Basic ResearchBiology

The Combined Effect of Mineral Trioxide Aggregate and

Enamel Matrix Derivative on Odontoblastic Differentiation
in Human Dental Pulp Cells
Kyung-San Min, DDS, PhD,* Seong-Hak Yang, DDS, MS,* and Eun-Cheol Kim, DDS, PhD
Abstract
Introduction: The current study investigated the effectiveness of enamel matrix derivative (EMD) and mineral
trioxide aggregate (MTA) in inducing the differentiation
of human dental pulp cells (HDPCs) into odontoblastlike cells in vitro. Methods: The effects of MTA and
EMD on odontoblastic differentiation were indexed by
alkaline phosphatase (ALP) activity and the expression
of odontoblastic/osteoblastic markers, as determined
by reverse-transcription polymerase chain reaction analysis. Mineralization was also evaluated by the staining
of calcium deposits with Alizarin red. Cells were treated
with a combination of MTA and EMD or with MTA alone.
Results: Compared with MTA-treated cells on day 3,
MTA/EMD-treated cells exhibited significantly greater
increases in ALP activity and in dentin sialophosphoprotein and bone sialoprotein expression. Mineralization
was significantly greater on day 7 in MTA/EMD-treated
cells than in MTA-treated cells. Conclusions: These
results suggest that a combination of MTA and EMD
promotes more rapid differentiation in HDPCs than
MTA alone and that this combination is thus a potential
pulp-capping agent. (J Endod 2009;35:847851)

Key Words
Enamel matrix derivative, human dental pulp cell,
mineral trioxide aggregate, mineralization, odontoblastic differentiation

From the Departments of *Conservative Dentistry and Oral

and Maxillofacial Pathology, School of Dentistry, Wonkwang
University, Iksan, South Korea.
Supported by the Korea Research Foundation Grant funded
by the Korean Government (MOEHRD, Basic Research Promotion Fund) (KRF-2007-331-E00243).
Address requests for reprints to Dr Eun-Cheol Kim, Department of Oral and Maxillofacial Pathology, College of Dentistry,
Wonkwang University, 344-2 Shinyong, Iksan, South Korea
570-749. E-mail address: eckwkop@wonkwang.ac.kr.
0099-2399/$0 - see front matter
Copyright 2009 American Association of Endodontists.
doi:10.1016/j.joen.2009.03.014

ulp capping is a treatment for exposed vital pulp in which the formation of reparative
dentin is facilitated by sealing the pulpal wound with a dental material (1). There
have been recent attempts to develop more effective pulp-capping materials. One of
these materials is mineral trioxide aggregate (MTA), which appears to have more reliable effects than materials previously used. MTA has been shown to induce hard-tissue
repair of exposed pulps in experimental animals (24) and to generate a greater
frequency of dentin bridge formation than earlier materials (2, 3). We recently reported
that the dentinogenic process in human pulp capping is induced more effectively by
MTA than by calcium hydroxide (5). However, MTA shares with calcium hydroxide
a mechanism of hard-tissue formation known to cause inflammatory and necrotic
changes in the subjacent pulp (6). Effects like these imply that the development of
nontoxic and biologically active pulp-capping agents is warranted.
Because they induce mesenchymal cell differentiation, ectodermal tooth enamel
proteins, as commercial preparations of porcine fetal enamel matrix derivative
(EMD), have been used in patients with periodontitis to promote cementogenesis
and periodontal ligament regeneration (79). EMD is also reported to induce a process
mimicking normal odontogenesis and can thereby serve as a biologically active pulpdressing agent that specifically induces pulpal wound healing and hard-tissue formation
without affecting healthy pulp (10, 11).
During dentin formation, odontoblasts synthesize several noncollagenous proteins
and secrete these into the dentin extracellular matrix (12). One of these proteins is dentin
sialophosphoprotein (DSPP), which is believed to play a regulatory role in the mineralization of reparative dentin; it also serves as a specific marker for the odontoblastic
phenotype (13). Bone sialoprotein (BSP) is a major extracellular matrix component
of bone, which is also found in the dentin (14). Osteonectin (ON) is a calcium-, hydroxyapatite-, and collagen-binding protein and a marker of bone cell differentiation (15).
Previous research has revealed that MTA suppresses the differentiation of bone
marrow osteoblast-like cells (16). Conversely, MTA was found to upregulate type I
collagen and osteocalcin messenger RNA in MC3T3-E1 osteoblast cells (17) and dentin
sialoprotein in human pulp (5). On the other hand, EMD has been shown to increase
the level of mineralization markers, including BSP and osteopontin, in osteoblasts (18).
EMD has also been found to promote the proliferation and differentiation of MC3T3-E1
cells and to indirectly inhibit osteoclastogenesis and osteoclast function by stimulating
the expression of osteoprotegerin (19). However, a capacity for EMD and MTA to facilitate the differentiation of human dental pulp cells (HDPCs) into odontoblast-like cells
does not appear to have been investigated. The aim of the current study was to determine
if EMD and MTA exert synergistic effects on mineralization and odontoblastic differentiation in HDPCs.

