articles

nature publishing group

Adipocyte Biology

Antiobesity Effects of yerba mat Extract

(Ilexparaguariensis) in High-fat
Dietinduced Obese Mice
Demtrius P. Arari1,2, Waldemar Bartchewsky1, Tanila W. dos Santos1, Karim A. Oliveira1,
Alexandre Funck1, Jos Pedrazzoli1, Marina F.F. de Souza2, Mario J. Saad3, Deborah H.M. Bastos2,
Alessandra Gambero1, Patricia de O. Carvalho4 and Marcelo L. Ribeiro1
Because the potential of yerba mat (Ilex paraguariensis) has been suggested in the management of obesity, the aim
of the present study was to evaluate the effects of yerba mat extract on weight loss, obesity-related biochemical
parameters, and the regulation of adipose tissue gene expression in high-fat dietinduced obesity in mice. Thirty
animals were randomly assigned to three groups. The mice were introduced to standard or high-fat diets. After
12weeks on a high-fat diet, mice were randomly assigned according to the treatment (water or yerba mat extract
1.0g/kg). After treatment intervention, plasma concentrations of total cholesterol, high-density lipoprotein cholesterol,
triglyceride, low-density lipoprotein (LDL) cholesterol, and glucose were evaluated. Adipose tissue was examined
to determine the mRNA levels of several genes such as tumor necrosis factor- (TNF-), leptin, interleukin-6 (IL-6),
C-C motif chemokine ligand-2 (CCL2), CCL receptor-2 (CCR2), angiotensinogen, plasminogen activator inhibitor-1
(PAI-1), adiponectin, resistin, peroxisome proliferator-activated receptor- 2 (PPAR- 2), uncoupling protein-1 (UCP1),
and PPAR- coactivator-1 (PGC-1). The F4/80 levels were determined by immunoblotting. We found that obese
mice treated with yerba mat exhibited marked attenuation of weight gain, adiposity, a decrease in epididymal fatpad weight, and restoration of the serum levels of cholesterol, triglycerides, LDL cholesterol, and glucose. The gene
and protein expression levels were directly regulated by the high-fat diet. After treatment with yerba mat extract,
we observed a recovery of the expression levels. In conclusion, our data show that yerba mat extract has potent
antiobesity activity in vivo. Additionally, we observed that the treatment had a modulatory effect on the expression of
several genes related to obesity.
Obesity (2009) 17, 21272133. doi:10.1038/oby.2009.158

Introduction

Yerba mat (Ilex paraguariensis) is one of the most widely

consumed plants in South America. It grows naturally or is
cultivated in Argentina, Brazil, Uruguay, and Paraguay. Mat
beverages have been reported to have various biological activities, which have been attributed to the high polyphenol content of yerba mat. The phenolic compounds have long been
known to possess biological functions. In addition to polyphenols such as flavonoids (quercetin and rutin) and phenolic
acids (chlorogenic and caffeic acids), yerba mat is also rich in
caffeine and saponins (1).
Recently published evidence have shown some beneficial effects
of I. paraguariensis, which include antioxidant activity (2), a protective effect against induced DNA damage (2), vasodilatation

effects (3), inhibition of glycation and atherosclerosis (4),

thermogenic effects (5), an improvement in glucose tolerance
(6), and antiobesity effects (7).
Obesity is a growing problem, resulting in significant
morbidity and mortality due to weight-related disease as well
as a reduced quality of life. The defect in energy balance that
causes obesity and visceral adiposity is a serious problem that
predisposes individuals to complications such as atherosclerosis, hepatic steatosis, and type 2 diabetes (8). The increasing incidence of obesity suggests that this epidemic will only
worsen in the future (9).
It is recognized that the obesity is associated with chronic mild
inflammation in which the metabolism of adipose tissue plays
an important role (10). The adipose tissue is an endocrine organ

1
Unidade Integrada de Farmacologia e Gastroenterologia, Universidade So Francisco, Bragana Paulista, Brazil; 2Departamento de Nutrio, Faculdade de Sade
Publica, Universidade de So Paulo, So Paulo, Brazil; 3Departamento de Medicina Interna UNICAMP, Campinas, Brazil; 4Laboratrio Multidisciplinar de Pesquisa,
Universidade So Francisco, Bragana Paulista, Brazil. Correspondence:Marcelo L. Ribeiro (marcelo.ribeiro@saofrancisco.edu.br)

Received 20 January 2009; accepted 20 April 2009; published online 14 May 2009. doi:10.1038/oby.2009.158
obesity | VOLUME 17 NUMBER 12 | december 2009

