Mol Gen Genomics (2006) 275: 217230

DOI 10.1007/s00438-005-0082-8

O R I GI N A L P A P E R

Fadi Basmaji Hele`ne Martin-Yken Fabien Durand

Adilia Dagkessamanskaia Carole Pichereaux
Michel Rossignol Jean Francois

The interactome of the Knr4/Smi1, a protein implicated in coordinating

cell wall synthesis with bud emergence in Saccharomyces cerevisiae
Received: 2 September 2005 / Accepted: 17 November 2005 / Published online: 16 December 2005

Springer-Verlag 2005

Abstract The integrity of the Saccharomyces cerevisiae

cell wall requires a functional Pkc1Slt2 MAP kinase
pathway that contributes to transient growth arrest,
enabling coordination of cell division with cell wall
remodelling. How this coordination takes place is still an
open question. Recently, we brought evidence that Knr4
protein, whose absence leads to several cell wall defects,
may play a role in this function. Here, we show that
Knr4 is a monomeric protein that exhibits an aberrant
mobility on a SDS-gel electrophoresis and a non-globular structure. Furthermore, Knr4 is an unstable protein
that is degraded as cells enter the stationary phase of
growth, while its corresponding gene is constitutively
expressed. In exponentially growing cells on glucose,
Knr4 appeared to be present in a protein complex that
migrates with an apparent Mw superior to 250 kDa.
Using the TAPtag methodology, nine potential partners of Knr4 were identied, which could be distributed
into three biological processes. A rst group consisted of
Slt2 and Pil1, two proteins dedicated to cell wall maintenance and biogenesis. The second group comprised
four proteins (Bud6, Act1, Cin8 and Jnm1) implicated in
the establishment of cell polarity and bud integrity
during mitosis. The last group contained four proteins
(Asc1, Ubc1, Hsc82 and Gvp36) that probably deal with
the stability/degradation of proteins. Deletion analysis
revealed that the domain of interaction covered 2/3 of
Communicated by S. Hohmann
F. Basmaji H. Martin-Yken F. Durand
A. Dagkessamanskaia J. Francois (&)
Laboratoire de Biotechnologie et Bioprocedes,
UMR-CNRS 5504 & INRA 792,
135, Avenue de Rangueil,
31077 Toulouse Cedex 04, France
E-mail: fran_jm@insa-toulouse.fr
Tel.: +33-5-61559492
Fax: +33-5-61559490
C. Pichereaux M. Rossignol
Proteomics Platform Toulouse Genopole,
IFR40, Castanet-Tolosan, France

the Knr4 sequence on the N-terminal side. Moreover,

the replacement of the two in vivo phosphorylated Ser200
and Ser203 by alanines led to a mutated protein with
reduced protein interactions and a weaker complementation ability towards knr4 null mutant phenotypes.
These results together with previous data from genome
scale two-hybrid and synthetic interaction screens support the notion that Knr4 is a regulatory protein that
participates in the coordination of cell wall synthesis
with bud emergence, and that this function may be
modulated by phosphorylation of this protein.
Keywords KNR4/SMI1 Protein interaction
TAPtag Two-hybrid Cell wall Signalization

Introduction
Yeast cells are surrounded by a thick cell wall that
delineates its shape, and provides mechanical and osmotic protection. Under normal growth condition (rich
glucose medium), the yeast cell wall is composed (in
percent per dry mass) of 5060% of b-1,3/b-1,6 glucan,
4050% mannoproteins and 13% chitin, but the relative proportions of these polysaccharides vary according
to growth conditions and developmental programs (Klis
1994; Klis et al. 2002). The biogenesis of the cell wall is a
highly complex process whose regulation occurs at the
transcriptional and post-translational levels, and implies
spatial and temporal localization of cell wall-related
proteins for precise deposition of cell wall components
and their cross-linking. It is estimated that about 1,200
genes participate directly and indirectly in the synthesis
and the organization of the Saccharomyces cerevisiae cell
wall (Klis 1994; Lesage et al. 2004).
In yeast, the PKC1SLT2 MAP kinase module is
considered as the main signalling pathway essential for
the proper cell wall construction in order to prevent cell
lysis. This MAP kinase module consists of a succession
of four protein kinases, starting with the Pkc1, the yeast
homologue of the protein kinase C and ending with the

218

MAP kinase encoded by SLT2/MPK1 (Heinisch et al.

1999; Levin 2005). A multiplicity of stimuli such as heat
and hypo-osmotic shock, actin depolymerization, caffeine, zymolyase, etc., triggers the activation of the Slt2/
Mpk1 kinase via sensing by specic cell wall sensors that
impact at dierent levels of the module and lead to the
activation of the Slt2 by its dual phosphorylation on
threonine190 and tyrosine191 (Martin et al. 2000). The
activated Slt2/Mpk1 kinase enters the nucleus and induces the transcription of genes that promote cell wall
remodelling through activation of the transcription
factor Rlm1, and contributes to cell cycle transient arrest
via activation of the Swi4 element of the SBF complex
factor (Harrison et al. 2001). Very recently, we brought
an additional element to this regulatory cascade by
showing that the Knr4/Smi1 protein is necessary for the
correct targeting of the Slt2 MAP kinase to its two
known downstream transcriptional targets, Rlm1 and
Swi4 (Martin-Yken et al. 2003).
Killer nine resistant 4 (KNR4) was originally isolated
by complementation of a mutant hyper resistant to the
killer toxin HM-1 from Hansenula Mrakii (Hong et al.
1994), whose cytocidal eect was due to the release of
cellular components through formation of pores at the
tip of growing buds (Takasuka et al. 1995). Later, it was
isolated as a suppressor of several Calcouor White
hypersensitive mutants (Martin et al. 1999). The same
gene called suppressor of matrix-association region
inhibition (SMI1) was also isolated in a genetic screen
looking for clones that can release inhibition of LacZ
expression driven by a GAL1 promoter due to the
presence of a mouse matrix-associated region (MAR)
sequence, and thus turned dark blue on X-GAL agar
plate (Fishel et al. 1993). This is now explained by the
fact that loss of this gene leads to high permeability of
yeast cells to this chromophore (Hong et al. 1994;
Martin et al. 1999). Other phenotypes caused by loss of
KNR4 function were a 50% reduction of b-glucan synthase activity and of b-glucan levels, hypersensitivity to
caeine, SDS, Congo red, Calcouor white, caspofungin, cercosporamide, and arrest of growth with a small
bud at temperature above 37C (Fishel et al. 1993;
Martin et al. 1999; Hong et al. 1994; Markovich et al.
2004). KNR4 encodes a 505 amino acids sequence that
contains ve putative PEST domains as well as several
potential site for protein phosphorylation. These data,
together with the fact that this protein is localized near
the presumptive bud site in unbudded cells and at the
mother-bud neck in budded cells, provided evidence for
a role of Knr4 in cell wall synthesis and probably in bud
formation (Martin et al. 1999). Additional work in our
laboratory furthermore led to the proposal that Knr4
plays a role in coordinating cell wall assembly with cell
growth by means of genetic interaction with Bck2, a
protein required at the G1 to S phase transition in the
absence of G1 cyclins (Martin-Yken et al. 2002), and by
physical interaction with the Slt2 MAP kinase (MartinYken et al. 2003). However, large-scale synthetic genetic
arrays analyses (SGA) seeking for synthetic lethal

interactions with knr4 null mutation expanded the network of KNR4 interactions, implicating this gene in
more than 80 synthetic interactions that were distributed
in many cellular functions including cell wall synthesis
(the highest number of partners), chromosome segregation and polarized growth, signal transduction, transcription and spores formation (Tong et al. 2001; Lesage
et al. 2004, 2005).
These results raised the intriguing question of how
Knr4 can be implicated in so many diverse cellular
functions. One possibility is to suggest that this protein
is part of a multiprotein complex that may exert its
function through proteinprotein interactions. Therefore, the purpose of this study was to identify the partners that physically interact with Knr4 in exponentially
growing yeast cells using the TAPtag strategy (Rigaut
et al. 1999; Puig et al. 2001), and to combine these results
with previous data obtained from two-hybrid and synthetic lethality approaches as well as with data concerning proteins localization and abundance in the cell.
In addition, domains of the Knr4 protein that interact
with putative in vivo partners were characterized, and
the physiological function of the in vivo phosphorylated
serine residues on Knr4 (Ficarro et al. 2002) was assessed. Altogether, our results consolidated our initial
proposal that Knr4 is a key component in the cell
machinery that participates in the coordination between
cell wall synthesis and bud emergence during mitosis.

