Professional Documents
Culture Documents
Computing Life PDF
Computing Life PDF
10 movie mania
12 sim sickness
U.S. Department OF
HeaLtH anD HUman SerVICeS
16 integrating biology
national Institutes of Health
national Institute of General medical Sciences 18 made possible by
What is N IGMS? the national Institute of General medical
We share:
70%
of our genes with
fruit flies and
98%
with chimpanzees and
99.9%
with each other.
<02|03> computing life | searching for genetic treasures
!
make up
If youre hooked on SUDOkU, you thats what scientists face when they
try to track and analyze changes within
your own
should try the letter game called 3-letter series, and
GENETIC CODE. Heres an an organisms genetic material, or
blow
who do you
?
the investigative team, led by
computational biologist David Hillis at
the University of texas at austin and think is guilty?
virologist michael metzker at Baylor
College of medicine in Houston, texas, Evidence from a crime scene
leads police to five suspects.
used a technique called Dna fingerprint
Compare DNA from the perpetra
ing to compare the Dna sequences from
tors blood left at the crime scene
the two viral samples. the team also
with the suspects DNA below.
used a number of different computer
programs to piece together how the viral DNA sequence from perpetrators
sequences most likely changed between blood found at the crime scene:
the alleged injection in 1994 and the trial AGGCTGCCTACGCGGTTAGG
in 1998.
the results showed that certain DNA sequences from suspects:
genetic sequences from the nurses virus #1 AGGATGGCTACCCGGTTAGG
were identical to those of the patients #2 AGGCTGCCTCAGCGGATAGG
#3 AGGCTGCCTACGCGGTTAGG
#4 CGGCAGCCTACTCGGTTAGG
Computational biologists
#5 AGGCTGGATACGCGGCTAGG
helped prove that a doctor
tried to murder his ex
In the Louisiana murder trial,
girlfriend using a syringe
scientists compared more than
filled with the AIDS virus.
2,000 letters of HIV from about 30
people. Computers did most of
the work!
> modeling@home
In high school, Johnathon Tinsley answer important questions about biology. in the lab check the result, also making
had MIXED feelings about MATH and the typical computers in a scientists lab sure that no one has tampered with
SCIENCE. Math was very challeng cant perform all of the required number the information.
crunching, but a network of hundreds and You can volunteer your computer,
ing, he recalls. I enjoyed some
even thousands of personal computers can. whatever the make or model. the com
parts of biology, but not physics. puter must be connected to the Internet
this British teenager helped How It Works the type of connection doesnt matter.
search for cures for diseases like You join a distributed computing network Older computers can do the job, although
aIDS and alzheimers just by by downloading free software. they generally get simpler calculations.
letting researchers use When your computer isnt busy, You can also choose how much computer
his computer when he WARNING! it sends a message to a server memory you want to donate.
wasnt. You can get Before you download in the researchers lab
distributed computing You dont need to worry about hackers
involved, too! basically saying, Hey, Im
software onto a public breaking into your computer system.
tinsley is part of computer, like the ones at available. Can I help? the Security checks protecting the main
a tech trend called school or work, ask if its server assigns a chunk of a
OK. If you dont, you could
servers and the limited capabilities of the
distributed computing large calculation that it knows
get into serious trouble! required software make participating in
that relies on the public the home computer can solve. the projects considerably safer than
to help advance health the donated computer may surfing the Internet.
and medicine. through this spend several days working out
approach, researchers harness the problem. When its done, it hands
the power of personal computers to in the answer. Just like teachers, people
DC Distributed computing
BOINC The Berkeley Open Infrastructure for Network While youre sleeping, your
computer could be doing
Computing, or the free software program used
scientific research.
by many DC projects
PC Personal computer
Wanna Volunteer?
