Characterization of Cupriavidus metallidurans CYP116B1

A thiocarbamate herbicide oxygenating P450phthalate

dioxygenase reductase fusion protein
Ashley J. Warman1, Jacob W. Robinson2, Dominika Luciakova2, Andrew D. Lawrence3,
Ker R. Marshall1, Martin J. Warren3, Myles R. Cheesman4, Stephen E. J. Rigby2,
Andrew W. Munro2 and Kirsty J. McLean2
1 Department of Biochemistry, University of Leicester, Leicester, UK
2 Faculty of Life Sciences, Manchester Interdisciplinary Biocentre, University of Manchester, Manchester, UK
3 Department of Biosciences, University of Kent, Canterbury, Kent, UK
4 School of Chemical Sciences, University of East Anglia, Norwich, UK

Keywords
CYP116B1 cytochrome P450 (116B1) from
Cupriavidus metallidurans; fusion enzyme;
phthalate dioxygenase reductase;
potentiometry
Correspondence
Kirsty J. McLean or Andrew W. Munro,
Faculty of Life Sciences, Manchester
Interdisciplinary Biocentre, University of
Manchester, 131 Princess Street,
Manchester M1 7DN, UK
Fax: 0044 161 306 8918
Tel: 0044 161 306 4194 2715
E-mail: kirsty.mclean@manchester.ac.uk
or
Tel: 0044 161 306 5151
Fax: 0044 161 306 8918
E-mail: andrew.munro@manchester.ac.uk
(Received 14 December 2011, revised 10
February 2012, accepted 17 February 2012)
doi:10.1111/j.1742-4658.2012.08543.x
The novel cytochrome P450 redox partner fusion enzyme CYP116B1 from
Cupriavidus metallidurans was expressed in and puried from Escherichia coli.
Isolated CYP116B1 exhibited a characteristic Fe(II)CO complex with Soret
maximum at 449 nm. EPR and resonance Raman analyses indicated low-
spin, cysteinate-coordinated ferric haem iron at both 10 K and ambient
temperature, respectively, for oxidized CYP116B1. The EPR of reduced
CYP116B1 demonstrated stoichiometric binding of a 2Fe-2S cluster in the
reductase domain. FMN binding in the reductase domain was conrmed
by avin uorescence studies. Steady-state reduction of cytochrome c and
ferricyanide were supported by both NADPH NADH, with NADPH used
more efciently (Km[NADPH] = 0.9 0.5 lM and Km[NADH] = 399.1
52.1 lM). Stopped-ow studies of NAD(P)H-dependent electron transfer
to the reductase conrmed the preference for NADPH. The reduction
potential of the P450 haem iron was -301 7 mV, with retention of haem
thiolate ligation in the ferrous enzyme. Redox potentials for the 2Fe-2S
and FMN cofactors were more positive than that of the haem iron. Multi-
angle laser light scattering demonstrated CYP116B1 to be monomeric.
Type I (substrate-like) binding of selected unsaturated fatty acids (myristo-
leic, palmitoleic and arachidonic acids) was shown, but these substrates
were not oxidized by CYP116B1. However, CYP116B1 catalysed hydroxyl-
ation (on propyl chains) of the herbicides S-ethyl dipropylthiocarbamate
(EPTC) and S-propyl dipropylthiocarbamate (vernolate), and the subse-
quent N-dealkylation of vernolate. CYP116B1 thus has similar thiocarba-
mate-oxidizing catalytic properties to Rhodoccocus erythropolis CYP116A1,
a P450 involved in the oxidative degradation of EPTC.

Abbreviations
CO, carbon monoxide; CPR, cytochrome P450 reductase; CYP101A1, Pseudomonas putida camphor hydroxylase P450cam or CYP102A1;
CYP116B1, cytochrome P450 (116B1) from Cupriavidus metallidurans CH34; ddH2O, distilled, deionized water; EPTC, S-ethyl
dipropylthiocarbamate; Fe-S, iron-sulfur; HS, high-spin; ImC10, imidazolyl decanoic acid; ImC11, imidazolyl undecanoic acid; ImC12,
imidazolyl dodecanoic acid; IPTG, isopropyl thio-b-D-galactoside; LC, liquid chromatography; MALLS, multi-angle laser light scattering; NHE,
normal hydrogen electrode; NO, nitric oxide; P450, cytochrome P450 or CYP; P450 BM3, cytochrome P450 BM3 from Bacillus megaterium
or CYP102A1; PDO, phthalate dioxygenase; PDOR, Burkholderia cepacia phthalate dioxygenase reductase; SEC, size-exclusion
chromatography; vernolate, S-propyl dipropylthiocarbamate.

FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS 1675
Biochemical analysis of CYP116B1
Introduction
The cytochromes P450 (P450s) are a superfamily of
cysteine thiolate-coordinated haem b-binding enzymes
widespread in nature [1]. The vast majority of P450s
catalyse the reductive scission of molecular oxygen
bound to the haem iron, resulting in monooxygenation
of a substrate molecule bound close to the haem [2]. A
highly reactive iron-oxo species (compound I) is con-
sidered to be the major oxidant in P450-mediated sub-
strate oxidations. Only recently has the rst compelling
evidence been presented for the formation and the
reactivity of compound I. Using the P450 CYP119
from the thermophilic bacterium Sulfolobus acidocalda-
rius, Rittle and Green demonstrated (using EPR,
Mossbauer and UV-visible absorption spectroscopy)
characteristic spectra near-identical to those observed
for compound I species in peroxidase hemoproteins,
and an apparent second-order rate constant for oxida-
tion of unactivated hydrocarbons of 1.1 107 m)1s)1
for the CYP119 compound I species [3]. However,
other iron-oxo species in the P450 catalytic cycle are
also potential substrate oxidants in selected P450 trans-
formations. For instance, the ferric hydroperoxo spe-
cies (compound 0) that precedes compound I is also a
potential oxidant (e.g. for epoxidation across carbon
carbon double bonds, or for sulfoxidation), albeit with
conicting evidence for its general catalytic relevance
emerging from experimental and computational studies
[46]. There is a broad spectrum of substrate specicity
seen across the P450 enzyme superfamily, and a wide
array of oxidative transformations are catalysed (e.g.
hydroxylation, epoxidation, demethylation, S- and
N-oxidation and C-C bond cleavage) [1,2,6]. Various
P450 enzymes can also catalyse reductive chemistry, in
addition to isomerizations and dehydrations [e.g.
2,7,8].
P450-mediated substrate oxygenation requires the
delivery of two consecutive electrons to a substrate-
bound, ferric enzyme. These events achieve reduction
of the iron, rst to the ferrous form (which binds
dioxygen) and then to the ferric peroxy state [1,2]. Suc-
cessive protonations of the latter intermediate produce
rst compound 0 and then (with water loss) the tran-
sient and highly reactive compound I [3]. Electrons are
typically derived from NAD(P)H and are delivered to
the P450 by iron-sulfur and or avoproteins. Histori-
cally, two major classes of P450 redox partners were
thought to exist. The rst (class 1) is typied by the
Pseudomonas putida camphor hydroxylase P450cam
(CYP101A1), to which electrons are shuttled from
NADH through the FAD-binding putidaredoxin
reductase and the ironsulfur (2Fe-2S) cluster-binding
1676 FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
A. J. Warman et al.
putidaredoxin [9,10]. The second system (class 2) is
exemplied by the mammalian hepatic P450 enzymes
(that are pivotal to drug and xenobiotic metabolism)
and involves membrane-bound P450s and a diavin
reductase [cytochrome P450 reductase (CPR)] that
sources its electrons from NADPH [11]. However,
more recent studies of diverse P450 systems, particu-
larly from microorganisms, have demonstrated that the
repertoire of P450 redox partners is much broader
than was rst considered [12] and that certain P450s
have disposed altogether with redox partner proteins
and interact directly with NADH or hydrogen perox-
ide to facilitate catalysis [13,14]. Also, other P450s
exist as natural fusions to both CPR-like and other
forms of redox partners [12,15].
The rst major class of P450redox partner fusion
enzymes characterized were the CYP102A family,
headed by the well characterized Bacillus megaterium
P450 BM3 (BM3, CYP102A1) [16]. This is a cytoplas-
mic enzyme in which a fatty acid hydroxylase P450
(N terminal) is fused to an NADPH-dependent CPR
[17]. P450 BM3 has the highest reported rate of sub-
strate oxidation for any P450 oxygenase
( 17 000 min)1 with arachidonate), facilitated by the
efcient electron transport system operating both
within its CPR domain and between the CPR and the
P450 [18,19]. Members of the CYP102A family are
widespread in Bacillus and in other bacteria, and a
similar type of P450CPR fatty acid hydroxylase
fusion is also found in lower eukaryotes (e.g. Fusari-
um oxysporum P450foxy, CYP505A1) [20,21]. P450
BM3 has been the subject of intensive studies aimed at
understanding its structure and mechanism, with recent
studies demonstrating that the dimeric form of the
enzyme is catalytically functional in fatty acid oxida-
tion, with electron transfer between monomers proba-
bly supporting its catalytic function [2224]. Moreover,
as a consequence of its catalytic efciency and the
availability of good crystal structure data, P450 BM3
has been extensively engineered in order to explore its
structurefunction relationships and to enable oxida-
tion of novel substrates such as short-chain fatty acids,
alkanes and steroids [2528].
A distinctive type of P450redox partner fusion sys-
tem was identied from genome analysis of pathogenic
Burkholderia species, the heavy metal-tolerant bacte-
rium Cupriavidus metallidurans CH34 and Rhodococcus
sp. NCIMB 9784 [29]. In this system, P450s of unde-
ned structure and substrate selectivity (classied in
the CYP116B P450 family) are fused to a reductase
module with an amino-acid sequence resembling that
A. J. Warman et al.
of Burkholderia cepacia phthalate dioxygenase reduc-
tase (PDOR), an enzyme that provides electrons to
phthalate dioxygenase (PDO) to enable this enzyme to
oxygenate phthalate in a pathway for its degradation
and exploitation as a carbon source for growth [30,31].
As with P450 BM3, the P450 module in the novel
CYP116PDOR fusion enzymes is at the N terminus
of the fusion protein (Fig. 1). The Rhodococcus enzyme
from this family (CYP116B2) was expressed and puri-
ed, and shown to exhibit P450-like spectral character-
istics. Genetic dissection of the enzyme enabled
characterization of FMN and 2Fe-2S centres in the
expressed PDOR module [32,33]. CYP116B2 was also
shown to have weak activity with a prototypical uo-
rescent substrate for the P450 superfamily (7-ethoxy-
coumarin). However, no physiologically relevant
substrate was identied [32].
A Results
B CYP116B1 P450 (gene 4932, UniProt Q1LDI2) was
Fig. 1. Schematic showing domain organization and electron flow
in CYP116B and CYP102A (P450 BM3) enzymes. (A) The genetic
arrangement of the individual domains (indicated by cofactor con-
tent: haem [P450] in the P450 domain, and FMN and 2Fe-2S [Fe-S]
in the reductase domain) in CYP116B1 is shown at the left. The
diagram at the right shows the direction of electron flow from
NADPH through FMN, iron-sulfur and onto the P450 haem within a
CYP116B1 monomer. (B) A similar diagram to (A) of genetic
arrangement for P450 BM3 (CYP102A1) is shown, with FMN and
FAD cofactors in the reductase domain. The diagram on the right
illustrates electron flow within the P450 BM3 dimer. Electron trans-
fer occurs from NADPH to FAD and then to FMN in monomer 1.
Thereafter, electrons are transferred from FMN of monomer 1 to
the haem in monomer 2 [22]. In the electron-transfer diagrams, the
flow of electrons from NADPH is indicated by large blue arrows.
The haem domains are represented by pink circles with the haem
shown in red; the iron-sulfur domain is in a coral circle with the
iron-sulfur cluster in red and yellow spacefill; and the FMN and
FAD domains are in orange and yellow circles, respectively, with
the isoalloxazine ring portions shown in the centre. CYP116B1 is
represented as a monomer, while one monomer of the P450 BM3
dimer is shown coloured as described above, while the second
monomer is shown in greyscale.
FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
Biochemical analysis of CYP116B1
In this manuscript we present the rst report of the
cloning, expression and detailed kinetic, spectroscopic,
hydrodynamic and thermodynamic analysis of the co-
factor-replete C. metallidurans P450PDOR fusion
enzyme (CYP116B1). The enzyme exhibits characteris-
tic haem Soret spectral properties for the P450 class,
but displays some notable differences to features
observed for CYP116B2. In this work, light scattering
studies showed CYP116B1 to be monomeric and to
bind polyunsaturated lipids with an induced shift in
haem iron spin-state equilibrium. We showed that
CYP116B1 catalyses NADPH-dependent oxygenation
of thiocarbamate herbicides, an activity consistent with
its evolutionary relationship with a distinct (non-part-
ner fused) P450 enzyme (CYP116A1, also known as
ThcB) from Rhodococcus erythropolis NI86 21 that
oxidatively degrades the thiocarbamate herbicide
S-ethyl dipropylthiocarbamate (EPTC) [34].
Expression, purification and UV-visible
absorption features of CYP116B1
The gene encoding the C. metallidurans CH34
cloned by PCR from bacterial genomic DNA and
expressed in Escherichia coli (Origami (DE3)) using a
pET11a construct. CYP116B1 was puried using a
combination of ion-exchange and hydrophobic afnity
chromatography, producing a single major band on
SDS PAGE (Fig. 2A, inset), consistent with the pre-
dicted 86.4-kDa molecular mass of the P450PDOR
fusion protein. The UV-visible absorption properties
of the pure CYP116B1 in its oxidized, sodium dithio-
nite-reduced and reduced carbon monoxide (CO)-
bound forms are illustrated in Fig. 2A. For oxidized
CYP116B1, the spectral features of a haem cofactor
are clearly evident. The main Soret band has its
absorption maximum at 418 nm, with longer-wave-
length alpha beta bands positioned at 566 and 532 nm,
respectively. A pyridine haemochromagen assay to
determine the haem concentration of CYP116B1 was
performed in triplicate and a CYP116B1-specic
extinction coefcient was determined to be e418 =
121 mm)1cm)1 at the Soret peak of the oxidized
enzyme. This value includes the spectral contributions
from iron-sulfur and avin centres in the cofactor-
replete CYP116B1, and was used to determine the
CYP116B1 concentration in all further experiments.
On aerobic reduction with sodium dithionite, the
Soret band decreased in intensity and was slightly
blue-shifted to 417 nm. The less intense haem alpha
1677
Biochemical analysis of CYP116B1
A rous, thiolate-coordinated state) [35,36]. The less-exten-
B concomitant changes in the spectral contributions of,
Fig. 2. UV-visible absorption spectroscopy of CYP116B1. (A)
UV-visible absorption spectra for CYP116B1 (2.9 lM) showing the
purified oxidized enzyme (thick solid line) with Soret maximum at
418 nm, the dithionite-reduced enzyme (dashed line) and the redu-
ced CO-bound adduct (thin solid line) showing the Fe(II)CO peak at
449 nm with a minor peak at 420 nm from the (protonated) cyste-
ine thiol-bound form. Inset: SDS PAGE gel (10%) of CYP116B1
showing the purified enzyme at 86.4 kDa at three different concen-
trations of 1, 0.5 and 0.1 lg (left to right), sizes of marker bands
indicated. (B) Complexes of CYP116B1 with small-molecule inhibi-
tors. Spectra shown are for oxidized CYP116B1 (2.3 lM, thick solid
line); NO-bound CYP116B1 (thin solid line), showing a Soret inten-
sity decrease and shift to 433 nm with Q-bands at 574 and
545 nm; cyanide (CN)-bound (50 mM KCN) CYP116B1 (dotted line),
showing a Soret intensity decrease and shift to 430 nm; and imid-
azole (2 mM)-bound CYP116B1 (dashed line), exhibiting a Soret shift
to 424 nm with a small decrease in intensity. Inset: CYP116B1-
imidazole binding curve generated from difference spectral data (as
described in the Materials and methods), yielding a Kd value of
646 13 lM.
and beta bands remained at  566 and 532 nm, respec-
tively. The extent of Soret absorbance shift was less
than that observed for other P450s (e.g. the P450 BM3
Soret shifted to  409 nm on full reduction to the fer-
1678 FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
A. J. Warman et al.
sive Soret shift for CYP116B1 is a consequence of
only partial reduction of the haem iron by dithionite
under aerobic conditions, which, in turn, is a result of
the rapid reaction of its ferrous haem iron with dioxy-
gen and its subsequent re-oxidation with production of
superoxide. Anaerobic titration of CYP116B1 with
dithionite led to complete reduction of the haem iron
and a more extensive Soret shift (see the section
Examination of the thermodynamic properties of
CYP116B1). However, the simultaneous drop in
absorption intensity in the region beyond  425 nm
suggests that the major cause of the apparent Soret
absorption decrease is actually the reduction of, and
the other cofactors bound to the protein. The reduc-
tase (PDOR) domain (amino acids  445780 of the
780-residue CYP116B1) is expected to bind both avin
(FMN) and ironsulfur cofactors, by homology with
both the B. cepacia PDOR and the reductase domain
of Rhodococcus sp. NCIMB9784 CYP116B2 [33].
Reductive bleaching of FMN, and 2Fe-2S cofactor
absorption by dithionite thus underlies the decreased
Soret intensity and the absorption bleaching observed
beyond  425 nm.
In view of the differing coenzyme selectivity of the
B. cepacia PDOR (which favours NADH) and the
Rhodococcus CYP116B2 (which favours NADPH)
[30,32], we also analyzed spectral changes on aerobic
mixing of oxidized CYP116B1 with NADH and
NADPH (50 lm). Interestingly, spectral changes simi-
lar to those observed with dithionite were seen using
NADPH as reductant, but NADH only effected par-
tial reduction of the FMN ironsulfur centres (data
not shown). In view of our subsequent work (vide
infra), which shows that both NADPH and NADH
support CYP116B1 catalytic activity, it is likely that
this reects faster enzyme reoxidation (and or slower
reduction) for NADH-reduced CYP116B1 compared
with the NADPH-reduced form. This conclusion is
consistent with stopped-ow studies reported later,
under Steady-state and stopped-ow kinetic studies on
CYP116B1.
Addition of CO to the dithionite-reduced
CYP116B1 resulted in a shift of the Soret peak to