Materials and methods

Yeast and bacteria strains, media and growth conditions
The strain AR27 (Mata ura352) was used as the recipient to express the TAPKnr4 fusion protein, HM10
(Mata ura352 knr4::KanR) for complementation analysis with dierent KNR4 plasmid constructs. Growth
media were prepared according to Rose et al. (1990).
Unless specied, cell growth was carried out at 30C and
followed by measurement at OD600. Sensitivity assays to
cell wall drugs (Calcouor white, Congo red, SDS, caffeine, sorbic acid) were carried out as described elsewhere (Martin et al. 1999; Page et al. 2003; Kren et al.
2003). Escherichia coli DH5a strain was used for plasmid
amplication, and BL21 strain for heterologous
expression of MBPKnr4 (Dagkessamanskaia et al.
2001) and Knr4DC-(His)6 protein fusion. This latter was
made using primers sense KNR4 BamHI: GTTAACGGATCCATGGATCTATTCAAAAGAAAAGTT and
antisense KNR4 1188 HindIII: AAGCTTTTGAACAGATTGTACATCTGCACT. The PCR product was
then cloned in pET21a digested by BamHI and HindIII.
Oligonucleotides and plasmids constructs
Plasmids and primers used in this study are listed in
Tables 1 and 2, respectively. DNA fragments of KNR4

219
Table 1 Plasmids used in this study
Nom

Description

Source

pBS1539
POBD80
PKNR4BD
POBD80KNR4-D
POBD80KNR4-F
POBD80KNR4-C
POBD80KNR4-A
POBD80-KNR4-B
PGAD424
pGal4aTYS1
pGal4aCIN5
pGal4aSLT2
pGal4aBCK2
pGal4aRLM1
pGal4a-PDA1
pHM38
pFB1

TAP-tag plasmid containing K. lactis URA3 marker

Gal4 binding domain-containing plasmid for two hybrid system
KNR4 ORF fused to Gal4 binding domain, in pOBD80
KNR4 (1253) fused to Gal4 binding domain, in pOBD80
KNR4 (122378) fused to Gal4 binding domain, in pOBD80
KNR4 (122505) fused to Gal4 binding domain, in pOBD80
KNR4 (247505) fused to Gal4 binding domain, in pOBD80
KNR4 (372505) fused to Gal4 binding domain, in pOBD80
Gal4-activating domain containing plasmid for two-hybrid system
TYS1 ORF fused to Gal4 activating domain, in pGAD424
CIN5 ORF fused to Gal4 activating domain, in pGAD424
SLT2 ORF fused to Gal4 activating domain, in pGAD424
BCK2 ORF fused to Gal4 activating domain, in pGAD424
RLM1 ORF fused to Gal4 activating domain, in pGAD424
PDA1 ORF fused to Gal4 activating domain, in pGAD424
2,95 kb XbaSpeI KNR4 fragment cloned in pRS316
Deletion of Knr4 (598600, 607609) constructed by
site-directed mutagenesis
Centromeric vector with URA3 marker

Rigaut et al. (1999)

Louvet et al. (1997)
Dagkessamanskaia et al.
This study
This study
This study
This study
This study
Amersham
Dagkessamanskaia et al.
Dagkessamanskaia et al.
Martin et al. (2000)
Dagkessamanskaia et al.
Watanabe et al. (1995)
This study
Martin et al. (1999)
This study

pRS316

were obtained by PCR amplication of the KNR4 ORF

and cloned in the BamHI and PstI sites of pOBD80
(Louvet et al. 1997). The pGADPDA1 was constructed
by PCR amplication of the PDA1 using the primers
p16 and p17 (Tables 2, 3), and cloned in the EcorI +
PstI sites of the plasmid pGAD424. Other plasmids and
two-hybrid constructs have been previously described
elsewhere (Dagkessamanskaia et al. 2001; Rajavel et al.
1999). For the RT-PCR experiment, primers specic for
KNR4 and all other genes were designed using Beacon
Designer 2.0 software. All primers used for the real time
quantitative RT-PCR are listed in Table 3.

(2001)

(2001)
(2001)
(2001)

Sikorski and Hieter (1989)

Real-time quantitative (RT-Q) PCR

Total RNA was extracted from yeast cells as described
by Hauser et al. (1998), using RNeasy Mini Kit (Qiagen), and veried for purity and concentration using an
Agilent 2100 Bioanalyser (Agilent Technologies). One
microgram of total RNA was transcribed into cDNA in
a 20 ll reaction using iScript cDNA synthesis kit (BioRad). The reaction was incubated at 25C for 5 min,
then at 42C for 30 min, and nally at 85C for 5 min.
The mRNA levels were analysed by quantitative RTPCR using Bio-Rad MIQTM Real-time PCR system.

Table 2 Primers used in this study

Name

Sequence

Utilization

Pr knr4-S-BamHI
Sense Knr4-1117
Antisense Knr4-1135
Sense Knr4-367
Antisense Knr4-385
Sense Knr4-742
Antisense Knr4-760
Pr knr4-AS-PstI-end
P1 NdeI-TAP
KNR4 BamHI
KNR4-HindIII
P2 ApaI-TAP
P3 QF-TAP

Progressive deletion of KNR4

Progressive deletion of KNR4
Progressive deletion of KNR4
Progressive deletion of KNR4
Progressive deletion of KNR4
Progressive deletion of KNR4
Progressive deletion of KNR4
Progressive deletion of KNR4
Construction of TAPtag plasmid
Construction of Knr4-(His) tag
Construction of Knr4-(His) tag
Construction of TAP
Construction of TAP

P13

GGATCCTGGATCTATTCAAAAGAAAAGTT
CGGGATCCAGCCTTCTACCCTCAACG
AACTGCAGCGTTGAGGGTAGAAGGCTG
CGGGATCCACGCAGAGGAAGACTTGG
AACTGCAGCCAAGTCTTCCTCTGCGTG
CGGGATCCATATCGGTGTTGACTTGG
AACTGCAGCCAAGTCAACACCGATATG
ATCTGCAGAAGCTATATTTTCAAATTCTTC
CATATGAATATCACAATTAACATTCTACAAC
GTTAACGGATCCATGGATCTATTCAAAAGAAAAGTT
AAGCTTTTGAACAGATTGTACATCTGCACT
GGGCCCACTAGTAGTATTTATTTTCTTTTTTTA
GATGATGCTAAAGTGGAAGAAGCGAGAGAAGAATT
TGAAAATATAGCTTTATCCATGGAAAAGAGAAG
GTCTTTCCATGGCTGAAGAGGCGCCAGTAGATGT
AACATGGGATAAACC
ACGGAGTCAAACGATGGTGTCTC

P14

CGCTAAAGTAGTCGTCATTGTCATCTACT

P12

ATCTACTGGCGCCTCTTCAGCCATGGAAAGACTAAA
TGGTAACAAGTTCAAAC
GAGAATTCATGTTTGTCGCACCTGTATCTTCACAA
GACTGCAGATCCCTAGAGGCAAAACCTTGCTTTTTGAA

P15

Pr sense PDA1 (EcorI)

Pr reverse PDA1 (PstI)

Mutation in the phosphorylation

site of KNR4
Mutation in the phosphorylation
site of KNR4
Mutation in the phosphorylation
site of KNR4
Mutation in the phosphorylation
site of KNR4
Two-hybrid system test
Two-hybrid system test

220
Table 3 Primers used for the
real-time quantitative RT-PCR

Name

Sequence

KNR4_QPCR_F
KNR4_QPCR_R
PDA1_QPCR_F
PDA1_QPCR_R
RPN2_QPCR_F
RPN2_QPCR_R
UBC6_QPCR_F
UBC6_QPCR_R
GSY2_QPCR_F
GSY2_QPCR_R
ACT1_QPCR_F
ACT1_QPCR_R

CGGTACTTCTGGCTTGTTTTATGGCTTCC
GATCTGGGATATTTGGCAGTTTGAACTTGTTAC
CAGGCTTCTATGGTGGTAATGGTATCGTG
GCAGGCGTCCTCGTTCTTGTATTGG
CGATGATGTCAGAAGGGCAGCAGTC
GGCACAAGCAATCCCAAGAGCAAATG
GGACCTGCGGATACTCCTTACAAG
GGGTGGTAATCACTCATAGAAAGGCATAATCG
TGCCCAGTATAAAGACCATTACCACTTGATAGG
GCACCTTCAATCAGCCACCTCCCATAAAC
TATCGTCGGTAGACCAAGACACCAAGG
ACTCTCAATTCGTTGTAGAAGGTATGATGCC

Each sample was tested in duplicate in a 96-well plate

(Bio-Rad, CA, USA), in a 25 ll reaction volume using
the iQ SYBR Green supermix kit (Bio-Rad). The 25 ll
reaction volume consisted of 12.5 ll of SYBR Green
supermix, 2.5 ll of 2.5 lM forward primer, 2.5 ll of
2.5 lM reverse primer, 2.5 H2O and 5 ll of 1/10 dilution
of cDNA. The (Q-RT-PCR) thermocycling program
consisted of one hold at 95C for 4 min, followed by 40
cycles of 10 s/95C, 45s/56C. The PCR eciency of
each primer pair (KNR4, GSY2, RPN2, UBC6, ACT1
and PDA1) was checked by serial dilution of the template cDNA and the melting curve data were collected to
verify the PCR specicity. KNR4 and GSY2 expression
levels were calculated using ACT1, PDA1, RPN2 and
UBC6 as references for normalization using the geNorm
software available online at http://www.medgen.ugent.be/%7ejvdesomp/genorm/. ACT1, PDA1,
RPN2 and UBC6 were used as reference for normalization, based on the consideration that their transcript
levels do not change during diauxic growth on glucose
(DeRisi et al. 1997), and GSY2 was used as a positive
gene whose transcript is known to be induced as cells
enter the diauxic shift (Parrou et al. 1999).
Two-hybrid interactions studies
To test for interactions, plasmid pairs [one with the
binding domain (BD) fusion and the other with activation domain (AD) of GAL4] were co-transformed in
PJ69-4A (Mata trp1-901 leu2,3-112 ura3-52 his3-200
gal4Dgal80D LYS2::GAL1::HIS3 GAL2-ADE2 met2::GAL7-lacZ, (James et al. 1996), and the two-hybrid
assays were carried out as described previously (Dagkessamanskaia et al. 2001). The strength of two-hybrid
interaction was quantied by measuring b-galactosidase
activity. Yeast transformants were grown in SC minus
trp- leu- for 24 h at 30C and inoculated in 50 ml of the
same medium at initial OD600 of 0.05. Cells (25 ml) were
collected after ve generations to measure b-galactosidase activity according to Rose et al. (1990). Activity of
b-galactosidase is expressed as nmol of O-nitrophenyl-bD-galactopyranoside (ONPG) hydrolysed per min and
per milligram proteins.