2127

articles
Adipocyte Biology
which has a fundamental role in metabolism and homeostasis
regulation through the secretion of several biologically active
adipokines with different protein structures and functions
including cytokines (leptin, tumor necrosis factor- (TNF-),
interleukin-6 (IL-6)), chemoattractant proteins (CCL receptor-2
(CCR2) and C-C motif chemokine ligand-2 (CCL2)), proteins
involved in the regulation of blood pressure, vascular homeo
stasis or angiogenesis (angiotensinogen and plasminogen
activator inhibitor-1 (PAI-1)), molecules involved in glucose
and lipid metabolism (adiponectin and resistin), adipogenesis peroxisome proliferator-activated receptor- (PPAR-),
and thermogenesis (PPAR- coactivator-1 (PGC-1) and
uncoupling proteins (UCPs)) (10).
There are data showing that animal models are a useful tool
to evaluate the efficacy of potential compounds in the prevention and treatment of obesity. It has been reported that rodents
fed high-fat diet are an excellent model of obesity where dietary environment is a major contributor (11). Additionally, in
animal models, chronic exposure to a high-fat diet induces
adipogenesis and the metabolic syndrome, and may modulate the inflammatory responses. Thus, the aim of the present
study was to evaluate the effects of yerba mat extract on
weight loss, obesity-related biochemical parameters, and the
regulation of adipose tissue gene expression in high-fat diet
induced obesity in mice.
Methods and Procedures
Mat tea preparation
The roasted yerba mat extract was prepared by dissolving instant mat
tea powder (Leao Jr, Curitiba-PR, Brazil) in pure water (25mg/ml) using
a homogenizer and was prepared fresh each day. The yerba mat extract
and vehicle (pure water) were administrated by intragastric gavage, to
guarantee total ingestion. The animals were treated for 8weeks and
received 1g of instant yerba mat/kg body weight.
Total phenolic concentration and chromatographic analysis
by high-performance liquid chromatography
The total phenolic concentration was measured by the Folin Ciocalteau
methodology, as described elsewhere (12). Chlorogenic acid (Sigma,
St Louis, MO) was used as a standard and total polyphenol concentration was expressed as equivalents to chlorogenic acid per g of instant
mat tea.
The instant mat tea was analyzed with no other modification than
the appropriate dilution in the mobile phase to fit the standard curves. A
Thermo Separation Products high-performance liquid chromatography
equipped with Spectra Series Gradient Pump, an automatic Spectra Series
Autosampler and a UV/VIS SpectraSystem UV/VIS detector was used
for the determinations. All the modules were controlled by a personal
computer equipped with the high-performance liquid chromatography System Manager SN4000 (SpectraSystem, San Jose, CA). A 4.6
250mm, 5m C18 Microsorb column was used for the separation. Injection volume was 20l. The analytical determination was carried out by
means of high-performance liquid chromatography using a two-solvent
isocratic elution. The composition of the solvents was: (A) water/acetic

acid (99.5:0.5v/v) and (B) methanol. The mobile phase composition was
75% of solvent A and 25% of solvent B. The flow rate was 0.8ml/min. Data
were obtained at 272nm for caffeine and theobromine and 323nm for
phenolic acids. The identification of phenolic compounds and methylxantines was based on the comparison of the spectra obtained between 250
and 350nm and the retention time of the unknown substances in relation
to that of pure standards. Quantification was achieved by external calibration, using a five-point curve of different dilutions of a standard solution.
Pearsons correlation coefficient (r) was always >0.99. The phytochemicals
from mat tea were shown in Table1.
Animals and diets
Thirty 6-week-old male Swiss strain mice (Sw/Uni) (27.3 0.4g) free
of specific pathogens were obtained from Centro Multidisciplinar Para
Investigacao Biologica (State University of Campinas, Campinas, Brazil).
The experiments were performed in accordance with the principles
outlined by the Brazilian College for Animal Experimentation (Colegio
Brasileiro de Experimentacao Animal) and received an approval from
Ethics Committee of the So Francisco University, Bragana Paulista,
Brazil. The animals were maintained on a 12h/12h artificial lightdark
cycle and housed in individual cages.
After random selection, mice were introduced to standard (s.d., n = 10)
or high-fat diets (n = 20) for 16 weeks. After the first 8 weeks on a highfat diet the obesity status was observed and the animals were randomly
divided into two subgroups in accordance with the treatment: one group
(HF-Mat, n = 10) received an aqueous extract of roasted yerba mat
extract (1.0mg/kg) and the other group received the vehicle (HF-C, n =
10) for 8 weeks. The compositions of the experimental diets are shown
in Table2. Body weight was measured twice a week during the feeding
period. At the end of the experiment mice were deeply anaesthetized (1:1
xilazineketamine) and blood samples were collected from the heart.
Then, transcardiac perfusion with 70ml isotonic saline solution (4C)
was carried out over a period of 6 min. White adipose tissue (WAT) from
the epididymal depot was dissected and weighed. The plasma, epididymal
WAT, and interscapular brown adipose tissue (BAT) samples were stored
at 80C until they were analyzed.
Biochemical analysis
Plasma concentrations of total cholesterol (CHOL), high-density
lipoprotein cholesterol, and triglyceride were determined using the
Cobas-Mira System (Roche Diagnostics, Indianapolis, IN). Plasma
LDL cholesterol concentration was calculated according to the formula:
CHOL(triglyceride/5+ high-density lipoprotein). The glucose levels
in serum were also determined using the Cobas-Mira System (Roche
Diagnostics).
RNA extraction and quantitative real-time PCR
WAT and BAT tissue fragments were collected, snap frozen, and
stored at 80C in RNAlater (Qiagen, Valencia, CA). Total RNA
was isolated using the RNeasy tissue kit (Qiagen). Single-stranded
cDNA was synthesized using the High Capacity cDNA Archive Kit
(Applied Biosystems, Foster City, CA) according to the manufacturers protocol. Quantitative real-time PCR was performed using
a 7300 real-time PCR System (Applied Biosystems), and threshold
cycle numbers were determined using RQ Study Software (Applied
Biosystems). Reactions were performed in triplicate, and threshold
cycle numbers were averaged. The 50l reaction mixture was prepared as follows: 25l of Platinum SYBR Green Quantitative PCR
SuperMix-UDG (Invitrogen Life Technologies, Alemeda, CA),
10mol/l of each primer (Table3), and 10l of cDNA (100ng). The

