Experimental and Applied Acarology (2005) 37: 257268

DOI 10.1007/s10493-005-3271-6
Springer 2005

-1

Hosts and pathogen detection for immature stages

of Ixodes ricinus (Acari: Ixodidae) in North-Central
Spain

A. ESTRADA-PENA1,*, J.J. OSACAR1, B. PICHON2 and J.S. GRAY2

1
Department of Parasitology, Veterinary Faculty, University of Zaragoza, Miguel Servet, 177. 50013
Zaragoza, Spain; 2Department of Environmental Resource Management, University College Dublin,
Ireland; *Author for correspondence (e-mail: aestrada@unizar.es; fax: +34-976-761-612)

Received 16 May 2005; accepted in revised form 20 September 2005

Key words: Blood remnants, Hosts, Immatures, Ixodes ricinus, Molecular detection, Pathogens

Abstract. To determine hosts of the immature stages of a southern population of Ixodes ricinus, we
trapped rodents and birds in an area of north-central Spain in MayJune and AugustSeptember of
1998 and 1999. The most frequently trapped rodents were Apodemus sylvaticus (230 specimens) and
Clethrionomys glareolus (99), with a larval infestation prevalence of 49% and 81%, respectively (in
spring) and 21% and 41% (in summer). C. glareolus was always more heavily parasitized by larvae
(mean numbers 19.8 in spring, 3.4 in summer) than A. sylvaticus (6.1 and 1.2, respectively). No
nymphs were collected from the rodents. The larval distribution pattern diered considerably
between rodent host species but not according to the season of the year. The most commonly
trapped birds were members of the Turdidae, which had infestation incidences of about 70%
(larvae) and 10% (nymphs) in spring and 2015% in summer. We also used molecular methods for
the identication of reservoir hosts of the larval ticks and of the pathogens they contained, from
nymphs collected in the same site in June of 2002 and 2003. The study showed that most of the ticks
had fed on birds and few on rodents and ruminants. Pathogens detected in these ticks included
Babesia microti, Borrelia garinii, B. valaisiana and B. afzelii. Borrelia afzelii was detected in a tick
that had apparently fed on a wild boar.

Introduction

The tick Ixodes ricinus transmits numerous pathogens, including viruses (tick-
borne encephalitis, louping-ill), bacteria (human granulocytic ehrlichiosis,
Lyme borreliosis) and protozoa (babesiosis) (Gray 1991). I. ricinus has received
considerable attention in the last 80 years, but there are many parts of the
ecology of the southern populations of the tick that require elucidation. In
countries with a Mediterranean climate the tick may be found in local areas of
sucient relative humidity to allow the survival of the population. While hosts
of the immature stages of this tick species are well known in wide regions of
Central Europe, Britain and Ireland, virtually nothing is known about hosts in
Mediterranean countries. Our incomplete understanding of the hosts of the
immature stages of I. ricinus in its southern distribution range renders any
258

attempts to describe how the pathogens are perpetuated in that region

somewhat speculative.
Kirstein and Gray (1996) demonstrated the feasibility of using polymerase
chain reaction (PCR) to identify host DNA in ticks containing remnants of the
previous instar blood meal, by amplifying part of the cytochrome B gene. By
identifying any pathogens in the same ticks information can thus be obtained
about possible reservoir hosts. The method was further modied by Pichon
et al. (2003) with the incorporation of an additional step involving amplica-
tion of part of the 18S rRNA of vertebrates and a multiplex PCR, targeting the
16S or 18S rDNA of pathogens for detection and identication of an array of
tick-borne pathogens. This method proved to be useful in the detection of
major host groups and pathogens in naturally infected ticks.
A previous report (Estrada-Pena et al. 2005) focused on the life cycle of I.
ricinus in northern Spain, and included a long-term set of observations on the
seasonal abundance of the tick coupled with studies on the development rate in
the eld in relation to microclimate records. This study presents data on hosts
for immature I. ricinus in the same region, produced by standard trapping
methods, together with blood meal analysis of nymphs for the detection and
identication of tick hosts and associated pathogens.