TAP-KNR4 gene fusion and purication of TAP-tagged

Knr4
The FB1 strain was constructed by integration of the
TAPtag double etiquette at the 3-end of KNR4 gene in
AR27 strain. For this purpose, a fragment of 400 bp of
KNR4-UTR was amplied with pr1 and pr2 primers
(Table 1, underlined are the NdeI and ApaI restrictions
sites). The PCR fragment was cloned in pBS1539 (Puig
et al. 2001). A 4 kb fragment from this plasmid was then
amplied with primers pr1 and pr3, which contained a
oating tail homologous to the end of KNR4 that allowed direct recombination at the KNR4 locus in the
yeast genome. The construction was veried by Southern blot and expression of the TAPKnr4 fusion protein
by Western blotting using antibodies anti-Knr4. For
purication of the TAPKnr4, the FB1 strain was cultivated in a 50-l fermentor containing 20 l of YEPD
medium. Cells were harvested in log phase (OD600=3
which corresponded to about 1 g dry mass/l), washed
with cold water and frozen at -80C. About 4 g dry cells
were used for each TAPtag purication, which was
carried out as described in Puig et al. (Puig et al. 2001),
with minor modications. The extraction buer was
IPP-buer (10 mM TrisCl, pH.7.9, 150 mM NaCl,
0.1% Nonidet (NP-40), 0.5 mM DTT, 0.5 mM phenylmethyl sulphonide uoride, 10 lg/ml leupeptin,
10 lg/ml antipain). The cells were lysed in 20 ml of IPPbuer using glass beads (0.5 mm diameter size) in Fast
Prep apparatus (Biospec from Q-Biogen) according to
Gould et al. (2004). After the extraction, the suspension
was diluted three times with the IPP-buer, centrifuged
at 3,000g for 5 min, followed by a second centrifugation
of the supernatant at 27,000g. This last supernatant was
then subjected to the two successive anity chromatography as described in Puig et al. (2001). Samples from
the rst and the second anity chromatography were
run on a 410% SDS polyacrylamide gel. They were
stained with blue colloidal. The visible bands were cut
and digested with trypsin. The tryptic fragments were
subjected to chromatography and tandem mass spectrometry at the proteomic platform of the Toulouse
Genopole. Briey, peptides from digest were separated
and analysed using a Q-TRAPTM (Applied Biosystems/

221

MDS Sciex, Foster City, CA, USA) LC-MS/MS system.

Mass data collected during analysis were processed by
the Analyst software (Applied Biosystems/MDS Sciex)
and the MS/MS lists were used to search the S. cerevisiae
proteome from Saccharomyces Genome Database
(http://www.yeastgenome.org/) using MASCOT search
engine version 2.0. The MASCOT searching parameters
were as follows: one missed cleavage, 0.5 and 0.3 Da
mass accuracy allowed for parent and the fragment ions,
respectively, and oxidized methionine as variable modication. Probability-based MASCOT scores were used
to evaluate protein identications. Only matches with
P<0.05 for random occurrence were considered to be
signicant. As a general rule, the amount of sequenced
peptides per identied protein ranged from 1 to 12 with
an average of 3.

tation was carried out essentially as in Sheu et al. (1998)

using 200 ll of cell lysate (about 4 mg total proteins)
from AR21 yeast strain prepared in KPi-buer (20 mM
NaHPO4 pH 7.2, 20 mM NaCl, 1 mM DTT, 1 mM
PMSF, 10 lg/ml leupeptin, 10 lg/ml antipain) and
centrifuged at 100,000g for 1 h prior to load onto a 4 ml
linear sucrose gradient (520%). Molecular size standards of 200 ll of a mixture containing 2.5 mg/ml of
thyroglobulin (19.4S), catalase (11.3S), aldolase (7.4S)
and serum albumin (4.4S) were run in parallel. Gradient
was centrifuged at 40,000g for 20 h at 4C and aliquot of
175 ll were withdrawn from the top of the tubes by a
peristaltic pump, precipitated by TCA/deoxycholate,
and analysed by Western blotting using anti-Knr4
antibodies as described above.
Other procedures

Site-directed mutagenesis
200

203

Two serine residues (Ser and Ser ) that were found

to be phosphorylated in vivo (Ficarro et al. 2002) were
replaced by alanine residues by recombinant PCR
strategy, using primers p13 and p14 as external primers
as well as primer p15 and primer p12 as internal primers
(NcoI) on pHM38 (Martin-Yken et al. 2002) to yield the
pFB1 (Tables 2, 3). The PCR was performed with the
high-delity Pfu turbo polymerase (Stratagene) and
veried by sequencing (Genome Express S.A., Grenoble,
France).
Gel ltration chromatography and sucrose gradient
velocity sedimentation
To estimate the molecular mass of native Knr4, 3 ml of
crude extract (32 mg total proteins) from AR27 strain
prepared in Buer H (20 mM K-Hepes, pH 7.2,
250 mM KCl, 1.5 mM MgCl2, 1 mM dithiothreitol,
1 mM phenylmethyluoride) was run on 230 cm glass
column packed with Sephacryl S300 resin (Amersham
Pharmacia) equilibrated with ve column volumes with
the same buer. Fractions of 3 ml were collected and
checked at 280 nm for the presence of proteins. An aliquot (300 ll) of each fraction was precipitated by
addition of 30 ll of 100% trichloroacetic acid (TCA)
and 3 ll of 2% sodium deoxycholate (DOC) for 30 min
at 4C. Proteins were collected by centrifugation at
15,000g for 15 min at 4C, washed with acetone and
solubilized in 30 ll of 1 Laemmli sample buer. The
solution was run on a 8% SDS-gel electrophoresis followed by electro transfer on nitrocellulose Hybond N
(Amersham) and Western blotting using anti-Knr4
antibodies as described previously (Dagkessamanskaia
et al. 2001). Calibration curve of the sizing column was
carried out under the same condition using a 2.5 mg ml1
of standard proteins (thyroglobulin, ferritin, catalase,
phosphorylase A, bovine albumin, carbonic anhydrase
and cytochrome c). Sucrose gradient velocity sedimen-

Total proteins in cell lysate were measured by the

Bradford method using bovine serum albumin as a
standard (Bradford 1976). Mass measurement was performed in linear mode by MALDI-TOF mass spectrometry according to published procedures (Karas and
Hillenkamp 1988; Brown and Lennon 1995).

Results
Knr4 is an unstable protein with a partially disordered
structure
As a rst step prior to search for in vivo partners
interacting with Knr4, we veried the abundance of this
protein during growth on glucose by Western-blot using
an anti-Knr4 antiserum (Fig. 1). This experiment revealed the presence of a major band that migrated at a
size of 8085 kDa. The amount of Knr4, which was
estimated as the ratio between the amount of anti-Knr4
that reacted with  85 kDa band and the total amount
of proteins in the yeast extract, steadily decreased during
growth on glucose, to become extremely low in stationary phase cells. Interestingly, this decrease of Knr4
protein contrasted signicantly with the constitutive
expression of the corresponding gene during growth
(Fig. 1b).
Several previous reports indicated that Knr4 had an
aberrant mobility on a SDS-gel electrophoresis (Hong
et al. 1994; Fishel et al. 1993; Martin et al. 1999; MartinYken et al. 2003), but so far, there was no satisfactory
explanation to account for the discrepancy between the
apparent Mw estimated on the gel (>80 kDa) and the
actual Mr of the Knr4 calculated from its amino acids
sequence (57,079 Da). Contrary to the prediction that
this mobility could be due to post-translational modications, such as glycosylation or phosphorylation, we
found that a recombinant Knr4 protein expressed from
a MBPKNR4 gene fusion in E. coli also migrated at an
apparent Mw superior to 80 kDa on the SDS-PAGE

222

(Fig. 2). On the other hand, the molecular mass of a

puried Knr4 protein was 58 kDa, i.e. close to the calculated Mr of 57,079 Da, as determined by MALDI-

