Veterinary Parasitology 166 (2009) 191198

Contents lists available at ScienceDirect

Veterinary Parasitology
journal homepage: www.elsevier.com/locate/vetpar

Babesia canis and other tick-borne infections in dogs in Central Poland

Renata Welc-Faleciak a, Anna Rodo b, Edward Sinski a, Anna Bajer a,*
a
Department of Parasitology, Institute of Zoology, Faculty of Biology, University of Warsaw, 1 Miecznikowa Street, 02-096 Warsaw, Poland
b
Department of Clinical Sciences, Faculty of Veterinary Medicine, Warsaw University of Life Sciences, 159c Nowoursynowska Street, 02-766 Warsaw, Poland

A R T I C L E I N F O A B S T R A C T

Article history: Vector-borne infections constitute increasing health problem in dogs worldwide,
Received 27 May 2009 including sled dogs, dramatically decreasing the tness of working dogs and even leading
Received in revised form 8 September 2009 to death. In the period 20062008 eighty-two blood samples were collected from eight
Accepted 18 September 2009 sled dog kennels in Central Poland. The prevalence of four vector-borne infections (Babesia
canis, Bartonella sp., Anaplasma/Ehrlichia and Borrelia burgdorferi) was estimated in 82 sled
Keywords: dogs using PCR and nested PCR for diagnosis and the same methods were used to identify
Babesia canis the vector-borne pathogens in 26 dogs presenting at veterinary clinics with symptoms of
Borrelia burgdorferi
vector-borne diseases. None of four studied vector-borne pathogens was detected in
Anaplasma phagocytophilum
samples originating from veterinary clinics. Among the remaining 82 dogs B. canis
Ehrlichia canis
Bartonella
infections were conrmed in three dogs undergoing treatment for babesiosis. The DNA of
Sled dogs tick-borne pathogens was also found among 22 (27.8%) of the 79 apparently healthy dogs,
Vector-borne diseases including 20 cases of B. canis infection (25.3%), one case of B. burgdorferi s.l. infection and
Ticks one case of Anaplasma phagocytophilum infection. No evidence of Bartonella spp. and
Prevention Ehrlichia canis infections were found in this set of samples. Sequencing of a Babesia
Chronic infections fragment of 18S rDNA amplied from acute (n = 5) and asymptomatic (n = 5) cases
revealed that all isolates were identical to the Babesia canis canis sequence, originally
isolated from Dermacentor reticulatus ticks in Poland.
A range of factors was shown to affect the distribution of babesiosis in sled dogs. The
data are also discussed in respect to the health risk factors generated by asymptomatic B.
canis infections and the efciency of chemoprophylaxis measures taken by sled dog
owners.
2009 Elsevier B.V. All rights reserved.

1. Introduction
Vector-borne infections constitute increasing health
problems in dogs worldwide (Baneth et al., 1998; Beall
et al., 2008; Dantas-Torres, 2008; Matjila et al., 2008;
Solano-Gallego et al., 2006) and also in Poland (Adaszek
and Winiarczyk, 2008a,b; Skotarczak and Wodecka, 2003;
Zygner et al., 2007). Dogs can be infected with protozoa of
the genus Babesia and many bacteria species, including
Anaplasma phagocytophilum, Borrelia burgdorferi s.l., Barto-
* Corresponding author. Tel.: +48 22 55 41 117; fax: +48 22 55 41 203.
E-mail address: anabena@biol.uw.edu.pl (A. Bajer).
nella spp. and Ehrlichia spp. transmitted by the two most
common tick species (Ixodes ricinus and Dermacentor
reticulatus) and by eas.
Vector-borne infections can also constitute serious
health problems in working dogs, including sled dogs. The
main symptoms of infections, such as loss of appetite,
anemia, weakening, muscles and joints disorders, liver,
kidney and heart disorders may dramatically decrease the
tness of working dogs and even lead to death. The training
of sled dogs consists of different elements including speed
and endurance trainings, which may overall sum as 30
50 km per week (Szmuro and Szmuro, 2002). During the
racing season in Poland (between September and April) the
same dogs participate in up to 12 different weekend

0304-4017/$ see front matter 2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetpar.2009.09.038
192 R. Welc-Faleciak et al. / Veterinary Parasitology 166 (2009) 191198