Folding@Home: http://folding.stanford.edu
Rosetta@home: http://boinc.bakerlab.org/rosetta
FightAIDS@Home: http://fightaidsathome.scripps.edu
<08|09> computing life | the next top protein model
Distributed Computing than 1 million playStation 3 gaming donate to many charities, you dont see
in Action consoles, pande can do the job in less a direct link between what you give and
the science we can do is unmatched by than a week. how its used. For us, you can actually
what we could do with any other avail tinsley donated about 40 hours of see what your computer has donated and
able tools, says Vijay pande, a scientist processing time every day between the results.
at Stanford University in California who his two computers. He liked knowing Serving science, though, is not the only
started a distributed computing project that his computers were doing some benefit. Distributing computing also offers
called Folding@Home. thing useful. tinsley says, theyre its participants an active social network.
pande studies the dynamics of how not just sitting there like stuffed many projects have message boards
proteins fold into their unique shapes. lemons British slang for being idle. where donors can post questions about
By studying how they fold, pande can For his distributed computing proj the science or random thoughts about life.
see what goes wrong and how drugs ects, tinsley tracked how much work Donors who really want to be ranked at
might patch misfolded proteins. his computer contributed compared to the top often will form competitive teams.
proteins fold much faster than you can others. If his computer helped predict I like competing to get my stats
fold a shirt. the quickest one is done in just a protein structure, he saw his name on above my team members, says tinsley.
5 millionths of a second. the projects Web site and maybe even But he also has enjoyed the social
pande says that it would take a very published in a scientific journal. Some aspect. For one team, he explains, the
fast desktop computer more than a projects also would award special main aim is to meet and talk with friends
thousand years to completely simulate certificates. and do something good and worthwhile
the process! But with the help of nearly Seeing the impact makes a big while were at it. EC
250,000 personal computers and more difference, says pande. When you
movie mania
Just as sound and color revolutionized the film industry, computer technology
has changed the way scientists view biology. Researchers today not only
can take snapshots of
biology, they can animate
entire biological processes,
thrusting viewers deep into
never-before-seen worlds.
Thanks to a HIGH-TECH tool, scientists many scientists stopped working others hold and interact with the models,
just regained their SIXTH SENSE. with physical models altogether, says a camera records a close-up shot of the
Before you think of a certain flick arthur Olson, a structural molecular models in motion. a computer program
starring Bruce Willis, think about feeling biologist. the nature of spatial percep then superimposes graphics, like the
your muscles flex as you push a box tion changes and the kind of understand arrangement of atoms or the energy
across carpet or plunging forward as ing you get from interacting with your between modeled molecules.
your car suddenly stops. these physical surroundings were lost when computer Olson combines the model and
responses to external cues are what graphics took over. computer graphics into one image that
many experts consider the Olson and his team at the Scripps allows him to study all the different facets
sixth type of sensory research Institute in La Jolla, California, of the biological molecule. Olson hopes
experience. have developed a tool that allows them that one day his interface could double as
to do both: physically a video game that lets students explore
manipulate a model of and play at the molecular level. EC
A scientist manipulates plastic a biological molecule
models of two proteins while while watching its
the computer tracks and
displays their electrostatic chemical and biophysi
pick up
!
properties, shown here as cal properties change
red and blue clouds. > arthur Olson on a computer screen.
Olson says combining a nearby object.
the two experiences
will let researchers approach and Rotate it so you see all
Some scientists
its sides. Does it feel
lost this sense in the understand biological problems in
heavy? What about cold?
computer age. they no new ways.
Smooth? How would you
longer used physical models of biologi the scientists use special printers
determine these qualities
cal molecules, like proteins or Dna, to that generate plastic or plaster 3-D if you only saw the object
see how they fit together. Instead, they shapes as easily as other printers on a computer screen?
used computer-generated models. produce 2-D pictures. as Olson and
<10|11> computing life | movie mania
By David Bochner
sim sickness
Scientists are creating their own virtual worlds where people live and work
and get sick. Here, researchers can mimic viruses and predict the spread of
contagious diseases through a community. Successful simulations can help us
better prepare for real-life outbreaks.
?
How would your simu about social networks and how people
lated life be different come into contact with each other.
from your best friends?
<12|13> computing life | sim sickness
?
What questions
in the library, scouring the shelves for would you want interests in math, biology and
scientific articles that discussed the to ask the models? human health. While most of her
1918 Spanish flu a pandemic that colleagues with double degrees
killed between 20 and 40 million practice bench-to-bedside
people worldwide. research in which they translate
It was very old-fashioned, says lab findings into patient care,
mills, who was studying international Because of the amount of data and Mills says shell stick with the
health at Harvard medical School in calculations involved, the simulations run computers-to-clinics approach.