449 nm, with a much smaller feature at  424 nm.
The former band is the characteristic signature for
the cysteine thiolate-ligated P450 haems in their
Fe(II)CO complexes. The minor feature at  424 nm
probably reects a small proportion of the (proton-
ated) cysteine thiol-coordinated P420 form. Proton-
ation of the proximal ligand can arise as a
consequence of either haem reduction or the binding
A. J. Warman et al.
of CO to ferrous haem iron, or both [37,38]. Other
spectroscopic studies indicate that the cysteine thio-
late-coordinated state is predominant in the oxidized
enzyme (see Characterization of CYP116B1 haem
and ironsulfur clusters by EPR). In the Fe(II)CO
complex of CYP116B1, there is a single absorption
Q-band peak in the visible region at  549 nm, indic-
ative of complete conversion of the haem iron to the
ferrous state (Fig. 2A).
To further dene the spectral features of CYP116B1,
we generated ligand complexes using the small-mole-
cule inhibitors imidazole, cyanide and nitric oxide
(NO) (Fig. 2B). All three molecules induced red (type
II) shifts in the Soret band, which is typical for haem
iron-coordinating P450 inhibitors. The imidazole com-
plex had its Soret band shifted to 423.5 nm with a
small decrease in intensity. An optical binding titration
with imidazole revealed a hyperbolic dependence of
induced absorption change on ligand concentration
and a Kd of 646 13 lm (Fig. 2B, inset). The Soret
shift from  418 nm to 423.5 nm on complexation of
imidazole and triazole inhibitors is typical of behav-
iour seen in other P450s (e.g. 38,39). However, it was
reported that puried Rhodococcus CYP116B2 has its
Soret maximum at  424 nm in the ligand-free state
[32]. Given that this enzyme was puried by imidazole
elution from nickel resin, it is probably the case that
the CYP116B2 form puried was the imidazole com-
plex. The CYP116B1 complex with (sodium) cyanide
resulted in a Soret shift to 431 nm and a substantial
decrease in peak intensity (as also observed, for exam-
ple, in the Mycobacterium tuberculosis sterol demethy-
lase CYP51B1) [38]. Optical titration indicated a Kd
value of 9.7 0.6 mm for cyanide. Finally, binding of
the gaseous ligand NO led to a Soret shift to 433 nm,
with a distinctive sharpening of features in the visible
region (Q-bands at 574 and 545 nm), and a spectrum
comparable to the NO-bound form of P450 BM3
(Fig. 2B) [40].
The binding of P450 substrate molecules often
induces spectral shifts in the Soret region. Blue shifts
(towards  390 nm) are observed when substrates
cause displacement of an aqua ligand bound weakly
to the sixth coordination position on the haem iron,
as seen, for example, for camphor binding to
P450cam (CYP101A1) and for fatty acid binding to
P450 BM3 [41,42]. To identify potential substrate
molecules for CYP116B1, we undertook extensive
binding trials with a diverse range of prototypical
P450 substrates, including fatty acids (e.g. lauric acid
and myristic acid), steroids and other cyclic mole-
cules (e.g. testosterone, hydrocortisone, 7-ethoxy-
coumarin and 6-deoxyerythronolide B). While there
FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
Biochemical analysis of CYP116B1
were no signicant optical changes observed with the
saturated fatty acids tested (lauric acid [C12], myris-
tic acid [C14], pentadecanoic acid [C15] and palmitic
acid [C16]), small type-I spectral shifts (typically
23 nm, spin-state change of  410%) were seen with
a number of monounsaturated fatty acids (myristo-
leic acid [C14], palmitoleic acid [C16] and oleic acid
[C18]), and with the polyunsaturated C20 arachidonic
acid. The low solubility of oleic acid in aqueous buf-
fer did not allow for afnity to be determined by
optical titration. However, this was feasible for the
three other lipids, and data for induced optical
change versus fatty acid concentration were tted
using a hyperbolic function to generate Kd values of
4.8 1.7 lm (myristoleic acid), 33.5 6.3 lm (pal-
mitoleic acid) and 5.6 1.3 lm (arachidonic acid).
Data are shown for myristoleic acid in Fig. 3A.
Given the successful demonstration of binding of
fatty acid molecules to CYP116B1, we also investi-
gated whether fatty acid-linked imidazole inhibitors
(imidazolyl decanoic acid [ImC10], imidazolyl
undecanoic acid [ImC11] and imidazolyl dodecanoic
acid [ImC12]) could act as potent inhibitors of P450.
In previous studies we demonstrated tight binding of
ImC10, ImC11 and ImC12 to the P450 BM3 fatty
acid oxygenase [43]. These molecules also bound
tightly to CYP116B1 and induced type-II spectral
changes (Soret shifts to 424 nm), consistent with
haem iron coordination. The Kd values obtained
from tting optical-titration data using a quadratic
equation for tight-binding ligands were 3.5 0.4 lm
(ImC10), 0.59 0.12 lm (ImC11) and 0.52 0.11
lm (ImC12) [44]. Data for the binding of ImC12 to
CYP116B1 are shown in Fig. 3B. These Kd values
compare favourably to those determined for binding
of ImC10, ImC11 and ImC12 to P450 BM3 (0.9, 7.5
and 1.35 lm, respectively), and with data for binding
to a rat CYP4A1CPR fatty acid hydroxylase fusion
protein (12.4, 0.37 and 0.35 lm, respectively) [43,45].
In view of the close relationship (52% amino-acid
sequence identity) of the CYP116B1 haem domain
with the R. erythropolis CYP116A1 (also known as
ThcB, a non-fused P450 shown to catalyse the N-deal-
kylation of EPTC [34]), we also analysed the binding
of EPTC and the related thiocarbamate herbicide
S-propyl dipropylthiocarbamate (vernolate) to
CYP116B1. Very small type-I haem perturbations were
observed, but these were not large enough to enable
accurate determination of Kd from optical binding.
However, we were able to show that CYP116B1 catal-
yses the oxidation of both vernolate and EPTC (see
Identication of CYP116B1-catalysed reaction prod-
ucts of thiocarbamate herbicides).
1679
Biochemical analysis of CYP116B1
A size-exclusion chromatography (SEC) coupled to
B that occurs as a consequence of dissociation of the
Fig. 3. Substrate- and inhibitor-type binding in CYP116B1. (A) Bind-
ing curve for myristoleic acid-induced spectral change in CYP116B1
(2.0 lM). Data were fitted using a quadratic function [44], generat-
ing a Kd value of 4.8 1.7 lM for myristoleic acid. Inset: difference
spectra showing the progressive substrate-like Soret absorbance
shifts to shorter wavelength (blue shifts) upon addition of myristo-
leic acid at 7.96, 15.92, 23.88, 47.76 and 79.60 lM. (B) Binding
curve for ImC12-induced spectral change in CYP116B1. Data were
fitted as described for (A), producing a Kd value of 0.52 0.11 lM.
Inset: UV-visible absorbance spectra for CYP116B1 in ligand-free
form (2.1 lM, solid line) and with ImC12 at a near-saturating con-
centration (5.13 lM, dashed line). There is a shift in the Soret peak
maximum from 418 to 424 nm on binding ImC12.
Multi-angle laser light scattering analysis of
CYP116B1
The P450 the BM3 P450-CPR fusion enzyme was
shown to be catalytically functional in its dimeric state,
with electron transfer between the FMN of monomer
1 and the haem of monomer 2 probably supporting its
fatty acid hydroxylase activity (Fig. 1) [22,24]. In order
to analyze the aggregation state of the P450PDOR
fusion enzyme (CYP116B1) in solution, we performed
1680 FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
A. J. Warman et al.
multi-angle laser light scattering (MALLS). In contrast
to P450 BM3, CYP116B1 was found to be predomi-
nantly monomeric in solution, eluting from a size-
exclusion column in a single band with an apparent
average molecular mass of 86.1 1.7 kDa, very close
to that predicted for the intact enzyme based on its
protein sequence (86.4 kDa) (Fig. 4). Steady-state
kinetic assays (see Steady-state and stopped-ow
kinetic studies on CYP116B1) revealed no discernible
CYP116B1 concentration dependence on the specic
rate of vernolate-induced NADPH oxidase activity.
This is consistent with a single (monomeric) state of
CYP116B1 and contrasts with the decreased specic
activity of P450 BM3 at low enzyme concentrations
dimer into inactive monomers [22]. It thus appears
likely that CYP116B1 (and probably also CYP116B2
and related CYP116B family enzymes) operate by
intramolecular electron transfer within a monomer, as
opposed to intermolecular electron transfer observed
for P450 BM3 (and the eukaryotic l-arginine oxidase
nitric oxide synthase avocytochromes) [22,46].
Characterization of CYP116B1 haem and
ironsulfur clusters by EPR
EPR spectra for the oxidized and sodium dithionite-
reduced forms of pure CYP116B1 were collected as
described in the Materials and methods. For oxidized
CYP116B1, a rhombic spectrum consistent with a fer-
ric cysteinate-coordinated haem iron was observed,
Fig. 4. SEC-MALLS analysis of CYP116B1. The MALLS profile is
shown for a pure CYP116B1 sample resolved by SEC on a Super-
dex 200 gel-filtration column before passing directly through
MALLS and refractive index (RI) detectors (the RI trace is shown
as a solid line). The number average molar mass (Mn) across the
single peak resolved (filled blue circles) was determined as
86.1 1.7 kDa. These data are consistent with CYP116B1 being a
monomeric enzyme.
A. J. Warman et al.
with g-values of 2.42 (gz), 2.25 (gy) and 1.93 (gx)
(Fig. 5). These g-values lie in the range typical for
other low-spin P450 enzymes [e.g. 38,47,48], and are
consistent with an essentially completely low-spin P450
enzyme. There were no signicant signals in the region
associated with the high-spin P450 haem iron (e.g.
g = 8.18 7.85, 3.44 3.97 and 1.66 1.78 for P450
BM3 P450cam in substrate-bound forms [48,49]), sug-
gesting that ferric CYP116B1 is hexacoordinated with
a water ligand trans to the cysteine thiolate. Similar
sets of g-values were obtained for the low-spin forms
of other bacterial P450s. These include P450 BM3 and
P450 BioI from Bacillus subtilis (CYP107H1), whose
EPR spectra yield g-values of 2.42, 2.26 and 1.92, and
2.41, 2.25 and 1.92, respectively [47,48].
For oxidized CYP116B1, there were no apparent
EPR signals that could be ascribed to either ironsulfur
or avin centres that are likely to be present in the
PDOR domain of the enzyme. Oxidized avins are EPR
silent, and the 2Fe-2S cluster in its oxidized form (i.e.
[2Fe-2S]2+) should contain two ferric iron atoms, in
which the magnetic moments of the unpaired electrons
are spin-coupled, giving S = 0. However, reduced 2Fe-
2S clusters are EPR active in the [2Fe-2S]+ form, with
one ferric and one ferrous iron atom [e.g. 50,51]. An
EPR spectrum was collected for the dithionite-reduced
form of CYP116B1 and is shown in Fig. 5. The spec-
trum is more compact than that for the oxidized enzyme
with the major features appearing between 3250 and
Fig. 5. X-Band EPR spectra for CYP116B1. Upper spectrum: oxi-
dized CYP116B1 (184 lM) showing a rhombic signal with g-values
typical for a low-spin, six-coordinate ferric haem iron at gz = 2.42,
gy = 2.25 and gx = 1.93. Lower spectrum: CYP116B1 (184 lM),
reduced anaerobically by dithionite, showing almost complete loss
of the signal from the ferric haem species (as haem is reduced to
the EPR-silent ferrous state) and the emergence of bands at
gz = 2.06, gy = 1.97 and gx = 1.88, typical of a plant-like 2Fe-2S
cluster in the EPR active [2Fe-2S]+ form. No significant signal is
observed for a flavin semiquinone.
FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
Biochemical analysis of CYP116B1
3750 Gauss. The reduced CYP116B1 spectrum has a
rhombic shape and g-values of gz = 2.06, gy = 1.97
and gx = 1.88 that fall within the typical ranges
reported by More et al. [52], clearly identifying the pres-
ence of a reduced 2Fe-2S cluster. There is no EPR signal
that could be clearly assigned to a avin semiquinone in
the reduced CYP116B1. The EPR spectrum for the
2Fe-2S cofactor-reconstituted PDOR (2Fe-2S- and
FMN-binding) domain of CYP116B2 from Rhodococ-
cus sp. NCIMB 9784 produces an identical set of
g-values [33]. The CYP116B1 2Fe-2S EPR spectrum is
also highly similar to that for the homologous B. cepa-
cia PDOR (g = 2.04, 1.95 and 1.90), and to that of the
Arabidopsis photosynthetic ferredoxin Fd2 (g = 2.05,
1.95, 1.89) [53,54]. Integration of the EPR signals for
the oxidized haem and for the reduced ironsulfur
cofactors in CYP116B1 indicate that the 2Fe-2S centre
is present at  98% of the concentration of the haem,
thus suggesting near-complete incorporation of the
iron-sulfur cluster in CYP116B1.
To identify the avin bound to CYP116B1, we iso-
lated the bound cofactor from a puried enzyme sam-
ple, as described in the Materials and methods.
Thereafter, avin uorescence was determined at both
pH 7.7 and pH 2.0, as described previously [55], and
compared with FAD and FMN standards treated in
the same way. Decreased avin uorescence was
observed for both the CYP116B1 cofactor extract and
for FMN standards on acidication, while enhanced
uorescence was seen for FAD (owing to hydrolysis of
its pyrophosphoryl bond and release of ADP and the
more highly uorescent FMN). FMN content was esti-
mated at 55% by comparison with the quantity of
bound haem, consistent with the previous report of
variable FMN content in CYP116B2 [33]. The inclu-
sion of free FMN (1 mm) in buffers used for
CYP116B1 purication enabled increased FMN con-
tent in the puried enzyme (typically to > 80%).
Steady-state and stopped-flow kinetic studies on
CYP116B1
Analysis of the ability of CYP116B1 to reduce electron
acceptor molecules (potassium ferricyanide, cyto-
chrome c) in a NAD(P)H-dependent manner and to
perform P450 substrate-dependent oxidation of
NAD(P)H was examined in steady-state reactions
(Table 1). There was a strong preference for NADPH
over NADH, with a difference of  440-fold in Km
values for NADPH (0.9 lm) and NADH (399.1 lm)
determined in cytochrome c-reduction studies. The kcat
values for both ferricyanide and cytochrome c reduc-
tion were also three-fold greater with NADPH as the
1681
Biochemical analysis of CYP116B1 A. J. Warman et al.