Materials and Methods

Primary HDPC Culture
HDPCs were cultured by using an explant technique as described previously (20).
Freshly extracted impacted third molars were obtained from the Department of Oral and
Maxillofacial Surgery, Wonkwang University Dental Hospital (Iksan, Republic of Korea)
and were immediately placed in phosphate-buffered saline supplemented with antibiotics. They were then transported to the laboratory on ice within 15 minutes of

JOE Volume 35, Number 6, June 2009

MTA and EMD Effects in Pulp Cells

847

Basic ResearchBiology
TABLE 1. RT-PCR Primers and Conditions
DSPP
BSP
ON
GAPDH

Sequences (5 -3)

Size (bp)

Temperature ( C)

Forward: AATGGGACTAAGGAAGCTG
Reverse: AAGAAGCATCTCCTCGGC
Forward: AATGAAAACGAAGAAAGCGAAG
Reverse: ATCATAGCCATCGTAGCCTTGT
Forward: ACATGGGTGGACACGG
Reverse: CCAACAGCCTAATGTGAA
Forward: CGGAGTCAACGGATTTGGTCGTAT
Reverse: AGCCTTCTCCATGGTGGTGAAGAC

814

54

450

56

405

52

306

54

extraction. The teeth were sectioned horizontally at 1 mm below the cementoenamel junction by using size 330 carbide bur mounted on
a high-speed handpiece and then split open. The pulp tissues were
removed aseptically and minced with a blade into small fragments.
They were then placed into the wells of a six-well cell culture plate
and incubated in high-glucose Dulbeccos modified Eagles Medium
(DMEM; Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine
serum and antibiotics (100 U/mL penicillin and 100 mg/mL streptomycin). The cultures were maintained at 37 C in a humidified atmosphere of 5% CO2 and 95% air. Cell cultures between the fifth and
seventh passages were used in this study.

Material Preparation and Cell Inoculation

MTA (ProRoot; Dentsply, Tulsa, OK) was mixed according to the
manufacturers instruction. The specimen of MTA was 10 mm in diameter and 1 mm in thickness. The mixed specimen of MTA was packed
into paraffin wax molds and stored for 3 hours in a moist chamber at
37 C, 96% humidity. EMD gel (30 mg/mL and 0.7 mL) (Emdogain; Biora AB, Malmo, Sweden) was diluted with sterile distilled water so that it
was a 100-mg/ml solution.
Single-cell suspensions of cells were seeded in six-well culture
plates at 5  104 cells per well, as determined by hemocytometry, in
complete DMEM. After 24 hours of incubation, cells were subjected
to three different treatments. Group 1 was cultured in DMEM with
10% fetal bovine serum as a control. In group 2, MTA was added alone
to the culture plate insert (Millicell; Millipore, Bedford, MA), which had
a membrane pore diameter of 0.4 mm so that there was no direct
contact between MTA and cells. In group 3, MTA plus EMD (Endogain)
was added to the culture plate.
Alkaline Phosphatase Activity
After the HDPCs were incubated for 1 and 3 days, the cells were
scraped into cold PBS and then sonicated with a cell disruptor (Heat
System-Ultrasonics, Plainview, NJ) in an ice-cold bath. Alkaline phosphatase activity (ALP) activity in the supernatant was determined by
the method of Lowry et al (21), with p-nitrophenyl phosphate as
a substrate. Absorbance was measured at 410 nm with an enzymelinked immunosorbent assay reader (Beckman DU-650; Beckman
Coulter, Fullerton, CA).
Alizarin Red Staining
After culturing HDPCs for 7 days, mineralization was assessed by
staining with Alizarin red (Sigma-Aldrich, St Louis, MO). Briefly, 40
mmol/L of Alizarin red was prepared in distilled water, adjusted to
a pH of 5.5 with ammonium hydroxide, and then applied to the cells
in six-well plates for 30 minutes at room temperature with gentle agitation. The cells were then washed with distilled water and allowed to dry.
848