TOF spectrometry (Brown and Lennon 1995). According to several reports (Klenova et al. 1997; Iakoucheva
et al. 2001), an aberrant mobility of a protein on SDSPAGE could result from the presence of a highly
charged Glu-rich region. Since Knr4 has 27 Glu residues
within the last 100 residues of its sequence, we created a
Knr4DC-His tagged protein that was truncated for its
last 108 amino acids (among which 36 were acidic residues). Again, as shown in Fig. 2b, the truncated protein
expressed from E. coli migrated at a size of 68 kDa on
the SDS-PAGE, which was still 40% higher than the
calculated molecular mass (47 kDa). The lower bands
visible on the gel (Fig. 2b) were likely due to partial
proteolysis of the recombinant Knr4 during its production or extraction from E. coli. This experiment indicated that the acidic C-terminal region is not the sole
cause of the aberrant mobility of Knr4 on SDS-PAGE.
Another possible reason that does not exclude the
importance of acidic region in this aberrant mobility is
that Knr4 might display intrinsic conformational disorder. Indeed, a link between structural disorder and
aberrant mobility on SDS PAGE has been demonstrated
previously, for example for the XPA DNA repair protein (Iakoucheva et al. 2001). In favour of this suggestion, we found that the bulk of Knr4 eluted on
Sepharose G300 with an apparent molecular mass of
80 kDa (data not shown). Since this method of sizing is
generally accepted for globular proteins, this result
might be an indication that Knr4 does not display a
globular structure under the condition of this experiment. Accordingly, in silico analysis of Knr4 using the
protein globularity prediction software GLOBE
developed by B. Rost (Cubic, Columbia University, and
accessible at http://www.cubic.bioc.columbia.edu/papers/1999_globe/paper.html), pointed to a non-globular
structure for this protein. Furthermore, the DisEMBL
software (Linding et al. 2004; accessible at http://
www.dis.embl.de/), which measures the propensity of

Fig. 2 Western blot analysis of the recombinant Knr4 protein

expressed in E. coli BL21. Bacterial cells were harvested after 4 h of
induction with 1 mM isopropyl b-D-thiogalactopyranoside, lysed in
Laemmli buer. In a, cell lysate was puried on amylose resin
(Biolabs), and the eluted protein (50 lg) was either treated (+) or

not (-) with 5 lg of factor Xa prior to run on a 8% SDS-PAGE

electrophoresis. In b, cell lysate was puried on a high-capacity
chelate N2+ anity matrix (Sigma), and the eluted protein (50 lg)
were run on a 8% SDS-PAGE electrophoresis and then stained
with blue Coomassie

Fig. 1 Relative changes in Knr4 and KNR4 mRNA levels during

growth of yeast on glucose. a The relative abundance of Knr4 was
estimated from immunoblots revealed with anti-Knr4 antibodies
(b), which were scanned by a phosphouoroimager STORM 860
(Molecular Dynamics, USA) and quantied using the software
Image Quant (Molecular Dynamics, Amersham Biotech). The
results were normalized to the total proteins loaded in each lane. c
Transcript levels of KNR4 (open histogram) and GSY2 (black
histogram) quantied by Q-RT-PCR on total RNA extracted as
described in Material and methods

223

protein sequences to be ordered or disordered, revealed

a disordered structure in the sequence of Knr4 from
amino acid residue 383 to the C-terminal end of the
protein. This result was conrmed by another in silico
analysis using NORSp, a predictor of non-regular secondary structure (Liu and Rost 2003; accessible at
http://www.cubic.bioc.columbia.edu/services/NORSp),
which identied a wide region of not helix nor sheet
(NORS) in the same C-terminal region of the protein. As
discussed below, the lack of ordered conformational
structure could be an important advantage for Knr4 to
bind a wide variety of substrates.
Partners of Knr4 identied by the TAPtag strategy
The question as to whether Knr4 is part of a multiprotein complex should be legitimately addressed, since recent high throughput two-hybrid and synthetic lethal
screens revealed a large spectrum of interaction of KNR4
with genes implicated in several cellular functions
including cell wall organization, cell polarity, sporulation and metabolism (Uetz et al. 2000; Ito et al. 2001;
Lesage et al. 2004). We veried this assertion by carrying
out a velocity sedimentation experiment of cell lysate on
a 520% sucrose gradient. Fractions from this gradient
were collected and probed with anti-Knr4 antibodies. As
shown in Fig. 3, two peaks of Knr4 were resolved in the
sucrose gradient. A rst peak had a sedimentation
velocity close to 4.4S, which corresponded to a Mw of
7080 kDa. It probably corresponded to the monomeric
form of Knr4, as obtained by exclusion chromatography

Fig. 3 Velocity sedimentation analysis of Knr4 protein. In a, cell

lysate of the wild-type strain AR27 was prepared as described in
Materials and methods and subjected to centrifugation in a 520%
sucrose gradient. Fractions were collected, run on 8% SDS-PAGE
and subject to Western blotting with anti-Knr4 antibodies (the
immunoblot is shown at the bottom of the gure). Sveberg
coecient (S) values of the markers included in the same gradient
are indicated at the top of the chromatogram. These are
thyroglobulin (19.4S), catalase (11.3S), aldolase (7.4S) and bovine
serum albumin (4.4S)

on Sepharose G300 gel (see above). A second peak was

eluted with a long tail in the range of the velocity sedimentation between 7.4S and 11.4S, which pointed to the
presence of Knr4 in a protein complex with an apparent
Mw in the range of 250350 kDa.
To identify components of multiprotein complexes,
Seraphin and colleagues (Rigaut et al. 1999) developed
the TAPtag method (Tandem Anity Purication),
which in theory allows the simultaneous identication of
proteins interacting with a given target. This technique
consists of two successive anity purications using a
IgG binding domain and a calmodulin binding peptide
separated by a TEV protease cleavage site (the TAP
tag). After integration of the TAPtag in the yeast
genome at the 3end of KNR4, the function of the
resulting encoded TAPtagged protein was found to be
intact since the strain expressing the Knr4TAP protein
showed wild-type phenotype with respect to sensitivity
to cell wall drugs (caeine, Calcouor white and Congo
red, data not shown). Moreover, this strategy enabled
the tagged version of Knr4 to be expressed at the wildtype level in the cell. We then puried the TAPtagged
Knr4 essentially as described by Puig et al. (2001) from
exponentially growing cells (OD600 @ 3), thus at the time
of maximal production of this protein (see Fig. 1a).
Proteins that coeluted with Knr4 during the second
anity chromatography were resolved on a 8% SDSPAGE and stained with colloidal blue reagent. Thirteen
bands clearly visible after coloration were cut from the
gel, digested with trypsin, and subjected to tandem mass
spectrometry fragmentation. As indicated in Table 4, we
identied several cytosolic enzymes and heat shock
proteins. Several of these proteins could be ascribed as
contaminants of the preparation that do not really
interact with Knr4 since (1) their amount per cell is 5- to
20-fold higher than Knr4, as judged from a recent global
analysis of protein expression in yeast (Ghaemmaghami
et al. 2003), and (2) most of these proteins were also
found in mock-transformed control strains (Rigaut et al.
1999; Gavin et al. 2002; Gould et al. 2004, unpublished
data). It is worth noticing that these proteins are systematically found in large TAPtag analysis (see for
instance data available in Cellzome at http://
www.yeast.cellzome.com)
Among the other proteins, several can be considered
as true partners of Knr4 based on high condence limit
settings (P<0.05) and on the presence of at least two to
three unambiguous peptides in the LC/MS/MS runs. To
further reduce falsepositive interactions, only proteins
whose abundance and localization in the cell was similar
to Knr4 were taken into consideration. Based on these
three ltering criteria, we retained nine proteins (Table 5) including Hsc82, the constitutive form of Hsp90
(Zhao et al. 2005). Although this latter is more abundant
than Knr4 in the cell, one could regard Hsp90 as a
putative partner of Knr4, based on the recent nding
that Hsp90 physically interacts with Slt2 (Zhao et al.
2005; Millson et al. 2005), and that Slt2 also shows
strong physical interaction with Knr4 (Martin-Yken

224
Table 4 Contaminating proteins in the TAPtag purication of Knr4TAP
Protein

Biological process or cellular function

Localization

Number of
molecules/cell

Ssa1/Ssa2
Pyk1
Rnr4
Pgk1
Tdh1
Fba1
Adh1
Eno1
Pdc1
Tpi1
Tif1
Tif2

Protein folding; proteinnucleus import, translocation

Glycolysis
Ribonucleotide reductase, DNA replication
Phosphoglycerate kinase, glycolysis
Glyceraldehyde-3-P dehydrogenase, glycolysis
Aldolase, glycolysis
Alcohol dehydrogenase I
Enolase/glycolysis
Pyruvate decarboxylase
Triose isomerase
Translation initiation
Translation initiation

Cytoplasm
Cytoplasm
Cytoplasm/nucleus
Cytoplasm
Cytoplasm
Cytoplasm
Cytoplasm
Cytoplasm
Cytoplasm
Cytoplasm
Cytoplasm
Cytoplasm