Table 1. Steady-state kinetic properties of CYP116B1. Km and kcat Despite favourable haem optical changes induced by
values for CYP116B1 were determined from steady-state kinetic myristoleic, palmitoleic, oleic and arachidonic acids,
assays with NADH and NADPH as reductants, and using the elec-
none of these molecules stimulated CYP116B1-depen-
tron acceptors potassium ferricyanide (FeCN) and cytochrome c,
and the P450 substrates vernolate and EPTC. Km values shown are
dent oxidation of either NADH NADPH to any signif-
for NAD(P)H in the experiments using cytochrome c and FeCN, icant levels. By contrast, substantial stimulation of
and for vernolate EPTC in the experiments using the thiocarba- oxidation of both coenzymes was observed with EPTC
mates. In experiments using the thiocarbamate substrates, NADH and vernolate as substrates. A hyperbolic dependence
(1.5 mM) and NADPH (200 lM) were used at near-saturating con- of coenzyme oxidation rate on EPTC concentration
centrations. All assays were performed on a dual-beam spectropho- was obtained using both NADH and NADPH, and
tometer (Jasco) in buffer A at 25 C using CYP116B1 at a final
data were tted using the Michaelis function to pro-
concentration of 75100 nM
duce values of kcat = 30.7 min)1 and Km EPTC =
Reductant 50.3 lm (with NADPH as the donor) and kcat = 17.0 -
min)1 and Km EPTC = 110.4 lm (with NADH as the
Acceptor or substrate NADPH NADH
donor). For vernolate, the comparable values were
Cytochrome c kcat = 57.3 min)1 and Km vernolate = 210.2 lm (using
Km (lM) 0.9 0.5 399.1 52.1 NADPH as the donor) and kcat = 34.0 min)1 and
kcat (min)1) 151.1 8.0 57.1 2.7 Km vernolate = 270.4 lm (using NADH as the donor)
(Table 1). Thus, EPTC (a substrate that is dealkylated
FeCN
Km (lM) 3.0 1.0 102.1 12.2
in whole cells of R. erythropolis that express
kcat (min)1) 833.1 17.8 286.8 7.5 CYP116A1) clearly stimulates NAD(P)H oxidation in
CYP116B1, and the related dithiocarbamate vernolate
Vernolate enhances NAD(P)H oxidation to an even greater
Km (lM) 210.2 30.7 270.4 58.8 extent. In the absence of vernolate, NADPH-dependent
kcat (min)1) 57.3 1.9 34.0 2.2 reduction of the CYP116B1 haem iron is slow in a CO-
saturated solution ( 0.2 min)1) and results mainly in
EPTC
Km (lM) 50.3 9.6 110.4 10.0
the P420 form of the enzyme. In the presence of satu-
kcat (min)1) 30.7 0.5 17.0 0.4 rating vernolate, there is some stimulation of the rate
of haem iron reduction, but data analysis is compli-
cated by a greater tendency of the enzyme to aggregate
with development of turbidity in the solution. Despite
the progressive aggregation of vernolate-bound
coenzyme than with NADH (e.g. 833.1 min)1 versus CYP116B1 in this experiment, it is notable that the pre-
286.8 min)1 for ferricyanide), resulting in a 99-fold dif- dominant species is now the P450 form, indicating sub-
ference in catalytic efciency for ferricyanide reduction strate-dependent stabilization of the thiolate ligand, as
(measured as the ratio of kcat Km[NADPH] to kcat Km[- observed previously in other systems [37,38,56]. Given
NADH]) and a 1174-fold difference for cytochrome c the limited solubility of vernolate, its marginal effect on
reduction in favour of NADPH (Table 1). CYP116B2 haem iron spin-state equilibrium and its inuence on
also demonstrated preference for NADPH aggregation of CYP116B1, it is difcult to establish the
(Km = 3.0 lm) over NADH (102.1 lm) in steady-state extent to which electron transfer to the CYP116B1
ferricyanide-reduction assays [32]. In contrast, the haem iron is thermodynamically gated in the presence
B. cepacia PDOR avoprotein has strong preference of this substrate and a kinetic gate to haem reduction
for NADH (Km  10 lm) over NADPH, and NADPH in CYP116B1 cannot be ruled out [57]. Consistent with
did not support measurable activity with either cyto- the monomeric form of CYP116B1 being the catalyti-
chrome c or the partner protein PDO, pointing to an cally relevant species, specic rates of vernolate-depen-
important evolutionary divergence between the stand- dent NADPH oxidation, determined across a range of
alone PDOR enzyme and the fused PDOR domains in CYP116B1 concentrations (10500 nm), showed no sig-
the CYP116B enzymes. nicant variation. In contrast, similar studies with P450
In view of the preceding data indicating substrate- BM3 and the substrate lauric acid showed diminished
like (type I) Soret spectral shifts induced on binding specic activity at low enzyme concentration as a result
both unsaturated fatty acids and (to a lesser extent) the of disassociation of the catalytically active dimer [22].
thiocarbamate herbicides EPTC and vernolate, we To further characterize the reaction of CYP116B1
analysed steady-state oxidation of NADPH by with NAD(P)H, stopped-ow absorption spectroscopy
CYP116B1 in the presence of these potential substrates. was used to analyse the kinetics of reduction of