Materials and methods

The study site is an area in North-Central Spain (4214 N, 0228 W) in the

Rioja region. It is a phytogeographically heterogeneous region composed
mainly of patches of Quercus robur and Q. faginea, with small areas of Q.
petraea. There are also small sites with Fagus sylvatica and patches of Pinus
spp., interspersed with patches of natural grass. Secondary vegetation included
Ilex aquifolium, Pteridium aquilinum and Rubus sp. The zone selected for
samplings was a patch of about 80 ha, mainly composed of an old forest of Q.
robur and Q. faginea, with abundant undergrowth. A deep leaf litter or debris
from fallen wood occurred in all areas and moss growth was much in evidence.
The climate is European Atlantic, with mild summers (maximum temperatures
2226 C) and cold winters (temperatures below 0 C in JanuaryFebruary).
Rainfall is high (9001100 mm) and seasonal (FebruaryMay, September
December). Detailed climate data for the zone have already been published
(Estrada-Pena et al. 2005). The large animal species thought to maintain I.
ricinus in the area are domestic ungulates, mainly cattle.
Red deer (Cervus elaphus) and roe deer (C. capreolus) are locally abundant in
parts of the region. Medium sized animals include hedgehogs (Erinaceus
europeaeus) and red squirrels (Sciurus vulgaris). Rabbits and hares are absent,
but foxes (Vulpes vulpes) and wild boars (Sus scrofa) are very common.
Amongst the small mammals, the most abundant tick hosts are the woodmouse
(Apodemus sylvaticus) and the bank vole (Clethrionomys glareolus).
 259

Host captures

Small mammals were captured monthly through MayJune and August

September in 1998 and 1999. No attempts were made to capture small mam-
mals on other dates because questing larvae are scarce before May and larval
peaks dramatically decrease after September (Estrada-Pena et al. 2005). Small
mammals were live trapped on seven 1 ha plots, selected to represent the main
vegetation gradients in the site of study. Each plot was sampled for two con-
secutive nights, using 50 Sherman live traps (Sherman Traps, Tallahasee,
Florida) placed in a grid at 5 5 stations, with two traps per station and an
interval of 20 m between stations. Each individual host was slightly anaes-
thetised with ether and ticks removed after combing and careful examination.
In order to further examine some specic sites, such as ears, the fur of the
animal was combed thoroughly, using a toothbrush over a white plastic batch.
Samples were divided into spring (MayJune) and summer (AugustSeptember).
Although some other small mammals were trapped (such as Sorex araneus and
Apodemus agrarius), they represented only about 2% of the total number of
mammals captured. All mammals were released near the point of capture.
Weekly collections of birds were made in the same months and years using
Japanese-type nets. Nets were set up at sunset and examined continuously for
3 h. The bird species were determined and before their release a careful visual
inspection of dened sites (i.e. around the ears) was performed and ticks col-
lected with ne forceps.
Host infestation by I. ricinus is described in terms of prevalence (% infested
hosts), arithmetic mean (number of ticks per host), variance (s2) and the ratio
s2/x. This ratio was used as a measure of clumping factor (Randolph 1975).
These values were calculated separately for host species and season. No sig-
nicant dierences were found in the percent of infested hosts according to sex.
The frequency distribution of larvae on mammals hosts (number of hosts with
1, 2,, n larvae) was also calculated.

Blood meal analysis and pathogen identication

This part of the study was carried out in an attempt to complement the data
and complete the picture of host use and pathogen circulation for I. ricinus in
the study site. Unfed nymphs were collected in the same site in June of 2002
and 2003. The site was examined for questing ticks by dragging a 1 m2 white
diaper annelette over the vegetation for 30 min. Ticks were usually collected
between 11.00 h and 16.00 h by three persons at the site. The cloth was
examined at 30 s intervals, and ticks removed with a ne paintbrush or an
insect aspirator.
The nymphs were kept alive and were sent to the Dublin laboratory for
DNA extraction and identication of blood meal remnants and pathogens. The
methods are fully described by Pichon et al. (2003). Briey, vertebrate DNA in
260

