Professional Documents
Culture Documents
1 s2.0 S0099239909002386 Main
1 s2.0 S0099239909002386 Main
Key Words
Enamel matrix derivative, human dental pulp cell,
mineral trioxide aggregate, mineralization, odontoblastic differentiation
ulp capping is a treatment for exposed vital pulp in which the formation of reparative
dentin is facilitated by sealing the pulpal wound with a dental material (1). There
have been recent attempts to develop more effective pulp-capping materials. One of
these materials is mineral trioxide aggregate (MTA), which appears to have more reliable effects than materials previously used. MTA has been shown to induce hard-tissue
repair of exposed pulps in experimental animals (24) and to generate a greater
frequency of dentin bridge formation than earlier materials (2, 3). We recently reported
that the dentinogenic process in human pulp capping is induced more effectively by
MTA than by calcium hydroxide (5). However, MTA shares with calcium hydroxide
a mechanism of hard-tissue formation known to cause inflammatory and necrotic
changes in the subjacent pulp (6). Effects like these imply that the development of
nontoxic and biologically active pulp-capping agents is warranted.
Because they induce mesenchymal cell differentiation, ectodermal tooth enamel
proteins, as commercial preparations of porcine fetal enamel matrix derivative
(EMD), have been used in patients with periodontitis to promote cementogenesis
and periodontal ligament regeneration (79). EMD is also reported to induce a process
mimicking normal odontogenesis and can thereby serve as a biologically active pulpdressing agent that specifically induces pulpal wound healing and hard-tissue formation
without affecting healthy pulp (10, 11).
During dentin formation, odontoblasts synthesize several noncollagenous proteins
and secrete these into the dentin extracellular matrix (12). One of these proteins is dentin
sialophosphoprotein (DSPP), which is believed to play a regulatory role in the mineralization of reparative dentin; it also serves as a specific marker for the odontoblastic
phenotype (13). Bone sialoprotein (BSP) is a major extracellular matrix component
of bone, which is also found in the dentin (14). Osteonectin (ON) is a calcium-, hydroxyapatite-, and collagen-binding protein and a marker of bone cell differentiation (15).
Previous research has revealed that MTA suppresses the differentiation of bone
marrow osteoblast-like cells (16). Conversely, MTA was found to upregulate type I
collagen and osteocalcin messenger RNA in MC3T3-E1 osteoblast cells (17) and dentin
sialoprotein in human pulp (5). On the other hand, EMD has been shown to increase
the level of mineralization markers, including BSP and osteopontin, in osteoblasts (18).
EMD has also been found to promote the proliferation and differentiation of MC3T3-E1
cells and to indirectly inhibit osteoclastogenesis and osteoclast function by stimulating
the expression of osteoprotegerin (19). However, a capacity for EMD and MTA to facilitate the differentiation of human dental pulp cells (HDPCs) into odontoblast-like cells
does not appear to have been investigated. The aim of the current study was to determine
if EMD and MTA exert synergistic effects on mineralization and odontoblastic differentiation in HDPCs.
847
Basic ResearchBiology
TABLE 1. RT-PCR Primers and Conditions
DSPP
BSP
ON
GAPDH
Sequences (5 -3)
Size (bp)
Temperature ( C)
Forward: AATGGGACTAAGGAAGCTG
Reverse: AAGAAGCATCTCCTCGGC
Forward: AATGAAAACGAAGAAAGCGAAG
Reverse: ATCATAGCCATCGTAGCCTTGT
Forward: ACATGGGTGGACACGG
Reverse: CCAACAGCCTAATGTGAA
Forward: CGGAGTCAACGGATTTGGTCGTAT
Reverse: AGCCTTCTCCATGGTGGTGAAGAC
814
54
450
56
405
52
306
54
extraction. The teeth were sectioned horizontally at 1 mm below the cementoenamel junction by using size 330 carbide bur mounted on
a high-speed handpiece and then split open. The pulp tissues were
removed aseptically and minced with a blade into small fragments.
They were then placed into the wells of a six-well cell culture plate
and incubated in high-glucose Dulbeccos modified Eagles Medium
(DMEM; Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine
serum and antibiotics (100 U/mL penicillin and 100 mg/mL streptomycin). The cultures were maintained at 37 C in a humidified atmosphere of 5% CO2 and 95% air. Cell cultures between the fifth and
seventh passages were used in this study.
Min et al.
Results
Effects of Combined MTA and EMD on ALP Activity
Compared with untreated control cells, cells treated with a combination of MTA and EMD or with MTA alone exhibited increases in ALP
activity. The increase in ALP activity was particularly pronounced in
MTA/EMD-treated cells, being greater than MTA-treated cells on day
3 (Fig. 1).