1682 FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
A. J. Warman et al. Biochemical analysis of CYP116B1

CYP116B1 by NADH and NADPH. Absorption tran- A

sients were collected at 465 nm (i.e. near the expected
absorption maximum for the oxidized FMN cofactor
[33]) after mixing CYP116B1 with different concentra-
tions of NAD(P)H. Reaction transients were biphasic
in all cases and were tted accurately using a double
exponential function. Approximately 80% (NADH)
and 90% (NADPH) of the overall absorption change
observed on coenzyme-dependent reduction of the
FMN 2Fe-2S centres occurred in the fast phase of the
reaction transients. The CYP116B1 haem was not
reduced by NAD(P)H to any extent in its substrate-
free form. Figure 6A shows a plot of the individual
rate constants for the fast (kobs1) and slow (kobs2)
phases of the transients against NADH concentration,
while Fig. 6B shows the same data set with NADPH B
as reductant. For NADH-dependent reduction, kobs1
shows a hyperbolic dependence on the NADH concen-
tration, and data were tted to yield a limiting rate
constant (klim) of 21.9 0.2 s)1 and an apparent
NADH Kd of 21.7 0.8 lm. The kobs2 values for
NADH are much slower (0.47 0.03 s)1) and show
no dependence on the NADH concentration (Fig. 6A).
For NADPH-dependent reduction of CYP116B1, the
reaction rate constants are higher, but there is no
dependence of either kobs1 (72 6 s)1) or kobs2
(5.5 3.0 s)1) on the NADPH concentration
(Fig. 6B).

Examination of the thermodynamic properties of
CYP116B1
To analyse the redox properties of CYP116B1, a
spectroelectrochemical redox titration was performed,
using methods described previously [58,59]. For the
intact CYP116B1, the overlapping spectral contribu-
tions of the individual haem, FMN and 2Fe-2S cofac-
tors resulted in difculty in deconvoluting potentials
for the three centres in the multicofactor enzyme.
However, it is clear that the reduction process occurs
in two phases. In the rst phase (black spectra in
Fig. 7A, completed in the range of 0 to )200 mV ver-
sus the normal hydrogen electrode [NHE]), spectral
bleaching of the contributions of the ironsulfur and
FMN cofactors occurs at  400600 nm (as seen for
the dithionite-reduced spectrum in Fig. 2A). There is
no obvious development of a long wavelength signal
(at  600 nm) during this reductive phase (Fig. 7A),
suggesting that there is negligible formation of the
FMN neutral semiquinone, as also observed in the
dithionite-reduced CYP116B1 EPR spectrum (Fig. 5).
This may indicate that the reduction potential for the
FMN semiquinone hydroquinone couple (E2) is more
Fig. 6. Stopped-flow kinetic analysis of NADH- and NADPH-depen-
dent CYP116B1 reduction. Stopped-flow absorption kinetic studies
of CYP1161B1 (3.3 lM final concentration) were performed by
monitoring the reduction of FMN 2Fe-2S centres at 465 nm (the
wavelength of maximal overall change between oxidized and
reduced CYP116B1) using both NADH (A) and NADPH (B) reducing
coenzymes at a range of concentrations up to 500 lM. Open circles
represent individual rate constants derived from the fast phase
(kobs1) of double-exponential fits to the DA465 versus time tran-
sients, while open squares represent kobs2 rate constants for the
slow phase of the reaction transients. There is no apparent depen-
dence of either kobs1 (72 6 s)1) or kobs2 (5.5 3.0 s)1) on
[NADPH]. With NADH as reductant, there is a hyperbolic depen-
dence of kobs1 on [NADH], giving a limiting rate constant (klim) of
21.9 0.2 s)1. However, there is no apparent dependence of kobs2
on [NADH] (0.47 0.03 s)1).
positive than that for the oxidized semiquinone cou-
ple (E1). With the assumption that absorption
changes at 485 nm (in the potential range where there
is negligible haem contribution) reect primarily the
transition from FMN quinone to hydroquinone (E12)
(with some absorption change also resulting from
the reduction of the 2Fe-2S cluster), the midpoint
potential for the two-electron FMN reduction was

FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS 1683
Biochemical analysis of CYP116B1
estimated as )122 9 mV (Fig. 7B). Data tted at
409 nm (an isosbestic point for the haem iron Fe(III)
to Fe(II) transition) produced a similar value
()134 8 mV) for the combined reduction of the
FMN 2Fe-2S centres. Although differing proportions
of absorption contribution probably come from the
FMN and ironsulfur cluster at the two wavelengths,
the midpoint potential values are within error and it
A
B the ferrous state. Haem iron reduction occurs with a
C mately half of the overall absorption change and is
1684 FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
A. J. Warman et al.
Fig. 7. Spectroelectrochemical titration of CYP116B1. (A) UV-visible
spectra recorded during a redox titration of CYP116B1 (6.3 lM).
The arrows show directions of absorbance changes occurring at dif-
ferent wavelengths during the reductive phase of the titration.
Absorbance spectra demonstrating the reduction of the FMN and
2Fe-2S clusters at more positive potentials are shown as black
lines, while spectra showing mainly reduction of the CYP116B1
haem iron from ferric to ferrous (at more negative potentials) are
shown as red lines. (B) A plot of absorbance data at 485 nm versus
applied potential in the range from  +25 to )200 mV (versus
NHE). Data are fitted using the Nernst function to define a midpoint
potential of )122 9 mV for the reduction of both the FMN and
2Fe-2S centres in CYP116B1. (C) A plot of absorbance data at
418 nm versus applied potential in the range from  +25 to
)450 mV (versus NHE). The plot shows two absorbance transi-
tions, and data were fitted using a two-electron Nernst function to
define midpoint potentials of 160 9 mV (encompassing both
FMN and 2Fe-2S centres) and )301 7 mV (for the CYP116B1
haem iron Fe(III) Fe(II) couple).
is clear that complete reduction of both cofactors
occurs in this potential range.
In the second stage of CYP116B1 reduction that
occurs in the range from )200 to )500 mV versus
NHE, the haem iron is converted from the ferric to
shift in the Soret peak from 418 to 410 nm (red spectra
in Fig. 7A), consistent with the retention of a cystei-
nate-ligated CYP116B1 haem iron and similar to the
spectral maximum observed for the reduced form of
P450 BM3 [58]. Data tted at 393 nm, where there are
negligible absorbance changes from the early part of
the reductive (FMN and iron-sulfur) titration, show a
single transition with a midpoint potential of
)291 9 mV (data not shown). Absorption versus
potential data plots at the oxidized Soret maximum
(418 nm) show a clear two-stage transition (Fig. 7C).
The decrease in A418 intensity in the rst stage of the
titration is attributed to the reduction of the FMN
and iron-sulfur cofactors. This accounts for approxi-
indicative of high levels of incorporation of these
cofactors in CYP116B1. The midpoint potentials
for the two transitions were determined using a two-
electron Nernst function [58], yielding values of (a)
)160 9 mV to encompass the FMN E12 and iron
sulfur cluster [2Fe-2S]2+ [2Fe-2S]+ couples and (b)
)301 7 mV for the haem iron Fe(III) Fe(II) couple.
These midpoint potential values are consistent with the
data ts at other wavelengths. Variations in the rela-
tive optical contributions of the FMN and 2Fe-2S
cofactors may explain the small differences in redox-
potential estimates for their combined reduction at
different analysis wavelengths.
A. J. Warman et al.
Identification of CYP116B1-catalysed reaction
products of thiocarbamate herbicides
Following the fatty acid thiocarbamate binding and
steady-state kinetic studies reported above, we under-
took experiments to establish whether CYP116B1
catalysed the oxidation of unsaturated fatty acids or of
the thiocarbamates vernolate and EPTC. No formation
of oxidized products was observed for NAD(P)H-driven
turnover of CYP116B1 with monounsaturated fatty
acids. However, preliminary studies indicated that prod-
ucts were formed from both vernolate and EPTC, with
superior levels of product formation seen using
NADPH as the reducing coenzyme (consistent with the
steady-state kinetic data in Table 1). A detailed charac-
terization of the products from the NADPH-dependent
turnover of CYP116B1 with these thiocarbamates was
thus undertaken by liquid chromatography (LC)-MS, as
described in the Materials and methods.
HPLC was used to analyse products from
CYP116B1-catalysed oxidation of vernolate and
revealed major features in the chromatogram at 34
39 min after sample loading, in addition to the remain-
ing parent molecule that eluted between 50 and 52 min
(Fig. 8A). The new features consisted of two major
product peaks, with a further small peak distinguish-
able between these major peaks. These product fea-
tures are absent from vernolate-only or enzyme-only
controls. The shorter retention time of these peaks
indicates that they arise from compounds more polar
in nature than the parent vernolate. The mass spectra
of the major bands at 37.1 and 38.4 min in the chro-
matogram are nearly identical, with two major peaks
observed with m z values at 220 and 144 (Fig. 8B).
The larger peak, at m z 220, corresponds to the mass
(M+H) of vernolate with a single hydroxylation. Fur-
ther analysis of this peak performed by collision-
induced disassociation (MS2) identied a single MS2
fragment with m z ratio 144. Analysis of the vernolate
structure revealed this MS2 fragment to be a hydroxyl-
ated form of vernolate lacking the S-propyl group and
probably arising from cleavage of the S-C bond
(Fig. 8C). MS2 analysis of the secondary HPLC-
derived peak at m z 144 revealed a single feature with
an m z ratio of 116, which again is a hydroxylated
product of a vernolate fragment lacking both the
S-propyl group and the carbonyl group (Fig. 8D). This
fragmentation pattern that shows loss of the S-propyl
group is consistent with that observed in the vernolate-
only controls (Fig. S2A,B) and conrms the position(s)
of CYP116B1-catalysed hydroxylation to be on one of
the N-propyl chains. The fact that we observed two
major peaks in the HPLC chromatogram with an
FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
Biochemical analysis of CYP116B1
almost identical mass spectrum may also be indicative
of hydroxylation occurring at different positions on
the N-propyl chain, although we cannot dene their
exact position(s) from these data. The mass spectrum
of the third small species observed at 37.7 min in the
chromatogram (indicated by an arrow in Fig. 8A) gave
a distinct single peak with an m z of 162 (Fig. 8E).
This m z ratio is consistent with dealkylation (loss of a
propyl group) from the parent vernolate. This is most
likely to be an N-dealkylation reaction given the differ-
ent m z ratio to that observed for the loss of the S-pro-
pyl group upon fragmentation. However, this
dealkylated product is a minor species compared with
the hydroxylated form(s) of vernolate, as seen from the
difference in sizes of the respective peaks in the HPLC
chromatogram. Similar hydroxylated products on the
N-propyl chains are also observed for the thiocarbamate
EPTC, which differs by a CH2 group in the S-ethyl
chain (S-propyl in vernolate) (Fig. S3), although these
are found in lower amounts compared with the verno-
late products. There is no evidence of CYP116B1-medi-
ated N-dealkylation with EPTC, although we cannot
rule out small amounts of such a product. Given the
greater proportion of hydroxylation and N-dealkylation
seen with vernolate over EPTC, it appears likely that
CYP116B1 binds more favourably to the S-propyl
group in vernolate than to the S-ethyl group in EPTC
to enable oxidative catalysis.
Discussion
We report here the rst biochemical characterization
of CYP116B1, a representative of a family of cyto-
chrome P450PDOR fusion enzymes with biotechno-
logical potential. Like P450 BM3 and other related
P450P450 reductase fusion enzymes, this makes
CYP116B1 a catalytically self-sufcient P450 enzyme,
requiring only substrates [NAD(P)H coenzyme and
thiocarbamate herbicide] for turnover (2,12,32).
The C. metallidurans CYP116B1 was expressed in
E. coli and puried to homogeneity using a combina-
tion of anion-exchange and hydrophobic afnity
chromatography. Heterologous expression of cofactor-
binding proteins in E. coli can result in incomplete
incorporation of non-covalently bound cofactors.
Indeed, in the case of the Rhodococcus sp. CYP116B2
enzyme, deciencies in both FMN and 2Fe-2S cofac-
tors were noted [33]. In our study of the C. metallidu-
rans CYP116B1, EPR quantication revealed
essentially stoichiometric incorporation of the 2Fe-2S
cluster and the P450 haem (Fig. 5). The FMN cofactor
was more weakly bound, but inclusion of FMN in
purication buffers enabled FMN incorporation to
1685
Biochemical analysis of CYP116B1 A. J. Warman et al.