Min et al.

Reverse-transcriptase Polymerase Chain Reaction Gene

Expression Analysis
After 1 and 3 days of culture, the total RNA of the pulp cells was
extracted using the Trizol reagent (Life Technologies, Gaithersburg,
MD) according to the manufacturers instruction. Mineralization maker
was measured by reverse transcriptase-polymerase chain reaction
(RT-PCR). RNA reverse transcription was performed by using AccuPower RT PreMix (Bioneer, Daejon, Korea). The RT-generated DNA
(2-5 mL) was amplified using AccuPower PCR PreMix (Bioneer). Amplification was performed for 30 cycles in a DNA thermal cycler. Primer
sequences for ON, DSPP, BSP, and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) are detailed in Table 1. The PCR products
were resolved on a 1.5% agarose gel and stained with ethidium bromide.
The intensity of each band after normalization with GAPDH messenger
RNA was quantified on the photographed gels with a densitometer
(Quantity One; Bio-Rad, Hercules, CA).
Statistical Analysis
The statistical analysis of the data was performed by one-way analysis of variance followed by a multiple-comparison Turkey test, with the
use of the SPSS program (SPSS 12.0; SPSS GmbH, Munich, Germany).
Statistical significance was determined at p < 0.05.

Results
Effects of Combined MTA and EMD on ALP Activity
Compared with untreated control cells, cells treated with a combination of MTA and EMD or with MTA alone exhibited increases in ALP
activity. The increase in ALP activity was particularly pronounced in
MTA/EMD-treated cells, being greater than MTA-treated cells on day
3 (Fig. 1).
0.16

ALP activity (nmol/30min/ug)

Gene

#
Con

0.14

MTA
0.12

MTA/EMD

0.1

0.06

**

0.08

0.04

0.02
0

1D

3D

Figure 1. The effects of MTA alone and MTA/EMD on ALP activity in HDPCs
(*p < 0.05).

JOE Volume 35, Number 6, June 2009

Basic ResearchBiology
RT-PCR Gene Expression Analysis
ON and BSP served as osteogenic markers, and DSPP served as
a specific marker for the odontoblast phenotype. As shown in Figure 3,
there was a significant level of DSPP expression in MTA/EMD-treated
cells on days 1 and 3, although not in MTA-treated cells on day 1. Significant levels of BSP expression was observed only in MTA/EMD-treated
cells on day 3.

Discussion

Figure 2. The effects of MTA and MTA/EMD on formation of calcification

nodules in HDPCs. HDPCs were cultured with MTA alone and MTA/EMD for
7 days and stained with Alizarin red. A representative photograph of Alizarin
red staining is shown.

Effects of MTA and EMD on Mineralization

Alizarin red staining for calcium showed a significant increase in
mineralization with both treatments. However, the amount of mineralization was greater for MTA/EMD-treated cells than for both MTAtreated cells and control cells (Fig. 2).