0.16
Gene
#
Con
0.14
MTA
0.12
MTA/EMD
0.1
0.06
**
0.08
0.04
0.02
0
1D
3D
Figure 1. The effects of MTA alone and MTA/EMD on ALP activity in HDPCs
(*p < 0.05).
Basic ResearchBiology
RT-PCR Gene Expression Analysis
ON and BSP served as osteogenic markers, and DSPP served as
a specific marker for the odontoblast phenotype. As shown in Figure 3,
there was a significant level of DSPP expression in MTA/EMD-treated
cells on days 1 and 3, although not in MTA-treated cells on day 1. Significant levels of BSP expression was observed only in MTA/EMD-treated
cells on day 3.
Discussion
The aim of the current study was to investigate the combined effect
of EMD and MTA in inducing the differentiation of HDPCs into odontoblast-like cells in vitro. We performed our investigation in HDPCs
because these cells are well characterized and can be induced to further
differentiate into odontoblast/osteoblast-like cells (22).
The extent to which growth or differentiation agents applied
directly to pulp tissue induce reparative dentin has been a focus of
many biomedical trials. Because it is commercially available and
economical than other bioactive agents, clinicians have recently become
interested in using EMD as a pulp-capping material. Unlike liquid agents
used in previous studies, EMD is a gel-type agent that does not rapidly
diffuse into the pulp tissue (23, 24). EMD has also been shown to
induce reparative dentin and odontoblast differentiation in experimental pulp capping (25, 26). Moreover, MTA has been reported to
induce mineralization not only in vitro but also in vivo (27, 28).
Although previous studies have investigated the individual effects of
EMD and MTA on odontogenic/osteogenic differentiation, a combined
effect of these agents in HDPCs does not appear to have been reported.
Thus, to the best of our knowledge, the current study is the first to investigate how a combination of EMD and MTA affects odontoblastic differentiation in HDPCs.
Figure 3. The effects of MTA and EMD on the expression of DSPP, BSP, and ON messenger RNA in HDPCs. (A) Total messenger RNA was extracted from the cells,
and the expression levels of the messenger RNAs were determined by RT-PCR as described in the Materials and Methods section. (BD) Gene expression levels of
DSPP, BSP, and ON messenger RNA were measured by densitometry. The relative level of gene expression was normalized against GAPDH messenger RNA, and the
control was set as 1.0. Optical density values represent the mean standard deviation (*p < 0.05).
849
Basic ResearchBiology
The differentiation and mineralization of osteoblasts and odontoblasts involve an initial period of extracellular matrix proliferation and
biosynthesis that is followed by cell differentiation (29). In the early
stages of this process, the matrix matures, and specific proteins associated with the pulp cells phenotype (eg, ALP) can be detected. In the
current study, MTA/EMD-treated cells were found to exhibit a higher
level of ALP activity than MTA-treated cells (Fig. 1). This suggests that
EMD may facilitate the regeneration of pulp and dentin.
As in other connective tissues, components of the extracellular
matrix in dental pulp include collagens and noncollagenous proteins.
We used ON, DSPP, and BSP as markers of odontoblast-like differentiation. ON is a major noncollagenous matrix protein in bone and dentin;
it is found in bovine odontoblasts (30, 31) and in odontoblasts and predentin in human prenatal and postnatal samples. ON is associated
spatially and temporally with development, tissue remodeling, and
repair (30). The odontoblast-specific gene products dentin sialoprotein and dentin phosphoprotein are encoded by a single gene known
as DSPP (32). The expression of these genes is associated with dentinogenesis and occurs after a collagenous predentin matrix is formed (33).
BSP is a major noncollagenous protein expressed specifically in mineralized tissue, including bone, mineralizing cartilage, dentin, and
cementum (14). BSP is produced primarily by osteoblasts and is
considered to be a marker of the osteoblastic phenotype (34), despite
being also found in the dentin (35). In the current study, BSP expression was found to be upregulated in both MTA-treated and MTA/EMDtreated cells, although to a greater extent in the latter on day 3 (Fig. 3C).
This suggests that the mineralization induced by a combination of MTA
and EMD in HDPCs may represent osteogenic properties. These results
support those of Hwang et al (36) who reported finding BSP expression
in the odontoblast-like cells of reparative dentin.
