Dilutions and Protocols (Draft)

Calculations

1.1

Area of gold plate

Diameter of gold plates: 500um

Hemisphere (V) of gold plate (in cubic meters) =
=

2
3

r3

2
(2503 106 )3 = 3.272 1011 m3
3

(1)

Volume of solution to fill hemisphere =

3.272 1011 (1000L/1m3 ) (106 uL/L) = 0.032725uL = 32.7259nL

(2)

8 gold plates to transistor 261.799 nL to fill all plates

1.2

Mass of aptamer

MW NS1 Aptamer with biotin and 6T = 12,116 g/mol S15 was 34 BP and NS1 aptamer is 32 BP,
both form g-quadruplex tertiary structures.
S15 sequence: 5 GCACCGGGCAGGACGTCCGGGGTCCTCGGGGGGC 3
Mass in grams for S15: 10646.79 Da = 1.7679409179e-20 grams
Molar Weight S15: grams/mole = (1.7679409179e-20 grams) * (6.022140857(74)1023 mol1) =
10,646.8969 g/mol

1.3

General concentration formula

concentration = mass / volume * 1/molecular weight

moles/liter = grams/[1liter = (.001meters3 )] 1/(grams/mole)

1.4

(3)

Density of aptamer in concentration

Assume 2 uM, 10 uM, 20 uM final concentration of NS1 aptamer in solution (from Goda papers
aptamer concentrations)
2 uM = 2 106 M
10 uM = 10 106 M
20 uM = 20 106 M
30 uM = 30 106 M
20*106
20*106
20*106
30*106

1.5

M = x g / 1 L * 1 / 10,646.8969 g/mol = .02129 grams/L = .02129 ng/nL

M = x g / 1 L * 1 / 10,646.8969 g/mol = .1064 grams/L = .1064 ng/nL
M = x g / 1 L * 1 / 10,646.8969 g/mol = .2129 grams/L = .2129 ng/nL
M= x g / 1 L * 1 / 10,646.8969 g/mol = .3194 grams/L = .3194 ng/nL

Aptamer Density vs. Protein

NS1 protein length:

Width: 120-125 Angstroms = 120 1010 m 125 1010 m
Diagnol Width: 140 Angstroms 140 1010 m
Theoretical surface density of the immobilized DNA aptamers (DN A ) =
1

1.6

Grams to fill one hemisphere

32.7259 nL to fill hemisphere of 1 plate

x nanograms / 32.759 nL = .02129 ng/nL
= .6974 ng at 2 uM concentration to fill one hemisphere
x nanograms / 32.759 nL = .1064 ng/nL
= 3.4856 ng at 10 uM concentration to fill one hemisphere
x nanograms / 32.759 nL = .2129 ng/nL
= 6.9743 ng at 20 uM concentration to fill one hemisphere
x nanograms / 32.759 nL = .3194 ng/nL
= 10.4634 ng at 30 uM concentration to fill one hemisphere

1.7

Grams to fill entire plate

261.799 nL to fill hemispheres of all plates

x nanograms /261.799 nL = .02129 ng/nL
= 5.5737 ng at 2 uM concentration to fill all hemispheres
x nanograms /261.799 nL = .1064 ng/nL
= 27.855 ng at 10 uM concentration to fill all hemispheres
x nanograms /261.799 nL = .2129 ng/nL
= 55.737 ng at 20 uM concentration to fill all hemispheres
x nanograms /261.799 nL = .3194 ng/nL
= 83.6189 ng at 30 uM concentration to fill all hemispheres

1.8

Number of tests

Amount of aptamer ordered = 25 ug

2 uM: .02129 ng
How many single gold plate tests can be run: 25000 ng / .69743 ng = 35845.89 tests
How many full transistor tests can be run: 25000 ng / 5.5737 ng = 4485.35 tests
10 uM: .1064 ng
How many single gold plate tests can be run: 25000 ng / 3.4856 ng = 7172.366 tests
How many full transistor tests can be run: 25000 ng / 27.855 ng = 897.504 tests
20 uM: .2129 ng
How many single gold plate tests can be run: 25000 ng / 6.9743 ng = 3584.589 tests
How many full transistor tests can be run: 25000 ng / 55.737 ng = 448.535 tests
30 uM: .3194 ng
How many single gold plate tests can be run: 25000 ng / 10.4634 ng = 2389.28 tests
How many full transistor tests can be run: 25000 ng / 83.6189 ng = 298.975 tests