The aim of the current study was to investigate the combined effect
of EMD and MTA in inducing the differentiation of HDPCs into odontoblast-like cells in vitro. We performed our investigation in HDPCs
because these cells are well characterized and can be induced to further
differentiate into odontoblast/osteoblast-like cells (22).
The extent to which growth or differentiation agents applied
directly to pulp tissue induce reparative dentin has been a focus of
many biomedical trials. Because it is commercially available and
economical than other bioactive agents, clinicians have recently become
interested in using EMD as a pulp-capping material. Unlike liquid agents
used in previous studies, EMD is a gel-type agent that does not rapidly
diffuse into the pulp tissue (23, 24). EMD has also been shown to
induce reparative dentin and odontoblast differentiation in experimental pulp capping (25, 26). Moreover, MTA has been reported to
induce mineralization not only in vitro but also in vivo (27, 28).
Although previous studies have investigated the individual effects of
EMD and MTA on odontogenic/osteogenic differentiation, a combined
effect of these agents in HDPCs does not appear to have been reported.
Thus, to the best of our knowledge, the current study is the first to investigate how a combination of EMD and MTA affects odontoblastic differentiation in HDPCs.

Figure 3. The effects of MTA and EMD on the expression of DSPP, BSP, and ON messenger RNA in HDPCs. (A) Total messenger RNA was extracted from the cells,
and the expression levels of the messenger RNAs were determined by RT-PCR as described in the Materials and Methods section. (BD) Gene expression levels of
DSPP, BSP, and ON messenger RNA were measured by densitometry. The relative level of gene expression was normalized against GAPDH messenger RNA, and the
control was set as 1.0. Optical density values represent the mean  standard deviation (*p < 0.05).

JOE Volume 35, Number 6, June 2009

MTA and EMD Effects in Pulp Cells

849

Basic ResearchBiology
The differentiation and mineralization of osteoblasts and odontoblasts involve an initial period of extracellular matrix proliferation and
biosynthesis that is followed by cell differentiation (29). In the early
stages of this process, the matrix matures, and specific proteins associated with the pulp cells phenotype (eg, ALP) can be detected. In the
current study, MTA/EMD-treated cells were found to exhibit a higher
level of ALP activity than MTA-treated cells (Fig. 1). This suggests that
EMD may facilitate the regeneration of pulp and dentin.
As in other connective tissues, components of the extracellular
matrix in dental pulp include collagens and noncollagenous proteins.
We used ON, DSPP, and BSP as markers of odontoblast-like differentiation. ON is a major noncollagenous matrix protein in bone and dentin;
it is found in bovine odontoblasts (30, 31) and in odontoblasts and predentin in human prenatal and postnatal samples. ON is associated
spatially and temporally with development, tissue remodeling, and
repair (30). The odontoblast-specific gene products dentin sialoprotein and dentin phosphoprotein are encoded by a single gene known
as DSPP (32). The expression of these genes is associated with dentinogenesis and occurs after a collagenous predentin matrix is formed (33).
BSP is a major noncollagenous protein expressed specifically in mineralized tissue, including bone, mineralizing cartilage, dentin, and
cementum (14). BSP is produced primarily by osteoblasts and is
considered to be a marker of the osteoblastic phenotype (34), despite
being also found in the dentin (35). In the current study, BSP expression was found to be upregulated in both MTA-treated and MTA/EMDtreated cells, although to a greater extent in the latter on day 3 (Fig. 3C).
This suggests that the mineralization induced by a combination of MTA
and EMD in HDPCs may represent osteogenic properties. These results
support those of Hwang et al (36) who reported finding BSP expression
in the odontoblast-like cells of reparative dentin.
In the current study, we have shown that a combination of MTA and
EMD promoted odontoblastic differentiation in HDPCs, as evidenced by
the induction of ALP activity, the upregulation of osteoblastic/odontoblastic markers, and the formation of mineralized nodules. These
findings show for the first time the synergistic effects of EMD on
MTA-induced odontoblastic differentiation in HDPCs.
The mechanism by which EMD influences odontoblastic/osteoblastic differentiation is not well understood. A previous report suggests
that EMD may directly stimulate odontoblasts or pulp cells to produce
collagen matrix for calcification (37). It is also possible that the presence of transforming growth factor-b1 or amelogenin peptides in EMD
induces cell signaling that stimulates matrix formation and mineralization (3840). Recently, Kaida et al (41) reported that BMP-expressing
macrophages induced by EMD might play important roles in reparative
dentin formation.
The current study showed that EMD acts in synergy with MTA to
induce odontoblastic differentiation and mineralization in HDPCs.
This suggests that a combination of MTA and EMD might be effective
in promoting the formation of hard tissue on exposed pulp and that
this combination is thus a potential pulp-capping agent.