In the current study, we have shown that a combination of MTA and
EMD promoted odontoblastic differentiation in HDPCs, as evidenced by
the induction of ALP activity, the upregulation of osteoblastic/odontoblastic markers, and the formation of mineralized nodules. These
findings show for the first time the synergistic effects of EMD on
MTA-induced odontoblastic differentiation in HDPCs.
The mechanism by which EMD influences odontoblastic/osteoblastic differentiation is not well understood. A previous report suggests
that EMD may directly stimulate odontoblasts or pulp cells to produce
collagen matrix for calcification (37). It is also possible that the presence of transforming growth factor-b1 or amelogenin peptides in EMD
induces cell signaling that stimulates matrix formation and mineralization (3840). Recently, Kaida et al (41) reported that BMP-expressing
macrophages induced by EMD might play important roles in reparative
dentin formation.
The current study showed that EMD acts in synergy with MTA to
induce odontoblastic differentiation and mineralization in HDPCs.
This suggests that a combination of MTA and EMD might be effective
in promoting the formation of hard tissue on exposed pulp and that
this combination is thus a potential pulp-capping agent.
References
1. Schroder U. Effects of calcium hydroxide-containing pulp-capping agents on pulp
cell migration, proliferation, and differentiation. J Dent Res 1985;64:5418.
2. Andelin W, Shabahang S, Wright K, et al. Identification of hard tissue after experimental pulp capping using dentin sialoprotein (DSP) as a marker. J Endod 2003;29:
64650.
3. Ford TR, Torabinejad M, Abedi HR, et al. Using mineral trioxide aggregate as a pulpcapping material. J Am Dent Assoc 1996;127:14914.
4. Faraco IM Jr, Holland R. Response of the pulp of dogs to capping with mineral
trioxide aggregate or a calcium hydroxide cement. Dent Traumatol 2001;17:1636.
850
Min et al.
5. Min KS, Park HJ, Lee SK, et al. Effect of mineral trioxide aggregate on dentin bridge
formation and expression of dentin sialoprotein and heme oxygenase-1 in human
dental pulp. J Endod 2008;34:66670.
6. Kuratate M, Yoshiba K, Shigetani Y, et al. Immunohistochemical analysis of nestin,
osteopontin, and proliferating cells in the reparative process of exposed dental pulp
capped with mineral trioxide aggregate. J Endod 2008;34:9704.
7. Hammarstrom L. Enamel matrix, cementum development and regeneration. J Clin
Periodontol 1997;24:65868.
8. Heijl L, Heden G, Svardstrom G, et al. Enamel matrix derivative (EMDOGAIN) in the
treatment of intrabony periodontal defects. J Clin Periodontol 1997;24:70514.
9. Gestrelius S, Lyngstadaas SP, Hammarstrom L. Emdogain-periodontal regeneration
based on biomimicry. Clin Oral Investig 2000;4:1205.
10. Nakamura Y, Hammarstrom L, Matsumoto K, et al. The induction of reparative
dentine by enamel proteins. Int Endod J 2002;35:40717.
11. Nakamura Y, Slaby I, Matsumoto K, et al. Immunohistochemical characterization of
rapid dentin formation induced by enamel matrix derivative. Calcif Tissue Int 2004;
75:24352.
12. Butler WT. Dentin matrix proteins and dentinogenesis. Connect Tissue Res 1995;33:
5965.
13. Iohara K, Nakashima M, Ito M, et al. Dentin regeneration by dental pulp stem cell
therapy with recombinat human bone morphogenetic protein 2. J Dent Res 2004;
83:5905.
14. Mizuno M, Imai T, Fujisawa R, et al. Bone sialoprotein (BSP) is a crucial factor for
the expression of osteoblastic phenotypes of bone marrow cells cultured on type I
collagen matrix. Calcif Tissue Int 2000;66:38896.
15. Long MW. Osteogenesis and bone-marrow-derived cells. Blood Cells Mol Dis 2001;
27:67790.
16. Nakayama A, Ogiso B, Tanabe N, et al. Behavior of bone marrow osteoblast-like cells
on mineral trioxide aggregate: morphology and expression of type I collagen and
bone-related protein mRNAs. Int Endod J 2005;38:20310.
17. Tani-Ishii N, Hamanda N, Watanabe K, et al. Expression of bone extracellular matrix
proteins on osteoblast cells in the presence of mineral trioxide. J Endod 2007;33:
8369.
18. Weishaupt P, Bernimoulin JP, Trackman P, et al. Stimulation of osteoblasts with Emdogain increases the expression of specific mineralization markers. Oral Surg Oral
Med Oral Pathol Oral Radiol Endod 2008;106:3048.