competitions and additional stress may arise from Table 1

The number of dogs of different sled dog breeds in the study.
transportation and interactions with other dogs and
unfamiliar people among the public (own observations, Breed of a dog No. of samples
unpublished). Sled dogs are competitive and usually work Alaskan Husky (AH) 22
in teams, which means that even relatively mild health Syberian Husky (SH) 16
problems of the individual may result in excessive physical European Sled Dog (ESD) 22
exertion and consequently overworking, and this may in Alaskan Malamut (AM) 5
Alaskan Malamut mixed 5
turn lead to the development of serious diseases. It is also
Greysther 8
pertinent that sled dogs are highly exposed to tick SH/Grenland dog 1
infections because the majority of training sessions and Mixed breed dog 3
racing sites are situated in forest areas where ticks abound.
Total 82
Moreover, they are usually housed in kennels where there
may be a high risk of ea and tick infestation.
The aims of the present work were (1) to estimate the
prevalence of four vector-borne infections in sled dogs collected in the spring of 2006 from eight sled dog kennels
using PCR and nested PCR for diagnosis, (2) to identify the situated in the vicinity of the cities: Warsaw, Tuszcz,
vector-borne pathogens in dogs with symptoms of vector- Nowy Dwor Mazowiecki and Grodzisk Mazowiecki (Fig. 1).
borne diseases, (3) to identify factors affecting the At the time of sampling three dogs underwent treatment
distribution of vector-borne infections and nally (4) to for Babesia canis infections but the remaining 79 indivi-
identify species/genotypes of any of the detected patho- duals were showing no overt clinical signs of infection and
gens. were participating fully in training schedules. One female
Siberian Husky (SH), born in 1997 was sampled four
2. Materials and methods timesspring 20062009. The distribution of different
breeds of sled dogs among the study group and abbrevia-
In the period 20062008 one hundred and nine blood tions used in text are presented in Table 1. A detailed
samples were collected from dogs in Warsaw and the description of non-registered breeds of sled dogs is
surrounding country side in Central Poland. Of these, 26 provided in Bajer and Bednarska (2007). In order to
samples originated from dogs showing some symptoms of evaluate the role of different factors for the risk of
vector-borne diseases, mainly similar to borreliosis (i.e. infection, dog owners were asked to ll a questionnaire
lameness, apathy, neurological abnormalities, fever), on requesting details of sex, age and breed of dogs, any history
the basis of veterinary inspection. The main set of 82 of previous vector-borne infections, episodes of tick and
individual blood samples (42 males, 40 females) was ea infestation and any prophylactic measures taken for

Fig. 1. Map of the area around Warsaw from which dogs were sampled. Bold rectangles highlight the towns from which dogs were sampled.
 R. Welc-Faleciak et al. / Veterinary Parasitology 166 (2009) 191198
Table 2
Nucleotide sequences of PCR primers used in this study.
Species Primer
Babesia spp. Piro-A
Piro-B
Bartonella spp. BhCS 1137n
BhCS 781p
Borrelia burgdorferi s.l. FL6
FL7
Anaplasma phagocytophilum EHR521
EHR747
Ehrlichia canis EHR-OUT1
EHR-OUT2
GE2F
EHRL3-IP2
tick/ea prevention. The dogs were divided into three age
classes: class 1up to 1-year-old (n = 10); class 2
between 2 and 7 years (n = 46); class 38 years and older
(n = 26).
To assess the effect of season on the distribution of B.
canis infection in dogs in Central Poland, the number of
conrmed babesiosis cases was counted during the rst
week of each month during 1-year study in the MULTIWET
veterinary clinic in Warsaw.
Blood samples were collected into 0.001 M EDTA and
frozen at 20 8C until DNA extraction. DNA extractions
were performed on whole blood using the AxyGen
MiniPrep Blood kit (AxyGen, USA). The extracted DNA
was subjected to PCR with specic primers provided in
Table 2 and in conditions previously described. Sequencing
reactions were conducted with the ABI-PRISM 377
automatic DNA sequencer (Applied Biosystem). The
resulting sequences were assembled using the program
ABITM BigDyeTM and compared with sequences deposited
in GenBank NCBI. Analysis of DNA sequences and
phylogenetic relationships for 10 obtained B. canis isolates
were done using the PHYLIP software package, version
3.66. Sequences were aligned using the program ClustalW
Aligment. For comparison, sequences of Theileria annae
(Babesia Spanish dog) (AF188001), B. microti (AB219802),
B. canis rossi (AB303075), B. canis vogeli (DQ297390), B.
canis canis (Russia) (AY649326), B. canis canis (Croatia)
(AY072926), B. canis canis (Poland) (EU152128), B. canis
canis (Hungary) (DQ174286), B. canis canis (Slovenia)
(AY259124), B. gibsoni (AY278443), Babesia North Carolina
dog (AF271081), Babesia Oklahoma dog (AF205636) and
Babesia Okinawa dog (AF271082) were obtained from
GenBank and included within the sequence alignment. For
distance analysis a neighbor-joining tree was generated
from a Kimura two-parameter distance matrix using the
algorithms DNADIST and NEIGHBOR. The stability of
inferred phylogenies was assessed by bootstrap analysis
of 1000 randomly generated sample trees using the
programs SEQBOOT and CONSENSE.
2.1. Statistical methods
Prevalence (percentage of animals infected) of the most
common pathogen, B. canis was analyzed by maximum
likelihood techniques based on log linear analysis of
contingency tables, implemented by the software package,
193
Sequence (50 30 ) Authors
AATACCCAATCCTGACACAGGG Armstrong et al., 1998
TTAAATACGAATGCCCCCAAC
AATGCAAAAAGAACAGTAAACA Norman et al., 1995
GGGGACCAGCTCATGGTGG Birtles and Raoult, 1996
TTCAGGGTCTCAAGCTTGCACT Picken et al., 1996
GCATTTTCAATTTTAGCAAGTGATG
TGTAGGCGGTTCGGTAAGTTAAAG Hodzic et al., 1998
GCACTCATCGTTTACAGGGTG
CTGGCGGCAAGCYTAACACATGCCAACATCTCACGAC Breitschwerdt et al., 1998
GCTCGTTGCGGGACTTAACCCAACATCTCACGAC
GTTAGTGGCATACGGGTGAAT
TCATCTAATAGCGATAAATC
SPSS v. 14. Prevalence of infection was entered as a binary
factor (infected = 1, not infected = 0) and then year and
season of study, host sex, age and breed as well as tick
infestation episodes, prophylactic measures for tick/ea
prevention and history of vector-borne diseases were
tted into a full factorial model. Beginning with the most
complex model, involving all possible main effects and
interactions, those combinations not contributing signi-
cantly to explaining variation in the data were eliminated
stepwise, beginning with the highest level interaction
(Bajer et al., 2002). A minimum sufcient model was then
obtained, for which the likelihood ratio of x2 was not
signicant, indicating that the model was sufcient in
explaining the data.
3. Results
3.1. Distribution of vector-borne infections in dogs on the
basis of PCR and nested PCR
None of four studied vector-borne pathogens was
detected in the 26 blood samples originating from
veterinary clinics. Among the remaining 82 dogs B. canis
infections were conrmed in three dogs undergoing
treatment for babesiosis. The DNA of tick-borne pathogens
was also found among 22 (27.8%) of the 79 apparently
healthy dogs, including 20 cases of B. canis infection
(25.3%), one case of B. burgdorferi s.l. infection and one case
of A. phagocytophilum infection. No evidence of Bartonella
spp. and Ehrlichia canis infections were found in this set of
samples.
All tick-borne infections were either asymptomatic or
associated with weak non-specic symptoms. B. burgdor-
feri s.l. infection was identied in a 7-year-old female SH
imported from Slovakia when 5 years old. The owner
reported only sporadic reduction of stamina and no
symptoms linked to joints in limbs. A. phagocytophilum
infection was found in a 7-year-old male ESD which had
been showing some non-specic symptoms for 7 months,
including periodic weakening and loss of stamina, long-
term decrease of appetite (but only a relatively small loss
of weight), signicant splenomegaly (on the basis of
ultrasonography [USG]) but with no changes in blood
morphology, liver function and no episodes of blood loss. B.
canis infections were asymptomatic but 6 out of 20 positive
dogs (30%) had been diagnosed and treated for babesiosis
194 R. Welc-Faleciak et al. / Veterinary Parasitology 166 (2009) 191198

