
(Biospec Products, OK). Protein content of the homogenates was approximately 300 mg/ml. Samples were diluted 1:2 and 1:4 with TBS. Only fresh samples or samples stored at 020C for 1 day were used. In some
2
Abbreviations used: GFAP, glial fibrillary acidic protein; PVP40, polyvinylpyrrolidone, 40,000 Mr ; ECL, enhanced chemiluminescence; TBS, Tris-buffered saline; BSA, bovine serum albumin.

experiments samples were prepared in TBS containing

1% SDS.
Nitrocellulose membranes were rinsed for 5 min in
distilled water and air dried immediately before use
(8). Volumes (0.3 ml) of 1:1, 1:2, and 1:4 dilutions of the
samples (corresponding to 100, 50, and 25 ng of protein,
respectively) were applied on membranes using a fine
pipet tip. For protein fixation membranes were wetted
with 1 mM EGTA or 1 mM CaCl2 in TBS for 10 min
after which they were immersed for 30 min in freshly
prepared 0.2% glutaraldehyde in TBS at room temperature. Finally, membranes were rinsed in distilled water for 1 min.
Nitrocellulose membranes were blocked for 3 h or
overnight with 1% PVP-40 in TBS containing 0.05%
Tween 20 (1% PVP/T-TBS). Antibody incubation was
carried out in 1% PVP/T-TBS in the presence of 1 mM
CaCl2 or 1 mM EGTA. In the case of aldehyde-fixed
samples 1% PVP/T-TBS without the addition of EGTA
or Ca2/ was used for antibody incubations. Antibody
dilution was 1:1000 for anti-calcineurin and 1:500 for
other antibodies. Some experiments were done using
5% nonfat dried milk powder in TBS or 1% BSA in TTBS as diluent/blocker during incubation with antibodies. Between incubations membranes were washed
with T-TBS (13 for 10 min). Incubations with secondary antibody (anti-mouse biotinylated, 1:500) and with
streptavidinperoxidase complex (1:3000) were carried
out in 1% PVP/T-TBS for 1 h. Membranes were then
washed for 1 h (14 for 10 min with T-TBS and 12 for
10 min with TBS). Membranes were developed according to the protocol recommended by Amersham. To
be certain that two membranes could be compared they
were immersed simultaneously for 1 min in the ECL
reagent by securing the corners of both membranes
with fine-tipped forceps. We found that even a few seconds of difference during immersion prejudiced the
quantitative comparison of different membranes. In
some experiments immunoreactivity was quantified by
densitometry, using peak height rather than peak area
as a measure of intensity.
Results and discussion. Instead of purified proteins
we used a fresh homogenate of brain tissue as a source
of Ca2/ binding proteins since Ca2/ binding may be
affected by the presence of other proteins in the sample
(9). We found that the immunoreactivity of calmodulin
and calcineurin in unfixed samples was increased in
the presence of Ca2/ (Figs. 1a1c) and that of calcineurin was preserved in samples prepared in 1% SDS
(Fig. 1c). In the case of S100B, Ca2/ had no effect on
its detection by anti-S100B using clone SH-B1 (Fig. 1d)
but was sensitive to Ca2/ using clone SH-B4 (Fig. 1e).
Interestingly, the SH-B1 clone occasionally reacted
with purified S100B from bovine brain in a Ca2/-dependent manner, but this result was not consistent (data

NOTES & TIPS

FIG. 1. Calcium-dependent immunoreactivity of calmodulin, calcineurin, and S100B. Samples of hippocampal homogenates prepared
from rat brain (at dilutions 1:1, 1:2, and 1:4) were spotted on nitrocellulose and immunodetected using anti-calmodulin (a), anti-calcineurin-b (b and c), anti-S100B (clone SH-B1) (d), anti-S100B (clone
SH-B4) (e), and anti-GFAP (f). In c, samples were prepared in the
presence of 1% SDS. The plus and minus signs indicate incubations
with antibodies in the presence of 1 mM EGTA or 1 mM CaCl2 , respectively. CaM, calmodulin; CaN(b), b-subunit of calcineurin.

not shown). Ca2/ did not affect the immunoreactivity

of GFAP (Fig. 1f). Quantitation by densitometry of the
effect of Ca2/ is shown in Table 1.
In the absence of Ca2/ the immunoreactivity of calmodulin, S100B (clone SH-B4), and b-calcineurin was
increased after glutaraldehyde fixation (Table 1). However after fixation, the Ca2/-dependent increment in
immunoreactivity seen in unfixed samples was absent
in the case of S100B and calmodulin and lower in the
case of calcineurin (Table 1).
Considering that factors present during incubation
with antibodies could modify Ca2/-dependent immune
recognition, we compared the immunoreactivity of bcalcineurin in three blocking/diluent agents commonly
used in immunodetection: PVP-40 (10), nonfat milk
powder, and BSA (11). Tween 20 was present during
incubations and washing steps at a concentration of
0.05% (v/v). In the presence of Ca2/ the immunoreactivTABLE 1

