[Downloaded free from http://www.jovr.org on Friday, January 13, 2017, IP: 115.178.237.

7]

Original Article

Transplantation of Autologous Ex Vivo Expanded

Human Conjunctival Epithelial Cells for
Treatment of Pterygia: A Prospective Open-l
abel Single Arm Multicentric Clinical Trial
Viraf Sam Vasania1, PhD; Aarya Hari1, MSc; Radhika Tandon2, FRCOphth; Sanjay Shah3, MS
Suhas Haldipurkar4, DOMS; Smitesh Shah5, DOMS; Shailendra Sachan1, MBBS Chandra
Viswanathan1, MD, PhD
Regenerative Medicine Group, Reliance Life Sciences Pvt. Ltd., Navi Mumbai, Maharashtra, India
1

2
Dr. Rajendra Prasad Centre for Ophthalmic Sciences, All India Institute of Medical Sciences, New Delhi, India
3
Department of Ophthalmology, King Edward Memorial Hospital, Pune, Maharashtra, India
4
Laxmi Eye Institute, Panvel, Mumbai, Maharashtra, India 5Dr. Shahs
Laser Eye Institute, Kalyan West, Thane, Maharashtra, India

Abstract
Purpose: To establish the efficacy and safety of ex vivo cultured autologous
human conjunctival epithelialcell (hCjEC) transplantation for treatmentof pterygia.
Methods: Twenty-five patients with pterygia were recruited at different centers across
the country. Autologous hCjEC grafts were prepared from conjunctival biopsy
specimens excised from the healthy eye and cultured ex vivo on human
amniotic membrane mounted on inserts using a unique mounting device.
The hCjEC grafts were then transported in an in-house designed transport
containerfor transplantation. Post-surgery, the patients were followed up on
days 1, 7, 14, 30, 90, and 180 as per the approved
study protocol. Clinical outcomes were assessed by slit lamp examination,
visual acuity, imprint cytology,fluorescein/rose bengal staining, Schirmers test, and
photographic evaluation three and 6 months post-transplantation.
Results: Two patients were lost to follow-up and final analysis included
23 cases. No recurrence of pterygium was observed in 18
(78.3%) patients; all of these eyes showed a smooth conjunctival surface
without epithelialdefects. Recurrence was observed in 5 (21.7%) patients at
3 months post-treatment. No conjunctival inflammation, secondary infections
or other complications were reported. Adequate goblet cells were present
in 19 (82.6%) patients at the site of transplantation.
Conclusion: We have, for the 1st time, standardized a protocol
for preparing autologous hCjEC grafts that can be safely
transported to multiple centers across the country for transplantation. The
clinical outcome was satisfactory for treating pterygia.

Keywords: Autologous; Human Amniotic Membrane; Conjunctival Epithelial Cells; Goblet Cells;
Pterygium; Multicenter Study
J Ophthalmic Vis Res 2014; 9 (4): 407-416.

Journal of ophthalmic and Vision research 2014; Vol.

9,
No.
4
407
[Downloaded free from http://www.jovr.org on Friday, January 13, 2017, IP: 115.178.237.7]

Ex vivo Expansion of Autologous Human Conjunctival Epithelial Cells; Vasania et al

INTRODUCTION etiology of pterygia remains largely unknown;[1] but it is

believed to be caused by exposure to ultraviolet radiation, A
pterygium is a triangular or wing-shaped fibrovascular dust, and dry
climates.[2] In severe cases, visual loss overgrowth of abnormal conjunctiva
onto the cornea. The

Correspondence to: Access this article online

Chandra Viswanathan, MD, PhD. Quick Response Code:
Medicine Website:
Group, Reliance Life Sciences Pvt. www.jovr.org
R - 282, T.
C Area of MIDC,
DOI:
Belapur Road, Rabale, Navi 10.4103/2008-322X.150800
Mumbai - 400 701,

E-mail: chandra.viswanathan@ril.com

Received: 12-10
12-10
may arise from induced irregular corneal treatment for recurrent and
astigmatism, corneal stromal scarring and advanced pterygia.[17] Although more
obscuration of the visual axis.[3,4] time consuming, conjunctival autografting
Several surgical methods have been employed is a much safer and effective
for management of pterygium. approach than chemotherapy or
Simple excision using the bare sclera radiotherapy. This technique, targeted to
technique has been shown to be reduce recurrence, has resulted in
associated with a recurrence rate varying degrees of success.[18] Recurrence rates
of more than 70%.[5-8] This high as high as 39% after conjunctival
recurrence rate has led to the search for adjunctive treatment autografting has been reported.[19]
options such as chemotherapy or Limbal-conjunctival autografts after
radiotherapy. Different surgical techniques pterygia excision have also shown promise for
combined with adjuvants such as treatment of recurrent pterygia.[20,21]
mitomycin-C,[9] -irradiation,[10] thiothepa,[11] anti-VEGF There is wide variationin the extent
(vascular endothelial growth factor) of surgical excision of pterygia and
agents,[12] and more recently, alcohol[13] have subconjunctival fibrovascular tissue by
been tried in various combinations for various investigators.[22,23] Excision of larger
the treatment of pterygia. conjunctival grafts from the bulbar
The use of amniotic membrane grafts conjunctiva may help reduce the
(AMG) has been shown to be recurrence rate of pterygia but may
efficacious in treating primary pterygia.[14] result in complications such as
AMG serves as an alternative to scarring, fibrosis and inflammation at the
conjunctival tissue in eyes with large donor site.[24] Since the preferred site
conjunctival defects and inadequate tissue for autograft excision is the
to cover the bare sclera, commonly superior bulbar conjunctiva, patients requiring
seen in recurrent pterygia.[15] subsequent glaucoma surgery could face
However, in terms of preventing further problems.
recurrence, most studies have shown this In 1997, Pellegrini et al
treatment modalityto be less reported the first successful use of ex vivo
effective than conjunctival autografting.[16] The expansion for autologous transplantation
conjunctival autografting technique was without inducing iatrogenic injury normally
introduced by Kenyon et al in associated with autograft excision.[25]
1985 and has become a popular Since then, this technique is being

Journal of ophthalmic and Vision research 2014; Vol.