the tick gut was identied by PCR amplication using universal primers tar-
geting part of the 18S rRNA gene, followed by Reverse Line Blot (RLB). In
addition some of the tick lysates were examined with primers for the 12S rRNA
gene. The 12S rRNA was amplied by 40 PCR cycles [94 C/4 min;
40 (94 C/30 s; 52 C/30 s, 72 C/30 s); 72 C/10 min] using universal
primers 244 (Biotin-5CTTCAGCRAACCCTAAAAA3) and 246 (5AAR-
ARAATGTAGCCCATT3). PCRs were run in 50 ll of reaction mixture
containing 1 U of Taq polymerase (Invitrogen), PCR buer (2 mM MgCl2,
0.2 lM of each primer and 200 lM of each dNTP). PCR products were
identied by RLB using 5amino-link probes described in Table 1. This ap-
proach identied hosts at the subgroup level, e.g. ruminants, Suidae (pigs),
hares/rabbits, carnivores, rodents, insectivores, game birds and song birds.
Pathogens (including Borrelia afzelii, B. burgdorferi, B. valaisiana, B. garinii,
Babesia microti, B. divergens and Anaplasma phagocytophilum) were detected
(using the same tick material as for host DNA detection) with a novel multi-
plex PCR, and RLB hybridisation was then performed to identify them.

Results

In addition to I. ricinus, specimens of I. trianguliceps, Haemaphysalis punctata,

and Dermacentor marginatus were collected from small mammals, and I.
frontalis and H. punctata were collected from birds. A total of 99 C. glareolus
and 230 A. sylvaticus were trapped. Data on infestation of small mammals by
larval I. ricinus are presented in Table 2. These data are provided separately for
the two collecting seasons (spring and summer) as the Students test of mean
showed highly signicant dierences (p < 0.0001) between seasons. The inci-
dence (% infested hosts) was clearly dierent in both host species, the highest
value being found for C. glareolus. The mean number of larvae per host was
signicantly greater on C. glareolus than on A. sylvaticus (p < 0.001) in spring
and summer.
Variance was higher in spring for both host species, although smaller in A.
sylvaticus. The frequency distribution of larvae on the host species is given in
Figure 1. The distribution pattern diers considerably between host species,

Table 1. Oligonucleotide sequences of probes used in RLB for detection and identication
of amplied 12S rRNA of vertebrates.

Probes Sequence 53 Targeted species

12s03 GTTTTAATGCTTGTTCTTGTGCT Apodemus sp.

12s04 ATTTATGTTTGAATCATTGTGCT Erinaceus sp.
12s05 CCACCACATTGGCTACACCT Clethrionomys sp.
12s06 CCAACCCATAAGCTACACCT Sus sp.
12s07 TTCCGTTCCATAGGTTACACC Cervus sp.
 261

Table 2. Larvae of Ixodes ricinus on small mammals.

C. glareolus A. sylvaticus

Spring
No. of hosts 57 110
% infested hosts 96.4 49.1
Larvae/host 19.8 6.1
Variance 453 101
Variance/mean 22.87 16.55
Summer
No. of hosts 42 120
% infested hosts 97.6 21.8
Larvae/host 3.4 1.2
Variance 4.8 11.2
Variance/mean 1.41 9.33

but not according to the season of the year. As mentioned previously, no

signicant dierences were observed between the host sexes, and therefore both
sexes are represented together. Most A. sylvaticus have low larval numbers in
both spring and summer and no hosts with more than 11 larvae were found in

Figure 1. Frequency distribution of larvae of I. ricinus in small mammals hosts according to

species and season. Included is the number of A. sylvaticus in spring (a) and summer (b) and C.
glareolus in spring (c) and summer (d) within a category of larvae/host.
262