1.9

Aptamer Reduction Buffer

TE buffer: 10 mM Tris, 0.1 mM EDTA, pH 7.5

10 mM Tris 121.14 100G : 121.14 g/mol
.01 M = x g / L * 1/121.14 g/mol = 1.2114 g/L
0.1 mM EDTA, pH 7.5 100G : 292.24 g/mol
.0001 M = x g / L * 1/292.24 g/mol = .029224 g/L
TCEP 1g : 286.65 MW
.01M = xg / 1L * 1/286.65 g/mole = 2.8665 g/L

1.10

Folding buffer concentrations and dilutions

1 mM MgCl2, 1X PBS, pH 7.5 (137 mM NaCl, 2.7 mM Potassium Chloride, 8 mM Sodium Phosphate dibasic, 2 mM Potassium Phosphate monobasic)
1 mM MgCl2 - 100 ml (1 M) : MW - 95.211 g/mol
1mL of solution - 100 buffers
137 mM NaCl : MW - 58.44 g/mol
.137 M = x g / L * 1/58.44 g/mol = 8 g/L
2.7 mM KCl : MW 74.5513 g/mol
.0027 M = x g / L * 1/74.5513 g/mol = .2013 g/L
8 mM Sodium Phosphate dibasic 250G : 141.96 g/mol
.0008 M = x g / L * 1/141.96 g/mol = .113568 g/L
2 mM Potassium Phosphate monobasic 500 g : 136.09 g/mol
.0002 M = x g / L * 1/136.09 g/mol = .027218 g/L

1.11

Reaction Buffer to bind aptamer to gold: concentrations/dilutions

10 mM TrisHCl, 100 mM KCl, 100 mM NaCl, 10 mM CaCl2, 10 mM MgCl2, and 1 mM TCEP

10mM tris-HCL Ph 8.0- 1L (1M) : MW 157.594 g/mol
10 mL of Tris HCL-100 buffer solutions from tris-HCL
100 mM KCl - in lab : MW 74.5513 g/mol
.1 M = x g / 1L * 1/74.5513 g/mol = 7.45513 g/L
10 mM NaCl - in lab : MW - 58.44 g/mol
.01 M = x g / 1L * 1/58.44 g/mol = .5844 g/L
10 mM CaCl2 - 500g : MW - 110.98 g/mol
.01 M = x g / 1L * 1/110.98 g/mol = 1.1098 g/L
10mM MgCl2- 100 ml (1 M) : MW - 95.211 g/mol
1mL of solution - 100 buffers
1 mM TCEP - 1g : MW 286.65 g/mol
.001 M = x g / 1L * 1/286.65 g/mol = .28665 g/L = .28665 mg/mL

1.12

SB Solution: concentrations/dilutions

1mM Sulfobentaine-3-undecanethiol - 10 mg : 353.59 MW

.001M = xg / 1L * 1/353.59 g/mole = .35355 g/L = .35355 ng/nL

1mM TCEPHCl, Tris(2-carboxyethyl)phosphine hydrochloride, 1g : 286.65 MW
.001M = xg / 1L * 1/286.65 g/mole = .28665 g/L = .28665 ug/uL