269,000
291,000
88,900
31,400
120,000
1,020,000
Not estimated
76,700
89,700
200,700
106,000
Not estimated

et al. 2003, this study). Therefore, it is possible that the

three proteins are present together in a same complex
during certain periods of the yeast life cycle. The presence of Slt2 in the TAPtag experiment was further
validated by Western blotting of an identical SDS-gel
using anti-Slt2 antibody (data no shown).
The nine putative Knr4 interacting proteins identied
in our TAPtag experiment can be assigned to three
main biological processes. The rst category comprises
Slt2 and Pil1, two proteins whose role is directly linked
to cell wall maintenance and biogenesis. Pil1 has been
previously identied by tandem mass spectrometry in
the Slt2 complex isolated by immuno-anity purication using anti-Slt2 antibodies (Ho et al. 2002). In
addition, it was shown that loss of PIL1 leads to a
higher basal and heat-induced phosphorylation of Slt2,
indicating that Pil1 acts to downregulate the activity of
Pkc1Slt2 MAP kinase pathway. Altogether, the interaction between Knr4 and Pil1 is consistent with a regulation of Slt2 activity by these two proteins (MartinYken et al. 2003; Zhang et al. 2004). The four other
proteins (Bud6, Act1, Cin8 and Jnm1) have functions in
cell polarity, bud emergence and spindle pole body orientation during mitosis. The nding of these proteins
copurifying with Knr4 is in accordance not only with
their co-localization at the bud neck during mitosis
(Martin et al. 1999; Huh et al. 2003), but also with their
connective function in cell wall synthesis and budding.
Indeed, Bud6 is a protein that is needed for bud site
selection (Amberg et al. 1997) and interacts both with
Slt2 and Act1. On the other hand, Cin8 is a kinesin-like
motor protein implicated in microtubule dynamics during mitosis, and whose loss of function results in cell wall
defects (Korolyev et al. 2005). Jnm1 is a member of the
dynactin complex, which is involved in a checkpoint that
ensures arrest of the cell cycle in response to a defect in
cell wall synthesis (Suzuki et al. 2004). The third category included three cytosolic proteins, namely Ubc1,
Asc1 and Gvp36. Ubc1 is a ubiquitin-conjugating enzyme that is involved in degrading abnormal or shortlived proteins (Seufert and Jentsch 1990). The presence
of Ubc1 in the Knr4 complex could be consistent with
the fact that Knr4 contains four predicted PEST motifs,

and with the rapid disappearance of this protein during

growth on glucose (see Fig. 1). However, denite proof
that this degradation implies the ubiquitin system awaits
additional work. Asc1 is a 40S ribosomal protein that is
implicated in translation regulation and that shows
synthetic interaction with several cell wall-related proteins including Chs3, Chs5, Knr4, Kre11, Zuo1, and
Krr1 (Lesage et al. 2004). We also identied Gvp36
protein in the TAPKnr4 fraction. This protein has no
established function yet, although it is suspected to be
located in Golgi-ER (Huh et al. 2003).
Association of proteins in a multimeric system should
predict that each partner of this complex may be
implicated in a common function. An indirect manner to
verify this assertion was to examine the phenotype obtained after deletion of genes encoding these proteins.
Accordingly, bud6D, cin8D, jnm1D and asc1D mutants
exhibited a sensitivity to caeine, Calcouor White and
Congo red that was comparable to that of a knr4 null
mutant (Table 6). This was, however, not the case for
gvp36 mutant which behaved as the wild type on these
dierent drugs.
Domains of Knr4 involved in protein interactions
measured by the two-hybrid system
An important aspect regarding Knr4 function was to
delineate the domain of interaction with its partners.
The region of Knr4 that interacts with most of its twohybrid partners was mapped by generating fragments of
the KNR4 ORF, which were cloned in frame of the
GAL4 binding domain in plasmid pOB80 (Fig. 4),
whereas partners were fused to the activating domain of
Gal4. Quantication of these proteinprotein interactions was then assessed by b-galactosidase activity from
the GAL7-lacZ reporter construct in pJ69-4A (Table 7).
In agreement with our previous report (Dagkessamanskaia et al. 2001), the interaction of Knr4 with Tys1 was
by far the strongest, and it was conned to the N-terminal part of the Knr4 protein (residues 1253). Bck2
also showed a strong interaction with the N-terminal
region of Knr4, while, interestingly, the interaction with

225
Table 5 Function and abundance of proteins in the yeast cell that copuried with Knr4 in the TAPtag purication
Proteina

Biological process or cellular function

Localizationb

Number of molecules/cellc

Knr4
Slt2
Bud6
Cin8
Jnm1
Act1
Asc1
Ubc1
Hsp90
Pil1
Gvp36

Cell wall organization and biogenesis

Cell wall organization and biogenesis
Cell polarity and bud emergence
Mitotic spindle organization and cell polarity
Mitotic spindle organization and cell polarity
Cell wall organization, cell polarity, etc
Protein involved in translation regulation
Protein ubiquitination
Chaperone cofactor-dependent protein folding
Process unknown, protein kinase inhibitor
Process unknown

Punctuate in the cytoplasm/bud neck

Bud/nucleus
Cytoplasm/bud neck/cell periphery
Spindle pole body; microtubule
Cytoplasm/spindle pole body
Cytoplasm/bud
Cytoplasm
Cytoplasm
Cytoplasm
Cytoplasm
Cytoplasm/bud neck

5,680
3,230
2,610
2,380
Not estimated
Not estimated
15,500
8,690
32,800
11,500
7,720

Results are from two independent TAPtag purication experiments

Huh et al. (2003)
c
Ghaemmaghami et al. (2003)
b

the whole protein was 2-fold weaker. The domain that

interacts with Slt2 was between residues 122 and 253
while a larger part of Knr4 (residues 122505) was required for the interaction with Pkc1 and Cin5. Finally,
the region between residue 247 and 372 was shown to be
relatively specic for the interaction with Pda1. To
summarize, these results indicate that all known twohybrid interactions with Knr4 map to overlapping regions of the N-terminal and middle part of the protein
and that there is not a single and well-dened domain
responsible for these interactions.
A recent phosphoproteome analysis by mass spectrometry of in vivo phosphorylated proteins in yeast
revealed that Knr4 was phosphorylated in vivo on two
serine residues at position 200 and 203 (Ficarro et al.
2002). These two serine residues in the motif sequence
GSSSSM (underlined are the phosphorylated serine)
appear to be located in a low-complexity region (193
203, predicted by SMART, accessible at http://
www.smart.embl-heidelberg.de/) that could separate
Knr4 into two domains (Fig. 4). We explored the function of the phosphorylation of these two serine residues
in protein interaction by substituting them with two

alanines by site-directed mutagenesis. A Knr4S200A,S203A

variant was thus expressed from a mutant allele of
KNR4 in pOBD80, and this plasmid was used to check
for two-hybrid interactions. As indicated in Table 7, the
interaction of this variant with Tys1 was completely lost,
while it was reduced by 3-fold with Slt2. On the other
hand, the interaction with Bck2 was not signicantly
dierent from that with the native protein. Consistent
with a reduced interaction with Slt2, we found that the
mutated allele of KNR4 poorly restored normal sensitivity to cell wall drugs when expressed from plasmid
pOBD80 in the knr4D mutant (Table 6). Another approach to verify the physiological eect of mutations in
the two phosphorylation sites of Knr4 was to quantify
the Rlm1 transcriptional activity, since we recently
showed that the full transcriptional activity of this
transcription factor required the interaction between
Knr4 and Slt2 (Martin-Yken et al. 2003). To this end,
we used the pHSP100 plasmid that allows measuring the
transcriptional activity of Rlm1 (Kirchrath et al. 2000),
and a transformed knr4D mutant together with this
plasmid in either pHM38 or pFB1, which expressed the
wild-type Knr4 or the mutated Knr4S200A, S203A,

Table 6 Score of phenotypes of yeast mutants deleted from genes whose products were identied in the TAPKnr4 purication
Genotype

Wild type
knr4D
slt2D
bud6D
cin8D
jnm1D
asc1D
gvp36D
Knr4D +pODBKnr4
Knr4D +pODBKnr4a

Drugs or condition of growth

SDS 0.05%

Calcouor
white 25 lg/ml

Congo red
100 lg /ml

Caeine
10 mM

Sorbic acid
1 mM (pH 4.5)

Temperature
38C

+++

+++

+++

+++
++

++

++

++
++
+++
+
+++
++
+

+++
+
+++
+++
++
+
++
+++
+++
+

++
+
++
++
+

+++
+++
+

++
++
+

The wild-type strain was BY4741 and mutant derived from it+++ Normal growth, ++ slow growth, + very slow growth,
Plasmid pODB80 bearing wild type or mutated KNR4 at serine 200 and 203 as were transformed in BY4741

++
++
++
++
++
++
no growth

226

Discussion

Fig. 4 Use of various truncated fragments of KNR4 cloned into

pOB80 (GAL4-binding domain) to reveal domains of Knr4
interacting with partners. The SMART algorithm (http://
www.smart.embl-heidelberg.de/) identies a pseudo coiled-coil
region between residues 423 and 504 of the protein and a lowcomplexity region (residues 198205). The in vivo phosphorylation
sites at serine residues 200 and 203 are shown by crosses. The
dashed box highlights the high probability of conformational
disorder from amino acids 383 to the C-terminal end, as predicted
by DisEMBL (http://www.dis.embl.de/) and NORsp (http://
www.cubic.bioc.columbia.edu/services/NORSp) algorithms

respectively. Contrary to our expectation, we found that

the Rlm1 activity in the knr4D mutant expressing the
Knr4S200A, S203A variant was almost the same as in the
mutant strain expressing the normal protein (data not
shown). This suggested that the 3-fold reduced interaction of the mutated form of Knr4 with Slt2 was still
enough to activate Rlm1. On the other hand, the poor
sporulation eciency observed in a knr4D/knr4D
homozygote diploid (Dagkessamanskaia et al. 2001) was
recovered upon transformation with the mutated Knr4
allele on pODB80, indicating that this phenotype was
not associated with the interaction of Knr4 with Tys1.
Taken together, these results suggested that the phosphorylated form of Knr4 at its two Ser200 and Ser203
residues is required for optimal interaction with its
partners.