from several months to 2 years before this study. Cases of

babesiosis, either symptomatic or asymptomatic, were
found in all sled dog kennels involved in the study (see
Fig. 1).
In the period 20062009 (spring) four episodes of
babesiosis were identied on the basis of veterinary
diagnosis (trophozoites in Giemsa stained blood smears)
and PCR in one elderly female SH born in 1997. Each
episode was connected with the spring appearance and
infestation of D. reticulatus ticks. The rst infection (June
2006) was linked with a range of babesiosis symptoms
(loss of appetite, fever, lethargy, anemia, hemoglobinuria
and thrombocytopenia) and was successfully treated with Fig. 2. Seasonal occurrence of conrmed babesiosis cases in dogs in
Warsaw during a 1-year study.
imidocarb. The second episode (June 2007) was only
associated with loss of appetite, decreased activity, fever
and thrombocytopenia, and was again successfully treated prophylactic measures: x2 = 20.0, df = 2, P < 0.001). There
with imidocarb. The third and fourth episodes (May 2008 was a signicant reduction of tick infestations among
and April 2009) were characterized by reappearance of 3- treated in comparison to untreated dogs (tick infestation
day periods of reduced appetite and decreased activity (no was reported for 87.5% of untreated dogs and for 62.2% of
fever) but again rapid recovery was observed after treated dogs; use of prophylactic measures  tick infesta-
imidocarb treatment. tion: x2 = 14.5, df = 1, P < 0.001). However, despite the use
of prophylactic measures almost 1/3 dogs (32.4%) had a
3.2. Factors affecting the distribution of B. canis infection and history of B. canis infection (detected by PCR diagnosis or
tick infestation in dogs reported by owners) (babesiosis  use of prophylactic
measures: x2 = 8.84, df = 1, P = 0.003).
As B. canis DNA was found in 23 out of 82 dogs, detailed Finally, an interesting 3-way interaction was also a
statistical analysis was conducted to identify intrinsic and component of the nal model (host age  tick infesta-
extrinsic factors inuencing its prevalence. The age of dogs tion  babesiosis: x2 = 7.34, df = 2, P = 0.025). In age classes
was found to affect the prevalence of Babesia (age  Babesia 2 and 3, all cases of babesiosis were reported for dogs with
pos. PCR: x2 = 6.30, df = 2, P = 0.043) and the previous
history of babesiosis (age  history of babesiosis: x2 = 7.06,
df = 2, P = 0.029) (goodness of t: x2 = 20.62, df = 35,
P = 1.000). Although no individuals with previous episodes
of babesiosis were found in age class 1, the highest rate of
B. canis positive samples was found in this group of dogs (5
out of 10 individuals; 50%). The lowest rate of B. canis DNA
positive samples was found in age class 2 (17%), but again it
was high in the oldest group of dogs (39% in age class 3).
Not surprisingly, the rate of reported babesiosis cases
increased with age of dogs, from 0 in age class 1, through
28 in age class 2, reaching 35% in the group of oldest dogs.
There were no differences in the prevalence of B. canis
positive samples between the two sexes but host sex
affected the history of tick infestation (sex  previous tick
infestation: x2 = 7.45, df = 1, P = 0.006). Tick infestation was
reported by owners in 78.6% of males but only 50% of
females. The breed of dogs did not affect either B. canis
prevalence or tick infestation.
There was also a strong inuence of previous tick
infestation on the history of babesiosis in dogs (tick
infestation  babesiosis: x2 = 20.84, df = 2, P < 0.001). A
single case of babesiosis was found among 29 dogs with no
episode of tick infestation (3.4%) in comparison to 43.4% in
dogs with reported tick infestation.
The use of prophylactic measures for tick/ea preven-
tion was implemented in the second step of the statistical
analysis. The minimal sufcient model incorporated three
interesting main effects (goodness of t: x2 = 24.72, df = 73,
Fig. 3. Phylogenetic tree of Babesia canis isolates from dogs and other
P = 1.000). The use of prophylactic measures was reported Babesia species generated from the analysis of sequences of the 18S rRNA
for 60% of young dogs (age class 1), 91.3% of age class 2 gene by the neighbor-joining method. Babesia spanish dog and Babesia
dogs and for 100% of the oldest group of dogs (age  use of microti were used as the outgroup.
 R. Welc-Faleciak et al. / Veterinary Parasitology 166 (2009) 191198 195