B C

D E

Fig. 8. Analysis of products of CYP116B1-catalysed vernolate oxidation by liquid chromatography (LC)-MS. (A) HPLC chromatogram showing
elution profiles of vernolate substrate (upper blue line) and CYP116B1-catalysed oxidation products of vernolate (lower black line). Vernolate
elutes as a single peak between 50 and 52 min. Two additional peaks are observed following turnover with CYP116B1. These elute between
34 and 39 min and were determined to be hydroxylated forms of vernolate. A further sharp peak of lower intensity is also identified within
this region, eluting at 37.7 min and indicated by the arrow. This feature is assigned to an N-dealkylated product of vernolate. (B) The mass
spectrum of the chromatogram peaks at 37.1 and 38.4 min (both found to contain almost identical masses) showing two major species with
m z values of 220 and 144, and a smaller m z feature at 162. The m z 220 species results from hydroxylation of vernolate
(m z = 204 + 16). The structure of a potential hydroxylated product of vernolate is shown as an inset. (C) MS2 analysis of the m z 220 spe-
cies with a resultant m z at 144. This 144 m z species is assigned to a hydroxylated fragment of vernolate, with the S-propyl group
removed. A representative structure of the hydroxylated vernolate fragment structure is shown as an inset. (D) MS2 analysis of the m z 144
species with a resultant m z at 116. This is assigned to a hydroxylated fragment of vernolate, with the S-propyl and adjacent carbonyl
groups removed. These data are further confirmatory that the hydroxylation occurs on one of the N-propyl chains, but do not define an exact
position. A representative structure of this hydroxylated fragment is shown as an inset. (E) Mass spectrum of the minor peak at 37.7 min in
the CYP116B1 + vernolate chromatogram (A), showing a predominant m z peak at 162. This is consistent with dealkylation (loss of a pro-
pyl group) from vernolate. While the dealkylation could theoretically occur with removal of either an N- (shown inset) or an S-propyl chain,
the likely product is the N-dealkylated form (as seen for the reaction of Rhodococcus erythropolis ThcB with EPTC), occurring by CYP116B1-
catalysed C-N bond cleavage following successive hydroxylations at adjacent carbons on the N-propyl chain [34].

> 80%. UV-visible, EPR and resonance Raman spec-
troscopy (see the Supporting Information) conrmed
that that enzyme was isolated in a predominantly
low-spin ferric state, with cysteinate and water as the
fth and sixth (axial) ligands to the haem iron
(Figs 2A and 5, Fig. S1). The CYP116B1 Soret maxi-
mum at 418 nm is typical of such coordination and
spin-state in P450s, whereas the previous report of the
related CYP116B2 enzyme with Soret peak at 424 nm
is instead indicative of an enzyme in which imidazole
(used to elute the enzyme from nickel afnity resin)
has displaced water as the sixth ligand to produce an
inhibited form of the enzyme [32]. Previous studies of
intact CYP116B2 and its PDOR domain indicated a
low content of the 2Fe-2S cluster (in the range of
436%), necessitating ironsulfur cofactor reconstitu-
tion of the enzyme under anaerobic conditions [33].
Given the essentially stoichiometric incorporation of