Table 1 Phytochemicals from mat tea (mg/g/day)

Caffeine
5.82 0.17

Theobromine

5-CQA

Caffeic acid

Total polyphenola

3.30 0.35

32.25 0.50

0.58 0.01

348.80 16.35

Determined from each chromatographic peak tentatively identified as chlorogenic acid, based in the UV spectra comparison with that of pure 5-caffeoylquinic
acid(5-CQA).
a

2128

VOLUME 17 NUMBER 12 | december 2009 | www.obesityjournal.org

articles
Adipocyte Biology
Table 3 Primers user in quantitative real-time PCR

Table 2Experimental diets composition

Standard diet
Cornstarch (Q.S.P.)
Casein

High-fat diet

g/kg

kcal/kg

g/kg

Kcal/kg

397.5

1,590

115.5

462

200

800

200

800

Sucrose

100

400

100

400

Dextrinated starch

132

528

132

528

Lard

312

2,808

Soybean oil

70

630

40

360

Cellulose

50

50

Mineral mix

35

35

Vitamin mix

10

10

l-Cystine

Choline
Total

2.5

2.5

1,000

5,358

1,000

3,948

s.d.

Body weight (g)

55

HF-C

Gene

Primer

Sequence (53)

-Actin

Sense

GCTACAGCTTCACCACCACA

Antisense

TCTCCAGGGAGGAAGAGGAT

Sense

TAGCCAGGAGGGAGAACAGA

Antisense

TTTTCTGGAGGGAGATGTGG

Sense

CTATGCCACCTTGGTCACCT

Antisense

ACCAAACCAAGCATTTTTGC

Sense

CCGGAGAGGAGACTTCACAG

Antisense

TCCACGATTTCCCAGAGAAC

Sense

ATTCTCCACACCCTGTTTCG

Antisense

GATTCCTGGAAGGTGGTCAA

Sense

CCCAATGAGTAGGCTGGAGA

Antisense

TCTGGACCCATTCCTTCTTG

Sense

GTCTTTCCGACCAAGAGCAG

Antisense

GACAAAGGCTGTGGAGGAAG

Sense

GGGTCAGAGCAGGAGTGTTC

TNF-
Leptin
IL-6
CCR2
CCL2
PAI-1
Adiponectin

Antisense

TAGCCAGCCTATCTGCCCTA

Resistin

Sense

AGCTGTGGGACAGGAGCTAA

Antisense

AGGAAAAGGAGGGGAAATGA

PPAR- 2

Sense

GATGGAAGACCACTCGCATT

Antisense

AACCATTGGGTCAGCTCTTG

Sense

TCAGGGCTGAGTCCTTTTGT

Antisense

CTGAAACTCCGGCTGAGAAG

Sense

CCGAGAATTCATGGAGCAAT

Antisense

TTTCTGTGGGTTTGGTGTGA

HF-Mat

45

35

25

8
12
Weeks

14

16

Figure 1 The effect of yerba mat extract on body weight gain in mice
fed the experimental diets. Symbols: standard diet (open squares), highfat diet (HF-C) (open circles), after treatment with yerba mat (HF-Mat)
(closed triangles).

reaction was cycled with preliminary UracilDNA glycosylase treatment for 2min at 50C and a denaturation step for 2min at 95C,
followed by 45 cycles of denaturation at 95C for 15s, annealing for
15s, and primer extension at 72C for 15s. This was followed by
melting point analysis of the double-stranded amplicons consisting
of 40 cycles of 1C decrement (15s each) beginning at 95C. The first
derivative of this plot, dF/dT, is the rate of change of fluorescence
in the reaction, and a significant change in fluorescence accompanies the melting curve of the double-stranded PCR products. A plot
of dF/dT vs. temperature displays these changes as distinct peaks.
TNF-, leptin, IL-6, CCL2, CCR2, angiotensinogen, PAI-1), adiponectin, resistin, PPAR-2, UCP1, and PGC-1 expression were examined
and normalized to a constitutive gene (-actin), and the relative fold
induction was calculated according to the formula 2(Ct) (13).
Protein extraction and western immunoblot analysis
Epididymal fat tissue fragments were excised and immediately
homogenized in solubilizing buffer at 4C (1% Triton X-100,
100mmol/l TrisHCl (pH 7.4), 100mmol/l sodium pyrophosphate, 100mmol/l sodium fluoride, 10mmol/l EDTA, 10mmol/l
sodium orthovanadate, 2.0mmol/l PMSF, and 0.1mg aprotinin/ml).
Insoluble material was removed by centrifugation for 20min at
9,000g at 4C. The protein concentration of the supernatants was
determined by the Biuret method. The extracts were treated with
Laemmli sample buffer containing 100mmol/l dithiothreitol and
heated in a boiling water bath for 5min, after which they were
subjected to sodium dodecyl sulfatepolyacrylamide gel electro
phoresis in a Bio-Rad miniature slab gel apparatus (Mini-Protean).
For immunoblot experiments, 0.15mg of protein extracts from each
obesity | VOLUME 17 NUMBER 12 | december 2009