spring. However, in summer up to 10% of A. sylvaticus were found with more

than 11 larvae. The frequency distribution pattern is clearly dierent in C.
glareolus, with more than 50% of hosts having high numbers of larvae in both
spring and summer. The frequency distribution of larvae on C. glareolus
progressively increased with a maximum of around 40 larvae/host, and then
suddenly decreased, with only 1 animal (1.7%) having more than 60 larvae in
spring and 2 (4.6%) in summer. No nymphs were found on any of the rodents.
A total of 750 birds, comprising 15 species, together with 116 undetermined
immature Turdus spp. were collected (Table 3). The most commonly collected
birds were T. merula, T. philomelos, Erithacus rubecula and Carduelis carduelis.
Larvae of I. ricinus were mainly found on Turdidae, with fewer specimens
collected on other bird species. The incidence of infested birds was 23 times
higher in spring than in summer. Larvae and nymphs were found together only
on Turdidae. However, while around 8090% of Turdus spp. were positive for
larvae, only 1012% were hosts for nymphs. Both mean and variance of lar-
vae/bird were lower than for the rodents.
Data on the molecular detection of host DNA (using both 18S and 12S) and/
or pathogens are included in Table 4. A total of 263 unfed nymphs were col-
lected for this analysis and 61 were processed. However, adequate PCR
amplication and unambiguous pathogen and/or host detection was only
achieved for 25 specimens. Most blood remnants were from Aves
(Passeriformes and Galliformes) while a few (3 out of 25) were from Apodemus
sp., 4 from wild boars (Sus scrofa) and 1 from Cervus sp. Concerning the
pathogens detected in these ticks, Borrelia afzelii, B. garinii or B. valaisiana
were identied in 12 out of 25 nymphs (with two double identications, B.
garinii plus B. valaisiana). B. afzelii was identied in ve nymphs. Three of
them fed as larvae on birds, one on a wood-mouse and one on a wild boar.
Babesia microti was identied in one nymph but no host DNA was detected.

Discussion

This study presented data on the parasitism by larval I. ricinus ticks of two
species of rodents and 15 species of passeriform birds, together with the
detection and identication of pathogens in blood remnants from nymphs
collected on vegetation. Although studied for more than 50 years, knowledge
of the biology of I. ricinus remains incomplete, partly because of the geo-
graphical and genetic heterogeneity of this tick species and also because of the
diverse habitats it occupies. A wide range of vertebrates such as reptiles, birds,
small-, medium- and large-sized mammals serve as hosts for I. ricinus
(Aeschlimann 1972). Small mammals, ground-foraging birds and reptiles are
common hosts for immature ticks but not for adults (Matuschka et al. 1991).
In this study, most trapped rodents were A. sylvaticus and C. glareolus. The
low trapping proportion of other mammal species, like Sorex araneus and
Table 3. Larvae and nymphs of Ixodes ricinus on birds.

Host Larvae Nymphs

Number % Positive Mean Variance Variance/Mean % Positive Mean Variance Variance/Mean

Spring
Turdus merula 102 96.1 3.9 6.1 1.56 10.8 2.1 9.4 4.47
T. philomelos 91 81.3 4.1 7.2 1.75 15.4 1.6 3.1 1.93
Turdus spp. 66 46.9 1.8 3.2 1.77 24.2 1.9 5.6 2.94
Troglodytes troglodytes 8 0 0
Prunella modularis 5 0 0
Parus ater 15 0 0
Parus major 22 0 0
Erithacus rubecula 106 1.9 2 0.6 0.3 0
Fringilla coelebs 65 4.6 3.3 0.3 0.09 0
Carduelis carduelis 32 0 0
Phylloscopus collybita 15 0 0
Saxicola torquata 7 0 0
Muscicapa striata 4 0 0
Motacilla cinerea 7 0 0
M. alba 5 0 0
Cinclus cinclus 3 0 0
Summer
Turdus merula 41 39.1 1.6 6.1 3.81 19.5 2.8 8.6 3.07
T. philomelos 39 23.1 1.1 7.2 6.54 12.8 1.8 4.8 2.66
Turdus spp. 50 24.0 1.4 3.2 2.28 20.0 1.8 6.9 3.83
Prunella modularis 1 0 0
Parus ater 10 0 0
P. major 8 0 0
Erithacus rubecula 86 4.6 0.4 0.6 1.5 0
Fringilla coelebs 31 9.7 0.1 0.3 3 0
Carduelis carduelis 45 0 0
Phylloscopus collybita 1 0 0
263

Saxicola torquata 1 0 0
264

Table 4. Molecular analysis of blood remnants in unfed nymphs collected by dragging in 2002
2003. A total of 263 unfed nymphs were collected. Data are included only for those individual ticks
that provided adequate DNA amplication and accurate host blood and/or pathogen identica-
tion. Frequencies of each pathogen or host identication are not calculated because of the small
numbers involved, nd: not done.