References
1. Schroder U. Effects of calcium hydroxide-containing pulp-capping agents on pulp
cell migration, proliferation, and differentiation. J Dent Res 1985;64:5418.
2. Andelin W, Shabahang S, Wright K, et al. Identification of hard tissue after experimental pulp capping using dentin sialoprotein (DSP) as a marker. J Endod 2003;29:
64650.
3. Ford TR, Torabinejad M, Abedi HR, et al. Using mineral trioxide aggregate as a pulpcapping material. J Am Dent Assoc 1996;127:14914.
4. Faraco IM Jr, Holland R. Response of the pulp of dogs to capping with mineral
trioxide aggregate or a calcium hydroxide cement. Dent Traumatol 2001;17:1636.

850

Min et al.

5. Min KS, Park HJ, Lee SK, et al. Effect of mineral trioxide aggregate on dentin bridge
formation and expression of dentin sialoprotein and heme oxygenase-1 in human
dental pulp. J Endod 2008;34:66670.
6. Kuratate M, Yoshiba K, Shigetani Y, et al. Immunohistochemical analysis of nestin,
osteopontin, and proliferating cells in the reparative process of exposed dental pulp
capped with mineral trioxide aggregate. J Endod 2008;34:9704.
7. Hammarstrom L. Enamel matrix, cementum development and regeneration. J Clin
Periodontol 1997;24:65868.
8. Heijl L, Heden G, Svardstrom G, et al. Enamel matrix derivative (EMDOGAIN) in the
treatment of intrabony periodontal defects. J Clin Periodontol 1997;24:70514.
9. Gestrelius S, Lyngstadaas SP, Hammarstrom L. Emdogain-periodontal regeneration
based on biomimicry. Clin Oral Investig 2000;4:1205.
10. Nakamura Y, Hammarstrom L, Matsumoto K, et al. The induction of reparative
dentine by enamel proteins. Int Endod J 2002;35:40717.
11. Nakamura Y, Slaby I, Matsumoto K, et al. Immunohistochemical characterization of
rapid dentin formation induced by enamel matrix derivative. Calcif Tissue Int 2004;
75:24352.
12. Butler WT. Dentin matrix proteins and dentinogenesis. Connect Tissue Res 1995;33:
5965.
13. Iohara K, Nakashima M, Ito M, et al. Dentin regeneration by dental pulp stem cell
therapy with recombinat human bone morphogenetic protein 2. J Dent Res 2004;
83:5905.
14. Mizuno M, Imai T, Fujisawa R, et al. Bone sialoprotein (BSP) is a crucial factor for
the expression of osteoblastic phenotypes of bone marrow cells cultured on type I
collagen matrix. Calcif Tissue Int 2000;66:38896.
15. Long MW. Osteogenesis and bone-marrow-derived cells. Blood Cells Mol Dis 2001;
27:67790.
16. Nakayama A, Ogiso B, Tanabe N, et al. Behavior of bone marrow osteoblast-like cells
on mineral trioxide aggregate: morphology and expression of type I collagen and
bone-related protein mRNAs. Int Endod J 2005;38:20310.
17. Tani-Ishii N, Hamanda N, Watanabe K, et al. Expression of bone extracellular matrix
proteins on osteoblast cells in the presence of mineral trioxide. J Endod 2007;33:
8369.
18. Weishaupt P, Bernimoulin JP, Trackman P, et al. Stimulation of osteoblasts with Emdogain increases the expression of specific mineralization markers. Oral Surg Oral
Med Oral Pathol Oral Radiol Endod 2008;106:3048.
19. He J, Jiang J, Safavi KE, et al. Emdogain promotes osteoblast proliferation and differentiation and stimulates osteoprotegerin expression. Oral Surg Oral Med Oral Pathol
Oral Radiol Endod 2004;97:23945.
20. Panagakos FS. Transformation and preliminary characterization of primary human
pulp cells. J Endod 1998;24:1715.
21. Lowry OH, Roberts NR, Wu ML, et al. The quantitative histochemistry of brain. II.
Enzyme measurements. J Biol Chem 1954;207:1937.
22. Couble M, Farges JC, Bleicher F, et al. Odontoblast differentiation of human dental
pulp cells in explant cultures. Calcif Tissue Int 2000;66:12938.
23. Nakashima M, Akamine A. The application of tissue engineering to regeneration of
pulp and dentin in endodontics. J Endod 2005;31:7118.
24. Jepsen S, Albers HK, Fleiner B, et al. Recombinant human osteogenic protein-1
induces dentin formation: an experimental study in miniature swine. J Endod
1997;23:37882.
25. Nakamura Y, Hammarstrom L, Lundberg E, et al. Enamel matrix derivative promotes
reparative processes in the dental pulp. Adv Dent Res 2001;15:1057.
26. Ishizaki NT, Matsumoto K, Kimura Y, et al. Histopathological study of dental pulp
tissue capped with enamel matrix derivative. J Endod 2003;29:1769.
27. Yasuda Y, Ogawa M, Arakawa T, et al. The effect of mineral trioxide aggregate on the
mineralization ability of rat dental pulp cells: an in vitro study. J Endod 2008;34:
105760.
28. Gomes-Filho JE, de Faria MD, Bernabe PF, et al. Mineral trioxide aggregate but not lightcure mineral trioxide aggregate stimulated mineralization. J Endod 2008;34:625.
29. Stein GS, Lian JB, Owen TA. Relationship of cell growth to the regulation of tissuespecific gene expression during osteoblast differentiation. FASEB J 1990;4:311123.
30. Fujisawa R, Kuboki Y. Changes in levels of ON in bovine dentin during tooth development. Arch Oral Biol 1989;34:8992.
31. Jontell M, Linde A. Non-collagenous proteins of predentin from dentinogenically
active bovine teeth. Biochem J 1983;214:76976.
32. MacDougall M, Simmons D, Luan X, et al. Dentin phosphoprotein and dentin sialoprotein are cleavage products expressed from a single transcript coded by a gene on
human chromosome 4. Dentin phosphoprotein DNA sequence determination. J Biol
Chem 1997;272:83542.
33. Feng JQ, Luan X, Wallace J, et al. Genomic organization, chromosomal mapping, and
promoter analysis of the mouse dentin sialophosphoprotein (Dspp) gene, which
codes for both dentin sialoprotein and dentin phosphoprotein. J Biol Chem
1998;273:945764.