UCP1
PGC-1

CCL2, C-C motif chemokine ligand-2; CCR2, CCL receptor-2; IL-6, interleukin-6;
PAI-1, plasminogen activator inhibitor-1; PGC-1, PPAR- coactivator-1;
PPAR- 2, peroxisome proliferator-activated receptor- 2; TNF-, tumor necrosis
factor-; UCP1, uncoupling protein-1.

tissue was separated by sodium dodecyl sulfatepolyacrylamide gel

electrophoresis, transferred to nitrocellulose membrane, and blotted
with anti-F4/80 or anti--actin. The nitrocellulose membranes were
developed using commercial chemoluminescent kits. Band intensities were quantitated by optical densitometry (Scion Image software;
ScionCorp, Frederick, MD) of the developed autoradiographs.
Statistical analysis
Data are expressed as the mean s.e.m. Comparisons among groups
of data were done using one-way ANOVA followed by the Dunnett
Multiple Comparisons test. An associated probability (P value) of <5%
was considered significant.
Results
Body weight and biochemical analysis

After 8 weeks on a high-fat diet there was a significant increase

in body weight as well as in glucose blood levels compared to
animals fed the standard diet (data not shown). At the end of
the study the total body weight of animals fed with the standard diet was lower than those fed the high-fat diet (P < 0.01,
Figure1). Regular ingestion of yerba mat extract significantly
decreased the final body weight (P < 0.05), when compared to
the HF-C group. The yerba mat intervention did not affect the
food intake. The epididymal fat weight of mice fed the high-fat
2129

articles
Adipocyte Biology
a

Table 4Anthropometric and biochemical parameters

43.00 1.41

Total
weight (g)
Food
intake (g)

NE

s.d.

Epididymal
fat (g)

**

1.5

F4/80/-Actin

##

0.5

0.0
s.d.

HF-C

HF-Mat

Figure 2 F4/80 protein expression in epididymal fat from control (s.d.),

high-fat (HF-C) diet, and after treatment with yerba mat (HF-Mat)
mice. Western blot analysis was performed on adipose tissue protein
extracts using antibodies against F4/80 (a) and -actin (b). The results
are representative of one experiment. Lower panel in (c) shows
the densitometry quantification of the F4/80 level, normalized by
densitometry quantification of the -actin level for the same sample.
Data are expressed as the means s.e.m. of five experiments.
**P<0.01, when compared with the control group and ##P < 0.01,
whencompared with the HF-C group.

diet was significantly higher than those fed the standard diet
(P < 0.01) (Table4).
The serum levels of cholesterol, high-density lipoprotein
cholesterol, triglycerides, and LDL cholesterol were significantly
higher among the HF-C group when compared to animals
fed the standard diet. Additionally, the high-fat diet caused
an increase in glucose serum levels (Table4). The treatment
with yerba mat extract for 8 weeks decreased serum levels of
cholesterol, triglycerides, LDL cholesterol, and glucose, when
compared to the HF-C group (Table4).
Adipokines mRNA expression

The mRNA expression levels of TNF-, leptin, IL-6, CCR2,

CCL2, angiotensinogen, PAI-1, adiponectin, resistin, PPAR- 2,
and PGC-1 were determined in WAT isolated from the previously described animals. Quantitative real-time PCR analysis
was also performed to evaluate the expression of PGC-1 and
UCP2 in interscapular BAT. In WAT, the high-fat diet caused
an upregulation of the TNF-, IL-6, leptin, CCR2, CCL2, angiotensinogen, and PAI-1 genes, significantly downregulated
adiponectin and PPAR- 2, and did not affect the expression of
resistin and PGC-1 (Table5). In BAT, the high-fat diet significantly downregulated the expression of UCP1, PPAR- 2, and
PGC-1. After treatment with yerba mat extract, the expression levels of cytokines (TNF-, IL-6, and leptin), chemo
attractant proteins (CCR2 and CCL2), and genes involved
in the regulation of blood pressure, vascular homeostasis or
angiogenesis (angiotensinogen and PAI-1) were significantly
reduced. On the other hand, the downregulation of genes
2130

HF-Mat
50.08 8.26

2.97 0.65

2.83 0.55

2.43 0.21**

1.82 0.10

154.67 17.93

284.60 24.48*

201.33 30.24

Cholesterol
(mg/dl)

88.67 6.43

203.00 9.54*

155.67 14.29

Triglyceride
(mg/dl)

132.00 3.61

190.33 5.69*

126.67 8.96

HDL
cholesterol

40.67 3.06

52.00 4.58

47.67 6.03

LDL
cholesterol

21.60 3.23

112.93 7.38*

Glucose
(mg/dl)

1.0

1.27 0.12

HF-C
54 10.09*

82.66 7.60

HDL, high-density lipoprotein; LDL, low-density lipoprotein; NE, Nonevaluated.

