Current Biology, Volume 24

Supplemental Information

Class I TCP-DELLA Interactions

in Inflorescence Shoot Apex
Determine Plant Height
Jean-Michel Davire, Michael Wild, Thomas Regnault, Nicolas Baumberger,
Herfried Eisler, Pascal Genschik, and Patrick Achard
Table S1. List of core cell cycle genes containing at least one class I TCP binding site in their 1-kb
promoter region (genes outlined in yellow). (Supplemental Excel File)

Primer list (Supplemental Excel file)

Table S1 and the Primer list can both be found in the same supplemental Excel file.

Supplemental Experimental Procedures

Plant lines
Arabidopsis transgenic lines pCYCB1;1:Dbox-GUS, ga1-3 pCYCB1;1:Dbox-GUS, gai-t6 rga-24
pCYCB1;1:Dbox-GUS (derived from Landsberg erecta ecotype), pTCP7:GUS, pTCP8:GUS,
pTCP21:GUS, pTCP22:GUS, pTCP14:TCP14-GUS, pTCP15:TCP15-GUS (derived from Columbia-0
ecotype), and Arabidopsis mutant tcp14-4 tcp15-3 were as described previously [S4, S5, S6].

Plasmid construction and plant transformation

The N-terminal part of the DELLA proteins is subject to autoactivation in yeast two-hybrid assays
[S7]; therefore, only the C-terminal domain of RGA (amino acids 199 to 587) was inserted into
pDONR207 (Invitrogen) by Gateway cloning and recombined with pGBKT7 (Clontech) to generate
BD-RGA. Similar constructions were engineered for BD-GAI (amino acids 148 to 533), BD-RGL1
(amino acids 132 to 511), BD-RGL2 (amino acids 161 to 547) and BD-RGL3 (amino acids 140 to
523). TCP14 cDNA was amplified by RT-PCR, subsequently inserted into pDONR207, and
recombined with pB7RWG2 [S8] to generate p35S:TCP14-RFP, with pGADT7 (Clontech) to
generate AD-TCP14 or with the Escherichia coli expression vector pMGWA [S9] to express MBP-
TCP14-6xHis protein. AD-TCP8, AD-TCP9, AD-TCP15, AD-TCP20, AD-TCP22 and AD-TCP23
were generated in a similar manner in pGADT7. RGA cDNA amplified by RT-PCR was inserted into
pDONR207 and recombined with pB7FWG2 to generate p35S:RGA-GFP, pGWB615 [S10] to
generate p35S:RGA-HA or with pHMGWA to express 6xHis-MBP-RGA protein. pTCP14:TCP14 and
TCP14-SRDX fragments were PCR amplified from pTCP14:TCP14-SRDX plasmid [S5].
Subsequently, the fragments were inserted into pDONR207 and respectively recombined with
pGWB650 [S10] to generate pTCP14:TCP14-GFP and with pB2GW7 [S8] to generate p35S:TCP14-
SRDX. amiR-tcp8/22 construct was engineered following the artificial microRNA designer WMD3
procedure (http://wmd3.weigelworld.org; [S11]). The plasmid pRS300 containing miR319a precursor
was used as template for PCR using specific primers to replace MIR319a target sequence by a 21
nucleotides sequence TATTTATGACCTAACTGTCTG designed to target TCP8 and TCP22. The
artificial miR precursor was then inserted into pDONR207, and recombined with pB2GW7 [S8] to
generate p35S:amiR-tcp8/22. pCYCB1;1 promoter amplified by PCR from pCYCB1;1:Dbox-GUS
plasmid [S12] was inserted into pDONR207 and recombined with pGWB633 [S10] to generate
pCYCB1;1-GUS. Primers used for the cloning are listed in Supplemental Information. The plant
binary vectors were introduced into Agrobacterium tumefaciens GV3101 strain by electroporation and
Arabidopsis plants were transformed by floral dip.