Table 3
Percent homology of sequences in the 18S rRNA gene fragment between Babesia species and isolates from dogs. The GenBank accession numbers are given
in parentheses.

Species Base pairs compared Percent of homology Authors

B. canis canis (EU152128) Poland 350/350 100 Zygner et al. (2008)

B. canis canis (AY321119) Poland 348/350 99.4 Sobczyk et al. (2005)
B. canis canis (AY072926) Croatia 348/350 99.4 Caccio` et al. (2002)
B. canis canis (AY649326) Russia 346/350 98.9 Rar et al. (unpublished)
B. canis canis (DQ174286) Hungary 344/346 99.4 Foldvari et al. (2005), unpublished
B. canis canis (AY259124) Slovenia 329/333 98.8 Duh et al. (2004)

a history of tick infestation (42% and 56% versus 0% [in
groups of free-of-ticks dogs], respectively), but in young
dogs (age class 1) all cases of babesiosis were identied in
dogs with no ticks reported (17% versus 0% [in group of
tick-infected dogs]).
Possible seasonal effects could not be included in the
statistical analysis because the great majority of samples
were collected in the spring of each year. However, in Fig. 2
the number of babesiosis cases occurring during a 1-year
study in veterinary clinic in Warsaw are presented. The
highest number of Babesia infections was found in spring
(March and May) and in autumn (October).
3.3. Genotyping of Babesia from acute and asymptomatic
cases
Sequencing of a Babesia fragment of 18S rDNA amplied
from acute (n = 5) and asymptomatic (n = 5) cases revealed
that all of the 10 isolates were identical (100% homology)
to B. canis canis (EU152128) originally isolated from D.
reticulatus ticks in Poland (Fig. 3). Analysis of the 18S rRNA
gene demonstrates that our canine isolates were clustered
with other European B. canis canis strains from Croatia,
Hungary and Slovenia. Table 3 presents the percent
homology of the sequenced 18S rRNA gene fragment
and those deposited in GenBank.
4. Discussion
The main aims of the present work were to estimate the
prevalence of four vector-borne infections in sled dogs and
to detect vector-borne pathogens in dogs with symptoms
of vector-borne diseases by means of molecular methods
(DNA amplication). To the best of our knowledge, our
study is one of the rst ones applying molecular
techniques for the detection of vector-borne pathogens
in a group of dogs without typical symptoms of vector-
borne diseases (see also Zygner et al., 2009) and the rst
study of such infections in sled dogs. Surprisingly, in the
group of sick animals no evidence of tick-borne pathogens
were obtained. However, the history of treatment for these
animals was not known, so this result may have arisen
through the applied antibiotic treatment. In contrast, the
DNA of tick-borne pathogens was found among 22 of the
79 healthy sled dogs, with mostly asymptomatic B. canis
infections (20 cases), one case of B. burgdorferi s.l. infection
and one case of A. phagocytophilum infection.
On the basis of PCR, we found a high prevalence of
Babesia infections in the sled dogs. Only three cases
manifested features of typical babesiosis, whereas the
remaining cases were asymptomatic. This is the rst study
demonstrating the existence of B. canis DNA in apparently
healthy dogs, indicating the ability of this parasite to
survive in infected hosts for months even after successful
treatment after resolution of symptoms and normalization
of blood morphology and liver/kidney function. One-third
of these dogs had been previously clinically ill and received
imidocarb treatment with full recovery of clinical symp-
toms. The remaining 2/3 of these dogs may have under-
gone sub-clinical invasion or may have endured with mild
symptoms that were not detected by the owners and had
self-cured. It is commonly believed that chronic babesiosis
may revert into symptomatic, in situations where the dogs
immune system is depressed during other diseases or
under heavy stress (Bourdoiseau, 2006). Nevertheless,
these asymptomatic invasions may constitute a signicant
risk for dog health, as we have described in our previous
case report (Bajer et al., 2008). In that paper the case of a 2-
year-old sled dog was described. The dog needed to
undergo splenectomy, after the spleen damage that
occurred during normal daily activities (free running with
other dogs). The likely cause for the spleen rupture was the
signicant splenomegaly observed during USG and sur-
gery. In a very short time after splenectomy, clinical
babesiosis became apparent, with haemoglobinuria, fever
and typical blood morphology (anemia, thrombocytope-
nia; see Zygner et al., 2007), and biochemistry. The short
period of the appearance of clinical symptoms and the
observed signicant splenomegaly suggested asympto-
matic B. canis infection as the indirect cause of spleen
rupture (Bajer et al., 2008; Welc-Faleciak et al., 2007).
