Cell and Microbiology.

Data interpretation : DNA, RNA, protein

Please read and analyse the four questions prior to the test in class in week
16.
1. What is depicted in Figure 1 below? Can you identify key parts and explain what
proteins are involved?
Figure 1.

2. What is depicted in Figure 2 below? Can you identify key parts and explain what
proteins are involved?
Figure 2.

3. Study the DNA sequence in Figure 3, (the sequence of only one strand is provided)
you could be asked questions about DNA, promoter regions, transcription and
translation in the test. A genetic code is provided in Figure 4,and will also be printed
on the question paper
Figure 3. DNA sequence.
5 ATCTGACTAACTATTGTCATTACGGTATCTCACTGACTATAATCTGCACCATC
GTTCTGCTTTCGTACTAGGAGGCCTTTGGCTGCTACTTATGTATCAAGCTGTT
GGTGGGTCTAGCTGATAACCCTTTATC 3

Figure 4. The Universal Genetic Code

4. Review the processes controlling gene expression, transcription and translation in

prokaryotes and eukaryotes you need to understand the differences between
them. There will be questions on this topic in the test.