Tick ID Host identication Pathogen detection

18S (nuclear) 12S (mitochondrial)

916 Galliformes nd B. afzelii

917 Passeriformes nd
920 Passeriformes nd
923 Galliformes nd B. valaisiana
924 Galliformes nd B. afzelii
925 Sus B. afzelii
926 Sus
933 Apodemus Apodemus B. afzelii
934 Sus
936 Passeriformes nd
941 Babesia microti
942 B. afzelii
944 Passeriformes nd B. garinii + B. valaisiana
948 Passeriformes nd
953 B. valaisiana
954 Passeriformes B. valaisiana
957 Sus
958 Passeriformes
962 Apodemus
963 Passeriformes B. garinii + B. valaisiana
964 Passeriformes B. garinii
968 Galliformes B. afzelii
971 Apodemus
972 Galliformes
974 Cervus

Apodemus agrarius, prevents any analysis on their importance for I. ricinus.

Like most studies concerning I. ricinus on rodents, the distribution of larvae is
highly clumped (non random). In the case of C. glareolus, the variance/mean
value was clearly smaller in summer than in spring, perhaps reecting changes
in the abundance of this host. The larval activity peak in the site of study was
unimodal, with a maximum activity around AugustSeptember (Estrada-Pena
et al. 2005) in contrast with patterns detected in other sites throughout Europe
(reviewed by Gray 1991). However, maximum infestation rates and maximum
numbers of larvae/host were observed in spring, before the peak of activity.
The incidence and the number of larvae/host were always higher in C. glareo-
lus. This is in obvious contrast with other studies on larval I. ricinus on rodents
in Europe (Kurtenbach et al. 1995; Gray et al. 1999; Humair et al. 1999) where
A. sylvaticus has been always found more infested than C. glareolus, with
variable patterns of larval distributions on hosts. This fact has been explained
 265

by a host preference by larvae (Nilsson and Lundqvist 1978) or because C.

glareolus acquires resistance to I. ricinus (Dizij and Kurtenbach 1995). Reasons
for such a discrepancy are unclear, but seem to be derived from a delicate
equilibrium between larval questing activity and the abundance of hosts
according to the season of the year. No nymphs were collected from rodents in
this study. Similarly low larval:nymph ratios were found in a neighbouring
region of Spain (1:451) (Gil et al. 2005) and in Ireland (1:754) (Gray et al.
1999). This contrasts with the pattern of parasitism in North America, where
only about 3.5 times more larval I. scapularis feed on small rodents than do
nymphs (Spielman et al. 1984).
Ticks were collected from birds out of the migratory season in an attempt to
restrict the data to resident hosts. Turdidae were clearly more infested than
other birds. Considering together all Turdus spp. collected, more than 70% of
birds were parasitized by larvae of I. ricinus, with an average of almost 3 ticks/
host. Nymphs of I. ricinus were found exclusively on Turdidae. Other abundant
ground-frequenting bird species showed remarkably low infestation preva-
lences. For instance, robins (Erithacus rubecula) usually search for food on the
ground of wooded areas and should be an easy target for host-seeking ticks.
However, this host species had an infestation prevalence of only about 1.9% in
spring and 0.4% in summer. This feature is in clear contrast to the high
prevalence of larval I. ricinus found on E. rubecula collected in the Czech
Republic (Hubalek et al. 1996). In other studies, as much as 53% of forest
birds were infested with immature I. ricinus, with the highest proportions on T.
philomelos, T. merula and E. rubecula, according to a study in Switzerland
(Humair et al. 1993).
Molecular analysis of the blood remnants in the gut of nymphs suggests that
passeriform and galliform birds are important hosts of larvae. This is supported
by preliminary studies at the study site by Osacar et al. (1998), who observed
that a large proportion of birds were parasitized by I. ricinus larvae. These
ndings strongly suggest that, at least in this study site, birds are the most
important hosts for I. ricinus larvae, and that data obtained by trapping small
mammals only reveals a partial picture of the host relationships in the site.
A high proportion of nymphs were found to be infected with at least one
member of the B. burgdorferi genospecies group. The nding of a nymph fed as
a larva on Susscrofa, and infected with the mammal-associated B. afzelii,
suggests that wild boar may function as reservoir for this genospecies, partic-
ularly bearing in mind the large number of immature ticks that could feed on
this host. Investigations into the geographical distribution of B. burgdorferi s.l.
in Europe have revealed that B. garinii is the most frequently cultured species,
followed by B. afzelii, B. burgdorferi and B. valaisiana in that order (Hubalek
and Halouzka 1997; Saint-Girons et al. 1998). B. valaisiana and B. lusitaniae
have been isolated from or detected in I. ricinus in a few countries.
A genospecies specicity has been proposed in Eurasia, with rodents as the
main host for B. afzelii (Gern and Humair 1998) and birds as the main host for
266