9,
No.
4
408
[Downloaded free from http://www.jovr.org on Friday, January 13, 2017, IP: 115.178.237.7]

Ex vivo Expansion of Autologous Human Conjunctival Epithelial Cells; Vasania et al

used extensively for treating various ocular Human Amniotic Membrane Processing
disorders with long-term positive Placentas were obtained, after due
clinical outcome.[26,27] The use of cultivated and ex vivo consenting process, from mothers undergoing
expanded conjunctival epithelial cell Caesarean section and were used to
sheets for treatment of pterygia has prepare HAM. Screening tests for
been in practice for a few years infectious disease were done for
now. The advantages of using human immunodeficiency viruses 1 and
cultivated conjunctival epithelium 2 (HIV-1, HIV-2), hepatitis B and C
include reduction in inflammation and viruses
early epithelialization leading to
faster recovery.[28-29]
benefit patients who are geographically Table 1. Criteria for selection of patients for the study
distant from the cell culture facility. Inclusion criteria
During the development stage, the major Patients with unilateral conjunctival
challenge was preparation of disorders
human conjunctival epithelial cell Male or female patients of 18 years
(hCjEC) grafts which could be transported and above
to hospitalsacross the country. To Patient willing to comply with protocol
overcome this issue, we developed described procedures
a novel device for mounting Writteninformed consent from patient/patients legal
representative
human amniotic membrane (HAM) which would
Exclusion criteria
serve as a substratefor culturing
Previous conjunctival transplantsurgery
the cells.[30] Further, we also designeda
Pregnant or lactating women
transportcontainer which would ensure graft
Patient with documented HIV infection/AIDS
integrity during shipment.[31] To the best
Historyof significant hematological,
of our knowledge, this is the
hepatic, renal, cardiovascular, respiratory,
We have standardized a method for HIV, human immunodeficiency viruses; AIDS,
acquired immune deficiency syndrome
ex vivo culture of autologous conjunctival
epithelial cells which would
408 Journal of ophthalmic and Vision research 2014; Vol. 9, No. 4
first multicentric clinical study to assess neurological, endocrinal or
the safety and efficacy of autologous allergic disease
hCjEC grafts transported across the Patients with history of diabetes
country and used for treatment of Coexisting conditions limiting the
pterygia. successful outcome of the
transplantsurgery such as dry eye
(Schirmers <6 mm), lid
METHODS margin disorder or actively inflamed eye
Any debilitating disease/disorder or
This study adhered to the tenets of psychiatric condition that in the
the Declaration of Helsinki and was judgment of the investigator
approved by the ethics committees would interfere with the adherence
of the study sites. Informed to the study protocol or
consent was obtained from all participants. ability to give informed consent
The study was conducted at four (HBV, HCV) by polymerase chain
sites across the country from January 2008 reaction (PCR) and for
to December 2009. Twenty-five cytomegalovirus (CMV-IgM, CMV-IgG),
patients were enrolled in the study as and Syphilis IgM/IgGby serology.
per the inclusion criteria [Table 1]. Amniotic membrane was
processed according to the
method proposed by Kim et
al.[32] Briefly, the placenta was
Journal of ophthalmic and Vision research 2014; Vol.
9,
No.
4
409
[Downloaded free from http://www.jovr.org on Friday, January 13, 2017, IP: 115.178.237.7]

Ex vivo Expansion of Autologous Human Conjunctival Epithelial Cells; Vasania et al

