Clinical and Molecular Laboratory Techniques, Spring 2017

A portion of the forward strand of the KRAS gene is shown below (5 to 3) starting with the ATG of the
start codon.
1
1

atgactgaatataaacttgtggtagttggagctggtggcgtaggcaagagtgccttgacg
MetThrGluTyrLysLeuValValValGlyAlaGlyGlyValGlyLysSerAlaLeuThr

60
20

1A. Please circle the portion of the above sequencing electropherogram of the KRAS forward strand that
shows the sequence of glycine (G) codons 12 and 13. (if you cant read the type, A is green, C is blue, G
is black, and T is red.) Remember that sequence results are displayed from 5 to 3. Circling the sequence
in the AGTADNA sequence above may help.

1B. Please circle the portion of the above sequencing electropherogram of the KRAS reverse strand that
shows the sequence of glycine (G) codons 12 and 13. Remember that sequence results are displayed from
5 to 3. You may need to write out the sequence of the reverse strand and circle the desired codons.
1

Clinical and Molecular Laboratory Techniques, Spring 2017

2A. The above electropherogram shows the sequencing of the KRAS forward strand of a patient sample.
Does this patient have a mutation in codon 12 or 13? If so, please try to write out the correct
nomenclature for the nucleotide and amino acid sequence changes.

2B. Why do sequencing electropherograms sometimes have 2 peaks at the same position?

2C. Would you expect to see a result like the one shown above for a germline mutation? Why or why
not?

2D. Would you expect to see a result like the one shown above in a cancer specimen? Why or why not?