B. garinii (Kurtenbach et al. 1998). In addition, some strains of B. garinii have

been detected in small rodents in other studies (Korenberg et al. 1997).
The role of birds as reservoir hosts is now clearly established in Europe
(Craine et al. 1997; Humair et al. 1998). Other than on colonial seabirds (Olsen
et al. 1993) infected ticks have been collected from thrushes (Turdus spp.),
blackbirds (T. merula), robins (Erithacus rubecula) and pheasants (Phasianus
colchicus). In pheasants, more than 50% of I. ricinus ticks were infected by
B. garinii and B. valaisiana (Kurtenbach et al. 1998). This host is absent in the
region of current study, but other galliforms (such as red partridge, Alectoris
rufa) are common in the site. The nding of blood remnants from galliforms,
associated with both B. valaisiana and B. afzelii suggests an important rela-
tionship between I. ricinus larvae, galliforms and these pathogens. Our results
from passeriform birds consistently associated them with both B. garinii and
B. valaisiana. This agrees with the reports on the absence of Borrelia
genospecies other than garinii and valaisiana observed in European Turdidae
(Gern and Humair 2002).
Borrelia afzelii has only recently been recognized in eld studies in Spain by
Gil et al. (2005) as previous studies reports failed to identify it (Barral et al.
2002; Escudero et al. 2000). Gil et al. (2005) found a low proportion of nym-
phal questing ticks infected with B. afzelii in a site close to that of the current
study. It seems that B. afzelii may be more abundant than previously thought,
as our results point to the presence of this genospecies in nymphal ticks molting
from larvae that fed on rodents, birds and a wild boar, reported here as a new
reservoir association. The presence and status of B. afzelii in Spain should be
re-examined to determine the importance of this genospecies there. Interest-
ingly, previous laboratory studies on vector competence, involving a German
isolate of B. afzelii in ticks collected in Germany, Ireland and Spain, revealed
than the Spanish nymphs, fed on B. afzelii-infected gerbils as larvae, had the
highest infection rates and the greatest intensity of infection (Estrada-Pena
et al. 1998).
The data on blood meal analysis and pathogen detection support a
hypothesis already raised by Gray et al. (1999) in Ireland. These authors
suggested that rodents are not the main source of the spirochaetes in the ticks
in an area of Ireland, as most ticks in the site were found to be infected with B.
garinii and B. valaisiana, according to data by Kirstein et al. (1997) and Pichon
et al. (2005). Rodent DNA was rarely found in infected ticks suggesting that
rodents were not important Borrelia reservoirs at that particular site. In our
data, most of the ticks that had fed on rodents were negative for Borrelia spp.,
but those identied as bird-fed were largely positive for these bird-associated
Borrelia spp. in this particular site. Similar ndings on the limited participation
of small rodents in the circulation of B. burgdorferi s.l. were reported by
Kurtenbach et al. (1998) for a site in UK. In our study site, rodents are thus of
small or no importance in the transmission of Lyme disease, because no
nymphs were collected on the trapped rodents, and because most infected
larvae appear to feed on birds and, to a lesser extent, on other mammals. The
 267

absence of nymphs on rodents could also explain the low prevalence of

B. afzelii (Gray et al. 1999; Gil et al. 2005).
In the original report of the method (Pichon et al. 2003), the authors
demonstrated that host DNA detection in nymphs, developed from fed larvae
maintained in the eld under natural temperature conditions in Ireland, was
still 100% after 7 months but reduced to 40% after 9 months. The results
presented here showed that PCR amplication was obtained in only 24.5%
(18S) and 15.5% (12S) of the ticks. Of the 263 ticks collected for the analysis
only 61 were in suciently good condition for processing following dispatch to
the Dublin laboratory. This indicates that most nymphs had probably been
stressed by the relatively low ground humidity (6075% RH) and high tem-
peratures at the Spanish site, and this may have resulted also in a greater rate
of DNA degradation than in Ireland. Further degradation may have occurred
in transit. Nevertheless, consecutive blood meal analysis and pathogen detec-
tion remains a promising means to further understand the puzzling picture of
hosts and pathogen associations of I. ricinus throughout its range.