cleaned under aseptic conditions and the Scientific-Nunc, DK-4000 Roskilde,

amnion was separated from the Denmark) containing supplemental
chorion by blunt dissection. The hormonal epithelial medium (SHEM).
membrane was cut into pieces
admeasuring 4 cm 4 cm Preparation of Human Conjunctival
and placed on separate pieces of
nitrocellulose paper. Each membrane was
Epithelial Cell Grafts
placed in the sterile specimen Conjunctival biopsies,approximately 2 mm
cryogenic vial (Thermo Fisher Scientific-Nun 4 mm in size, with
c, DK-4000 Roskilde, Denmark) underlying stroma were obtained under strict
containing Dulbeccos modified aseptic conditions from the superior fornix
Eagles medium (DMEM) (Invitrogen-Gibco, of the contralateral healthy eye of
Carlsbad, CA, USA) and glycerol patients. Biopsies collected at the
(Sigma Aldrich, St. Louis, MO, USA) [1:1] respective sites by trained investigators
and cryopreserved at 80C. were sent to the current Good
Sterility checks and endotoxin tests were Manufacturing Practices (cGMP) facility for
performed before releasing the processing. They were transported at
membranes for clinical use. 2C8C in SHEM [Table 2]. The
biopsy was cut into pieces and
seeded on two HAM constructs in
Mounting on Human Amniotic Membrane SHEM. The cultures were incubated at
On the day of biopsy processing, 37C in an atmosphere of 5%
two membranes were thawed and CO2 and 95% air. Growth of cells from
washed thrice with sterile Dulbeccos the explants was monitored with an
phosphate-buffered saline (DPBS) (Invitrogen-Gi inverted phase-contrast microscope (Olympus
bco, Carlsbad, CA, USA) for 5 Corporation, Tokyo, Japan) for a period
min each time. The basement of 1421 days. The culture medium was
membrane side of HAM was then replenished on alternate days.
treated with trypsin-EDTA (Invitrogen-Gibco,
Carlsbad, CA, USA) for 15 min
Uniqueness of the Transport Container
at 37C. The amniotic epithelium was
The transportcontainer was designedto
gently removed using a cell scrapper and
hold the graft assembly in place
washed thrice for 5 min in DPBS
and protect the graft from
(1X) to remove cellular debris.
The HAM was oriented correctly, as Table 2. Composition of supplemental hormonal epithelial
described by Zakaria et al, with medium
its basement membrane facing Medium components Final Manufactured by
upwards.[33] The nitrocellulose membrane concentration
on the millicell insert (Millipore DMEM/F-12 1X Invitrogen-Gibco,
Corporation, Billerica, MA, USA) was (1:1) Carlsbad, CA,
gently peeled off. The insert was then USA
placed on top of the membrane Fetal bovine 10% HyClone Laboratories
and the edges of the membrane serum (ES Inc., Logan,
cell Utah,
were pulled over the rim of the
tested) USA
insert. This is now referred to as
Dimethyl 0.1% Sigma-Aldrich, St.
HAM construct. The HAM construct
sulphoxide Louis, MO, USA
was then flipped over and placed on
Epidermal 10 ng/ml Sigma-Aldrich, St.
the base of the mounting growth Louis, MO, USA
device [Figure 1a]. A silicone ring was factor
slipped onto the HAM construct using Insulin-transferrin 1X Invitrogen-Gibco,
the plunger of the mounting -selenium Carlsbad, CA,
device in order to provide a USA
wrinkle-free substrate[Figure 1b]. The HAM Hydrocortisone 0.5 g/ml Sigma-Aldrich, St.
construct was then flipped back and Louis, MO, USA
placed in the 6-well plate (Thermo Fisher
[Downloaded free from http://www.jovr.org on Friday, January 13, 2017, IP: 115.178.237.7]

Ex vivo Expansion of Autologous Human Conjunctival Epithelial Cells; Vasania et al

Basic fibroblast 4 ng/ml R&D systems, was needed for the transplantation. The
growth Minneapolis, MN, second graft was sent as a
factor USA standby in the unlikely event of
Penicillin- 1X Invitrogen-Gibco, damage to the first graft.
Streptomycin Carlsbad, CA,
USA
Gentamicin 50 g/ml Sigma-Aldrich, St.
In-Process Testing
Louis, MO, USA During graft preparation, spent medium was
DMEM, dulbeccos modified eagles medium;ES, checked for stem
embryonic sterility by direct inoculation
method as prescribed in the
current Indian Pharmacopoeia and endotoxin
test using the Limulus Amebocyte
Lysate (LAL) gel-clot method (Wako Chemicals,
Richmond, VA, USA) at different stages
during the process [Table 3]. Mycoplasma
testing of the spent medium was
carried out as per the manufacturers
instructions (Minerva Biolabs GmbH,
Berlin, Germany).

c
Characterization of the Human Conjunctival
Epithelial Cell Graft
After successful transplantation, the
a b second graft was sent back to the
Figure
(a 1. and b) Indigenously designed facility.
and Thepatented
expanded cells were
mounting device for mounting checked
human amniotic for
membraneviability and expression of
onto a millicell insert, (c) In-house key markers by semi-quantitative RT-PCR.
designed and patented stainless steel
transport container for transportation of
the graft to hospital site.
damage during transport. The transport
container is cylindrical in shape,
made of SS316 L and has a
screw cap lid [Figure 1c]. A
speciallydesignedsilicone gasket holds the graft
firmly in place and prevents leakage of
medium during transport.

Packaging of the Graft

Upon attaining confluence (approximately 1421
days), the grafts were individually
packaged in the in-house designed
transportcontainers. The graft assembly
was placed gently inside the container
and the medium was added slowly along
the sides. The silicone gasket was
placed on top and the container
was closed with the lid. The
prepared grafts were transported to the
hospital site for transplantation within 24
h of packaging. Only one graft

Journal of ophthalmic and Vision research 2014; Vol.

9,
No.
4
411
[Downloaded free from http://www.jovr.org on Friday, January 13, 2017, IP: 115.178.237.7]

Ex vivo Expansion of Autologous Human Conjunctival Epithelial Cells; Vasania et al