Besides the health risk for dogs constituted by the
asymptomatic Babesia infection, the chronic persistence of
parasitaemia facilitates the transmission of parasites in the
environment, as it constitutes long-term source for tick
infections (Welc-Faleciak et al., 2007). Thus, there is a need
for the identication and better treatment of asympto-
matic Babesia invasions in dogs.
Although canine babesiosis is reported worldwide
(Adaszek and Winiarczyk, 2008a,b; Baneth et al., 1998;
Bourdoiseau, 2006; Caccio` et al., 2002) the comparison of
prevalence of this disease between countries is difcult,
due to lack of screening studies in asymptomatic dogs,
endemic distribution of disease and its vector, D. reticulatus
ticks, and also due to the use of different detection
methods. In recent study in dogs from Warsaw, prevalence
of 12% was reported in 408 randomly selected dogs
(Zygner et al., 2009). However, the number of central
European countries where babesiosis is being reported, is
still increasing (Austria, Netherlands, Hungary). In Poland,
196 R. Welc-Faleciak et al. / Veterinary Parasitology 166 (2009) 191198
the geographical distribution of B. canis continues to
spread. Even recently canine babesiosis was believed to be
a disease endemic to the north- and south-eastern Poland,
not crossing the western border of the Vistula river
(Adaszek, 2006; Huas and Dobrzynski, 1995). However,
from the map showing the localization of the kennels
which acted as a source of blood samples collected in this
study (Fig. 1), it is evident that this border does not exist
any longer. Babesia-positive samples originated from each
studied kennel, including three situated near Grodzisk
Mazowiecki, the city situated to the west of the Vistula
river. Expansion of B. canis in Poland and in Europe is
directly connected with the expanding range of the main
vectorD. reticulatus tick (Dautel et al., 2006; Sreter et al.,
2005). Thirty years ago this tick species was found only in a
few loci in eastern Poland and its life cycle was believed to
rely on elks (Siuda, 1993). To date, D. reticulatus ticks are
abundant in the eastern half of the country and are
secondarily adapted to suburban and urban habitats
(wastelands, fallow lands, grasslands)any kind of open
zones, a situation identical to that in France (own data
unpublished, Bourdoiseau, 2006). The main hosts for adult
ticks are now various ungulates (wild and domestic
ruminants, equidae) and dogs (Drozdz and Bogdaszewska,
1997; Dautel et al., 2006). Ticks of this species are actually
the most common ticks found on dogs in the Warsaw area
(Zygner and Wedrychowicz, 2006). It has been conrmed
recently that 11% of D. reticulatus individuals collected
from dogs in Warsaw were positive for B. canis DNA
(Zygner et al., 2008). As the geographical range of D.
reticulates continues to expand in Poland and throughout
Europe (Dautel et al., 2006; Heile et al., 2006; Nijhof et al.,
2007; Sreter et al., 2005), probably due to either climate
changes or changes in agricultural practices (abandoned
elds), babesiosis should be treated as emerging infectious
diseases. Although treatment with imidocarb is very
effective in the early stage of disease, there are still
numerous fatal cases of babesiosis due to late treatment
when secondary disorders (dysfunction of kidneys and
liver, advanced anemia) develop (Adaszek, 2006; Bourdoi-
seau, 2006).
In our study, detailed statistical analysis of a range of
factors conrmed some of the earlier ndings in the
epidemiology of this disease (summarized in Bourdoiseau,
2006). In our study the age of dogs was an important factor
inuencing the distribution of B. canis infection. As
observed before, babesiosis was most common in the
youngest dogs (<1-year-old) (Adaszek, 2006; Adaszek and
Winiarczyk, 2008a). However, in our study elderly
individuals also appeared to be more sensitive to this
invasion. The reported case of elderly female SH, which had
been infected with B. canis four times, suggested either lack
of long-term effective protection against re-infection but
also a weak outcome of natural immunization evident
through the signicantly reduced babesiosis symptoms on
subsequent appearance of infection. Not surprisingly, the
rate of reported babesiosis cases increased with age of
dogs, reaching a maximum in the group of oldest dogs.
There were no signicant differences between the two
sexes, as found earlier (Bernard, 1997; Porchet et al., 2007),
although in our study males were reported to be
signicantly more frequently infested with ticks. The
breed of dogs did not affect either B. canis prevalence or
tick infestation, as observed before (Bourdoiseau, 2006;
Bernard, 1997; Porchet et al., 2007). We have also
demonstrated the same pattern of seasonal occurrence