JOE Volume 35, Number 6, June 2009

Basic ResearchBiology
34. Mizuno M, Imai T, Fujisawa R, et al. Bone sialoprotein (BSP) is a crucial factor for
the expression of osteoblastic phenotypes of bone marrow cells cultured on type I
collagen matrix. Calcif Tissue Int 2000;66:38896.
35. About I, Bottero MJ, de Denato P, et al. uman dentin production in vitro. Exp Cell
Res 2000;258:3341.
36. Hwang YC, Hwang IN, Oh WM, et al. Influence of TGF-b1 on the expression of BSP,
DSP, TGF-b1 receptor I and Smad proteins during reparative dentinogenesis. J Mol
Histol 2008;39:15360.
37. Ishizaki NT, Matsumoto K, Kimura Y, et al. Histopathological study of
dental pulp tissue capped with enamel matrix derivative. J Endod 2003;
29:1769.

JOE Volume 35, Number 6, June 2009

38. Kawase T, Okuda K, Momose M, et al. Enamel matrix derivative (emdogain) rapidly
stimulates phosphorylation of the MAP kinase family and nuclear accumulation of
smad 2 in both oral epithelial and fibroblastic human cells. J Periodontal Res
2001;36:36776.
39. Kawase T, Okuda K, Yoshie H, et al. Anti-TGF-antibody blocks enamel matrix derivative-induced upregulation of P21WAF1/cip1 and prevents its inhibition of human
oral epithelial cell proliferation. J Periodontal Res 2002;37:25562.
40. Iwata T, Morotome Y, Tanabe T, et al. Noggin blocks osteoinductive activity of
porcine enamel extracts. J Dent Res 2002;81:38791.
41. Kaida H, Hamachi T, Anan H, et al. Wound healing process of injured pulp tissues
with emdogain gel. J Endod 2008;34:2630.

MTA and EMD Effects in Pulp Cells

851