Gene Expression Profiling by Semi- Excess antibodies were washed off and
samples were mounted in immunofluorescence
RNA extraction was performed using Sterility Endotoxin Mycoplasma
RNeasy Mini Kit (QIAGEN, testing testing detection
Hilden, Germany) as per the Conjunctival culture * -
manufacturers instructions. One medium
microgram of RNA was Spent conjunctival -
converted into complementary DNA biopsy
(cDNA) utilizing the first strand collectionmedium -
synthesis kit (Invitrogen, Spent conjunctival
Carlsbad, CA, USA) as per culture medium - -
the manufacturers protocol.PCR was (day 10)
Spent conjunctival
performed as reported previously.[34] -
culture medium
The primer details are as given
(day 12)
in Table 4.
Spent conjunctival
culture medium
Cellular Characterization (at the time
During the standardization process for of
preparation of hCjEC grafts, packaging)
immunofluorescence staining was *Test was done;
Test was not done
performed to confirm the
identity of conjunctival
410 Journal of ophthalmic and Vision research 2014; Vol. 9, No. 4
Quantitative Reverse Transcription- mounting medium (Sigma-Aldrich, St. Louis,
polymerase Chain Reaction MO, USA) and observed under a
fluorescence microscope (Nikon E600) for
epithelial cells. Formalin-fixed paraffin-embed
the presence of immunoreactive cells.
ded sections of hCjEC graft were
deparaffinized with xylene and
graded alcohol treatment. The Surgical Procedure
sections were dipped in 10 mM The surgical procedure was carried out
sodium citrate buffer, pH 6.0 for as described previously.[18] Under local
antigen retrieval.The sections were anesthesia with 2% lignocaine, the
heated in a microwave oven head of the pterygium was
for 30 s and permeabilized completely removed by blunt dissection.
with 0.2% Triton X-100 in The hCjEC graft was washed 4 times
phosphate-buffered saline (PBS). The with DPBS (1X) containing D-glucose
non-specific binding sites were and sodium pyruvate (Invitrogen-Gibco,
blocked with 3% bovine serum Carlsbad, CA, USA) and placed over
albumin (BSA) in PBS for 60 the diseased conjunctival surface with the
minutes at 4C. Sections were epithelial cells facing upwards. The
incubated with mouse anti-cytokerati graft was trimmed to fit the entire
n epithelial clone AE1 (Millipore, conjunctival defect, including the bulbar
Billerica, MA, USA), mouse anti-c surface of the fornix and the
ytokeratin epithelial clone AE3 deeper portion of the palpebral aspect
(Millipore, Billerica, MA, USA), of the fornix, if required.It was
goat anti-mucin MUC4 (Santa Cruz then secured to the recessed conjunctival
Biotechnology, Santa Cruz, CA, USA), edge with a few interrupted or
and mouse anti-mucin MUC5AC running 8.0 vicryl sutures so that its
(Millipore, Billerica, MA, USA) margin remained placed under the
overnight at 4C followedby conjunctival margins. Sutures were tied
incubation with their respective carefullyensuring that the trailing
FITC-conjugated secondary antibodies
for 30 minutes at 4C.
[Downloaded free from http://www.jovr.org on Friday, January 13, 2017, IP: 115.178.237.7]

Ex vivo Expansion of Autologous Human Conjunctival Epithelial Cells; Vasania et al

Table 3. Schedule for in-process testing Stage In-process quality checks suture did not
drag along the surface of the
Table 4. Primers used for semi-quantitative RT-PCR
membrane. If clinically
Gene Primer sequence
required (based on investigators
discretion), the conjunctival graft
p63 F -
was then tucked to the deep
AGCAGCAAGTTTCGGACAGT
fornix by a muscle hook
R -
GCTGCTGAGGGTTGATAAGC anchored to the palpebral
Oct4 F - side of the fornix by
AGTGAGAGGCAACCTGGAGA passing two or three double-armed
R - 6.0 vicryl sutures through the full
CAAAAACCCTGGCACAAACT thickness of the lid and
CK4 F - secured to the skin with
CCAGGAGCTCATGAGTGTGA silicone bolsters. The rest of the
R - conjunctival graft was then
CCAAACTCCAAGAGGCAGAG secured and flattened to the bulbar
CK7 F - aspect by interrupted 10.0 nylon
sutures with superficial scleral bites.
CAGGAACTCATGAGCGTGAA R - A topical broad-spectrum antibiotic was
used and the eye was patched. The
GGGTGGGAATCTTCTTGTGA
patch was not disturbed for the
CK12 F -
next 24 h. Post-operatively, prednisolone
eye drops were instilled 4 times a
AGGACTGGGTGCTGGTTATG R -
day for 4 weeks, followedby
CAGGGCCAGTTCATTCTCAT topical fluorometholone and tobramycin 4
CK19 F - times a day for the next 4
AGCAGGTCCGAGGTTACTGA weeks. Lubricating eye drops were
R - administered at 2-4 h intervals for
CCTCCAAAGGACAGCAGAAG the first 1-month and then tapered down
ABCG2 F - to 3 times a day for the
next 2 months.
TTATCCGTGGTGTGTCTGGA R -
Post-operative Evaluation of Clinical
CCTGCTTGGAAGGCTCTATG
Integrin 1 F - Outcomes
Throughout the study, operated eye was
AATGAAGGGCGTGTTGGTAG R - observed for signs of inflammation
CCTCGTTGTTCCCATTCACT and infection. Patients were monitored
Connexin F - on at post-operative days 1, 7,
43 14, 30, 90, and 180 for graft
GGACATGCACTTGAAGCAGA R - edema, lacrimation, graft retraction/ necrosis
GGTCGCTCTTTCCCTTAACC and irritation.
MUC4 F - Physiological and anatomical assessment
of conjunctival epithelium was done
AAAACAGCCCACTGATGTCC R - on day 90 and day 180 using
local and slit lamp examination,
CCAGCCTTCACGAAACTCTC
imprint cytology, fluorescein/ rose-bengal
GAPDH F -
staining, Schirmers test, and visual
acuity. The graft success was assessed based
TTCACCACCATGGAGAAGG R -
CATGTGGGCCATGAGGTC
on the smoothness, vascularity,
RT-PCR, reverse transcription-polymerase chain reaction; epithelial
CK, integrity,adequatehydration, tear
glyceraldehyde-3-phosphate dehydrogenase formation and the presence of goblet
Journal of ophthalmic and Vision research 2014; Vol.
9,
No.
4
413
[Downloaded free from http://www.jovr.org on Friday, January 13, 2017, IP: 115.178.237.7]