of babesiosis in Poland, noted before in France, Switzerland
and Austria (Bourdoiseau, 2006; Bernard, 1997; Porchet
et al., 2007; Leschnik et al., 2008).
There was also a strong inuence of previous tick
infestation on the history of babesiosis in dogs. A single
case of babesiosis was found among 29 dogs with no
reported episode of tick infestation (3.4%) in comparison to
43.4% in dogs with reported tick infestation. This result
strongly suggests that repeated detailed inspection by its
owner of a dog living in an endemic area may help in the
early recognition of babesiosis and shorten the treatment
and recovery period in the case of acquired disease
(Adaszek, 2006).
The analysis of chemoprophylaxis measures revealed
that although treatment had signicantly decreased the
tick infestation rate, it was not successful enough in
reducing the number of babesiosis cases. It also seems that
dog owners learn to use prophylaxis measures the longer
they keep dogs, as the rate of treated dogs increased with
dog age. In Poland the use of vaccination against canine
babesiosis is not common, likely due to its low efciency
in prevention of disease development (Adaszek, 2006).
None of the studied dogs had been vaccinated against B.
canis.
The sequencing of 10 Babesia isolates conrmed that
the etiological factor of canine babesiosis in central Poland
is B. canis canis and the signicant role of its vectorD.
reticulatus tick (Adaszek and Winiarczyk, 2008a,b; Zygner
et al., 2008). Sequences derived from acute and chronic
cases were identical, suggesting that the course of disease
depends more on the immunological or physiological
status of the individual dog than on the involved parasite
strain. However, further molecular analysis of different loci
may result in the appearance of differences between B.
canis isolates derived from sick and healthy dogs.
Recently the PCR-RFLP analysis of 18S rDNA of B. canis
canis isolated in Poland revealed the existence of two
genetic groups (A and B) and seven sequence variants
(Adaszek and Winiarczyk, 2008b). However, in the cited
study no signicant differences were noted in the course of
disease among dogs infected with parasites of these two
genetic groups.
B. burgdorferi s.l. infection was identied in one 7-
year-old female SH imported from Slovakia, among 82
studied sled dogs (1.2%). No positive cases were found
among 26 dogs suffering from lameness and other
symptoms connected with canine borreliosis. The overall
infection rate is therefore less than 1% among the
studied groups of dogs. It seems that this tick-borne
disease was not common in dogs in the surroundings of
Warsaw in the study period, in agreement with recent
study from Warsaw (1.7% in Zygner et al., 2009) but in
contrast to earlier ndings of Skotarczak and Wodecka
(2003), in which B. burgdorferi DNA was detected in 40%
of symptomatic dogs (n = 15). In another recent study in
the Lubelskie region, seroprevalence of B. burgdorferi was
 R. Welc-Faleciak et al. / Veterinary Parasitology 166 (2009) 191198
only 4% among 208 dogs (Adaszek, 2006). The pre-
valence of B. burgdorferi in dogs, on the basis of
molecular studies and seroprevalence, varies worldwide
and very rarely reaches 10% (Beall et al., 2008; Foley
et al., 2007; Greene et al., 1988; Joppert et al., 2001).
Interestingly, the highest seroprevalence of 50% was
reported in dogs from Slovakia (Stefancikova et al., 1996,
1998), the country from which the infected 7-year-old
female came to Poland when 5 years old. The dog had
received doxycycline treatment and had been returned
to training and racing schedules.
A. phagocytophilum infection was conrmed in one
(<1%) 7-year-old male ESD which had been showing some
non-specic symptoms for 7 months and had had to be
excluded from sled dog races. However, lethargy, reduc-
tion of appetite and splenomegaly have been recently
identied as common features encountered during the
course of canine granulocytic anaplasmosis in Germany
(Kohn et al., 2008). The dog had fully recovered after the
treatment with doxycycline and had been returned to
training and racing schedules. In Poland and worldwide,
the reported prevalence of A. phagocytophilum infections is
even lower than that of B. burgdorferi s.l., with a range from
0% to 3% of infected dogs (Adaszek, 2006; Skotarczak et al.,
2004; Beall et al., 2008; Foley et al., 2007; Zygner et al.,
2009). However, recently one study in Poland has
demonstrated in dogs high seroprevalence of A. phagocy-
tophilum of 21% (Adaszek, 2006). Both B. burgdorferi and A.
phagocytophilum DNAs were detected in Ixodes ricinus ticks
in Poland (Grzeszczuk and Stanczak, 2006; Stanczak et al.,
2004) which suggests that these pathogens may constitute
the health risk hazard to dogs in many regions of Poland.