Despite previous biochemical and genetic works, the role

of Knr4 in the cell wall synthesis is still poorly understood, although yeast cells lacking this protein exhibit
several phenotypes related to cell wall, growth and
sporulation (Hong et al. 1994; Lagorce et al. 2002;
Martin et al. 1999; Markovich et al. 2004; Fishel et al.
1993; Dagkessamanskaia et al. 2001). In a previous
work, it was speculated on the possible poor stability of
Knr4 due to the presence of ve putative PEST motifs in
its amino acid sequence (Hong et al. 1994). Here, we
provide clear evidence that this protein disappears along
the growth on glucose, and hence this disappearance
could be due to a proteolytic process, although a
blockage of the translational machinery as an explanation of its loss cannot be totally excluded. In accordance
with the existence of PEST sequence, preliminary results
suggest the implication of the ubiquitinproteasome
complex system in the loss of Knr4 (A. Dagkessamanskaia, unpublished data). Nevertheless, this rapid
disappearance of Knr4 is consistent with our initial
proposal that this protein is implicated in the coordination of cell growth with cell wall assembly. Hence,
when yeast cells are no longer budding, this protein does
not need to be active anymore.
Another peculiarity of Knr4 is to exhibit several
features that characterize unfolded or intrinsically disordered proteins. This was not only predicted by in silico
analysis of the protein sequence, but also supported by
the aberrant mobility of this protein on gel electrophoresis under denaturating conditions. These results are
interesting to place in a more general perspective that
contrary to the general belief, the function of a protein is
not necessarily dictated by its three-dimensional structure, but that there is an increasing number of proteins
that lack intrinsic secondary structure, which are involved in regulatory functions including cell signalling,
cell cycle control, transcriptional and translational regulation (Vucetic et al. 2003; Fink 2005). More impor-

Table 7 Two-hybrid interaction between Knr4 domain and protein partners quantied b-galactosidase activity
Prey in pGAD424
(GAL4 activating domain)

Empty
Tys1
Pda1
Cin5
Slt2
Pkc1
Rlm1
Bck2

Bait in pOBD80 (GAL4-binding domain)

pOBD80
empty

Knr4
(1505)

D
(1253)

F
(122253)

C
(122505)

A
(247505)

B
(372505)

Knr4a

5.01.10
9.20.67
7.30.68
203.60
5.70.55
6.20.63
8.51.55
6.51.28

40.74
1041.75
367.8
332.0
441.55
6.40.93
171.55
274.57

31.57
1432.05
42.05
ND
181.10
5.60.50
61.16
5319.45

4.50.35
3.50.65
9.50.10
250.98
363.95
40.75
70.90
62.78

6.50.76
6.70.21
171.90
5732.5
81.20
222.35
91.10
9.82.80

101.04
9.70.65
212.33
152.10
6.50.90
95.28
14.52.20
12.61.10

4.50.81
7.40.56
4.50.88
7.52.67
3.00.40
4.90.77
ND
5.60.35

5.51.10
110.67
9.50.90
133.30
152.50
ND
ND
233.89

Yeast strain PJ69-4A, transformed with pOBD80 + baite and pGAD424 + prey, was cultivated on selective SD leu- trp-medium. Samples
at the log phase (OD600=1) were taken for b galactosidase activity. Values given are the mean SD of three independent experiments.
The dierent Knr4 fragments cloned in pOBD80 are illustrated in Fig. 2
a
Knr4 designed the mutated protein in which serine residues at position 201 and 203 were substituted for alanine

227
Fig. 5 Overlapping of data sets
from synthetic lethal, twohybrid and TAPtag interaction
screens. Out of the 82 genes
synthetic lethal with KNR4
deletion reported by Lesage
et al. (2004), only the ones with
known functions related to cell
wall, morphogenesis,
transcription, and metabolism
are reported in the diagram.
Data from two-hybrid
interaction were from Uetz
et al. (2000), Ito et al. (2001),
Dagkessamanskaia et al. (2001)
and Martin-Yken et al. (2002)

tantly, the lack of intrinsic structure is in many cases

relieved when the protein binds to its target molecule.
Such a disorderorder transition has been nicely illustrated for the human cyclin-dependent kinase (Cdk)
inhibitor p21Waf1/Cip1/Sdi1 upon binding to Cdk2 (Kriwacki et al. 1996). The intrinsic lack of structure may
also give thermodynamic advantages in the binding
process. Also, unstructured domains are present in
proteins that are targeted for rapid destruction (for a
review, see Wright and Dyson 1999; Fink 2005). Work is
ongoing to verify whether Knr4 is a natively unfolded
protein that acquires a specic 3D structure upon
binding to partners or upon changes in the phosphorylation status.
The TAPtag method reported above brought up a
complementary view of the interaction network of
Knr4 that was previously inferred from two-hybrid and
synthetic genetic arrays analysis (Uetz et al. 2000;
Dagkessamanskaia et al. 2001; Lesage et al. 2004). A
summary of the interactome network gained from the
three complementary methods is shown in Fig. 5. The
overlapping was relatively poor as it was limited to a
single protein Slt2, which denitively demonstrates that
Knr4 belongs to the Pkc1Slt2 MAP kinase pathway.
This weak overlapping was expected since each method
does not raise the same issues and is endowed with its
own technical biases (von Mering et al. 2002; Hazbun
et al. 2003). The two-hybrid technique identies physical binary interaction that needs to occur in the nucleus, which is not the natural compartment of most of
the proteins, and the identied interaction may not
necessarily have a physiological setting. This can be the
reason why six out of the ten Knr4 partners found by
this method are nuclear proteins, whose interaction

with Knr4 has no obvious physiological signicance,

except for Bck2 (Martin-Yken et al. 2002) and perhaps
Cin5. Indeed, a recent report indicated that this transcription factor positively regulates expression of chitin
synthases encoding genes (Zakrzewska et al. 2005).
This result could explain our previous data that overexpression of KNR4 led to reduced expression of these
genes (Martin et al. 1999), since excess of Knr4 would
titrate Cin5 into the cytosol and thus reduce the
amount of this protein in the nucleus. The TAPtag
approach seeks also for physical interaction but the
isolated protein complexes may have a physiological
meaning. However, these complexes might be transient
and formed only under certain circumstances. This
could explain the lack of Tys1 in the puried taggedKnr4 fraction, while these two proteins show the
strongest two-hybrid interaction. The complex Knr4
Tys1 probably exists only in ascopores during the
formation of the dityrosine layer (Dagkessamanskaia
et al. 2001). Likewise, the lack of Pda1 in the Knr4
complex puried by TAPtag may be explained by the
localization of Pda1 in mitochondria (Pronk et al.
1996), which were removed by high-speed centrifugation before TAPtag purication. On the other hand,
the systematic genetic arrays analysis is a method
seeking for genetic interaction between two genes that
are functionally associated while usually taking part in
dierent pathways, although their encoded proteins
may also interact physically. This approach is more
exhaustive than the two previous ones because it is
independent on the abundance and on the localization
of the proteins in the cell.
The three independent methods were, however, convergent in highlighting the three major biological pro-

228
Fig. 6 An overview of the Knr4
interactome network taking
into account partners obtained
by two-hybrid (dotted arrow)
and those by TAPtag or
immunoanity purication
obtained from SGD (http://
www.stanford.com) (continuous
arrow)

cesses in which Knr4 is directly involved, namely the cell

wall maintenance, the polarity/bud emergency, and the
cell cycle/mitosis. As indicated in Fig. 6, Knr4 can
operate as a possible linker in the connection between
Slt2-dependent cell wall integrity pathway and the polarisome (Bni1, Bud6, Spa2, Pea2, Rvs167), the function
of which is to promote polarized cell growth by directing
secretion along polarized actin cables (Sheu et al. 1998;
Pruyne and Bretscher 2000). However, this connection
also occurs by other proteins, notably by Spa2, which
could explain why the loss of KNR4 results in a weak
morphogenetic phenotype (Y. Ohya, personal communication, see also SCMD Saccharomyces cerevisiae
morphological database at http://www.yeast.gi.k.u-tokyo.ac.jp/). Moreover, the interaction of Knr4 with
Jnm1, a component of the dynactin complex that was
recently demonstrated as being involved in a checkpoint
that ensures cell wall synthesis and mitosis (Suzuki et al.
2004), suggests a direct contribution of Knr4 to this
process and establishes a physical link between the cell
wall integrity checkpoint pathway and the Pkc1/Slt2
signalling pathway. This hypothesis is supported by the
fact that the Slt2-mediated signalling pathway restores
cell wall synthesis by promoting the activation of a range
of cell wall regulatory genes through the transcription
factors Rlm1 and SBF (Jung and Levin 1999; Madden
et al. 1997), and that this function requires a functional
Knr4 for proper coordination of Rlm1 and SBFdependent genes expression (Martin-Yken et al. 2003).
Overall, this activation in turn overcomes the cell wall
integrity checkpoint and enables the cell cycle progression.

