Professional Documents
Culture Documents
Bio 1001 Notebook Final
Bio 1001 Notebook Final
11/04/2013
The sugar and phosphate groups form the nucleic acid backbone
Nucleic acid backbone has directionality (3 vs. 5) antiparallel
(think of a highway)
Antiparallel: parallel, but going in opposite directions
o Pyrimidines are nitrogenous bases characterized by a sixmembered ring made up of carbon and nitrogen atoms
o Purines are nitrogenous bases characterized by a fivemembered ring fused to a six-membered ring where both
rings are made up of carbon and nitrogen atoms
and the polymer (single strand DNA)
Specific-base pairing complementary base pairs the key to solving
puzzle
A-T and G-C pairs, explained Chargaffs Rules
DNA Length
DNA in a typical human cell is about 2 meters long
Must be contained within a cell about 10 m in diameter
So in American units if the average cell were an inch in diameter,
the DNA contained inside of it would be about 3 miles long
Genes
Mini-satellite sequences:
DNA replication
Semiconservative replication
In this model, each new DNA double helix would be made of a strand
of old DNA and a strand of new DNA
2 copies old-new paired
Where it starts
1.
2.
Transcription
nucleus
DNA gets transcribed into mRNA (messenger RNA on transcript)
DNA RNA
Translation
Outside the nucleus
On a ribosome
mRNA transcript gets translated into a protein
mRNA (nucleotides) protein (amino acids)
tRNA (transfer RNA): reads the nucleotide language and converts it
to amino acid language
rRNA (ribosomal RNA): physically makes up the ribosome
Bases in
DNA: GATC
RNA: GAUC
a.
2. Base thymine (DNA) is replaced by uracil (RNA)
Question: Why are only 20 amino acids formed from the 64 possible
combinations of the bases?
An amino acid can be encoded by more than one nucleotide
triplet
Transcription Initiation
Transcription - Elongation
Transcription Termination
Conclusion of transcription
The P site holds the tRNA with the polypeptide chain attached
o Where the protein that has been made so far will be found
The A site hold the tRNA with the next amino acid to be added
o Where the next tRNA containing the next amino acid will be
found
The ribosome holds all the components together as enzymes
transfer the next amino acid to the growing polypeptide chain
Catalytic site: contains the enzyme needed to form peptide bonds
between amino acids
Using this
One Codon One Anticodon One Amino Acid
Method the gene is decoded to synthesize a protein
Mutations are permanent changes in the DNA that can involve large
chromosomal regions or a single nucleotide pair
Point mutations are mutations limited to one or two nucleotides in a
single gene, and can affect the function of a protein
Insertion is the insertion of one or more nucleotide pairs into a gene
Translation happens on the ribosome
5 = the beginning
EXAM QUESTION:
DNA: 3 GAC 5
RNA: 5 CUG 3
Or
DNA: 5 GGA 3
RNA: 3 CCU 5
5 must always be first so answer is written as 5 UCC 3
Transcription:
DNA mRNA (nucleus)
mRNA protein (ribosome)
Start Codon: Almost always AUG which codes for the amino acid
Methionine (Met)
This amino acid is almost always the first amino acid in proteins
Know the 3 Stop codons:
UGA
UAA
UAG
How many amino acids long will the protein coded by this mRNA be?
5 GCCAGCAUGCCCAAUGCCAGCUGACCG 3
START
STOP
It would be 5 amino acids long (you DO NOT count the stop codon)
Darwin and Wallace independently proposed that organisms evolved by
natural selection
Both presented papers to a biological journal in London in 1858
Darwin published On the Origin of Species by Means of Natural
Selection in 1859
o Proposed that individuals evolved through a process of
descent with modification
Individuals in each generation differ slightly from the
members of the preceding generation
Over long time periods, small genetic differences
accumulate to produce major transformations
Darwin and Wallaces theory was based on 4 principles:
Principle 1: Individual members of a population are different from
one another
o We now know that variations arise purely by chance resulting
from random mutations in DNA
o The difference are obvious in many physical characteristics
and extend to the genetic level
o Variation in a Population of Snails:
vii.
a. Vestigial structures are remnants of structures that are inherited
from ancestors
i. Molar teeth in vampire bats (which live on a diet of blood and,
therefore, dont chew their food) are vestigial structures.
Tonsils, a tailbone, and the appendix in humans.
3. Embryological similarity suggests common ancestry
a. All vertebrate embryos resemble one another in their early
development
b. All vertebrate embryos possess genes that direct development of
gill slits and a tail
c. Adult fish retain gills and tail because the genes are active
throughout their embryonic development
d. Humans are born without gills and a tail because the genes are
active only during early embryonic development
e. Embryological Stages Reveal Evolutionary Relationships
i.