GUS analyses
Histochemical detection of GUS activity was carried out on inflorescences of 5 week-old plants. Plant
material was first fixed for 10 min in 90% (v/v) acetone on ice, washed, then infiltrated in GUS
solution (500 g/ml 5-bromo-4-chloro-3-indolyl--D-glucuronide (X-Gluc); 50 mM sodium
phosphate pH 7; 1 mM potassium ferricyanide; 1 mM potassium ferrocyanide; 10 mM EDTA; 0.01%
triton X-100) for 15 min and incubated at 37C for 8 h. Then, the GUS solution was replaced with
100% (v/v) ethanol during 6 h at room temperature and kept in 70% (v/v) ethanol at 4C.

Gene expression analyses

Total RNA from dissected inflorescence shoot apices was extracted using NucleoSpin RNA Plant kit
(Macherey Nagel) following the user manual. 2 g of total RNA were treated first with 2 units of
DNase I (Promega) and then reverse transcribed in a total volume of 40 L with 2 M oligo(dT)20, 0.5
mM deoxynucleotide triphosphate (dNTP), 5 mM DTT, and 200 units of Superscript III reverse
transcriptase (Invitrogen). qRT-PCR was performed using gene-specific primers (listed in
Supplemental Information) in a total volume of 10 L SYBR Green Master mix (Roche) on a
Lightcycler LC480 apparatus (Roche) according to manufacturers instructions. AT4G34270 (TIP41-
LIKE) and AT4G26410 genes were used as internal reference genes. The relative expression level of
each gene was calculated using Lightcycler 480 software, release 1.5.0 SP3, and averaged over three
replicates.

Chromatin-immunoprecipitation (ChIP) assays

ChIP assays were performed on inflorescences of 5 week-old pTCP14:TCP14-GFP plants treated with
100 M GA3 or 50 M PAC as described previously [S13]. Briefly, chromatin was
immunoprecipitated with anti-GFP antibodies (Abcam) together with protein A/G magnetic beads
(Millipore). ChIP experiments using mouse IgG were carried out as negative controls. The resulting
ChIP DNA was subjected to qPCR analysis. Enrichment of promoter regions was averaged over three
replicates and normalized using ACTIN2. ChIP-qPCR analyses were performed on two independent
biological repeats with two technical repeats. qPCR primers used are listed in Supplemental
Information.

Electrophoretic mobility shift assays (EMSA)

The MBP-TCP14-6xHis recombinant protein was expressed in the Rosetta 2 (DE3) pLysS (Novagen)
E. coli strain by induction with 0.5 mM IPTG for 4 h at 20C, purified by binding onto a HisTrap HP
column (GE Healthcare Life Sciences) and eluted with imidazole. The 6xHis-MBP-RGA recombinant
protein was co-expressed with the chaperone Tig in BL21 carrying the pTf16 plasmid (Takara) by
induction with 0.1 mM IPTG for 16 h at 12C, purified by binding onto a MBP-Trap HP column (GE
Healthcare Life Sciences) and eluted with maltose. Elution buffer was replaced by EMSA buffer (15
mM HEPES-KOH pH 7.5; 40 mM KCl; 0.1 mM dithiothreitol; 10% glycerol) by filtration through a
Sephadex-G25 HiTrap column (GE Healthcare Life Sciences). Oligonucleotide probes were end-filled
32
labeled with the Klenow enzyme (Fermentas) in the presence of P-dCTP. The sequence of the
oligonucleotides is indicated in Supplemental Information. The EMSA reaction was performed with 1
32
ng of P-labeled probe, 2 g of poly(dI-dC) and 100 ng of TCP14 alone or combined with RGA or
MBP (1:1 to 1:3 ratio as indicated) and incubated at room temperature for 20 min. The binding
reactions were analyzed by electrophoresis on 6% native acrylamide gel in 0.5 x TBE buffer. After
drying, the gel was autoradiographed at -80C overnight.