1.13

Antibody/NS1 binding buffer

1.14

NS1 and measurement buffer

Mass of NS1 with His-tag: 2.5837986e-20 g

MW: 15562.61 g/mole
Concentration: 100 ug at 0.53 mg/ml
10nM:
10*109 M = x g / 1L * 1/15562.6 g/mol = .00015562 g/L
50nM:
50*109 M = x g / 1L * 1/15562.6 g/mol = .0007781 g/L
100nM:
100*109 M = x g / 1L * 1/15562.6 g/mol = .0015562 g/L
500nM:
500*109 M = x g / 1L * 1/15562.6 g/mol = .007781 g/L
1uM:
1*106 M = x g / 1L * 1/15562.6 g/mol = .015562 g/L
Electrolyte composition of measurement buffer (pH 8.2): 10mM TrisHCl, 5mM KCl, 3mM NaCl,
1mM CaCl2 and 1mM MgCl2.
10mM tris-HCL pH 8.0- 1L (1M) : MW 157.594 g/mol
10 mL of Tris HCL-100 buffer solutions from tris-HCL
5 mM KCl - in lab : MW 74.5513 g/mol
.005 M = x g / 1L * 1/74.5513 g/mol = .37276 g/L
3 mM NaCl - in lab : MW - 58.44 g/mol
.003 M = x g / 1L * 1/58.44 g/mol = .17532 g/L
1 mM CaCl2 - 500g : MW - 110.98 g/mol
.001 M = x g / 1L * 1/110.98 g/mol = .11098 g/L
1mM MgCl2- 100 ml (1 M) : MW - 95.211 g/mol
100uL of solution - 1000 buffers

1.15

2
2.1

Fluorospectrometry Cuvette Buffers

Protocols
Aptamer Reduction Protocol

1. xBriefly centrifuge the aptamer storage tube to ensure the dried aptamer pellet is at the bottom
of the tube.
2. Resuspend the aptamers pellet in TE buffer (10 mM Tris HCl, 0.1 mM EDTA, pH 7.5) or
non-DPEC treat-ed, nuclease free water to achieve 100uM concentration (using volumes indicated
in the Product Information Sheet that accompanies each order).
3. Incubate at room temperature for 30 minutes.
4. Briefly vortex and quickly spin the sample down ( 10,000g for 1 second).
4

5.Create aliquots and store 20o C.

1.Resuspend and aliquot aptamer in TE buffer to 100 uM according to the instruction on the
Product Information Form from BasePairBio.
2.Prepare a 1:1 v/v dilution of aptamer solution with 20 mM TCEP solution, for a final concentration of 50 uM aptamer and 10 mM TCEP. Incubate the reaction at room temperature for 1
hour.

2.2

Aptamer Folding Protocol

1. Prior to use, dilute the reduced thiol-aptamer to its working concentration in Folding Buffer.
2. Heat the aptamer solution to 85 95 o C for 5 minutes.
3. Allow the solution to cool to room temperature ( 15 minutes).

2.3

Aptamer and SB gold plate binding protocol

Immobilize thiol-modified DNA aptamers in a Reaction Buffer overnight, followed by rinse with
water. Backfill the remaining gold surface with SB solution, followed by rinse with water.

2.4

Measurement Buffer and NS1

Use varying concentration of NS1 in Measurement Buffer ie. go from 0-1400 nm over time and see
the signal difference.

2.5

6x His Tag Antibody

To determine the binding efficacy of the DENV2 NS1 to its related aptamer, well be performing
something similar to an ELISA assay. This document will provide details on how this will be
performed.
Process (components, paragraph form): The process will work much the same as a standard
ELISA assay. The base of our assay will be a layer of gold plating. This is necessary because the
next component, the NS1 aptamer, is thiolated. Thiols bind to gold, thereby anchoring the aptamer
to the gold surface. The next component will be for the NS1, since it binding to the aptamer is
what we want to test. This NS1 well be using has another feature that will be important for this
assay: these particles have 6xHis tags attached to them. Once an adequate amount of time has
passed, the NS1 will have theoretically bound to the aptamer, we will add the antibody detector.
This antibody binds to His tags and will have a dye bound to the functional end. After washing,
what we expect to see is fluorescence (green light) from the bound dyes, which will show that the
NS1 is bound to the aptamer.
Process (components, layered from top to bottom w/ associated quantities needed*):
6x-His tag antibody (DyLight 488) NS1 protein, His-tagged NS1 aptamer, thiolated Gold surface
Process (general ELISA steps):
Details taken from ThermoFisher: https://www.thermofisher.com/us/en/home/life-science/proteinbiology/protein-biology-learning-center/protein-biology-resource-library/pierce-protein-methods/overviewelisa.html
The direct detection method uses a labeled primary antibody that reacts directly with the
antigen. Direct detection can be performed with antigen that is directly immobilized on the assay
plate or with the capture assay format. Direct detection is not widely used in ELISA but is quite
common for immunohistochemical staining of tissues and cells.