Ex vivo Expansion of Autologous Human Conjunctival Epithelial Cells; Vasania et al

cells on the conjunctival surface. Any confidence interval along with counts and
evidenceof inflammation of the proportions.
conjunctival surface, necrosis at the site
of transplant, dry cornea with
blurred vision and mucopurulent discharge
RESULTS
from the recipient eye within 1-week of The demographic and clinical details are
transplantation were considered as signs summarized in Table 5. A total
of graft failure. of 25 patients from four different
centers were recruited. These patients
underwent pterygium excision followedby
Statistical Analysis
transplantation of autologous human
Data processing, tabulation of
conjunctival epithelial cell graft. The
descriptive statistics, and calculation
patients included 12 (48.0%) male and 13
of inferential statistics was performed
(52.0%) female subjects with mean age of
primarily using SAS software (release 9.0
43.9 (range, 2567) years. All patients were
or higher) for Windows. Statistical
followedfor 6 months. Two (8.0%)
analysis was performed using 95%
patients were lost to follow-up.
[Downloaded free from http://www.jovr.org on Friday, January 13, 2017, IP: 115.178.237.7]

Ex vivo Expansion of Autologous Human Conjunctival Epithelial Cells; Vasania et al

All conjunctival biopsies even from the SD, standarddeviation; hCjEC, human conjunctival epithelia
farthest site (approximately 2,000 km away)
were received at the facility within 24
h of excision.They were well
transported at 2C8C in a
validated shipper. The biopsies were cut
into small pieces and seeded as
explants on two different HAM in
parallel. Initial migration of the
a b
conjunctival epithelial cells from the
explants was seen by day 2 Figure 2. Phasecontrast microscopy of expanded
ex vivo
[Figure 2a]. The cells started expanding hCjECs from conjunctival biopsy. (a) Primary explant c
in a concentric manner and from conjunctival explants seeded on HAM
showed typical cobble-stone morphology show budding of cells by day
[Figure 2b]. On day 12, mycoplasma 2. (b) Confluent monolayer
testing by PCR was done on the of cells showing cuboidal morphology
typically of epithelial cells by day
spent medium.All the cultures (n =
14. Total magnification of the
24) were found to be negative phase-contrast image: 100. Arrow shows
[Figure 3]. A confluent sheet of budding of cells from the
epithelial cells was obtained within 14-21 explants. hCjECs, human conjunctival
days. These hCjEC grafts were then epithelial cells; HAM, human amniotic
packaged and transported in membrane.
speciallydesignedstainless steel transportcontainers the size of the excised tissue from
that maintained graft integrity during the donor eye did not provide
transit. adequatecells for characterization. Hence, it
All the cultivated conjunctival grafts, was decided to confirm the identity of
at process development stage, showed high the cultured cells post-operatively, from the
expression of cytokeratin epithelial second graft sent back by the
clones AE1 and AE3; and goblet-cell investigator.
rich mucins, MUC4 and MUC5AC by The second hCjEC graft was transported
immunofluorescence staining, thus confirming back at 2C8C and received at
that they were conjunctival cells the cGMP facility within 48 h of
[Figure 4]. transplantation. Upon receipt, these unused grafts
Much as it would have been were assessed for viability and molecular
desirable to characterize the characterization. The viability of the cells
cultivated conjunctival grafts prior to as determined by trypan blue dye
transplantation, exclusion assay was between 78% and
Table 5. Demographic and clinical details of the study 90% [Figure 5a] in all specimens.
Semi-quantitativeRT-PCR analysis was done on
Number of patients 25 (100.0)
conjunctival cells. High levels of
Left eye affected 15 (60.0)
mRNA expression of epithelial stem
Right eye affected 10 (40.0)
cell marker, p63; conjunctival epithelial
Mean age (years) SD 43.911.09
cell markers, CK4 and CK7; epithelial
Range of age 25-67
basal marker, CK19; integrin 1 (CD29);
(years)
connexin 43 (CX43); and goblet-cell
Gender 12 (48.0) male
13 (52.0) female
marker, MUC4 were observed in these
Race Indian/Asian
cells. We also observed that these
Treatment modality hCjEC graft
cells weakly expressed CK12 and
transplantation ABCG2.These results clearly indicate that the
Graft rejection None cells retain their normal characteristics
Pterygium recurrence 5.0 (21.7) [Figure 5b].
Patients lost to 2.0 (8.0) The focus of the study was also
follow-up to determine the clinical acceptance
and success of the graft and the
rate of pterygium recurrence.
Figure 6a-f shows a case with
 pterygium extending up to thepatients within 14 days of transplantation.
central cornea from the nasal region in On day 90, no conjunctival
the right eye prior to and after
inflammation was seen in the
hCjEC grafting on days 1, 14, 30,operated eye of 22 (95.7%) patients but
90, and 180. in 1 (4.3%) patient it persisteduntil
One of the evaluated parameters the end of study period. Other
was reduction in ocular surface parameters such as overall luster,
inflammation. We observed that discharge, and bleeding were also
conjunctival inflammation subsided to monitored in the treated eye in
normal levels all patients. Luster and discharge from
16 (69.6%) patients within 7 the
days and in recipient
18 eye was
(78.3%) normal from day
14 onwards until the end of the
study. Minor bleeding was observed in
2 patients on day 7 but there
was no conjunctival bleeding in any
patient from day 14 up to the
end of the study as shown in
Table 6. There were no secondary
infections or other complications
observed with respect to the
transplant.
Visual acuity of the recipient eye
was checked on day 1 and post-o
perative days 90 and 180. The
number of patients with visual acuity of
6/6 increased from 7 (28%) pre-o
peratively to 12 (48%) at final
FigureDetection
3. of Mycoplasma visit. medium
DNA. Spent No worsening of
day 12) ( was tested by polymerase chain reaction (PCR) using
412
primer sets specific to the highly
conserved 16S rRNA coding region
in the mycoplasma genome. The
expected product sizes for positive and
negative controls are 270 and 191
base pairs, respectively. Spent
medium (day 12) was found a
negative. A 100 bp DNA ladder
was used as the molecular
size marker. PCR data presented here
are representative of 24
b
independent clinical samples.
Figure 4. Cellular characterization of hCjEC graft.
Representative images of
immunofluorescence staining for (a)
acidic (type I) cytokeratin (AE1),
(b) basic (type II) cytokeratin
(AE3), and goblet-cell rich mucins,
(c) MUC4 and (d) MUC5AC
a b on paraffin sections of the
conjunctival graft. hCjEC, human
conjunctival epithelial cell.