19. He J, Jiang J, Safavi KE, et al. Emdogain promotes osteoblast proliferation and differentiation and stimulates osteoprotegerin expression. Oral Surg Oral Med Oral Pathol
Oral Radiol Endod 2004;97:23945.
20. Panagakos FS. Transformation and preliminary characterization of primary human
pulp cells. J Endod 1998;24:1715.
21. Lowry OH, Roberts NR, Wu ML, et al. The quantitative histochemistry of brain. II.
Enzyme measurements. J Biol Chem 1954;207:1937.
22. Couble M, Farges JC, Bleicher F, et al. Odontoblast differentiation of human dental
pulp cells in explant cultures. Calcif Tissue Int 2000;66:12938.
23. Nakashima M, Akamine A. The application of tissue engineering to regeneration of
pulp and dentin in endodontics. J Endod 2005;31:7118.
24. Jepsen S, Albers HK, Fleiner B, et al. Recombinant human osteogenic protein-1
induces dentin formation: an experimental study in miniature swine. J Endod
1997;23:37882.
25. Nakamura Y, Hammarstrom L, Lundberg E, et al. Enamel matrix derivative promotes
reparative processes in the dental pulp. Adv Dent Res 2001;15:1057.
26. Ishizaki NT, Matsumoto K, Kimura Y, et al. Histopathological study of dental pulp
tissue capped with enamel matrix derivative. J Endod 2003;29:1769.
27. Yasuda Y, Ogawa M, Arakawa T, et al. The effect of mineral trioxide aggregate on the
mineralization ability of rat dental pulp cells: an in vitro study. J Endod 2008;34:
105760.
28. Gomes-Filho JE, de Faria MD, Bernabe PF, et al. Mineral trioxide aggregate but not lightcure mineral trioxide aggregate stimulated mineralization. J Endod 2008;34:625.
29. Stein GS, Lian JB, Owen TA. Relationship of cell growth to the regulation of tissuespecific gene expression during osteoblast differentiation. FASEB J 1990;4:311123.
30. Fujisawa R, Kuboki Y. Changes in levels of ON in bovine dentin during tooth development. Arch Oral Biol 1989;34:8992.
31. Jontell M, Linde A. Non-collagenous proteins of predentin from dentinogenically
active bovine teeth. Biochem J 1983;214:76976.
32. MacDougall M, Simmons D, Luan X, et al. Dentin phosphoprotein and dentin sialoprotein are cleavage products expressed from a single transcript coded by a gene on
human chromosome 4. Dentin phosphoprotein DNA sequence determination. J Biol
Chem 1997;272:83542.
33. Feng JQ, Luan X, Wallace J, et al. Genomic organization, chromosomal mapping, and
promoter analysis of the mouse dentin sialophosphoprotein (Dspp) gene, which
codes for both dentin sialoprotein and dentin phosphoprotein. J Biol Chem
1998;273:945764.
Basic ResearchBiology
34. Mizuno M, Imai T, Fujisawa R, et al. Bone sialoprotein (BSP) is a crucial factor for
the expression of osteoblastic phenotypes of bone marrow cells cultured on type I
collagen matrix. Calcif Tissue Int 2000;66:38896.
35. About I, Bottero MJ, de Denato P, et al. uman dentin production in vitro. Exp Cell
Res 2000;258:3341.
36. Hwang YC, Hwang IN, Oh WM, et al. Influence of TGF-b1 on the expression of BSP,
DSP, TGF-b1 receptor I and Smad proteins during reparative dentinogenesis. J Mol
Histol 2008;39:15360.
37. Ishizaki NT, Matsumoto K, Kimura Y, et al. Histopathological study of
dental pulp tissue capped with enamel matrix derivative. J Endod 2003;
29:1769.
38. Kawase T, Okuda K, Momose M, et al. Enamel matrix derivative (emdogain) rapidly
stimulates phosphorylation of the MAP kinase family and nuclear accumulation of
smad 2 in both oral epithelial and fibroblastic human cells. J Periodontal Res
2001;36:36776.
39. Kawase T, Okuda K, Yoshie H, et al. Anti-TGF-antibody blocks enamel matrix derivative-induced upregulation of P21WAF1/cip1 and prevents its inhibition of human
oral epithelial cell proliferation. J Periodontal Res 2002;37:25562.
40. Iwata T, Morotome Y, Tanabe T, et al. Noggin blocks osteoinductive activity of
porcine enamel extracts. J Dent Res 2002;81:38791.
41. Kaida H, Hamachi T, Anan H, et al. Wound healing process of injured pulp tissues
with emdogain gel. J Endod 2008;34:2630.
851