1686 FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
A. J. Warman et al.
the 2Fe-2S cluster reported here for CYP116B1 (puri-
ed without using a nickel afnity step), it appears
possible that the nickel Sepharose resin used for puri-
cation of CYP116B2 resulted in stripping of iron from
the 2Fe-2S centre in this enzyme.
There is no EPR signal attributable to bound avin in
its EPR active (semiquinone) form in the dithionite-
reduced form of CYP116B1 (Fig. 5), and no obvious
optical signals typical of a avosemiquinone are
observed for either dithionite- or NADPH-reduced
CYP116B1 (Fig. 2A). We thus infer that the reduction
potential for the CYP116 FMN oxidized semiquinone
couple (E1) is more negative than that for the semiqui-
none hydroquinone couple (E2), meaning that little
FMN semiquinone accumulates during avin reduction.
Bound avin is converted from quinone to the two-elec-
tron hydroquinone form on reduction with dithionite,
and thus remains EPR silent. Redox potentiometry of
CYP116B1 (Fig. 7) demonstrates clearly that the reduc-
tion of the non-haem centres in CYP116B1 takes place
at a more positive potential than does the reduction of
the P450 haem iron. Bleaching of absorption occurs in
the avin (and ironsulfur) region between  420 and
520 nm before there is any notable shift in the position
of the haem Soret band. At more negative potentials,
the Soret shifts from 418 to  410 nm, consistent with
retention of cysteine thiolate as the haem iron fth
ligand in the reduced (ferrous) state of CYP116B1
[37,38]. The CYP116B1 haem iron potential
()301 7 mV versus NHE from data analysis at
418 nm) is more positive than that previously reported
for the isolated haem (P450) domain of the related
CYP116B2 enzyme ()380 4 mV), but is also more
negative than the reduction potential of the 2Fe-2S and
FMN centres in CYP116B1, whose reduction is com-
pleted by  )200 mV. This suggests that binding of
substrate to the CYP116B1 P450 active site may make
the haem iron potential more positive (through displace-
ment of the sixth water ligand to the ferric iron and
concomitant shift in haem iron spin-state towards high-
spin), as is the case for several other P450s [e.g. 41,58].
The limited solubility of vernolate EPTC, their mar-
ginal effects on CYP116B1 haem spin-state equilibrium
and their promotion of CYP116B1 aggregation prevents
us from establishing whether the binding of these dith-
iocarbamates is associated with a large elevation in
haem iron potential. This makes it difcult to establish
the extent to which substrate-dependent haem iron spin-
state modulation is important for control of enzyme
catalysis in CYP116B1, or whether an alternative mode
of regulation may be involved [e.g. 57,58].
In other work reported here, CYP116B1 was shown
to bind to unsaturated fatty acids with chain lengths
FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
Biochemical analysis of CYP116B1
from C14 to C20, producing substrate-like type I spec-
tral changes with accumulation of HS haem iron (e.g.
Fig. 3A). However, no evidence for their oxidation by
CYP116B1 could be obtained either through measure-
ments of fatty acid-dependent stimulation of
CYP116B1 NAD(P)H oxidation or isolation of oxi-
dized fatty acid products. In contrast, the thiocarba-
mate herbicides vernolate and EPTC, despite showing
rather small P450 type I (HS) spectral changes, not
only stimulated CYP116B1-dependent NAD(P)H oxi-
dation (Table 1), but were also shown to be substrates
for CYP116B1, and to be hydroxylated (EPTC and
vernolate) and N-dealkylated (vernolate) in an
NADPH-dependent manner. The modest type I shifts
induced by these herbicides possibly indicates that they
can occupy different positions in the CYP116B1
active-site pocket, with transient occupancy of the HS
position probably linked to oxidative catalysis by the
P450. Steady-state kinetic analysis indicates a prefer-
ence for vernolate over EPTC in CYP116B1, and this
is conrmed by the greater amounts of hydroxylated
products obtained with vernolate, as well as there
being clear evidence for N-dealkylation only in the
case of vernolate. Vernolate differs from EPTC in the
length of its S-alkyl side chain (S-propyl for vernolate
and S-ethyl for EPTC). The vernolate S-propyl chain
may confer greater specicity for CYP116B1 than does
the respective S-ethyl chain in EPTC. Although
CYP116B1 catalyses N- rather than S-dealkylation of
vernolate, it is conceivable that the S-propyl chain por-
tion of the thiocarbamate makes stabilizing interac-
tions in the active site that are important for
orientating one of the N-propyl chains of vernolate
towards the CYP116B1 haem to enable its oxidation
and subsequent N-dealkylation. At this stage we can-
not entirely rule out the absence of CYP116B1-medi-
ated S-dealkylation, although products are not
detected under the experimental conditions used. Other
N-dealkylation reactions are known in P450 chemistry,
and such oxidations are common in human enzymes.
For instance, several such reactions are catalysed by
the major human drug-metabolizing enzymes CYP2D6
and CYP3A4, including N-dealkylation of the opioid
addiction drug buprenorphine [e.g. 60,61]. In the case
of the vernolate N-dealkylation reaction catalysed by
CYP116B1, there are clear functional similarities
between CYP116B1 and the non-partner fused P450
ThcB in R. erythropolis NI86 21 [34]. ThcB
(CYP116A1 in the P450 superfamily) was shown to
oxidatively dealkylate EPTC. This is probably the rst
of a series of reactions enabling thiocarbamate catabo-
lism in the Rhodococcus strain. CYP116A1 and the
haem domain of CYP116B1 show 52% amino-acid
1687
Biochemical analysis of CYP116B1
sequence identity and are clearly orthologues. In
R. erythropolis, genes encoding a 2Fe-2S ferredoxin
(rhodocoxin) and a ferredoxin reductase (rhodocoxin
reductase) are located immediately downstream of the
P450, forming a classical bacterial class I P450 redox
system [2,34]. The divergent evolution of the CYP116B
family has clearly involved the genetic fusion of the
CYP116-type P450 with a distinctive redox partner
system, presumably as a result of advantages gained in
catalytic efciency. While it is uncertain whether thioc-
arbamates such as EPTC and vernolate are physiologi-
cally relevant substrates of CYP116B1, it is quite
possibly the case that C. metallidurans exploits this
P450 as part of its armoury of enzymes for metabolism
of xenobiotics. C. metallidurans is a bacterium able to
thrive in stressful pollutant heavy metal-contaminated
and nutrient-limited environments, and oxidases of
diverse substrate selectivity are probably important
components of its survival strategy [62].
In conclusion, we present the rst report of the bio-
chemical, spectroscopic, thermodynamic and catalytic
properties of C. metallidurans CYP116B1, a novel, cat-
alytically self-sufcient P450PDOR fusion enzyme
with oxidative activity towards thiocarbamate herbi-
cides. From a biotechnological viewpoint, there is
growing interest in the exploitation of such single-com-
ponent P450redox partner fusion enzymes. This
comes both from the perspective of using protein engi-
neering on high-activity fusion enzymes, such as P450
BM3, to enable industrially useful oxidation chemistry
[e.g. 2528], and also with respect to mimicking the
efciency of the naturally fused P450 enzymes by gen-
erating articial fusions of exogenous P450s to redox
partner systems. In the case of P450 BM3, fusions of
exogenous P450s to the BM3 reductase have met with
limited success, probably as a consequence of its
dimeric nature and the difculty in orientating reduc-
tase and P450 domains to achieve efcient intermolec-
ular electron transfer. However, CYP116B1, and
probably the other CYP116B family members, are
monomeric enzymes, and thus fusions of exogenous
P450s to their PDOR modules could provide a more
robust route to the generation of novel self-sufcient
P450 oxidases for biotechnological applications [63].
Materials and methods
Cloning, expression and purification of CYP116B1
The CYP116B1 gene (Rmet_4932) was cloned from geno-
mic DNA prepared from a culture of C. metallidurans
CH34 supplied by Professor Nigel Brown of the University
1688 FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
A. J. Warman et al.
of Birmingham, UK. To generate the megaplasmid DNA
template for Rmet_4932 cloning, single colonies of C. me-
tallidurans were resuspended in 1 mL of distilled, deionized
water (ddH2O), and 50 lL of the sample was heated at
99 C for 9 min in a PHC-2 thermal cycler (Techne, Bur-
lington, NJ, USA). The PCR reaction to amplify the
CYP116B1 gene involved 30 cycles of (a) denaturation at
95 C for 45 s, (b) annealing at 59 C for 1 min and (c)
polymerization at 72 C for 5 min, followed by a nal poly-
merization step of 72 C for 10 min. The forward and
reverse primers used for this reaction were based upon the
published genome sequence of C. metallidurans (http://gen-
ome.ornl.gov/microbial/rmet/), and were as follows:
CYP116B1F, GGACTAATCTCGCTGGACTGATTAATG
CCGC; and CYP116B1R, CGCTCAGCATCCGTGATG
CCGTGCTGAG (Nucleotides in bold are sites for restric-
tion enzymes AseI and BlpI, respectively, which were incor-
porated to facilitate the subcloning of CYP116B1.
Underlined nucleotides indicate the initiation (ATG) and
termination (TGA) codons.) The PCR ( 2.4 kbp) product
was puried using a Min-Elute gel-purication kit (Qiagen,
Crawley, UK) using the manufacturers protocol. The PCR
fragment was then A-tailed and cloned into the plasmid
vector pGEM-T (Promega, Southampton, UK). CYP116B1
clones were veried by blue white screening following the
manufacturers instructions, and subsequently by DNA
sequencing of the entire genes (PNACL, University of
Leicester). The CYP116B1 gene was transferred from the
pGEM-T cloning vector into the expression plasmid,
pET11a (Merck, Nottingham, UK). CYP116B1 was excised
from the pGEM-T clone by restriction digestion with AseI
and BlpI and the resultant gene fragment (2423 bp) was
resolved by electrophoresis through a 1% agarose gel and
puried as above. The pET11a vector was digested using
BlpI and NdeI (the latter enzyme produces ends cohesive
with those generated by AseI) and similarly puried. Resul-
tant colonies from ligation reactions were identied by
diagnostic restriction enzyme digestions and veried by
DNA sequencing. Validated CYP116B1pET11a constructs
were used for CYP116B1 production.
Expression trials were performed with CYP116B1
pET11a under a variety of conditions (varying growth
temperature, culture time, growth medium and isopropyl
thio-b-d-galactoside (IPTG) concentration) and in various
DE3 lysogen E. coli strains (Rosetta, Origami and
HMS174, all from Merck). Optimal expression of
CYP116B1 was obtained in the Origami(DE3) CYP116B1
pET11a transformant with growth at 37 C in Luria
Bertani (LB) medium until the culture reached an optical
density at 600 nm (D600) of 0.6. Thereafter, the culture tem-
perature was reduced to 18 C and growth continued until
an D600 of 0.8 was reached. At this point, IPTG was added
to a nal concentration of 100 lm and growth was contin-
ued overnight (typically 1216 h). For protein preparation,
a total culture volume of  6 L was used. Cells were
A. J. Warman et al.
harvested by centrifugation (30 min at 10 000 g in a Beck-
man JLA 8.1000 rotor). Cell pellets were resuspended in
buffer A (50 mm Tris HCl, pH 7.2, containing 1 mm
EDTA) and then re-pelleted as before. Cells were resus-
pended in the same buffer ( 50 mL) and kept on ice. A
CompleteTM protease inhibitor tablet (Roche, West Sussex,
UK) was added at this stage, along with the protease inhib-
itors phenylmethanesulfonyl uoride (1 mm) and benzami-
dine hydrochloride (1 mm). These protease inhibitors were
added to all buffers from this stage in the purication. The
cells were disrupted by passage (twice) through a French
Press (ThermoFisher, Loughborough, UK) at 950 psi, fol-
lowed by ultrasonication using a Bandelin Sonopuls
GM2600 sonicator (6 20-s bursts at 50% full power, with
5 min cooling time on ice allowed between bursts). The
lysate was centrifuged at 46 000 g for 30 min at 4 C and
then the supernatant was transferred to a DEAE column
pre-equilibrated in buffer A. CYP116B1-containing frac-
tions were eluted using a gradient (500 mL) of buffer A to
buffer A + 500 mm KCl. CYP116B1 eluted at  350 mm
KCl. Fractions were pooled and transferred to a phenyl
Sepharose column pre-equilibrated with buffer B (buffer A
containing 0.75 m ammonium sulphate solution). The col-
umn was washed extensively in buffer B and CYP116B1
was eluted using a gradient of buffer B to buffer A
(500 mL). Fractions were pooled, concentrated by ultral-
tration (using Centriprep concentrators; Millipore,
Watford, UK) and dialysed extensively against buffer A to
desalt the protein. The protein solution was then trans-
ferred to a Q-Sepharose column and CYP116B1 was eluted
as described for the DEAE step above. CYP116B1 was
pure at this stage and was concentrated by ultraltration
(as already described) to a nal concentration of  500 lm,
and then dialysed into buffer A, containing 50% (v v) ster-
ile glycerol, before storage at )80 C.
UV-visible spectroscopic analysis and cofactor
identification
UV-visible spectra of CYP116B1 were collected using a
Cary UV-50 scanning spectrophotometer (Varian) with a
1 cm-pathlength quartz cuvette. Spectra were recorded for
oxidized, sodium dithionite-reduced and various substrate-
(fatty acid and thiocarbamate) and ligand- (CO, NO,
cyanide, imidazole and substituted imidazole) bound forms,
as described previously [35,38]. Reduction of CYP116B1
and binding of CO was performed as described previously
[64]. The haem concentration of CYP116B1 was determined
using the pyridine haemochromagen method [65].
SEC-MALLS studies of CYP116B1
MALLS analysis of CYP116B1 was coupled to SEC and
performed on a Supredex-200 24 30 gel-ltration column
(GE Healthcare, Chalfont St Giles, UK) run in 50 mm
FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
Biochemical analysis of CYP116B1
potassium phosphate (pH 8.0), containing 200 mm KCl, on
a Dionex BioLC HPLC at 0.71 mLmin)1. Protein was
passed directly through a Wyatt EOS 18-angle laser pho-
tometer coupled to a Wyatt Optilab rEX refractive index
detector. The molecular weight moments and concentra-
tions of the resulting peaks were analysed using the Astra
v.5.3.2 software (Wyatt Technology, Haverhill, UK). Sam-
ples were passed through the column twice to ensure that
no aggregating species were included in the mass calcula-
tions.
EPR
EPR spectra were recorded at 10 K on a Bruker ER-300D
series electromagnet and microwave source, interfaced to a
Bruker EMX control unit and tted with a dual microwave
cavity from the same supplier (model ER-4116DM). Spectra
were recorded at 2 mW microwave power at a modulation
amplitude of 10 G. Spectra were recorded for both oxidized
and sodium dithionite-reduced forms of CYP116B1.
Determination of CYP116B1 flavin content
Flavin uorescence was recorded with sample excitation at
450 nm, and emission data were collected at 500600 nm
using a Cary Eclipse uorescence spectrometer in a 2 ml
quartz uorescence cuvette of 1 cm pathlength. To remove
avin cofactor from CYP116B1, enzyme samples (150 nm
3 lm) were heated to 95 C for 3 min and aggregated protein
was separated by centrifugation at 14 000 g for 10 min at
4 C. The supernatant was retained and analysed. Fluores-
cence data were collected for the protein in 100 mm potas-
sium phosphate (pH 7.7) and following acidication with
perchloric acid at pH 2.0, according to the method of Knight
and Hardy [66]. Fluorescence data at the different pH values
were compared with those for standard FAD and FMN solu-
tions for identication and quantication of the CYP116B1-
bound avin, as described in our earlier review [55].
Substrate- and ligand-binding studies
Analysis of interactions of CYP116B1 with various ligands
and candidate substrates was performed by spectral titration
in buffer A, monitoring ligand-induced absorption changes
across the spectral region from 300 to 750 nm. Difference
spectra were created at each point in the titrations by sub-
traction of the spectrum for the ligand-free enzyme from
that of the relevant ligand-bound form. Titrations were con-
tinued until no further spectral change could be discerned.
Maximal induced absorption change data were computed as
the difference in absorption at the peak and trough in the
difference spectra, and these values were plotted versus the
relevant ligand concentration applied. To determine Kd val-
ues, these data were tted to either a standard hyperbolic
1689
Biochemical analysis of CYP116B1
function or to a quadratic function (for very tight-binding
ligands), as described previously [39]. Titrations were per-
formed at 25 C, with ligands added either in buffer A or
(for fatty acids and thiocarbamate herbicides) in ethanol or
dimethylsulfoxide. The total volume of ligand addition was
< 1% of the nal volume in the assay. Volume changes as
a result of ligand additions were accounted for by spectral
correction before data analysis.
Steady-state and stopped-flow analysis of
CYP116B1
Steady-state kinetic analysis was carried out with
CYP116B1 in buffer A at 25 C on a dual-beam spectro-
photometer (Jasco). Assays for reduction of electron accep-
tor substrates were performed with cytochrome c (horse
heart) and potassium ferricyanide. Reactions typically used
75100 nm CYP116B1, and the Km values for cytochrome c
(29.9 1.7 lm) and ferricyanide (103.6 20.5 lm) were
established in preliminary assays using NADPH at a satu-
rating concentration (200 lm). Thereafter, the kcat and Km
values for NADPH and NADH were established in assays
in which the coenzyme concentration was varied for both
NADH (02 mm) and NADPH (0200 lm), and the elec-
tron acceptor concentration was maintained at a constant
near-saturating concentration (300 lm for cytochrome c
and 1 mm for ferricyanide). Rates were determined at
550 nm for cytochrome c using De550 = 22640 m)1cm)1
[18] and at 420 nm for ferricyanide using De420 =
1020 m)1 cm)1. Similar assays for P450 substrate-dependent
NAD(P)H oxidation (De340 = 6210 m)1 cm)1) were carried
out using various fatty acids (myristoleic acid, palmitoleic
acid and arachidonic acid, typically 0500 lm) and using
the thiocarbamate herbicides EPTC and vernolate, at con-
centrations up to 2 mm, using previously described methods
[48]. Vernolate-dependent NADPH oxidation was also
measured across a range of CYP116B1 concentrations
(10500 nm) in order to evaluate the effects on the specic