c d
[Downloaded free from http://www.jovr.org on Friday, January 13, 2017, IP: 115.178.237.7]

Ex vivo Expansion of Autologous Human Conjunctival Epithelial Cells; Vasania et al

presence of tears in all 23

(100%) patients at days 90 and 180.
No recurrence of pterygium was
observed in 18 (78.3%) patients until
day 180 and conjunctival surface
appeared clinically normal in these
patients from 3 months post-operatively. In
the remaining 5 (21.7%) patients,
a b pterygium c recurrence was observed
within 6 months.

DISCUSSION
Pterygia are complex fibrovascular conjunctival
overgrowths on the cornea and
surgical excision is the most prevalent
treatment option. Recurrence is
d e common and f therefore, newer approaches
to treat pterygia are being contemplated
Figure 6. (a) Pre-operative photograph of theand tried by researchers and
pterygium extendingfrom the nasal region.
ophthalmic surgeons.[15] More recently,
graft transplantation, taken on (b) dayautologous conjunctival epithelial cell
30, (e) day 90, and (f) day
grafting has been reported for reconstructing
recurrence of pterygium. hCjEC, human
Figure 5. Viability and gene expression
conjunctival defects.[29] The results of our
analysis of returned hCjEC grafts. (a) clinical trial to assess the safety and
Cell viability was determined by efficacy of such autologous grafts to
trypan blue dye-exclusion assay on stabilize the conjunctival surface have been
conjunctival cells recoveredfrom the promising. This clinical study was
returned grafts. (b) RNA was isolated conducted with formal approval from the
from the graft and expression Drug Controller General of India, the
of p63, Oct4, CK4, CK7, CK12, highest approving authority, in the
CK19, ABCG2, integrin 1 (Int 1), Indian context. All procedures for graft
connexin 43 (CX43), and MUC4 were
preparation including cell
analyzed by semi-quantitative RT-PCR.
GAPDH was used as an internal characterization and transportconditions were
standard. The expected product sizes for established prior to commencement of
GAPDH, p63, Oct4, CK4, CK7, CK12, the study.
CK19, ABCG2, integrin 1 (Int 1), Conjunctival epithelial cell transplantation
connexin 43 (CX43), and MUC4 are requires a carrier tissue, as it is
690, 378, 447, 491, 346, 436, not possible to transfer these cells alone.
367, 429, 664, 368, and 353 A natural basement membrane, HAM
base pairs, respectively. A 100 is already in clinical use and is
bp DNA ladder was used as
believed to minimize ocular inflammation,
the molecular size marker. Data
reduce pain and aid in
presented here are representative of
24 independent clinical samples. RT-PC epithelialization. [35]
HAM has been used as
R, reverse transcriptase-polymerase chain carrier tissue for conjunctival stem cells.
reaction.
[29]
In our study, we used HAM
vision was observed in any as the substratum for culturing
patient during the follow-up period. conjunctival epithelial cells.
Imprint cytologyshowed that goblet cells The hCjEC grafts were prepared from the
at the site of transplantation were ipsilateral conjunctival tissue. Regardless
seen in 17 (73.9%) patients on day of age, the biopsy samples were all
30 and in 19 (82.6%) patients by 2 mm 4 mm in size
day 180. No goblet cell was seen and all of them were cultured on
in 3 (13%) patients at the end HAM as per the procedure
of the study. In addition,Schirmers described in the methods section. The
test confirmed adequatehydration with quality of the prepared graft is
directly related to the conjunctival
biopsy tissue excised from the donor eye. (78.3) (21.7)
Despite this inherent variation, our 30 18 5
results showed consistency in the
quality of the grafts prepared using this (78.3) (21.7)
standardized method. 90 22 1 (4.3)
Transporting the grafts to distant sites
across the country was a (95.7)
180 22 epithelial cell 1 (4.3)
proper orientation and integrity of the *hCjEC, human conjunctival
graft during (95.7)
414 Luster 7 23 Vol. 9, No. 40
Journal of ophthalmic and Vision research 2014; (0)
challenge. We did validation
runs to establish the logistics and (100)
transportconditions. The in-house 14 23 0 (0)
designedtransportcontainer maintained
transit. Our validation study (100)
showed that the graft can be 30 23 0 (0)
transported at 2C8C
(100)
without affectingits viability and
90 23 0 (0)
integrity [Table 7]. No instance of
graft damage was noted during
(100)
transport. Also, cell viability of
180 23 0 (0)
all returned grafts was found to
be greater than 80% when (100)
assessed 48 h after surgery. At Discharge 7 22 1 (4.3)
the hospital site, the doctors and
the paramedical staff were (95.7)
trained to handle the graft to 14 23 0 (0)
ensure that there is no
damage during transplantation. (100)
Most of our patients had primary 30 23 0 (0)
pterygia while five cases had
recurrent lesions. The primary (100)
objective of the study was 90 23 0 (0)
to assess feasibility of the
graft through manifestations such as (100)
inflammation, graft melting, mucopurulent 180 23 0 (0)
discharge, necrosis,and redness on
the recipient eye. The entire study (100)
was uneventful with no cases Bleeding 7 21 2 (8.7)
having post-operative infections or
(91.3)
redness. Minor adverse events like eye
14 23 0 (0)
pain and local irritation subsided with
medications. (100)
30 23 0 (0)
Table 6. Parameters monitored in the recipient eye
posttransplantation (100)
Parameter Follow-up Number of patients 90 23 0 (0)
(days) (n=23) (%)
Normal Abnormal (100)
180 23 0 (0)
Inflammation 7 16 7
(100)
(69.6) (30.4)
14 18 5
Table 7. Stability study of the hCjEC* grafts (n=10)
[Downloaded free from http://www.jovr.org on Friday, January 13, 2017, IP: 115.178.237.7]