*P < 0.05 and **P < 0.01, when compared to s.d. group; P < 0.05 and

P < 0.01, when compared to s.d. group; P < 0.05, when compared to the
HF-C group.

Table 5 Gene expression determined by quantitative

realtime PCR
Gene

s.d.

HF-C

HF-Mat

TNF-

0.21 0.09

3.86 0.42**

0.49 0.18

IL-6

0.80 0.23

4.39 0.85**

0.66 0.34

Leptin

0.39 0.10

4.89 0.99**

0.47 0.16

CCR2

0.14 0.02

0.40 0.12*

0.17 0.09

CCL2

0.41 0.11

3.08 0.74**

0.45 0.26

PAI-1

0.83 0.26

3.19 0.62**

1.01 0.31

Adiponectin

1.25 0.33

0.27 0.09*

0.89 0.20

Resistin

1.85 0.17

2.03 0.43

1.89 0.34

PPAR-2

0.80 0.19

0.37 0.12*

0.87 0.02

PGC-1

1.39 0.22

0.40 0.14*

1.05 0.32

UCP1

0.58 0.19

0.29 0.11*

0.59 0.17

CCL2, C-C motif chemokine ligand-2; CCR2, CCL receptor-2; IL-6, interleukin-6; PAI-1, plasminogen activator inhibitor-1; PGC-1, PPAR- coactivator-1;
PPAR- 2, peroxisome proliferator-activated receptor- 2; TNF-, tumor necrosis
factor -; UCP1, uncoupling protein-1.
*P < 0.05 and **P < 0.01, when compared to s.d. group; P < 0.05, when
compared to s.d. group P < 0.05, and P < 0.01, when compared to the
HF-C group.

implicated in adipogenesis (PPAR- 2) and glucose and lipid

metabolism (adiponectin) were reversed (Table4). Inaddition, the yerba mat treatment recovered the expression of
genes implicated in thermogenesis (PGC-1 and UCP1) in
BAT (Table5).
Macrophage infiltration in adipose tissue

The level of F4/80 was increased in WAT from the HF-C group
when compared with animals fed the standard diet and was
significantly decreased after treatment with yerba mat extract
VOLUME 17 NUMBER 12 | december 2009 | www.obesityjournal.org

articles
Adipocyte Biology
(Figure2). F4/80 is a specific marker of activated macrophage
infiltration in the adipose tissue.
Discussion

In this study, yerba mat was evaluated for its putative effects
on weight loss, obesity-related biochemical parameters, and
the regulation of adipose tissue gene expression in high-fat
dietinduced obese mice. Our data clearly demonstrated that
when treated with yerba mat, obese mice exhibited marked
attenuation of weight gain adiposity, a decrease in epididymal
fat-pad weight, and a restoration of the serum levels of chole
sterol, triglycerides, LDL cholesterol, and glucose, as previously reported (46).
Yerba mat has been reported to have various biological
activities which have been mainly attributed to its high
polyphenol content (1). Chlorogenic acid, the main polyphenol in yerba mat, is thought to modulate the activity of
glucose-6-phosphatase, which is involved in glucose metabolism (14), and reduce the risk of cardiovascular disease by
decreasing the oxidation of LDL and cholesterol (15). In this
sense, our results are in accordance with previous studies that
have shown that I.paraguariensis treatment improves glucose
tolerance in obese animals (4,7). In addition to chlorogenic
acid, the presence of methylxantines is also thought to account
for some of the pharmacological effects of yerba mat (6). The
saponins, another important compound found in yerba mat,
have been reported to interfere with cholesterol metabolism
(16). Thus, the effects on cholesterol levels could be partially
attributed to its saponin content. The data presented in this
study suggested that the compounds found in yerba mat
extract may act synergistically to suppress body weight gain,
visceral fat accumulation, and decrease the serum levels of
cholesterol, triglycerides, LDL cholesterol, and glucose.
The adipose tissue is an endocrine organ which has a fundamental role in metabolism and homeostasis regulation. The
production and secretion of an excess or insufficient amount
of adipokines greatly influence insulin sensitivity, glucose
metabolism, inflammation, and atherosclerosis, and may provide a molecular link between increased adiposity and the
development of diabetes mellitus, metabolic syndromes, and
cardiovascular diseases (17). In the present study the expression of TNF-, IL-6, leptin, CCR2, CCL2, angiotensinogen,
PAI-1, adiponectin, PPAR- 2, PGC-1, and UCP1 in adipose
tissue were directly regulated by high-fat diet. Additionally we
described that treatment with yerba mat extract was able to
recover the expression of these genes.
Obesity is associated with a state of chronic, low-grade inflammation characterized by abnormal cytokine production and the
activation of inflammatory signaling pathways in WAT (18).
Obesity leads to increased production of several inflammatory
cytokines, which play a critical role in obesity-related inflammation and metabolic pathologies. TNF- is a potent cytokine
that induces the production of IL-6 (19), which is the major
determinant of the acute phase response, and also has effects on
glucose transport, lipid metabolism, and insulin action (20). It
has been reported that in obese individuals and animal models,
obesity | VOLUME 17 NUMBER 12 | december 2009