Knr4 may be also implicated in interaction with

metabolic proteins. A connection with the Hog1dependent osmoregulation pathway could be inferred
from the fact that Knr4 interacts with Pda1 and that
this protein was present in a complex isolated by immuno-anity purication using anti-Pbs2 antibodies
(Ho et al. 2002). Also, a role of Knr4 in tyrosine
metabolism, probably dedicated for the synthesis of
the dityrosine layer at the cell surface of the ascopores,
is supported by the synthetic lethality of the double
tyr1 knr4 mutant (Tong et al. 2004), and by the nding
that the two-hybrid interaction of Tys1 (tyrosine
amino acyl tRNA synthetase) with Knr4 is dependent
upon the phosphorylation state of Knr4 at its serine
200, 203
. As a conclusion, this proteinprotein interaction study enabled us to construct the most probable
in vivo interactomic map for Knr4 in vegetative cells.
The next question, that need further biochemical and
biophysical investigations, will be to clarify how and
when these interactions with Knr4 take place in the
cell cycle.
Acknowledgments We thank our colleagues and in particular Dr.
Jean Luc Parrou for his help with RT-PCR experiments. We are
grateful to M. Crouzet (LBMS, Bordeaux, France), J. Heinisch
(University of Osnabruck, Germany ), K. Matsumoto (Nagoya
University, Japan) and M. Molina (CSIC, Facultad de Farmacia,
Madrid) for kind provision of yeast strains and plasmids. We also
thank Miss Faubladier for helping us with the sucrose gradient
experiment in Fig. 2. This work was supported in part by grants
(QLK3-CT2000-01537) from the European Commission Framework Program and from Fonds de Recherche Hoechst Marion
Roussel (FRHMR2/9922) to JF. F.B. holds a pre-doctoral grant
from Syrian Ministry of Research and Education.

229

References
Amberg DC, Zahner JE, Mulholland JW, Pringle JR, Botstein D
(1997) Aip3p/Bud6p, a yeast actin-interacting protein that is
involved in morphogenesis and the selection of bipolar budding
sites. Mol Biol Cell 8:729753
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding. Anal Biochem 72:24854
Brown RS, Lennon JJ (1995) Mass resolution improvement by
incorporation of pulsed ion extraction in a matrix-assisted laser
desorption/ionization linear time-of-ight mass spectrometer.
Anal Chem 67:19982003
Dagkessamanskaia A, Martin-Yken H, Basmaji F, Briza P,
Francois J (2001) Interaction of Knr4 protein, a protein involved in cell wall synthesis, with tyrosine tRNA synthetase
encoded by TYS1 in Saccharomyces cerevisiae. FEMS Microbiol Lett 200:5358
DeRisi JL, Iyer VR, Brown PO (1997) Exploring the metabolic and
genetic control of gene expression on a genomic scale. Science
278:680686
Ficarro SB, McCleland ML, Stukenberg PT, Burke DJ, Ross MM,
Shabanowitz J, Hunt DF, White FM (2002) Phosphoproteome
analysis by mass spectrometry and its application to Saccharomyces cerevisiae. Nat Biotechnol 20:301305
Fink AL (2005) Natively unfolded proteins. Curr Opin Struct Biol
15:3541
Fishel BR, Sperry AO, Garrard WT (1993) Yeast calmodulin and a
conserved nuclear protein participate in the in vivo binding of a
matrix association region. Proc Natl Acad Sci USA 90:5623
5627
Gavin AC, Bosche M, Krause R, Grandi P, Marzioch M, Bauer A,
Schultz J, Rick JM, Michon AM, Cruciat CM, Remor M,
Hofert C, Schelder M, Brajenovic M, Runer H, Merino A,
Klein K, Hudak M, Dickson D, Rudi T, Gnau V, Bauch A,
Bastuck S, Huhse B, Leutwein C, Heurtier MA, Copley RR,
Edelmann A, Querfurth E, Rybin V, Drewes G, Raida M,
Bouwmeester T, Bork P, Seraphin B, Kuster B, Neubauer G,
Superti-Furga G (2002) Functional organization of the yeast
proteome by systematic analysis of protein complexes. Nature
415:141147
Ghaemmaghami S, Huh WK, Bower K, Howson RW, Belle A,
Dephoure N, OShea EK, Weissman JS (2003) Global analysis
of protein expression in yeast. Nature 425:737741
Gould KL, Ren L, Feoktistova AS, Jennings JL, Link AJ (2004)
Tandem anity purication and identication of protein
complex components. Methods 33:239244
Harrison JC, Bardes ES, Ohya Y, Lew DJ (2001) A role for the
Pkc1p/Mpk1p kinase cascade in the morphogenesis checkpoint.
Nat Cell Biol 3:417420
Hauser NC, Vingron M, Scheideler M, Krems B, Hellmuth K,
Entian KD, Hoheisel JD (1998) Transcriptional proling on all
open reading frames of Saccharomyces cerevisiae. Yeast
14:12091221
Hazbun TR, Malmstrom L, Anderson S, Graczyk BJ, Fox B, Rie
M, Sundin BA, Aranda JD, McDonald WH, Chiu CH,
Snydsman BE, Bradley P, Muller EG, Fields S, Baker D, Yates
JR III, Davis TN (2003) Assigning function to yeast proteins by
integration of technologies. Mol Cell 12:13531365
Heinisch JJ, Lorberg A, Schmitz H-P, Jacoby JJ (1999) The protein
kinase C-mediated MAP kinase pathway involved in the
maintenance of cellular integrity in Saccharomyces cerevisiae.
Mol Microbiol 32:671680
Ho Y, Gruhler A, Heilbut A, Bader GD, Moore L, Adams SL,
Millar A, Taylor P, Bennett K, Boutilier K, Yang L, Wolting C,
Donaldson I, Schandor S, Shewnarane J, Vo M, Taggart J,
Goudreault M, Muskat B, Alfarano C, Dewar D, Lin Z,
Michalickova K, Willems AR, Sassi H, Nielsen PA, Rasmussen
KJ, Andersen JR, Johansen LE, Hansen LH, Jespersen H,
Podtelejnikov A, Nielsen E, Crawford J, Poulsen V, Sorensen
BD, Matthiesen J, Hendrickson RC, Gleeson F, Pawson T,

Moran MF, Durocher D, Mann M, Hogue CW, Figeys D,

Tyers M (2002) Systematic identication of protein complexes
in Saccharomyces cerevisiae by mass spectrometry. Nature
415:180183
Hong Z, Mann P, Brown NH, Tran LE, Shaw KJ, Hare RS, Didomenico B (1994) Cloning and characterization of KNR4, a
yeast gene involved in (1,3)-beta-glucan synthesis. Mol Cell Biol
14:10171025
Huh WK, Falvo JV, Gerke LC, Carroll AS, Howson RW,
Weissman JS, OShea EK (2003) Global analysis of protein
localization in budding yeast. Nature 425:686691
Iakoucheva LM, Kimzey AL, Masselon CD, Smith RD, Dunker
AK, Ackerman EJ (2001) Aberrant mobility phenomena of the
DNA repair protein XPA. Protein Sci 10:13531362
Ito T, Chiba T, Yoshida M (2001) Exploring the protein interactome using comprehensive two-hybrid projects. Trends Biotechnol 19:S23S27
James P, Halladay J, Craig EA (1996) Genomic libraries and a host
strain designed for highly ecient two-hybrid selection in yeast.
Genetics 144:14251436
Jung US, Levin DE (1999) Genome-wide analysis of gene expression regulated by the yeast cell wall integrity signalling pathway. Mol Microbiol 34:10491057
Karas M, Hillenkamp F (1988) Laser desorption ionization of
proteins with molecular masses exceeding 10,000 daltons. Anal
Chem 60:22992301
Kirchrath L, Lorberg A, Schmitz HP, Gengenbacher U, Heinisch
JJ (2000) Comparative genetic and physiological studies of the
MAP kinase Mpk1p from Kluyveromyces lactis and Saccharomyces cerevisiae. J Mol Biol 300:743758
Klenova EM, Nicolas RH, U S, Carne AF, Lee RE, Lobanenkov
VV, Goodwin GH (1997) Molecular weight abnormalities of
the CTCF transcription factor: CTCF migrates aberrantly in
SDS-PAGE and the size of the expressed protein is aected by
the UTRs and sequences within the coding region of the CTCF
gene. Nucleic Acids Res 25:466474
Klis FM (1994) Review: cell wall assembly in yeast. Yeast 10:851
869
Klis FM, Mol P, Hellingwerf K, Brul S (2002) Dynamics of cell
wall structure in Saccharomyces cerevisiae. FEMS Microbiol
Rev 26:239256
Korolyev E, Steinberg-Neifach O, Eshel D (2005) Mutations in the
yeast kinesin-like Cin8p are alleviated by osmotic support.
FEMS Microbiol Lett 244:379383
Kren A, Mamnun YM, Bauer BE, Schuller C, Wolfger H, Hatzixanthis K, Mollapour M, Gregori C, Piper P, Kuchler K (2003)
War1p, a novel transcription factor controlling weak acid stress
response in yeast. Mol Cell Biol 23:17751785
Kriwacki RW, Hengst L, Tennant L, Reed SI, Wright PE (1996)
Structural studies of p21Waf1/Cip1/Sdi1 in the free and Cdk2bound state: conformational disorder mediates binding diversity. Proc Natl Acad Sci USA 93:1150411509
Lagorce A, Le Berre-Anton V, Aguilar-Uscanga B, Martin-Yken
H, Dagkessamanskaia A, Francois J (2002) Involvement of
GFA1, which encodes glutamine-fructose-6-phosphate amidotransferase, in the activation of the chitin synthesis pathway in
response to cell-wall defects in Saccharomyces cerevisiae. Eur J
Biochem 269:16971707
Lesage G, Sdicu AM, Menard P, Shapiro J, Hussein S, Bussey H
(2004) Analysis of beta-1,3-glucan assembly in Saccharomyces
cerevisiae using a synthetic interaction network and altered
sensitivity to caspofungin. Genetics 167:3549
Lesage G, Shapiro J, Specht CA, Sdicu AM, Menard P, Hussein S,
Tong AH, Boone C, Bussey H (2005) An interactional network
of genes involved in chitin synthesis in Saccharomyces cerevisiae. BMC Genet 6:8
Levin DE (2005) Cell wall integrity signaling in Saccharomyces
cerevisiae. Microbiol Mol Biol Rev 69:262291
Linding R, Schymkowitz J, Rousseau F, Diella F, Serrano L (2004)
A comparative study of the relationship between protein
structure and beta-aggregation in globular and intrinsically
disordered proteins. J Mol Biol 342:345353