Acknowledgement

The blood meal analysis component of the study was funded by the Wellcome
Trust, UK.

References

Aeschlimann A. 1972. Ixodes ricinus, Linne, 1758 (Ixodoidea: Ixodidae). Essai preliminaire de
synthe`se sur la biologie de cette espe`ce en Suisse. Acta Tropica 29: 321340.
Barral M., Garc a-Perez A.L., Juste R.A., Hurtado A., Escudero R., Sellek R.E. and Anda P. 2002.
Distribution of Borrelia burgdorferi sensu lato in Ixodes ricinus (Acari Ixodidae) ticks from the
Basque country. Spain. J. Med. Entomol. 39: 177184.
Craine N.G., Nuttall P.A., Marriott A.C. and Randolph S.E. 1997. Role of grey squirrels and
pheasants in the transmission of Borrelia burgdorferi sensu lato, the Lyme disease spirochaete, in
the UK. Folia Parasitol. 44: 155160.
Dizij A. and Kurtenbach K. 1995. Clethrionomys glareolus, but not Apodemus sylvaticus, acquires
resistance to Ixodes ricinus L., the main European vector of Borrelia burgdorferi. Parasite
Immunol. 17: 177183.
Escudero R., Barral M., Perez A, Vitutia M.M., Garc a-Perez A.L., Jimenez S., Sellek R.E. and
Anda P. 2000. Molecular and pathogenic characterization of Borrelia burgdorferi sensu lato
isolates from Spain. J. Clin. Microbiol. 38: 40264033.
Estrada-Pena A., Daniel M., Frandsen F., Gern L., Gettinby G., Gray J.S., Jaenson T.G.T.,
Jongejan F., Kahl O., Korenberg E., Mehl R. and Nuttall P.A. 1998. Ixodes ricinus strains in
Europe. Zentralblatt fur Bakteriologie 287: 190195.
Estrada-Pena A., Mart nez J.M., Sanchez Acedo C., Qu lez J. and Del Cacho E. 2005. Phenology
of the tick, Ixodes ricinus, in its southern distribution range (central Spain). Med. Vet. Entomol.
18: 111.
Gern L. and Humair P.-F. 2002. Ecology of Borrelia burgdorferi in Europe. In: Gray J.S., Kahl O.,
Lane R.S. and Stanek G. (eds), Lyme Borreliosis. Biology, Epidemiology and Control. CABI
Publishing, Oxon, UK.
 268