catalytic rate. CO-trapping experiments (to examine the
inuence of dithiocarbamate substrate on the reduction of
CYP116B1 haem) were performed anaerobically in the
absence and presence of vernolate, and in saturated CO
buffer with 3 lm CYP116B1. Electron transfer was initiated
by the addition of 10-fold excess NAD(P)H, and spectral
data were recorded to monitor the formation of (reduced-
CO) P450-adducts.
Stopped-ow studies of CYP116B1 were carried out
under the same conditions as the steady-state assays.
Assays were performed using both NADH and NADPH as
reductants and at 465 nm (the wavelength of maximal over-
all change between oxidized and PDOR domain-reduced
CYP116B1). Data were recorded using an SX18MV
UV-visible stopped-ow instrument (Applied Photophysics,
Leatherhead, UK). Enzyme (6.6 lm) was mixed with
NAD(P)H (up to 500 lm) in the stopped-ow instrument
1690 FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
A. J. Warman et al.
and single-wavelength data were recorded for up to 0.5 s.
Data were tted accurately using a double exponential
function and the applied photophysics software.
Thermodynamic characterization
A spectroelectrochemical redox titration of CYP116B1 was
performed, as described previously [58,59], with CYP116B1
at  8 lm. Spectral data were tted using Nernst functions
at wavelengths reecting transitions from the oxidized to
the reduced forms of the bound cofactors, in order to
derive midpoint reduction potentials for the CYP116B1
haem iron Fe3+ Fe2+ transition and to establish the poten-
tial range in which the 2Fe-2S and FMN cofactors were
reduced.
Product analysis
In order to identify the products of vernolate and EPTC
oxidation by CYP116B1, turnover reactions were per-
formed according to the methods reported by Lawson et al.
[47]. The 10-ml reactions contained CYP116B1 at a nal
concentration of 6 lm, 1 mm NADPH, 20 mm glucose and
8.25 units of glucose dehydrogenase (an NADPH regenera-
tion system), and 0.33 mm of either vernolate or EPTC.
The reaction constituents were all solubilized in buffer A,
with the exception of vernolate and EPTC, which were pre-
pared in ethanol. The reactions were performed in 30-mL
glass vials that had been wrapped in foil to exclude light
and washed with methanol, dichloromethane and ddH2O to
remove potential contaminants. Control reactions lacking
either CYP116B1 or substrate were also performed. Reac-
tion mixtures were incubated at 25 C and stirred continu-
ously for 16 h. Reactions were terminated by the addition
of 0.5 mL of 1.0 m HCl. Reaction products were extracted
by adding 3 mL of HPLC-grade dichloromethane to each
reaction. Organic phases were retained and aqueous phases
were subjected to a second extraction with dichloromethane
to maximize product recovery. Organic phases from each
reaction were pooled and the residual aqueous phase was
removed by the addition of anhydrous magnesium sulphate.
Samples were ltered to remove any particulates before
being evaporated to dryness under vacuum. The resultant
pellets were resuspended in a minimal volume of HPLC-
grade methanol ( 50 lL) for LC-MS analysis. LC-MS
was performed using an Agilent 1100 series HPLC-MSD
(Agilent Technologies, Waldbronn, Germany). Samples
were resolved using a Vydac C8 column (21 150 mm) run
at a ow rate of 1 mLmin)1 and maintained at 30 C. Fol-
lowing sample loading, an isocratic gradient of the mobile
phase (66% solvent A [100% HPLC-grade acetonitrile] and
34% solvent B [0.2% acetic acid in ddH2O]) was run for
28 min. Subsequently, the concentration of solvent B was
raised to 100% and the column was run for an additional
32 min. Detection of reaction products from the resolved
A. J. Warman et al.
samples was performed using the ion trap mass spectrome-
ter in the positive electrospray mode.
Acknowledgements
The authors thank the Biotechnology and Biological
Sciences Research Council UK (BBSRC) for funding
(PhD studentship to Ashley Warman). The authors
also thank Dr Harriet Seward (University of Leicester)
for assistance with EPR data collection, Dr Tom
Jowitt and Mrs Marj Howard for assistance with
MALLS collection and analysis and Mrs Marina
Golovanova (University of Manchester) for excellent
technical support.
References
1 Denisov IG, Makris TM, Sligar SG & Schlichtling I
(2005) Structure and chemistry of cytochrome P450.
Chem Rev 105, 22532277.
2 Munro AW, Girvan HM & McLean KJ (2007) Varia-
tions on a (t)heme novel mechanisms, redox partners
and catalytic functions in the cytochrome P450 super-
family. Nat Prod Rep 24, 585609.
3 Rittle J & Green MT (2010) Cytochrome P450 com-
pound I: capture, characterization, and C-H bond acti-
vation kinetics. Science 330, 933937.
4 Cryle MJ & De Voss JJ (2006) Is the ferric hydroperoxy
species responsible for sulfur oxidation in cytochrome
P450s? Angew Chem Int Ed 45, 82218223.
5 Shaik S, de Visser SP & Kumar D (2004) One oxidant,
many pathways : a theoretical perspective of monooxy-
genation mechanisms by cytochrome P450 enzymes.
JBiol Inorg Chem 9, 661668.
6 Guengerich FP (2001) Common and uncommon cyto-
chrome P450 reactions related to metabolism and chem-
ical toxicity. Chem Res Toxicol 14, 611650.
7 Rylott EL, Jackson RG, Sabbadin F, Seth-Smith HM,
Edwards J, Chong CS, Strand SE, Grogan G & Bruce
NC (2011) The explosive-degrading cytochrome P450
XplA: biochemistry, structural features and prospects for
bioremediation. Biochim Biophys Acta 1814, 230236.
8 Song W-C, Baertschis SW, Boeglin WE, Harris TM &
Brash AR (1993) Formation of epoxyalcohols by a
puried allene oxide synthase. Implications for the
mechanism of allene oxide synthase. J Biol Chem 268,
62936298.
9 Poulos TL, Finzel BC & Howard AJ (1987) High-reso-
lution crystal structure of cytochrome P450cam. J Mol
Biol 195, 687700.
10 Sevrioukova IF, Poulos TL & Churbanova IY (2010)
Crystal structure of the putidaredoxin reductase-puti-
daredoxin electron transfer complex. J Biol Chem 285,
1361613620.
FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
Biochemical analysis of CYP116B1
11 Wang M, Roberts DL, Paschke R, Shea TM, Masters
BS & Kim JJ (1997) Three dimensional structure of
NADPH-cytochrome P450 reductase: prototype for
FMN- and FAD-containing enzymes. Proc Natl Acad
Sci USA 94, 84118416.
12 Munro AW, Girvan HM & McLean KJ (2007) Cyto-
chrome P450-redox partner fusion enzymes. Biochim
Biophys Acta 1770, 345359.
13 Daiber A, Shoun H & Ullrich V (2005) Nitric oxide
reductase (P450nor) from Fusarium oxysporum. J Inorg
Biochem 99, 185193.
14 Shoji O, Fujishiro T, Nakajima H, Kim M, Nagano S,
Shiro Y & Watanabe Y (2007) Hydrogen peroxide
dependent monooxygenations by tricking the substrate
recognition of cytochrome P450BSbeta. Angew Chem
Int Ed 46, 36563659.
15 Hannemann F, Bichet A, Ewen KM & Bernhardt R
(2007) Cytochrome P450 systems biological variations
of electron transport chains. Biochim Biophys Acta
1770, 330344.
16 Warman AJ, Roitel O, Neeli R, Girvan HM, Seward HE,
Murray SA, McLean KJ, Joyce MG, Toogood H, Holt
RA et al. (2005) Flavocytochrome P450 BM3: an update
on structure and mechanism of a biotechnologically
important enzyme. Biochem Soc Trans 33, 747753.
17 Narhi LO & Fulco AJ (1987) Identication and charac-
terization of two functional domains in cytochrome
P-450BM-3, a catalytically self-sufcient monooxygen-
ase induced by barbiturates in Bacillus megaterium.
J Biol Chem 262, 66836690.
18 Noble MA, Miles CS, Chapman SK, Lysek DA, Mac-
Kay AC, Reid GA, Hanzlik RP & Munro AW (1999)
Roles of key active-site residues in avocytochrome
P450 BM3. Biochem J 339, 371379.
19 Munro AW, Daff S, Coggins JR, Lindsay JG & Chap-
man SK (1996) Probing electron transfer in avocyto-
chrome P450 BM3 and its component domains. Eur J
Biochem 239, 403409.
20 Gustafsson MC, Roitel O, Marshall KR, Noble MA,
Chapman SK, Pessegueiro A, Fulco AJ, Cheesman
MR, von Wachenfeldt C & Munro AW (2004) Expres-
sion, purication and characterization of Bacillus subtil-
is cytochromes P450 CYP102A2 and CYP102A3:
avocytochrome homologues of P450 BM3 from Bacil-
lus megaterium. Biochemistry 43, 54745487.
21 Kitazume T, Takaya N, Nakayama N & Shoun H
(2000) Fusarium oxysporum fatty-acid subterminal
hydroxylase (CYP505) is a membrane-bound eukaryotic
counterpart of Bacillus megaterium cytochrome P450
BM3. J Biol Chem 275, 3973439740.
22 Neeli R, Girvan HM, Lawrence A, Warren MJ, Leys
D, Scrutton NS & Munro AW (2005) The dimeric form
of avocytochrome P450 BM3 is catalytically functional
as a fatty acid hydroxylase. FEBS Lett 579, 55825588.
1691
Biochemical analysis of CYP116B1
23 Kitazume T, Haines DC, Estabrook RW, Chen B &
Peterson JA (2007) Obligatory intermolecular electron
transfer from FAD to FMN in dimeric P450 BM-3.
Biochemistry 46, 1189211901.
24 Girvan HM, Dunford AJ, Neeli R, Ekanem IS, Wal-
tham TN, Joyce MG, Leys D, Curtis RA, Williams P,
Fisher K et al. (2011) Flavocytochrome P450 BM3
mutant W1046A is a NADH-dependent fatty acid
hydroxylase: implications for the mechanism of electron
transfer in the P450 BM3 dimer. Arch Biochem Biophys
507, 7585.
25 Ost TW, Miles CS, Murdoch J, Cheung Y, Reid GA,
Chapman SK & Munro AW (2000) Rational re-design
of the substrate binding site of avocytochrome P450
BM3. FEBS Lett 486, 173177.
26 Peters MW, Meinhold P, Glieder A & Arnold FH
(2005) Regio- and enantioselective alkane hydroxylation
with engineered cytochromes P450 BM-3. J Am Chem
Soc 125, 1344213450.
27 Kille S, Zilly FE, Acevedo JP & Reetz MT (2011)
Regio- and stereoselectivity of P450-catalysed hydroxyl-
ation of steroids controlled by laboratory evolution.
Nat Chem 14, 738743.
28 Whitehouse CJ, Bell SG & Wong LL (2012) P450 BM3
(CYP102A1): connecting the dots. Chem Soc Rev 41,
12181260.
29 De Mot R & Parret AH (2002) A novel class of self-suf-
cient cytochrome P450 monooxygenases in prokary-
otes. Trends Microbiol 10, 502508.
30 Gassner GT, Ludwig ML, Gatti DL, Correll CC & Bal-
lou DP (1995) Structure and mechanism of the iron-sul-
fur avoprotein phthalate dioxygenase reductase.
FASEB J 9, 14111418.
31 Batie CJ & Ballou DP (1990) Phthalate dioxygenase.
Methods Enzymol 188, 6170.
32 Roberts GA, Celik A, Hunter DJ, Ost TW, White JH,
Chapman SK, Turner NJ & Flitsch SL (2003) A self-
sufcient cytochrome P450 with a primary structural
organization that includes a avin domain and a
[2Fe-2S] redox center. J Biol Chem 278, 4891448920.
33 Hunter DJ, Roberts GA, Ost TW, White JH, Muller S,
Turner NJ, Flitsch SL & Chapman SK (2005) Analysis
of the domain properties of the novel cytochrome P450
RhF. FEBS Lett 579, 22152220.
34 Nagy I, Schoofs G, Compornolle F, Proost P, Vander-
leyden J & de Mot R (1995) Degradation of the thioc-
arbamate herbicide EPTC (S-ethyl
dipropylcarbamothioate) and biosafening by Rhodococ-
cus sp. Strain NI86 21 involve an inducible cytochrome
P-450 system and aldehyde dehydrogenase. J Bacteriol
177, 676687.
35 Girvan HM, Levy CW, Williams P, Fisher K,
Cheesman MR, Rigby SE & Munro AW (2010) Gluta-
mate-haem ester bond formation is disfavoured in avo-
cytochrome P450 BM3: characterization of glutamate
1692 FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
A. J. Warman et al.
substitution mutants at the haem site of P450 BM3.
Biochem J 427, 455466.
36 Ost TW, Miles CS, Munro AW, Murdoch J, Red GA
& Chapman SK (2001) Phenylalanine 393 exerts ther-
modynamic control over the heme of avocytochrome
P450 BM3. Biochemistry 40, 1342113429.
37 Perera R, Sono M, Sigman JA, Pster TD, Lu Y &
Dawson JH (2003) Neutral thiol as a proximal ligand
to ferrous heme iron: implications for heme proteins
that lose cysteine thiolate ligation on reduction. Proc
Natl Acad Sci USA 100, 36413646.
38 McLean KJ, Warman AJ, Seward HE, Marshall KR,
Girvan HM, Cheesman MR, Waterman MR & Munro
AW (2006) Biophysical characterization of the sterol
demethylase P450 from Mycobacterium tuberculosis, its
cognate ferredoxin and their interactions. Biochemistry
45, 84278443.
39 McLean KJ, Cheesman MR, Rivers SL, Richmond A,
Leys D, Chapman SK, Reid GA, Price NC, Kelly SM,
Clarkson J et al. (2002) Expression and purication of
the cytochrome P450 CYP121 from Mycobacterium
tuberculosis. J Inorg Biochem 91, 527541.
40 Quaroni LG, Seward HE, McLean KJ, Girvan HM, Ost
TW, Noble MA, Kelly SM, Price NC, Cheesman MR,
Smith WE et al. (2004) Interaction of nitric oxide with
cytochrome P450 BM3. Biochemistry 43, 1641616431.
41 Sligar SG & Gunsalus IC (1976) A thermodynamic
mode of regulation: modulation of redox equilbria in
camphor monoxygenase. Proc Natl Acad Sci USA 73,
10781082.
42 Miles JS, Munro AW, Rospendowski BN, Smith WE,
McKnight JE & Thomson AJ (1992) Domains of the
catalytically self-sufcient cytochrome P-450 BM-3.
Genetic construction, overexpression, purication and
spectroscopic characterization. Biochem J 288, 503509.
43 Noble MA, Quaroni L, Chumanov GD, Turner KJ,
Chapman SK, Hanzlik RP & Munro AW (1998)
Imidazolyl carboxylic acids as mechanistic probes of
avocytochrome P-450 BM3. Biochemistry 37, 15799
15807.
44 Morrison JF (1969) Kinetics of the reversible inhibition
of enzyme-catalysed reactions by tight-binding inhibi-
tors. Biochim Biophys Acta 185, 269286.
45 Alterman MA, Chaurasia CS, Lu P, Hardwick JP &
Hanzlik RP (1995) Fatty acid discrimination and omega
hydroxylation by cytochrome P450 4A1 and a cyto-
chrome P450 4A1 NADPH-P450 reductase fusion pro-
tein. Arch Biochem Biophys 320, 289296.
46 Siddhanta U, Presta A, Fan B, Wolan D, Rousseau DL
& Stuehr DJ (1998) Domain swapping in inducible
nitric-oxide synthase. Electron transfer occurs between
avin and heme groups on adjacent subunits in the
dimer. J Biol Chem 273, 1895018958.
47 Lawson RJ, Leys D, Sutcliffe MJ, Kemp CA, Chees-
man MR, Smith SJ, Clarkson J, Smith WE, Haq I,
A. J. Warman et al.
Perkins JB et al. (2004) Thermodynamic and biophysi-
cal characterisation of cytochrome P450 BioI from
Bacillus subtilis. Biochemistry 43, 1241012426.
48 Girvan HM, Marshall KR, Lawson RJ, Leys D, Joyce
MG, Clarkson J, Smith WE, Cheesman MR & Munro
AW (2004) Flavocytochrome P450 BM3 mutant A264E
undergoes substrate- dependent formation of a novel
heme iron ligand set. J Biol Chem 279, 2327423286.
49 Lipscomb JD (1980) Electron paramagnetic resonance
detectable states of cytochrome P-450cam. Biochemistry
19, 35903599.
50 Evans EH, Rush JD, Johnson CE & Evans MCW
(1979) Mossbauer spectra of Photosystem-I reaction
centres from the blue-green alga Chlorogloea fritschii.
Biochem J 182, 861865.
51 Sellers VM, Wang K, Johnson MK & Dailey HA
(1998) Evidence that the fourth ligand to the [2Fe-2S]
cluster in animal ferrochelatase is a cysteine. J Biol
Chem 273, 2231122316.
52 More C, Belle V, Asso M, Fournel A, Roger G, Guigliar-
elli B & Bertrand P (1999) EPR spectroscopy: a powerful
technique for the structural and functional investigation
of metalloproteins. Biospectroscopy 5(S5), S3S18.
53 Batie CJ, Lahaie E & Ballou DP (1987) Purication
and characterization of phthalate oxygenase and phtha-
late oxygenase reductase from Pseudomonas cepacia.
J Biol Chem 262, 15101518.
54 Voss I, Goss Y, Murozuka E, Altmann B, McLean KJ,
Rigby SE, Munro AW, Scheibe R, Hase T & Hanke
GT (2011) FdC1, a novel ferredoxin protein capable of
alternative electron partitioning, increases in conditions
of acceptor limitation at photosystem I. J Biol Chem
286, 5059.
55 Munro AW & Noble MA (1999) Fluorescence analysis
of avoproteins. Methods Mol Biol 131, 2548.
56 Driscoll MD, McLean KJ, Levy C, Mast N, Pikuleva
IA, Late P, Rigby SE, Leys D & Munro AW (2010)
Structural and biochemical characterization of Myco-
bacterium tuberculosis CYP142: evidence for multiple
cholesterol 27-hydroxylase activities in a human patho-
gen. J Biol Chem 285, 3827038282.
57 Honeychurch MJ, Hill AO & Wong LL (1999) The ther-
modynamics and kinetics of electron transfer in the cyto-
chrome P450cam enzyme system. FEBS Lett 451, 351353.
58 Daff SN, Chapman SK, Turner KL, Holt RA, Govind-
araj S, Poulos TL & Munro AW (1997) Redox control
of the catalytic cycle of avocytochrome P450 BM3.
Biochemistry 36, 1381613823.
59 Dutton PL (1978) Redox potentiometry: determination
of midpoint potentials of oxidation-reduction compo-
nents of biological electron-transfer systems. Methods
Enzymol 54, 411435.
60 de Groot MJ, Ackland MJ, Horne V, Alex AA & Jones
BC (1999) A novel approach to predicting P450 medi-
ated drug metabolism. CYP2D6 catalyzed N-dealkyla-
FEBS Journal 279 (2012) 16751693 2012 The Authors Journal compilation 2012 FEBS
Biochemical analysis of CYP116B1
tion reactions and qualitative metabolite predictions
using a combined protein and pharmacophore model
for CYP2D6. J Med Chem 42, 40624070.
61 Kobayashi K, Yamamoto T, Chiba K, Tani M, Shi-
mada N, Ishizaki T & Kuroiwa Y (1998) Human bupr-
enorphine N-dealkylation is catalyzed by cytochrome
P450 3A4. Drug Metab Dispos 26, 818821.
62 Janssen PJ, Van-Houdt R, Moors H, Monsieurs P,
Morin N, Michaux A, Benotmane MA, Leys N,
Vallaeys T, Lapidus A et al. (2010) The complete
genome sequence of Cupriavidus metallidurans CH34,
a master survivalist in harsh and anthropogenic
environments. PLoS One 5, e10433.
63 Sabbadin F, Hyde R, Robin A, Hilgarth E-A, Delenn
M, Flitsch S, Turner N, Grogan G & Bruce NC (2010)
LICRED: a versatile drop-in vector for rapid genera-
tion of redox-self-sufcient cytochrome P450s. Chem-
BioChem 11, 987994.
64 Omura T & Sato R (1964) The carbon monoxide-bind-
ing pigment of liver microsomes. I. Evidence for its
hemoprotein nature. J Biol Chem 239, 23702378.
65 Berry EA & Trumpower BL (1987) Simultaneous deter-
mination of hemes a, b, and c from pyridine hemo-
chrome spectra. Anal Biochem 161, 115.
66 Knight E Jr & Hardy RF (1966) Isolation and charac-
teristics of avodoxin from nitrogen-xing Clostridium
pasteurianum. J Biol Chem 241, 27522756.
Supporting information
The following supplementary material is available:
Fig. S1. Analysis of the CYP116B1 heme cofactor
properties by resonance Raman spectroscopy
Fig. S2. Vernolate and EPTC LC-MS controls
Fig. S3. Product analysis of CYP116B1 EPTC turn-
over by LC-MS
Fig. S4. Amino acid alignment of the structurally
resolved Burkholderia cepacia phthalate dioxygenase
reductase (B. cepacia PDOR) and the reductase domain
of Cupriavidus metallidurans CYP116B1 (CYP116B1-
RED). Amino acid alignment of the reductase domain
of CYP116B1 (RED) with the structurally resolved
Burkholderia cepacia phthalate dioxygenase reductase
(B. cepacia PDOR) and key amino acids involved in
FMN binding and pyridine cofactor binding specicity.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be reorganized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing les)
should be addressed to the authors.
1693