the levels of TNF- and IL-6 are persistently elevated (20), and
a reduction of adipose mass leads to a decrease in these expression levels (20). Additionally, TNF- can also modulates leptin
secretion by increasing its gene expression and circulating levels
(21). Although leptin levels have been positively associated with
the amount of body fat (22), a reduction in body weight could
lead to a reduction in leptin levels, as previously reported (22).
Our data showed that adipose tissue upregulates TNF-, IL-6,
and leptin mRNA expression, therefore it seems reasonable that
the anti-inflammatory effects observed after yerba mat extract
treatment could be attributed to the observed reduction on
adipose mass, and to an intrinsic anti-inflammatory activity of
yerba mat compounds (1).
Obesity also induces the accumulation of macrophages,
through the monocyte chemoattractant protein-1 (CCL2)/
CCR2 pathway, which produces some of the pro-inflammatory
molecules, released by adipose tissue and have been implicated in the development and maintenance of obesity-induced
adipose tissue inflammation (23). Adipose tissue expression
of (CCL2) and its receptor (CCR2) are increased in proportion to obesity, as described in the present study (24). As
CCR2 can regulate monocyte and macrophage chemotaxis as
well as local inflammation responses (25), our data indicate
that inhibition of CCL2/CCR2 could explain the low level of
macrophage infiltration observed after yerba mat extract
treatment, thus contributing to reduce the adipose tissue
inflammation.
The chronic and low level inflammation provided by
adiposity has been associated with obesity-related health
problems (18). PAI-1 is an important endogenous inhibitor
of tissue plasminogen activator and is a major determinant
of fibrinolytic activity. PAI-1 contributes to the pathogenesis
of atherothrombosis and cardiovascular diseases (26). It has
been shown that the elevation of PAI-1 levels can be attributed to its upregulation in WAT (27). Accordingly, the data
presented in this and other studies have shown a positive
correlation between PAI-1 levels and increased visceral
fat depots (28). However, weight loss is associated with a
reduced PAI-1 activity in obese subjects (28). Additionally,
it has been reported that TNF- can regulate PAI-1 expression (29). As it has been shown that I. paraguariensis extract
can inhibit the progression of atherosclerosis (4), the data
presented in this study showed that this could be due to the
ability of yerba mat extract to restore the mRNA levels of
PAI-1. Therefore, the downregulation of PAI-1 seems to be
due to the decrease in visceral fat-pad weight and the downregulation of TNF-, which might be a protective factor
against cardiovascular diseases.
Additionally, hypertension is also a frequent complication
of obesity and a major risk for the development of cardio
vascular diseases. A positive correlation between blood
pressure and circulating levels of angiotensinogen has been
demonstrated (30). In animal models, the upregulation of
angiotensinogen mRNA in WAT resulted in elevated plasma
angiotensinogen, hypertension, and increased WAT mass
(30). In addition, angiotensinogen-deficient mice are partially
2131