Ex vivo Expansion of Autologous Human Conjunctival Epithelial Cells; Vasania et al

Parameter Storage time at 2C-8C conjunctival surface became smooth gradually

analyzed by the end of 3 months and
6h 12 h 24 h 48 h
continued up to the end of
Attachment of cells Good Good the study. Further, at the end of
Good Good
1-year, we had informal communication that
Morphology of cells Cuboidal Cuboidal Cuboidal
there was no change in the
Cuboidal
smoothness at the transplant site.
Cell viability % 952 902
883 823
Presence of adequategoblet cells is
pH of the transport 7.2 7.3 7.5
a critical parameter that reflects the
8.3 medium overall health of the ocular surface.[37]
Surgical excision remains the conventional At least 19 (82.6%) patients showed
treatment for pterygium and sufficient goblet cells at day 180.
recurrence is the most common This is another important indicatorof
undesirable outcome. The two normal conjunctival regeneration post-transplant.
important concernsin pterygium In other studies, transplantation of an
surgery are to reduce pterygium autologous cultivated conjunctival
recurrence and minimize complications epithelial sheet facilitated early post-o
arising from surgery. There is no perative epithelialization and recovery.
standard definition of recurrence but However, true recurrence was
when a fibrovascular outgrowth is observed in 22.7% cases.[18] In our
observed at the site of clinical study, 5 (21.7%) patients showed signs
previously excised pterygium, it is of recurrent pterygia 3 months post-t
generally accepted as recurrence.[15] It ransplantwhich is consistent with other
has been reported that at least 97% reports.
of all recurrences manifest within the In conclusion, we demonstrated for
1st year after excision.[36] Much as it would the 1st time, the feasibility of
have been desirable to extend transporting ex vivo expanded autologous
follow-up to 1-year, our approved human conjunctival epithelial cells
protocol was limited to 6 months. (hCjECs) to distant locations
However, we did follow the without compromising viability and integrity of
patients for up to 1-year through the graft. This method of transporting
telephone interactions with the cultured grafts in the present study seems
investigator, purely out of interest. In satisfactory. Larger studies with longer
our study, 18 (78.3%) patients had no follow-up will be needed before one
recurrence of the pterygia at 6 can consider this method as the
months. Informal communication confirmed that preferred alternative for treatment
there was no recurrence in these of pterygia.
patients even after 1-year.
Ocular surface inflammation plays a ACKNOWLEDGEMENTS
significant role in increasing the
The authors would like to thank
risk of pterygium recurrence. Reliance Life Sciences Pvt. Ltd.
Hence, control of inflammation before and (www.rellife.com) for providing the
after surgery is essential for reducing opportunity and financial support to
recurrence rate. In our study, carry out the clinical study. They
conjunctival inflammation subsided in 18 also thank All India Institute of
(78.3%) patients within 14 days post-operativel Medical Sciences, New Delhi; King Edward
y and no conjunctival inflammation MemorialHospital, Pune; Laxmi Eye
was present in 22 (95.7%) patients by Institute, Panvel; and Dr. Shahs Laser
day 90. This observation continued Eye Institute, Kalyan for conducting
this study.
until the end of the study. No
other serious complications were reported
during the study indicating that
hCjEC graft was well tolerated at the REFERENCES
site of transplantation. 1. Tan DT, Tang WY, Liu YP, Goh
Integrity of the conjunctiva is HS, Smith DR. Apoptosis and
a very important end point. The apoptosis related gene expression in normal
 conjunctiva and pterygium. Br J Ophthalmol20. Gris O, Gell JL, del Campo Z.
2000;84:212-226. Limbal-conjunctival autograft transplantation for
2. Coroneo MT. Pterygium as an early the treatment of recurrent pterygium.
indicator of ultraviolet insolation: A Ophthalmology 2000;107:270-273.
hypothesis. Br J Ophthalmol 1993;77:734-739. 21. Ozer A, Yildirim N, Erol N,
3. Spraul CW, Grossniklaus HE. Tumors of Yurdakul S. Long-term results of bare
the cornea and conjunctiva. Curr sclera, limbal-conjunctival autograft and amniotic
Opin Ophthalmol 1996;7:28-34. membrane graft techniques in primary
4. Hill JC, Maske R. Pathogenesis of pterygium excisions. Ophthalmologica 2009;223:269-273.
pterygium. Eye (Lond) 1989;3 (Pt 2):218-226. 22. Chen PP, Ariyasu RG, Kaza V, LaBree
5. Cameron ME. Pterygium Throughout the World. LD, McDonnell PJ. A
Springfield IL: Charles C Thomas; randomized trial comparing mitomycin C
1965. and conjunctival autograft after excision
of primary pterygium. Am J Ophthalmol
6. Youngson RM. Recurrence of pterygium after
1995;120:151-160.
excision. Br J Ophthalmol 1972;56:120-125.
23. Tan DT, Chee SP, Dear KB, Lim