Ca2/-Dependent Immunoreactivity of Calmodulin,

b-Calcineurin, and S100B in Unfixed and Fixed Samples
Unfixed
Protein

Control

S100B (4)
Calcineurin (7)
Calmodulin (6)

100
100
100

/Ca

Fixed
2/

323 { 37**
596 { 40*
173 { 11*

Control

/Ca2/

187 { 13**
154 { 15*
157 { 12**

244 { 14*
367 { 22*#
155 { 8*

Note. Values are group means { standard error of peak heights

of triplicate dots determined by densitometry and expressed as the
percentage of unfixed controls normalized to 100%. Samples were
fixed on membranes in the presence of 1 mM EGTA or 1 mM Ca2/
as described in the text. Control incubations for unfixed samples
contained 1 mM EGTA. All antibody incubations for fixed samples
were done in PVP/T-TBS without addition of Ca2/ or EGTA.
Values marked with * or ** are significantly different from the
unfixed controls. The value marked with # is significantly different
from the corresponding fixed control. In the case of S100B the values
for the fixed control and fixed /Ca2/ incubations are not significantly
different. The number of separate experiments is given in parentheses. Significance was calculated by ANOVA and Duncans test.
**P 0.05, *P 0.01, #P 0.01.

129

FIG. 2. Immunoreactivity of calcineurin in different media during

incubation with antibodies. Three dilutions of the hippocampal homogenates (1:1, 1:2, and 1:4) were spotted on nitrocellulose membranes. The membranes were blocked with 1% PVP-40 and incubated
with anti-calcineurin in 1% PVP-40, 5% nonfat milk, or 1% BSA, all
prepared in TBS with 1 mM CaCl2 or 1 mM EGTA (PVP-40 and BSA)
or 50 mM EGTA (nonfat milk). (aThe free Ca2/ in the milk medium
was not determined and it is probable that 50 mM EGTA was insufficient to chelate all of it.)

ity of b-calcineurin was qualitatively similar regardless

of blocking reagent used (Fig. 2). In the absence of Ca2/
immunoreactivity using PVP-40 or BSA was qualitatively the same and less than with Ca2/ present. In the
case of 5% milk no difference in immunoreactivity was
observed under the two conditions, presumably because the concentration of EGTA (50 mM) used to chelate the free Ca2/ was insufficient. It is noteworthy
that when milk was used as the blocking agent the
immunoreactivity of all examined proteins was lower
than that observed with PVP-40 or BSA as blocking
agents (data not shown). A similar result has been described in other studies (12, 13).
Since Ca2/-induced conformational change in proteins bound to nitrocellulose may be restricted, it is
theoretically possible that our results underestimated
the dependence of antibody binding on Ca2/. However,
in a few preliminary experiments with homogenates
prepared in the presence or absence of Ca2/, the results
were similar to those reported here. Moreover, our procedure avoids the possibility that the binding of the
proteins to nitrocellulose depended on their Ca2/ status, particularly since we were studying proteins whose
hydrophobicity changes in the presence of Ca2/. It will
be of interest in future work to use epitope mapping of
these antibodies to determine the relation of the recognition sites to Ca2/ binding domains, as was done by
Winsky and Kuznicki (1) for calretinin.
Conclusions. The immunoreactivity to commercial
monoclonal antibodies of the Ca2/-modulated proteins
calmodulin and S100B and of the b-subunit of calcineurin in homogenates of hippocampal tissue from
rat brain was increased in the presence of Ca2/. Fixation of the tissue with glutaraldehyde also increased
the immunoreactivity of these proteins in the absence
of Ca2/, but sensitivity to Ca2/ was only preserved in
the case of calcineurin. These results extend the work
of Winsky and Kuznicki (1) and further emphasize that
caution is needed in interpreting the results of immunochemical studies both of proteins that bind Ca2/ and

130

NOTES & TIPS

of proteins whose Ca2/ binding status is unknown. Simple dot immunobinding assays can be useful in determining the Ca2/ dependence of the immunoreactivity of proteins.
Acknowledgments. This work was supported by the Brazilian
funding agencies PRONEX, CNPq, FAPERGS, FINEP, and PROPESP and the European Commission (Grant CI1*-CT94-0116).