articles
Adipocyte Biology
protected from diet-induced obesity (31). Our data showed
that the mRNA levels of angiotensinogen were significantly
increased in obese animals, and the yerba mat supplementation was able to decrease those levels, which could lead to a
putative protection against hypertension.
Adiponectin is the most abundantly expressed adipokine in WAT (32). It is a multifunctional protein that exerts
pleiotropic insulin-sensitizing effects. It lowers hepatic glucose production and increases glucose uptake and fatty acid
oxidation in skeletal muscle (32). Additionally, an anti-inflammatory role of adiponectin has also been reported (32).
Unlike most adipokines, adiponectin mRNA in WAT and
its serum levels are decreased in obese individuals (33). It
has been reported that in animal models adiponectin levels
decreased with weight gain when the animals became obese
(33). However, weight loss resulted in significant increases
incirculating adiponectin levels (33). The results presented
here demonstrated that yerbamat extract supplementation
can recover the adiponectin mRNA levels, as an effect of
weight loss.
Adipogenesis is the developmental process by which a
multipotent mesenchymal stem cell differentiates into a
mature adipocyte. PPAR was found to be a master regulator
of adipogenesis (34). PPAR-2, a splicing isoform of PPAR,
is expressed selectively in the adipose tissues and promotes
the differentiation and proliferation of adipocytes causing an
increase in adipose tissue (35). In the present study the mRNA
levels of PPAR-2 were downregulated in visceral adipose
tissue from mice fed the high-fat diet. Although it has been
reported that a high-fat diet increases the expression levels of
PPAR-2 (36), our data show that the high-fat diet significantly
decreased the mRNA levels genes as previously described (7).
Accordingly, it appears that chronic exposure to high-fat diets
leads to an adaptive response that aims to limit the expansion
of fat storage (7). The results presented in this study show that
treatment with yerba mat extract recovered the mRNA levels
of PPAR-2 as previously described (7).
In contrast to WAT, which is mainly used for fat storage,
BAT uses lipids as a fuel for adaptative thermogenesis. BAT
is characterized by small, multilocular lipid droplets and
high numbers of mitochondria (37). Recently, a coactivator
of PPAR, PGC-1 has been identified and seems to stimulate mitochondrial biogenesis and respiration in muscle by
inducing the expression of UCPs (38). Several studies have
focused on adaptive thermogenesis by UCP families (UCP1,
UCP2, and UCP3) as a physiological defense against obesity
and diabetes (38). UCP-1 expression in BAT is known to be a
significant component of whole body energy expenditure, and
its dysfunction contributes to the development of obesity (39).
Our data showed that a high-fat diet downregulates the expression of PGC-1 and UCP1 in BAT, which may have decreased
energy expenditure and increased diet-induced obesity. The
present study also showed that PGC-1 and UCP-1 mRNA
levels in BAT were recovered after yerba mat treatment, which
could be attributed to the methylxantine content of yerba mat,
as suggested previously (7).
2132

In conclusion, this study reports that yerba mat extract has

potent antiobesity activity in vivo. Additionally, we observed
that the treatment has a modulatory effect on the expression of
several genes related with the obesity process.
Acknowledgments
We thank Fundacao de Amparo a Pesquisa do Estado de Sao Paulo
(06/61797-0), Financiadora de Estudos e Projetos (FINEP), and Leo Junior
S/A for financial support.

Disclosure
The authors declared no conflict of interest.
2009 The Obesity Society

References
1. Bastos DHM, De Oliveira DM, Matsumoto RLT, Carvalho PO, Ribeiro ML.
Yerba mate: pharmacological properties, research and biotechnology.
MedAromat Plant Sci Biotechnol 2007;1:3746.
2. Miranda DD, Arari DP, Pedrazzoli J et al. Protective effects of mate tea
(Ilexparaguariensis) on H2O2-induced DNA damage and DNA repair in
mice. Mutagenesis 2008;23:261265.
3. Stein FLP, Schimidt B, Furlong EB. Vascular responses to extractable
fractions of Ilex paraguariensis in rats fed standard and high-chloesterol
diets. Biol Res Nurs 2005;7:146156.
4. Mosimann ALP, Wilhelm-Filho D, Silva EL. Aqueous extract of Ilex
paraguariensis attenuates the progression of atherosclerosis in
cholesterolfed rabbits. BioFactors 2006;23:112.
5. Pomilio AB, Trajtemberg S, Vitale AA. High-performance capillary
electrophoresis analysis of mate infusions prepared from stems and leaves
of Ilex paraguariensis using automated micellar electrokinetic capillary
chromatography. Phytochem Anal 2002;13:235241.
6. Rodriguez de Sotillo DV, Hadley M. Chlorogenic acid modifies plasma and
liver concentrations of: cholesterol, triacylglycerol, and minerals in (fa/fa)
Zucker rats. J Nutr Biochem 2002;13:717726.
7. Pang J, Choi Y, Park T. Ilex paraguariensis extract ameliorates obesity
induced by high-fat diet: potential role of AMPK in the visceral adipose
tissue. Arch Biochem Biophys 2008;476:178185.
8. Berg AH, Scherer PE. Adipose tissue, inflammation, and cardiovascular
disease. Circ Res 2005;96:939949.
9. Haslam DW, James WP. Obesity. Lancet 2005;366:11971209.
10. Yudkin JS, Stehouwer CD, Emeis JJ, Coppack SW. C-reactive protein
in healthy subjects: associations with obesity, insulin resistance, and
endothelial dysfunction: a potential role for cytokines originating from
adipose tissue? Arterioscler Thromb Vasc Biol 1999;19:972978.
11. Bull M, Casas-Agustench P, Amig-Correig P, Aranceta J, Salas-Salvad J.
Inflammation, obesity and comorbidities: the role of diet. Public Health Nutr
2007;10:11641172.
12. Arabbi PR, Genovese MI, Lajolo FM. Flavonoids in vegetable foods
commonly consumed in Brazil and estimated ingestion by the Brazilian
population. J Agric Food Chem 2004;52:11241131.
13. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods
2001;25:402408.
14. Hemmerle H, Burger HJ, Below P et al. Chlorogenic acid and synthetic
chlorogenic acid derivatives: novel inhibitors of hepatic glucose-6-phosphate
translocase. J Med Chem 1997;40:137145.
15. Nardini M, DAquino M, Tomassi G et al. Inhibition of human low-density
lipoprotein oxidation by caffeic acid and other hydroxycinnamic acid
derivatives. Free Radic Biol Med 1995;19:541552.
16. Han LK, Zheng YN, Xu BJ, Okuda H, Kimura Y. Saponins from
platycodi radix ameliorate high fat diet-induced obesity in mice. J Nutr
2002;132:22412245.
17. Shimomura I, Hammer RE, Ikemoto S, Brown MS, Goldstein JL. Leptin
reverses insulin resistance and diabetes mellitus in mice with congenital
lipodystrophy. Nature 1999;401:7376.
18. Hotamisligil GS. Inflammation and metabolic disorders. Nature
2006;444:860867.
19. Bull M, Garca-Lorda P, Peinado-Onsurbe J, Hernndez M, Del Castillo D,
Argils JM, Salas-Salvad J. TNFalpha expression of subcutaneous adipose
tissue in obese and morbid obese females: relationship to adipocyte LPL
activity and leptin synthesis. Int J Obes Relat Metab Disord 2002;26:652658.
VOLUME 17 NUMBER 12 | december 2009 | www.obesityjournal.org