7. Frucht-Pery J, Siganos CS, Ilsar M.
AS. Effect of pterygium morphology
Intraoperative applicationof topical
on pterygium recurrence in a
mitomycin C for pterygium surgery.
controlled trial comparing conjunctival
Ophthalmology 1996;103:674-677.
autografting with bare sclera
8. Alpay A, Uurba SH, Erdoan B. excision. Arch Ophthalmol 1997;115:1235-1240.
Comparing techniques for pterygium surgery.
24. Vrabec MP, WeisenthalRW, Elsing SH.
Clin Ophthalmol 2009;3:69-74.
Subconjunctival fibrosis after conjunctival
9. Lam DS, Wong AK, Fan DS, Chew autograft. Cornea 1993;12:181-183.
S, Kwok PS, Tso MO.
25. Pellegrini G, Traverso CE, Franzi AT,
Intraoperative mitomycin C to prevent
Zingirian M, Cancedda R, De Luca
recurrence of pterygium after excision: A
M. Long-term restoration of damaged corneal
30-month follow-up study. Ophthalmology
surfaces with autologous cultivated corneal
1998;105:901-904.
epithelium. Lancet 1997;349:990-993.
10. Aswad MI, Baum J. Optimal time for
26. Schwab IR, Reyes M, Isseroff RR.
postoperative irradiation of pterygia.
Successful transplantation of bioengineered
Ophthalmology 1987;94:1450-1451.
tissue replacements in patients with
11. Cassady JR. The inhibition of pterygium ocular surface disease. Cornea 2000;19:421-426.
recurrence by thio-tepa. Am J Ophthalmol
27. Sangwan VS, Matalia HP, Vemuganti GK, Fatima
1966;61:886-888.
A, Ifthekar G, Singh S, et al. Clinical
12. Detorakis ET, Zaravinos A, Spandidos DA. Growth outcome of autologous cultivated limbal
factor expression in ophthalmic pterygia epithelium transplantation. Indian J Ophthalmol
and normal conjunctiva. Int J Mol Med 2006;54:29-34.
2010;25:513-516.
28. Tan DT, Ang LP, Beuerman RW.
13. Chen KH, Hsu WM. Intraoperative ethanol Reconstruction of the ocular surface
treatment as an adjuvant therapy of by transplantation of a serum-fr
pterygium excision. Int J Biomed Sci 2006;2:414-421. ee derived cultivated conjunctival epithelial
14. Ma DH, See LC, Liau SB, Tsai equivalent.Transplantation 2004;77:1729-1734.
RJ. Amniotic membrane graft for primary29. Ang LP, Tan DT, Cajucom-Uy H,
pterygium: Comparison with conjunctival Beuerman RW. Autologous cultivated
autograft and topical mitomycin C conjunctival transplantation for
treatment. Br J Ophthalmol 2000;84:973-978. pterygium surgery. Am J Ophthalmol 2005;139:611-619.
15. Mohammed I. Treatment of pterygium. Ann Afr30. LaboratoryDevice for Lifting Biological Material
Med Registered in Indian Patent Office Under
2011;10:197-203. Design No: 195065. Reliance Life Sciences
16. Prabhasawat P, Barton K, Burkett G, Pvt Ltd, 2004-6-5.
Tseng SC. Comparison of 31. Container for Transporting Biological Material
conjunctival autografts, amniotic membrane grafts, Registered in Indian Patent Office Under
and primary closure for pterygium Design No: 195066. Reliance Life Sciences
excision. Ophthalmology 1997;104:974-985. Pvt Ltd, 2004-6-5.
17. Kenyon KR, Wagoner MD, Hettinger ME. 32. Kim JC, Tseng SC. Transplantation of
Conjunctival autograft transplantation for preserved human amniotic membrane for surface
advanced and recurrent pterygium. Ophthalmology reconstruction in severely damaged rabbit
1985;92:1461-1470. corneas. Cornea 1995;14:473-484.
18. Ti SE, Chee SP, Dear KB, Tan 33. Zakaria N, Koppen C, Van Tendeloo V,
DT. Analysis of variation in success Berneman Z, Hopkinson A, Tassignon MJ.
rates in conjunctival autografting Standardized limbal epithelial stem cell
for primary and recurrent pterygium. Br J graft generation and transplantation. Tissue
Ophthalmol 2000;84:385-389. Eng Part C Methods 2010;16:921-927.
19. Ang LP, Chua JL, Tan DT. Current 34. Vasania VS, Prasad P, Gill RK, Mehta
concepts and techniques in pterygium A, Viswanathan C, Sarang S, et al.
treatment. Curr Opin Ophthalmol 2007;18:308-313. Molecular and cellular characterization of
expanded and cryopreserved human limbal
[Downloaded free from http://www.jovr.org on Friday, January 13, 2017, IP: 115.178.237.7]

Ex vivo Expansion of Autologous Human Conjunctival Epithelial Cells; Vasania et al

epithelial stem cells reveal unique surface disease. A better indicator than
immunological properties. Exp Eye Res tear mucin. Arch Ophthalmol
2011;92:47-56. 1983;101:1284-1287.
35. Sippel KC, Ma JJ, Foster CS.
Amniotic membrane surgery. Curr Opin Ophthalmol
2001;12:269-281. How to cite this article: Vasania VS, Hari A, Tandon R, Shah S,
36. Hirst LW, Sebban A, Chant D. Haldipurkar S, Shah S, et al. Transplantation of autologous ex vivo
Pterygium recurrence time. Ophthalmology expanded human conjunctival epithelial cells for treatment of pterygia: A
1994;101:755-758. prospective open-label single arm multicentric clinical trial. J Ophthalmic
Vis Res 2014;9:407-16.
37. Kinoshita S, Kiorpes TC, Friend J, Thoft
RA. Goblet cell density in ocular
Source of Support: Nil. Conflict of Interest: None declared.
416 Journal of ophthalmic and Vision research 2014; Vol. 9, No. 4