REFERENCES
1. Winsky, L., and Kuznicki, J. (1996) J. Neurochem. 66, 764771.
2. Picone, C. M., Grotta, J. C., Earls, R., Strong, R., and Dedman,
J. (1989) J. Cereb. Blood Flow Metab. 9, 805811.
3. Buwalda, B., Naber, R., Nyakas, C., and Luiten, P. G. M. (1994)
Dev. Brain Res. 78, 210216.
4. Barrit, G. J. (1992) in Communication within Animal Cells (Barrit, G. J., Ed.), p.192, Oxford Science, Oxford.
5. Kakalis, B., Kennedy, M., Sikkink, R., Rusnak, F., and Armitage,
I. M. (1995) FEBS Lett. 362, 5558.
6. Van Eldik, L. J., and Wolchok, S. R. (1984) Biochem. Biophys.
Res. Commun. 124, 752759.
7. Yang, Q., Hamberger, A., Hyden, H., Wang, S., Stigbrand, T.,
and Haglid, K. G. (1995) Brain Res. 696, 4961.
8. Jahn, R., Schiebler, W., and Greengard, P. (1984) Proc. Natl.
Acad. Sci. USA 81, 16841687.
9. Olwin, B. B., and Storm, D. R., (1985) Biochemistry 24, 8081
8086.
10. Haycock, J. W. (1993) Anal. Biochem. 208, 397399.
11. Baldo, B. A. (1994) Adv. Electrophoresis 7, 407478.
12. Spinola, S. M., and Cannon, J. G. (1985) J. Immunol. Methods
81, 161165.
13. DenHollander, N., and Befus, D. (1989) J. Immunol. Methods
122, 129135.

Separation of Microsatellite Fragments

on Small Precast Polyacrylamide Gels
and Visualization by Silver Staining1
Y. A. Luqmani,*, M. Mathew,* L. Temmim,
and S. Al-Bustan
*Faculty of Allied Health and Faculty of Science, Kuwait
University, and Kuwait Cancer Control Center, Kuwait
Received July 17, 1997

Recently, polymorphic trinucleotide repeat sequences

have been found within exonic regions of genes implicated in several inherited neurodegenerative disorders,
and it was observed that the number of these repeats
had expanded in diseased individuals (1). Subsequently, many reports have appeared describing so1
Key Words: microsatellites; polyacrylamide gel electrophoresis;
silver staining.

ANALYTICAL BIOCHEMISTRY
ARTICLE NO.

253, 130132 (1997)

AB972345

0003-2697/97 $25.00
Copyright 1997 by Academic Press
All rights of reproduction in any form reserved.

matic instability in microsatellites in human cancers

(2), thought to be as a consequence of polymerase slippage resulting in replication error. These changes involve expansion and/or contraction of just a few repeats
and can be detected by PCR amplification using primers flanking the region containing the repeat sequence.
Tumor and constitutive DNA from each individual is
compared with respect to PCR fragment sizes which
may differ by only a few bases.
The most commonly used procedure is to label PCR
products using either 32P-end-labeled primer or 32P-labeled deoxynucleotide followed by separation on 68%
denaturing sequencing gels that may be up to 3040
cm in length. Gels are then dried and exposed one or
more times to X-ray film. This is a fairly tedious procedure and involves handling of radioactive materials.
In laboratories fortunate enough to have access to an
automated DNA sequencer, band sizes of fluorescently
labeled products are determined by computer analysis.
This allows a much higher throughput in a shorter
time. However, such facilities are not widely available
and most laboratories use more cumbersome manual
techniques. Therefore, in order to simplify microsatellite analyses, we have developed a method using precast polyacrylamide gels which are supplied in a dehydrated form. These can be conveniently stored at 4C
and rehydrated in buffer just before use. The DNA
bands can be subsequently visualized using a 90-min
silver staining method. DNA was extracted from normal and malignant cells from paraffin sections of breast
tissue from cancer patients. Using primers flanking a
CTG repeat in the 3 untranslated region of the myotonin gene, we amplified fragments ranging in size
from 128 to 176 bp which included 521 CTG repeats.
As described previously (3), single 5-mM sections were
deparaffinized in clearing agent and washed in alcohol;
DNA was then extracted from the tissue by incubation
in 100 ml of a buffer containing 50 mM TrisHCl, pH
8.5, 1 mM EDTA, 0.5% Tween, and 200 mg/ml proteinase K at 55C for 34 h or until the tissue was completely dissolved. After heating to 95C for 510 min,
12 ml of this extract was added directly into a 50-ml
PCR mix containing 10 mM TrisHCl, pH 8.3, 50 mM
KCl, 2 mM MgCl2 , 400 mM dNTP mix, 200 ng DM primers (5 CTTCCCAGGCCTGCAGTTTGCCCATC 3 and
5 GAACGGGGCTCGAAGGGTCCTTGTAGC 3) (4),
and 1 unit AmpliTaq (PerkinElmer). After an initial
incubation at 94C for 3 min, a 40-cycle amplification
was performed, with denaturation at 94C for 20 s,
annealing at 62C for 10 s, and extension at 72C for
20 s, with a final extension for 10 min.
During this time, a dehydrated GeneGel Clean 15/
24 gel (Pharmacia) was rehydrated for 2.5 3 h in 13
ml of supplied gel buffer containing 7 M urea. This
is longer than the recommended time; we found it
necessary, probably as a consequence of the presence