Yeast two hybrid assays

RGA cDNA (amino acids 199 to 587) was fused to the GAL4-binding domain of pGBKT7 (Clontech)
yeast two-hybrid vector. A cDNA library CD4-30 (ABRC) prepared from Arabidopsis inflorescences
was used to perform the yeast two-hybrid screening following the Clontech yeast two-hybrid system
user manual. Direct interaction assays in yeast were carried out following the Clontech small-scale
LiAc yeast transformation procedure. Yeast strain AH109 was co-transformed with BD-DELLA and
AD-TCP or empty vector, and interaction tests were surveyed on selective media lacking Leu, Trp,
Ade and His (Clontech).

Co-immunoprecipitation (CoIP) assays

CoIP assays of RGA and TCP14 proteins were performed on N. benthamiana agro-infiltrated leaves
with p35S:RGA-GFP and p35S:TCP14-RFP constructs. Total proteins were extracted in Lysis buffer
containing 50 mM Tris-HCl pH 8, 150 mM NaCl, 1% Triton X-100, supplemented with EDTA free
protease inhibitors (Roche), and then incubated for 2 h at 4C with 50 l of anti-GFP antibody
conjugated to micro beads (MACS GFP-tagged beads - Miltenyi Biotec). MACS GFP-tagged beads
were retained and washed onto a magnetic column system (M columns; Miltenyi Biotec) to recover
the immunoprotein complexes according to the manufacturers instructions. RGA and TCP14 proteins
bound to the beads were resolved by SDS-PAGE and detected by anti-GFP (Clontech) or anti-RFP
antibody (Clontech) followed by a Goat anti Rabbit-HRP antibody (Invitrogen).

Transient transactivation assays

Transactivation assays were performed on N. benthamiana agro-infiltrated leaves with the effectors
p35S:TCP14-RFP or p35S:TCP14-SRDX alone or together with p35S:RGA-HA, as indicated. A
construct containing p35S:P19 was used as an internal control to evaluate leaf transfection efficiency
[S14]. The relative CYCB1;1:GUS expression (used as reporter) was calculated by normalizing against
P19 expression, using Lightcycler 480 software, and averaged over three replicates. qPCR primers
used are listed in Supplemental Information.

Fluorescence-lifetime imaging microscopy (FLIM) analyses

FLIM was carried out using a Nikon TE2000 microscope connected to a LiFA FLIM system.
Fluorescence-lifetime was measured using the LiFLIM software version 1.2.8. on N. benthamiana
agro-infiltrated leaves expressing RGA-GFP (control) and co-expressing RGA-GFP and TCP14-RFP
proteins. At least 60 nuclei per condition were analyzed.

Phylogenetic analysis
The phylogram was generated using Phylogeny (http://www.phylogeny.fr) from amino acids of
Arabidopsis TCP and rice PCF proteins obtained from Phytozome (http://www.phytozome.net) and
National Center for Biotechnology Information (www.ncbi.nlm.nih.gov) databases. Alignments of
protein sequences were generated using MUSCLE [S15, S16], using Gblocks program to eliminate
poorly aligned positions and divergent regions. Numbers shown in the tree represent the bootstrap
support values (%).

Bioinformatics analyses
Motif-based sequence analysis program (MEME) was used at National Biomedical Computation
Resource (http://meme.nbcr.net) to identify an overrepresented motif based on the degree of sequence
conservation (Fig. S2). Promomer program was used at The Arabidopsis Information Resource
(http://bar.utoronto.ca/ntools/cgi-bin/BAR_Promomer.cgi) to identify subset of genes having at least
one defined motif in their 1-kb promoter sequences (Table S1).

Supplemental References

S1. Davire, J.M., and Achard, P. (2013). Gibberellin signaling in plants. Development 140, 1147-
1151.