The results of our study: (1) clearly demonstrate that B.
canis canis infections are the most prevalent among the
studied four groups of vector-borne diseases in sled dogs
from the area of central Poland and (2) outline the
signicance of the use of PCR-based detection method in
diagnostics of these pathogens in asymptomatic working
dogs.
Acknowledgement
The study was supported by State Committee for
Scientic Research, KBN, through Faculty of Biology,
Warsaw University intramural grant, BW 1755/62.
References
Adaszek, L., 2006. Selected issues in epidemiology of babesiosis, boreliosis
and ehrlichiosis in dogs. PhD thesis. Faculty of Veterinary Medicine in
Lublin, Poland.
Adaszek, L., Winiarczyk, S., 2008a. Dogs babesiosisstill actually problem.
Wiad. Parazytol. 54, 109115.
Adaszek, L., Winiarczyk, S., 2008b. Molecular characterization of Babesia
canis canis isolates from naturally infected dogs in Poland. Vet. Para-
sitol. 152, 235241.
Armstrong, P.M., Katavolos, P., Caporale, D.A., Smith, R.P., Spielman, A.,
Telford 3rd, S.R., 1998. Diversity of Babesia infecting deer ticks (Ixodes
dammini). Am. J. Trop. Med. Hyg. 58, 739742.
Bajer, A., Bednarska, M., 2007. Cryptosporidium spp. and Giardia spp.
infections in sled dogs. Med. Wet. 63, 147150.
Bajer, A., Bednarska, M., Paweczyk, A., Behnke, J.M., Gilbert, F.S., Sinski, E.,
2002. Prevalence and abundance of Cryptosporidium parvum and
Giardia spp. in wild rural rodents from the Mazury Lake District region
of Poland. Parasitology 125, 2134.
197
Bajer, A., Rodo, A., Welc-Faleciak, R., Sinski, E., 2008. Asymptomatic
babesiosis as a cause of splenomegaly and splenectomy in a dog.
Med. Wet. 64, 441443.
Baneth, G., Breitschwerdt, E.B., Hegarty, B.C., Pappalardo, B., Ryan, J., 1998.
A survey of tick-borne bacteria and protozoa in naturally exposed
dogs from Israel. Vet. Parasitol. 74, 133142.
Beall, M.J., Chandrashekar, R., Eberts, M.D., Cyr, K.E., Diniz, P.P., Mainville,
C., Hegarty, B.C., Crawford, J.M., Breitschwerdt, E.B., 2008. Serological
and molecular prevalence of Borrelia burgdorferi, Anaplasma phago-
cytophilum and Ehrlichia species in dogs from Minnesota. Vectorne-
Borne Zoonotic Dis. 8 doi: 10.1089/vbz.2007.0236.
Bernard, L., 1997. Etude epidemiologique et clinique de la babesiose
canine dans la region de Firminy (42). Ph.D. Thesis. Veterinary, Lyon,
no. 76.
Birtles, R.J., Raoult, D., 1996. Comparison of partial citrate synthase gene
(gltA) sequences for phylogenetic analysis of Bartonella species. Int. J.
Syst. Bacteriol. 46 (4), 891897.
Bourdoiseau, G., 2006. Canine babesiosis in France. Vet. Parasitol. 138,
118125.
Breitschwerdt, E.B., Hegarty, B.C., Hancock, S.I., 1998. Sequential evalua-
tion of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeen-
sis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii. J. Clin.
Microbiol. 36, 26452651.
Caccio`, S.M., Antunovic, B., Moretti, A., Mangili, V., Marinculic, A., Baric,
R.R., Slemenda, S.B., Pieniazek, N.J., 2002. Molecular characterisation
of Babesia canis canis and Babesia canis vogeli from naturally infected
European dogs. Vet. Parasitol. 106, 285292.
Dantas-Torres, F., 2008. Canine vector-borne diseases in Brazil. Parasites
Vectors 1, 25 doi:10.1186/1756-3305-1-250.
Dautel, H., Dippel, C., Oehme, R., Hartelt, K., Schettler, E., 2006. Evidence
for an increased geographical distribution of Dermacentor reticulatus
in Germany and detection of Rickettsia sp RpA4. Int. J. Med. Microbiol.
296 (S1), 149156.
Drozdz, J., Bogdaszewska, Z., 1997. A focus of Dermacentor reticulatus kept
by red and fallow deer animal husbandry (Kosewo, Poland). Wiad.
Parazytol. 43, 207212.
Duh, D., Tozon, N., Petrovec, M., Strasek, K., Avsic-Zupanc, T., 2004. Canine
babesiosis in Slovenia: molecular evidence of Babesia canis canis and
Babesia canis vogeli. Vet. Res. 35, 363368.
Foley, J., Drazenovich, N., Leutenegger, C.M., Chomel, B.B., 2007. Associa-
tion between polyarthritis and thrombocytopenia and increased
prevalence of vectorborne pathogens in Californian dogs. Vet. Rec.
160, 159162.
Greene, R.T., Levine, J.F., Breitschwerdt, E.B., Berkhoff, H.A., 1988. Anti-
bodies to Borrelia burgdorferi in dogs in North Carolina. Am. J. Vet. Res.
49, 473476.
Grzeszczuk, A., Stanczak, J., 2006. High prevalence of Anaplasma phago-
cytophilum infection in ticks removed from human skin in north-
eastern Poland. Ann. Agric. Environ. Med. 13, 4548.
Heile, C., Heydorn, A.O., Schein, E., 2006. Dermacentor reticulatus (Fabri-
cius, 1794)distribution, biology and vector for Babesia canis in
Germany. Berl. Munch. Tierarztl. Wochenschr. 119, 330334.
Hodzic, E., Fish, D., Maretzki, C.M., De Silva, A.M., Feng, S., Barthold, S.W.,
1998. Acquisition and transmission of the agent of human granulo-
cytic ehrlichiosis by Ixodes scapularis ticks. J. Clin. Microbiol. 36,