Boston, massachusetts. I couldnt just on high-performance computers that can
type a search word into Google and simulate a 180-day outbreak in a matter
get the necessary information. the of hours. eubank uses software pro
hunt eventually led her to the 1918 grams to take snapshots of the pretend
transmission rates. pandemic as it occurs.
I know exactly when a virtual person
Asking Questions gets infected, shows symptoms and
With all the modeling pieces in place, the
recovers, says eubank, explaining that
mIDaS researchers invite policymakers
the computer records every change in
to ask questions that can be answered
disease state.
using the models. Questions range from
>>>
What happens if we dont do anything?
to How many people could be protected
if we intervene?
National Institute of General Medical Sciences
timeline
! create a
of what you did yesterday.
List all the people (even if
you dont know their names)
you came into contact with.
If you were contagious with
the seasonal flu, how many
of these people do you think
you would have infected? The
answer is surprisingly low.
Estimates suggest that youd
pass the virus to no more than
three people. But if more than
one other person catches it
from you, the bug will con
tinue to spread.
Flu Forecast
eubank and other researchers
modeling the 2009 H1n1 pandemic
flu simulated outbreak scenarios in
communities across the United
States. the results suggested that
early vaccination of school kids best
reduced disease spread, while
vaccinating elders became more
important later on. the simulations
also indicated that people at risk for
serious complications like pregnant
women or individuals with pre In 2006, MIDAS modelers mapped the potential spread
existing health problems should be of pandemic flu in the United States. Each dot changes
given antiviral medicines to take at from green to red as more people in that area get sick.
the first signs of illness. The top map shows what could happen if we didnt
While the results generated by do anything. The bottom map shows the effect of
the simulations are useful, eubank giving people a less effective vaccine while a better
stresses that theyre not a guarantee one is being developed. > Proceedings of the National Academy of Sciences
of what actually will happen. He and
Watch this pandemic flu spread on the Computing Life
others often will ask different models
Web site.
the same questions and, when the
models agree, theyll have more
confidence in the predictions. EC
By Alison Davis
If you live in the United States and virus actually causes its own
dont travel ABROAD, chances demise. Like a hungry wolf pack
are youll never come down with that clears out the local deer
population, the virus eventually
DENGUE fever. Thats not the case
starves itself. Infecting too many
for people living in tropical and people reduces its food
subtropical climates, like South supply.
America, Africa and the Caribbean. this work is just one example
Between 50 and 100 million of these of how researchers can develop
people catch the mosquito-transmitted models to answer questions
dengue virus every year. most of them about outbreaks of dengue
will bounce back after 2 weeks of rest or other diseases. With a math
and extra fluids. a small percentage, ematically based model, ecologist
however, wont be so lucky. after pejman rohani at the University of
contracting dengue a second time, Georgia in atlanta examined 30 years of
some people may develop a potentially epidemiological data from thailand, a hot
fatal dengue hemorrhagic fever. spot for dengue. He learned that envi
Scientists suspected that the human ronmental factors, like warmer
immune system might be to blame for temperatures, can re-route mosquito
making the second infection more flyways and in turn change dengue
dangerous, but until recently they infection rates.
werent sure how.
Using computer simulations,
epidemiologists at the Johns Hopkins
Bloomberg School of public Health in
Baltimore, maryland, learned that the
infected persons antibodies proteins
that should fight off dengue actually
help the virus copy itself. more copies Dengue is common
make the virus a better predator, in Haiti, and survi
allowing it to spread faster and infect vors of the massive
more people. earthquake that
But the researchers Derek devastated the coun
Cummings and Donald Burke, who is trys capital in 2010
now at the University of pittsburgh in faced a greater risk
pennsylvania also learned that the of infection due to
standing water and
contaminated sanita
tion systems.
integrating biology
Identifying all the parts of a cell or organism wont necessarily tell you how
those parts work together to make the system run. To do this, scientists
have turned to a relatively new field called systems biology that combines
experimental data and computational models to diagram everything from
how cells move to how hearts beat. With the diagrams, the researchers can
tinker with different parts and begin to explore questions nearly impossible
to answer through traditional lab experiments.