S2. Viola, I.L., Uberti Manassero, N.G., Ripoll, R. and Gonzalez, D.H. (2001). The Arabidopsis class
I TCP transcription factor AtTCP11 is a developmental regulator with distinct DNA-binding
properties due to the presence of a threonine residue at position 15 of the TCP domain. Biochem.
J. 435, 143-155.

S3. Franco-Zorrilla, J.M., Lopez-Vidriero, I., Carrasco, J.L., Godoy, M., Vera, P., and Solano, R.
(2014). DNA-binding specificies of plant transcription factors and their potential to define target
genes. Proc. Natl. Acad. Sci. USA 111, 2367-2372.

S4. Achard, P., Gusti, A., Cheminant, S., Alioua, M., Dhondt, S., Coppens, F., Beemster, G.T.S., and
Genschik, P. (2009). Gibberellin signaling controls cell proliferation rate in Arabidopsis. Curr.
Biol. 19, 1188-1193.
S5. Kieffer, M., Master, V., Waites, R., and Davies, B. (2011). TCP14 and TCP15 affect internode
length and leaf shape in Arabidopsis. Plant J. 68, 147-158.

S6. Aguilar-Martinez, J.A., and Sinha, N. (2013). Analalysis of the role of Arabidopsis class I TCP
genes AtTCP7, AtTCP8, AtTCP22 and AtTCP23 in leaf development. Front Plant Sci. 4, 406.

S7. De Lucas, M., Davire, J.M., Rodrigues-Falcon, M., Iglesias-Pedraz, J.M., Lorrain, S.,
Fankhauser, C., Blazquez, M.A., Titarenko, E., and Prat, S. (2008). A molecular framework for
light and gibberellin control of cell elongation. Nature 451, 480-484.

S8. Karimi, M., Inz, D., and Depicker, A. (2002). GATEWAY vectors for Agrobacterium-mediated
plant transformation. Tends Plant Sci. 7, 193-195.

S9. Busso, D., Delagoutte-Busso, B., and Moras, D. (2005). Construction of a set Gateway-based
destination vectors for high-throughput cloning and expression screening in Escherichia coli.
Anal. Biochem. 343, 313-321.

S10. Nakamura, S., Mano, S., Tanaka, Y., Ohnishi, M., Nakamori, C., Araki, M., Niwa, T., Nishimura,
M., Kaminaka, H., Nakagawa, T., Sato, Y., and Ishiguro, S. (2010). Gateway binary vectors with
the bialaphos resistance gene, bar, as a selection marker for plant transformation. Biosci.
Biotechnol. Biochem. 74, 1315-1319.

S11. Schwab, R., Ossowski, S., Riester, M., Warthmann, N., and Weigel, D. (2006). Highly specific
gene silencing by artificial microRNAs in Arabidopsis. Plant Cell 18, 1121-1133.

S12. Colon-Carmona, A., You, R., Haimovitch-Gal, T., and Doerner, P. (1999). Technical advance:
spatio-temporal analysis of mitotic activity with a labile cyclin-GUS fusion protein. Plant J. 20,
503-508.

S13. Wild, M., Daviere, J.M., Cheminant, S., Regnault, T., Baumberger, N., Heintz, D., Baltz, R.,
Genschik, P., and Achard, P. (2012). The Arabidopsis DELLA RGA-LIKE3 is a direct target of
MYC2 and modulates jasmonate signaling responses. Plant Cell 24, 3307-3319.

S14. Voinnet, O., Rivas, S., Mestre, P., and Baulcombe, D. (2003). An enhanced transient expression
system in plants based on suppression of gene silencing by the P19 protein of tomato bushy stunt
virus. Plant J. 33, 949-956.

S15. Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Res. 32, 1792-1797.

S16. Dereeper, A., Audic, S., Claverie, J.M., and Blanc, G. (2010). BLAST-EXPLORER helps you
building datasets for phylogenetic analysis. BMC Evol. Biol. 12, 10:8.