35743578.
Huas, C., Dobrzynski, A., 1995. Babesiosis cases in dogs. Med. Wet. 51,
589590.
Joppert, A.M., Hagiwara, M.K., Yoshinari, N.H., 2001. Borrelia burgdorferi
antibodies in dogs from Cotia County, Sao Paulo State, Brazil. Rev. Inst.
Med. Trop. S. Paulo 43, 251255.
Kohn, B., Galke, D., Beelitz, P., Pster, K., 2008. Clinical features of canine
granulocytic anaplasmosis in 18 naturally infected dogs. J. Vet. Intern.
Med. 22, 12891295.
Leschnik, M., Kirtz, G., Tichy, A., Leidinger, E., 2008. Seasonal occurrence of
canine babesiosis is inuenced by local climatic conditions. Int. J.
Med. Microbiol. 298 (S1), 243248.
Matjila, P.T., Leisewitz, A.L., Jongejan, F., Penzhorn, B.L., 2008. Molecular
detection of tick-borne protozoal and ehrlichial infections in domes-
tic dogs in South Africa. Vet. Parasitol. 155, 152157.
Nijhof, A.M., Bodaan, C., Postigo, M., Nieuwenhujis, H., Opsteegh, M.,
Franssen, L., Jebbnik, F., Jongejan, F., 2007. Tick and associated patho-
gens collected from domestic animals in the Netherlands. Vector
Borne Zoonotic Dis. 7, 584595.
Norman, A.F., Regnery, R., Jameson, P., Greene, C., Krause, D.C., 1995.
Differentiation of Bartonella-like isolates at the species level by PCR-
restriction fragment length polymorphism in the citrate synthase
gene. J. Clin. Microbiol. 33, 17971803.
Picken, M.M., Picken, R.N., Han, D., Cheng, Y., Strle, F., 1996. Single-tube
nested polymerase chain reaction assay based on agellin gene
198 R. Welc-Faleciak et al. / Veterinary Parasitology 166 (2009) 191198
sequences for detection of Borrelia burgdorferi sensu lato. Eur. J. Clin.
Microbiol. Infect. Dis. 15, 489498.
Porchet, M.J., Sager, H., Muggli, L., Oppliger, A., Muller, N., Frey, C.,
Gottstein, B., 2007. A descriptive epidemiological study on canine
babesiosis in the Lake Geneva region. Schweiz Arch. Tierheilkd. 149,
457465.
Siuda, K., 1993. Ticks of Poland (Acari: Ixodida). Part II. Systematics and
Distribution. PWN, Warsaw.
Skotarczak, B., Adamska, M., Rymaszewska, A., Supron, M., Sawczak, M.,
Maciejewska, A., 2004. Anaplasma phagocytophilum and protozoans of
Babesia genus in dogs from endemic areas of Lyme disease in north-
western Poland. Wiad. Parazytol. 50, 555561.
Skotarczak, B., Wodecka, B., 2003. Molecular evidence of the presence of
Borrelia burgdorferi sensu lato in blood samples taken from dogs in
Poland. Ann. Agric. Environ. Med. 10, 113115.
Sobczyk, A.S., Kotomski, G., Gorski, P., Wedrychowicz, H., 2005. Useful-
ness of touch-down PCR assay for the diagnosis of atypical cases of
Babesia canis canis infections in dogs. Bull. Vet. Inst. Pulawy 49, 407
410.
Solano-Gallego, L., Trotta, M., Razia, L., Furlanello, T., Caldin, M., 2006.
Molecular survey of Ehrlichia canis and Anaplasma phagocytophilum
from blood of dogs in Italy. Ann. N. Y. Acad Sci. 1078, 515518.
Sreter, T., Szell, Z., Varga, I., 2005. Spatial distribution of Dermacentor
reticulatus and Ixodes ricinus in Hungary: evidence for change? Vet.
Parasitol. 128, 347351.
Stanczak, J., Gabre, R.M., Kruminis-ozowska, W., Racewicz, M., Kubica-
Biernat, B., 2004. Ixodes ricinus as a vector of Borrelia burgdorferi sensu
lato Anaplasma phagocytophilum and Babesia microti in urban and
suburban forests. Ann. Agric. Environ. Med. 11, 109114.
Stefancikova, A., Tresova, G., Petko, B., Skardova, I., Sesztakova, E., 1998.
ELISA comparison of three whole-cell antigens of Borrelia burgdorferi
sensu lato in serological study of dogs from area of Kosice, eastern
Slovakia. Ann. Agric. Environ. Med. 5, 2530.
Stefancikova, A., Skardova, I., Petko, B., Janovska, D., Cyprichova, V., 1996.
Antibodies IgG to Borrelia burgdorferi in dogs from Kosice region. Vet.
Med. Czech. 41, 8386.
Szmuro, M., Szmuro, I., 2002. Huskies and other breeds of sled dogs. Sled
dog sport. Ed. Agencja Wydawnicza Egros, Warsaw.
Welc-Faleciak, R., Bajer, A., Bednarska, M., Paziewska, A., Sinski, E., 2007.
Long term monitoring of Babesia microti infection in BALB/c mice,
using nested PCR. Ann. Agric. Environ. Med. 14, 287290.
Zygner, W., Jaros, S., Wedrychowicz, H., 2008. Prevalence of Babesia canis,
Borrelia afzelii, and Anaplasma phagocytophilum infection in hard ticks
removed from dogs in Warsaw (central Poland). Vet. Parasitol. 153,
139142.
Zygner, W., Gojska, O., Rapacka, G., Jaros, D., Wedrychowicz, H., 2007.
Hematological changes during the course of canine babesiosis caused
by large Babesia in domestic dogs in Warsaw (Poland). Vet. Parasitol.
145, 146151.
Zygner, W., Gorski, P., Wedrychowicz, H., 2009. Detection of the DNA of
Borrelia afzelii, Anaplasma phagocytophilum and Babesia canis in blood
samples from dogs in Warsaw. Vet. Rec. 164, 465467.
Zygner, W., Wedrychowicz, H., 2006. Occurrence of hard ticks in dogs
from Warsaw area. Ann. Agric. Environ. Med. 13, 355359.