Gern L. and Humair P.-F. 1998. Natural history of Borrelia burgdorferi sensu lato. Wien. Klin.
Wochenschr. 100: 856858.
Gil H., Barral M., Escudero R., Garc a-Perez A.L. and Anda P. 2005. Identication of a new
Borrelia species among small mammals in areas of northern Spain where Lyme disease is en-
demic. Appl. Environ. Microbiol. 71: 13361345.
Gray J.S. 1991. The development and seasonal activity of the tick Ixodes ricinus: a vector of Lyme
borreliosis. Rev. of Med. Vet. Entomol. 6: 323333.
Gray J.S., Kirstein F., Robertson J.N., Stein J. and Kahl O. 1999. Borrelia burgdorferi sensu lato in
Ixodes ricinus ticks and rodents in a recreational park in south-western Ireland. Exp. Appl.
Acarol. 23: 717729.
Hubalek Z., Anderson J.F., Halouzka J. and Hajek V. 1996. Borrelia in immature Ixodes ricinus
(Acari: Ixodidae) ticks parasitizing birds in the Czech Republic. J. Med. Entomol. 33: 766771.
Hubalek Z. and Halouzka J. 1997. Distribution of Borrelia burgdorferi sensu lato genomic groups
in Europe, a review. Eur. J. Epidemiol. 13: 951957.
Humair P.-F., Postic D., Wallich R. and Gern L. 1998. An avian reservoir (Turdus merula) of the
Lyme borreliosis spirochetes. Zentralb. Bakteriol. 287: 521538.
Humair P.-F., Turrian N., Aeschlimann A. and Gern L. 1993. Ixodes ricinus immatures on birds in
a focus of Lyme borreliosis. Folia Parasitol. 40: 237242.
Kirstein F. and Gray J. 1996. A molecular marker for the identication of the zoonotic reservoirs
of Lyme borreliosis by analysis of the blood meal in its European vector Ixodes ricinus. Appl.
Environ. Microbiol. 62: 40604065.
Kirstein F., Rijpkema S., Molkenboer M. and Gray J.S. 1997. The distribution and prevalence of
B. burgdorferi genomospecies in Ixodes ricinus ticks in Ireland. Eur. J. Epidemiol. 13: 6772.
Korenberg E.I., Gorelova N.B., Postic D., Kovalevskii I.V., Baranton G. and Voroleva N.N. 1997.
The reservoir hosts and vectors of Borrelia-the causative organisms of ixodid tick-borne bor-
reliosis in Russia. Zh. Mikrobiol. epidemiol. Immunobiol. 64: 11691174.
Kurtenbach K., Kampen H., Dizij A., Arndt S., Seitz H.M., Schaible U.E. and Simon M.M. 1995.
Infestation of rodents with Ixodes ricinus (Acari: Ixodidae) is an important factor in the trans-
mission cycle of Borrelia burgdorferi s.l. in German woodlands. J. Med. Entomol. 32: 807817.
Kurtenbach K., Peacey M., Rijpkema S.G.T., Hoodless A.N., Nuttall P. and Randolph S.E. 1998.
Dierential transmission of the genospecies of Borrelia burgdorferi sensu lato by game birds and
small rodents in England. Appl. Environ. Microbiol. 64: 11691174.
Matuschka F.-R., Fischer P., Musgrave K., Richter D. and Spielman A. 1991. Hosts on which
nymphal Ixodes ricinus most abundantly feed. Am. J. Trop. Med. Hyg. 44: 100107.
Nilsson A. and Lundqvist L. 1978. Host selection and movements of Ixodes ricinus (Acari) larvae
on small mammals. Oikos 31: 313322.
Olsen B., Jaenson T.G.T., Noppa L., Bunikis J. and Bergstrom S. et al., 1993. A Lyme borreliosis
cycle in seabirds and Ixodes uriae ticks. Nature 362: 340342.
Osacar J.J., Estrada-Pena A. and Lucientes J. 1998. Ticks (Acarina) of wild birds in the Ebro mid
basin (North-East Spain). Acarologia 15: 197205.
Pichon B., Egan D., Rogers M. and Gray J. 2003. Detection and identication of pathogens and host
DNA in unfed host-seeking Ixodes ricinus L. (Acari: Ixodidae). J. Med. Entomol. 40: 723731.
Pichon B., Egan D., Rogers M. and Gray J. 2005. Blood meal analysis for the identication of
reservoir hosts of tick-borne pathogens in Ireland. Vector Borne and Zoonotic Dis.. In press.
Randolph S.E. 1975. Patterns of distribution of the tick Ixodes trianguliceps Birula on its hosts. J.
Anim. Ecol. 44: 451474.
Saint-Girons I., Gern L., Gray J.S., Guy E.C., Korenberg E., Nuttall P.A., Rijpkema S.G.T.,
Schonberg A., Stanek G. and Postic D. 1998. Identication of Borrelial burgdorferi sensu lato
species in Europe. Zentbl. Bakteriol. Parasitenkd. Infektionskr. Hyg. Abt. I Orig. 287: 190195.
Spielman A., Levine J.F. and Wilson M.L. 1984. Vectorial capacity of North American Ixodes
ticks. Yale J. Biol. Med. 57: 507513.

The author has requested enhancement of the downloaded file. All in-text references underlined in blue are linked to publications on ResearchGate.