articles
Adipocyte Biology
20. Kern PA, Ranganathan S, Li C, Wood L, Ranganathan G. Adipose tissue
tumor necrosis factor and interleukin-6 expression in human obesity and
insulin resistance. Am J Physiol Endocrinol Metab 2001;280:745751.
21. Corica F, Allegra A, Corsonello A et al. Relationship between plasma leptin
levels and the tumor necrosis factor-alpha system in obese subjects. Int J
Obes Relat Metab Disord 1999;23:355360.
22. Xenachis C, Samojlik E, Raghuwanshi MP, Kirschner MA. Leptin, insulin and
TNF-alpha in weight loss. J Endocrinol Invest 2001;24:865870.
23. Weisberg SP, McCann D, Desai M et al. Obesity is associated
with macrophage accumulation in adipose tissue. J Clin Invest
2003;112:17961808.
24. Takahashi K, Mizuarai S, Araki H et al. Adiposity elevates plasma MCP-1
levels leading to the increased CD11b-positive monocytes in mice. J Biol
Chem 2003;278:4665446660.
25. Weisberg SP, Hunter D, Huber R et al. CCR2 modulates inflammatory and
metabolic effects of high-fat feeding. J Clin Invest 2006;116:115124.
26. Kruithof EK. Plasminogen activator inhibitorsa review. Enzyme
1988;40:113121.
27. Skurk T, Hauner H. Obesity and impaired fibrinolysis: role of adipose
production of plasminogen activator inhibitor-1. Int J Obes Relat Metab
Disord 2004;28:13571364.
28. Primrose JN, Davies JA, Prentice CR, Hughes R, Johnston D. Reduction
in factor VII, fibrinogen and plasminogen activator inhibitor-1 activity after
surgical treatment of morbid obesity. Thromb Haemost 1992;68:396399.
29. Sawdey MS, Loskutoff DJ. Regulation of murine type 1 plasminogen
activator inhibitor gene expression in vivo. Tissue specificity and induction
by lipopolysaccharide, tumor necrosis factor-alpha, and transforming
growth factor-beta. J Clin Invest 1991;88:13461353.

obesity | VOLUME 17 NUMBER 12 | december 2009

30. Massira F, Bloch-Faure M, Ceiler D. Adipose angiotensinogen is involved

in adipose tissue growth and blood pressure regulation. FASEB J
2001;15:27272729.
31. Massiera F, Seydoux J, Geloen A et al. Angiotensinogen-deficient mice
exhibit impairment of diet-induced weight gain with alteration in adipose
tissue development and increased locomotor activity. Endocrinology
2001;142:52205225.
32. Hu E, Liang P, Spiegelman BM. AdipoQ is a novel adiposespecificgenedysregulated in obesity. J Biol Chem 1996;271:
1069710703.
33. Yang WS, Lee WJ, Funahashi T et al. Weight reduction increases plasma
levels of an adipose-derived anti-inflammatory protein, adiponectin. J Clin
Endocrinol Metab 2001;86:38153819.
34. Rosen ED, Spiegelman BM. Molecular regulation of adipogenesis. Annu Rev
Cell Dev Biol 2000;16:145171.
35. Tontonoz P, Hu E, Spiegelman BM. Stimulation of adipogenesis in
fibroblasts by PPAR gamma 2, a lipid-activated transcription factor.
Cell1994;79:11471156.
36. Rodrguez E, Ribot J, Rodrguez AM, Palou A. PPAR-gamma2 expression
in response to cafeteria diet: gender- and depot-specific effects. Obes Res
2004;12:14551463.
37. Lowell BB, Spiegelman BM. Towards a molecular understanding of adaptive
thermogenesis. Nature 2000;404:652660.
38. Argils JM, Busquets S, Lpez-Soriano FJ. The role of uncoupling
proteins in pathophysiological states. Biochem Biophys Res Commun
2002;293:11451152.
39. Argyropoulos G, Harper ME. Uncoupling proteins and thermoregulation.
JAppl Physiol 2002;92:21872198.

2133