230
Liu J, Rost B (2003) NORSp: predictions of long regions without
regular secondary structure. Nucleic Acids Res 31:38333835
Louvet O, Doignon F, Crouzet M (1997) Stable DNA-binding
yeast vector allowing high-bait expression for use in the twohybrid system. Biotechniques 23:816820
Madden K, Sheu YJ, Baetz K, Andrews B, Snyder M (1997) SBF
cell cycle regulator as a target of the yeast PKC-MAP kinase
pathway. Science 275:17811784
Markovich S, Yekutiel A, Shalit I, Shadkchan Y, Osherov N (2004)
Genomic approach to identication of mutations aecting caspofungin susceptibility in Saccharomyces cerevisiae. Antimicrob Agents Chemother 48:38713876
Martin H, Dagkessamanskaia A, Satchanska G, Dallies N,
Francois J (1999) KNR4, a suppressor of Saccharomyces cerevisiae cwh mutants, is involved in the transcriptional control of
chitin synthase genes. Microbiology 145:249258
Martin H, Rodriguez-Pachon JM, Ruiz C, Nombela C, Molina M
(2000) Regulatory mechanisms for modulation of signaling
through the cell integrity Slt2-mediated pathway in Saccharomyces cerevisiae. J Biol Chem 275:15111519
Martin-Yken H, Dagkessamanskaia A, Basmaji F, Lagorce A,
Francois J (2003) The interaction of Slt2 MAP kinase with
Knr4 is necessary for signalling through the cell wall integrity
pathway in Saccharomyces cerevisiae. Mol Microbiol 49:2335
Martin-Yken H, Dagkessamanskaia A, Talabi D, Francois J (2002)
KNR4 is a member of the PKC1 signalling pathway and
genetically interacts with BCK2, a gene involved in cell cycle
progression in Saccharomyces cerevisiae. Curr Genet. 41:323
332
von Mering C, Krause R, Snel B, Cornell M, Oliver SG, Fields S,
Bork P (2002) Comparative assessment of large-scale data sets
of proteinprotein interactions. Nature 417:399403
Millson SH, Truman AW, King V, Prodromou C, Pearl LH, Piper
PW (2005) A two-hybrid screen of the yeast proteome for
Hsp90 interactors uncovers a novel Hsp90 chaperone requirement in the activity of a stress-activated mitogen-activated
protein kinase, Slt2p (Mpk1p). Eukaryot Cell 4:849860
Page N, Gerard-Vincent M, Menard P, Beaulieu M, Azuma M,
Dijkgraaf GJ, Li H, Marcoux J, Nguyen T, Dowse T, Sdicu
AM, Bussey H (2003) A Saccharomyces cerevisiae genome-wide
mutant screen for altered sensitivity to K1 killer toxin. Genetics
163:875894
Parrou JL, Enjalbert B, Francois J (1999) STRE- and cAMPindependent transcriptional induction of Saccharomyces cerevisiae GSY2 encoding glycogen synthase during diauxic growth
on glucose. Yeast 15:14711484
Pronk JT, Yde SH, Van DJ (1996) Pyruvate metabolism in Saccharomyces cerevisiae. Yeast 12:16071633
Pruyne D, Bretscher A (2000) Polarization of cell growth in yeast. J
Cell Sci 113:571585
Puig O, Caspary F, Rigaut G, Rutz B, Bouveret E, BragadoNilsson E, Wilm M, Seraphin B (2001) The tandem anity
purication (TAP) method: a general procedure of protein
complex purication. Methods 24:218229
Rajavel M, Philip B, Buehrer BM, Errede B, Levin DE (1999) Mid2
is a putative sensor for cell integrity signaling in Saccharomyces
cerevisiae. Mol Cell Biol 19:39693976
Rigaut G, Shevchenko A, Rutz B, Wilm M, Mann M, Seraphin B
(1999) A generic protein purication method for protein complex characterization and proteome exploration. Nat Biotechnol 17:10301032
Rose MD, Winston F, Hieter P (1990) Methods in yeast genetics : a
laboratory course manual. Cold Spring Harbor Laboratory
Press, New York

Seufert W, Jentsch S (1990) Ubiquitin-conjugating enzymes UBC4

and UBC5 mediate selective degradation of short-lived and
abnormal proteins. EMBO J 9:543550
Sheu YJ, Santos B, Fortin N, Costigan C, Snyder M (1998) Spa2p
interacts with cell polarity proteins and signaling components
involved in yeast cell morphogenesis. Mol Cell Biol 18:4053
4069
Sikorski RS, Hieter P (1989) A system of shuttle vectors and yeast
host strains designed for ecient manipulation of DNA in
Saccharomyces cerevisiae. Genetics 122:1927
Suzuki M, Igarashi R, Sekiya M, Utsugi T, Morishita S, Yukawa
M, Ohya Y (2004) Dynactin is involved in a checkpoint to
monitor cell wall synthesis in Saccharomyces cerevisiae. Nat
Cell Biol 6:861871
Takasuka T, Komiyama T, Furuichi Y, Watanabe T (1995) Cell
wall synthesis specic cytocidal eect of Hansenula mrakii
toxin-1 on Saccharomyces cerevisiae. Cell Mol Biol Res 41:575
581
Tong AH, Evangelista M, Parsons AB, Xu H, Bader GD, Page N,
Robinson M, Raghibizadeh S, Hogue CW, Bussey H, Andrews
B, Tyers M, Boone C (2001) Systematic genetic analysis with
ordered arrays of yeast deletion mutants. Science 294:2364
2368
Tong AH, Lesage G, Bader GD, Ding H, Xu H, Xin X, Young J,
Berriz GF, Brost RL, Chang M, Chen Y, Cheng X, Chua G,
Friesen H, Goldberg DS, Haynes J, Humphries C, He G,
Hussein S, Ke L, Krogan N, Li Z, Levinson JN, Lu H, Menard
P, Munyana C, Parsons AB, Ryan O, Tonikian R, Roberts T,
Sdicu AM, Shapiro J, Sheikh B, Suter B, Wong SL, Zhang LV,
Zhu H, Burd CG, Munro S, Sander C, Rine J, Greenblatt J,
Peter M, Bretscher A, Bell G, Roth FP, Brown GW, Andrews
B, Bussey H, Boone C (2004) Global mapping of the yeast
genetic interaction network. Science 303:808813
Uetz P, Giot L, Cagney G, Manseld TA, Judson RS, Knight JR,
Lockshon D, Narayan V, Srinivasan M, Pochart P, QureshiEmili A, Li Y, Godwin B, Conover D, Kalbeisch T, Vijayadamodar G, Yang M, Johnston M, Fields S, Rothberg JM
(2000) A comprehensive analysis of proteinprotein interactions
in Saccharomyces cerevisiae. Nature 403:623627
Vucetic S, Brown CJ, Dunker AK, Obradovic Z (2003) Flavors of
protein disorder. Proteins 52:573584
Watanabe Y, Irie K, Matsumoto K (1995) Yeast RLM1 encodes a
serum response factor-like protein that may function downstream of the Mpk1 (Slt2) mitogen-activated protein kinase
pathway. Mol Cell Biol 15:57405749
Wright PE, Dyson HJ (1999) Intrinsically unstructured proteins:
re-assessing the protein structurefunction paradigm. J Mol
Biol 293:321331
Zakrzewska A, Boorsma A, Brul S, Hellingwerf KJ, Klis FM
(2005) Transcriptional response of Saccharomyces cerevisiae to
the plasma membrane-perturbing compound chitosan. Eukaryot Cell 4:703715
Zhang X, Lester RL, Dickson RC (2004) Pil1p and Lsp1p negatively regulate the 3-phosphoinositide-dependent protein kinase-like kinase Pkh1p and downstream signaling pathways
Pkc1p and Ypk1p. J Biol Chem 279:2203022038
Zhao R, Davey M, Hsu YC, Kaplanek P, Tong A, Parsons AB,
Krogan N, Cagney G, Mai D, Greenblatt J, Boone C, Emili A,
Houry WA (2005) Navigating the chaperone network: an
integrative map of physical and genetic interactions mediated
by the hsp90 chaperone. Cell 120:715727