For scientists, the INTERNET is any network can serve as a model for
more than an information super understanding another because all these
highway and AIRPORTS arent just systems operate by a similar set of rules,
says physicist Luis amaral at northwestern
places where planes take off and Each spot on this globe represents a
University in evanston, Illinois. city, and each color corresponds to a
land. They are examples of complex amaral models the networks of the community of easily connected cities.
NETWORkS that can help research Internet and air travel, but he also maps > Luis a.n. amaral, roger Guimer
made possible by
Youve learned a lot about how computing power gives us new perspectives
on biology. At the center of it all is a component more advanced than
any silicon chip inside a computer processor. Its the human brain.
Biologists, engineers, physicists, computer scientists,
epidemiologists, geneticists and even writers and
artists have brought their brainpower to the
table to solve these old and new problems.
Going from Moms or Dads savory that predicts how proteins fold and attach algebra course, he says he knew it was
home cooking to the CAMPUS to other biological molecules. time to visit the math help room, where
cafeterias mystery meat can be By the time he graduated from high students could work with tutors. the effort
school, Harrison had presented his paid off. Harrison finished the class with a
a big adjustment for any COLLEGE
research to scientists older than his B-, which, considering how tough the class
freshman. But for Ryan Harrison, a parents and received numerous awards, was, he says felt more like an a+.
BIOMEDICAL engineering and including a top prize in the 2005 Intel I study a lot, admits Harrison. But I
economics major at Johns Hopkins Science talent Search the nations still make time to do things that I enjoy.
University in Baltimore, Maryland, it oldest and most prestigious high among his hobbies: directing a one-
wasnt a big deal. school science competition. act play, experimenting with light and
While most of his high school friends after graduation, Harrison sound for student theater productions and
took it easy their last year to fully enjoy returned to Hopkins and playing his favorite computer game.
senioritis, Harrison spent his downtime the Gray lab. even and he taught disadvantaged kids
at Hopkins, where he worked in the with a full college in Baltimore how to play chess,
chemical and biomolecular engineering course load, he explaining that it was also good
lab of professor Jeff Gray. Harrison got still found time to practice for him.
the chance through his high school, work on rosetta. With so many interests, one
which offers a program that pairs Dont be of Harrisons biggest challenges
students with researchers. fooled, though. in college was finding time for
Harrison had been writing his own Just because he all of his activities and
computer programs since the 4th grade. was an award- deciding what he ultimately
So when his high school biology teacher winning researcher wanted to do professionally. as
at age 17 doesnt Harrison in high he wrote in his online diary (see
introduced him to Gray, everything fell into school, when
place. He was into computational biology mean hes a whiz many scientists excerpts on the next page), I have
and we immediately hit it off! says Harrison. at everything! When mistook him for a more questions now about my
college or graduate
While in the Gray lab, Harrison he started losing the future than ever before. But, I
student!
improved the rosetta computer program battle in a high-level > Stephen Spartana
guess thats a normal part of
growing up.
<18|19> computing life | made possible by
Accessibility
this publication can be made available
in formats that are more accessible to
people with disabilities. to request this
material in a different format, contact the
nIGmS Office of Communications and
public Liaison at 301-496-7301; send
e-mail to info@nigms.nih.gov; or write
to the office at the following address:
45 Center Drive mSC 6200, Bethesda, mD
20892-6200. If you have questions or
comments about this publication, you
can use the same contact information
to reach the editor, emily Carlson.
People with many different talents > ask your science teacher or
can join in COMPUTING LIFE. If youre guidance counselor about
interested, ask yourself what aspects opportunities to work with a
researcher at a nearby college
of the research featured here you find
or other institution.
EXCITING. Do the projects blend many
> Search the Web for scientists
of your academic interests? Are there working at the crossroads of biology
particular biological problems youd and computation.
like to solve? > e-mail scientists at your local
Here are a few tips on how to get college or university for more
started looking into COMPUTING LIFE information.