Available online at www.sciencedirect.

com

ScienceDirect
Rice Science, 2016, 23(6): 297305

Identification and Characterization of OsWRKY72 Variant in

Indica Genotypes

Narasimha ASHWINI, Radha Sivarajan SAJEEVAN, Makarla UDAYAKUMAR, Karaba Nalkur NATARAJA
(Department of Crop Physiology, University of Agricultural Sciences, Gandhi Krishi Vignan Kendra, Bangalore, Karnataka 560065, India)

Abstract: Plant WRKY transcription factors (TFs) constitute one of the largest families of proteins
involved in biotic and abiotic stress responses. These TFs have a conserved 60 amino acid WRKY
domain at the N-terminal and a zinc finger motif at the C-terminal. To examine the relevance of
OsWRKY72 in imparting salinity stress tolerance, two indica rice genotypes, Rasi (tolerant genotype)
and Tellahamsa (susceptible genotype), were used. In Rasi seedlings at 12 h under 100 mmol/L NaCl
stress, OsWRKY72 expression was up-regulated, whereas in Tellahamsa, it was highly up-regulated at
lethal stress. Full-length OsWRKY72 cDNA was cloned from these two rice genotypes for further
analysis. We identified a variant, termed as OsWRKY72b that carries an additional sequence of 111 bp
within the WRKY domain. Expression of OsWRKY72b was higher under salinity stress in Rasi than in
Tellahamsa. Disorder prediction of OsWRKY72b showed that the additional sequence in the WRKY
domain is ordered thereby maintaining the tertiary structure that might interact with the major groove of
DNA. Prediction of phosphorylation sites in OsWRKY72b indicated that a few serine residues could be
the potential phosphorylation sites. In this study, we firstly reported a OsWRKY72 variant that could
have a role in abiotic stress responses.
Key words: Oryza sativa; indica genotype; OsWRKY72 gene; salinity; transcription factor

Transcription factors (TFs) are regulatory proteins that
bind to specific sequences of DNA upstream of a gene,
leading to activation or repression of any other gene.
In plants, these TFs are classified according to the
conserved amino acid sequences in their DNA-binding
domains, such as AP2/ERF, WRKY and NAC
(Yamasaki et al, 2008). WRKY is one of the largest
families of TFs with 75 members in Arabidopsis
thaliana, 102 in Oryza sativa subsp. indica, and 103
in Oryza sativa subsp. japonica (Song et al, 2010a).
WRKY TFs contain a 60 amino acid WRKY domain,
which has a conserved motif WRKYGQK at N-
terminal, and a zinc finger motif at the C-terminal
(Eulgem et al, 2000; Chen et al, 2012). Both the
WRKY and zinc finger motifs are required for the
binding of TF to DNA (Maeo et al, 2001). All the
WRKY proteins have a binding preference to a consensus
cis-acting element called the W-box (T/CTGACC/T),
while a neighboring sequence to this element partly
determines which WRKY interacts with it. For
example, if G nucleotide is directly adjacent to W-box
at the 5-end, AtWRKY6 and AtWRKY11 bind to the
element, whereas if T, C or A is adjacent to the element,
AtWRKY26, AtWRKY38 and AtWRKY43 bind to the
element (Ciolkowski et al, 2008). Based on the
WRKY and zinc finger motifs, WRKY members are
classified into three groups: Group I having two
WRKY domains and Cys2-His2 motif, group II having
one WRKY domain with Cys2-His2 zinc finger motif,
and group III with one WRKY domain containing
different zinc finger motifs, Cys2-His/Cys or Cys2-
His2 (Eulgem et al, 2000; Chen et al, 2012). WRKY
proteins regulate developmental processes such as
trichome development, seed development (Johnson et al,
2002) and leaf senescence (Hinderhofer and Zentgraf,
2001), although their major roles are in biotic stress

Received: 7 January 2016; Accepted: 4 July 2016

Corresponding author: Karaba Nalkur NATARAJA (nataraja_karaba@yahoo.com; nnkaraba@uasbangalore.edu.in)
Copyright 2016, China National Rice Research Institute. Hosting by Elsevier BB.V.
V This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/)
Peer review under responsibility of China National Rice Research Institute
http://dx.doi.org/
http://dx.doi.org/10.1016/j.rsci.2016.07.002
298
response and abiotic stress acclimation (Pandey and
Somssich, 2009). Expression profiling of 103 OsWRKY
genes in young and mature leaves, panicles and roots
indicated that 65 of them are expressed in at least one of
the tissues, of which 6 genes show root-specific
expression while 4 are panicle-specific (Ramamoorthy
et al, 2008). Various studies have demonstrated that
WRKYs in rice are rapidly induced under abiotic
stress such as drought, salinity (Ramamoorthy et al,
2008; Song et al, 2009), heat (Song et al, 2009; Wu et al,
2009) and osmotic stress (Song et al, 2009). A few
WRKY genes are also up-regulated upon phytohormone
treatment, such as abscisic acid, gibberellic acid, indole
acetic acid, methyl jasmonate, and salicylic acid
(Ramamoorthy et al, 2008). For example, OsWRKY72
is induced upon abscisic acid treatment in rice
aleurone cells (Xie et al, 2005; Li et al, 2015).
One of the major goals of crop biotechnology is to
prospect candidate TFs, which activate a cascade of
downstream signaling events in response to specific
stress leading to overall cellular tolerance. In an earlier
study, two-day-old seedlings of Rasi showed tolerant
to high temperature and salinity stress (Jayaprakash et al,
1998), while Tellahamsa displayed susceptible to high
temperature. In this study, we made an attempt to
examine the relevance of the upstream regulatory
genes OsWRKY72, and analyzed the expression
pattern of OsWRKY72 under salinity stress in two rice
genotypes Rasi and Tellahamsa. We cloned full-length
OsWRKY72 cDNA from these two rice genotypes and
discovered a transcript variant for the first time. The
relevance and significance of OsWRKY72a and
OsWRKY72b was analyzed and discussed.
MATERIALS AND METHODS
Plant material and stress imposition
Salinity stress was imposed to two-day-old
germinated rice seedlings (Jayaprakash et al, 1998).
The seedlings were grouped into three sets: the first
set was transferred to petri plates (15 cm 15 cm)
containing NaCl solution (100 mmol/L) for induction
stress, the second set was exposed directly to lethal
(shock) stress (250 mmol/L NaCl), and the third set
was maintained as control (in distilled water). The
seedlings were grown on blotting paper moistened
with distilled water (control) or salt solution (stress),
and incubated at 28 C with a relative humidity of
70%80%. Three replications were maintained for
each treatment. After 12 h of induction stress, the
seedlings were transferred to lethal stress, whereas the
Rice Science, Vol. 23, No. 6, 2016
other sets were continued in lethal stress and control
until 24 h (Uma et al, 1993; Jayaprakash et al, 1998).
Seedling growth was recorded by measuring root and
shoot length (cm) at 12 h and 24 h under the
treatments. Data were represented as percent reduction
in growth over control and the tissue samples were
collected for gene cloning and expression studies.
Isolation of total RNA and cDNA synthesis
Total RNA was isolated from 100 mg tissues using the
phenol-chloroform method (Sajeevan et al, 2014). All
RNA samples were treated with 1 U of DNase I
enzyme (MBI Fermentas, Hanover, USA) at 37 C for
45 min to remove the presence of genomic DNA
before cDNA synthesis. The first strand cDNA was
synthesized using 5 g total RNA in a 20 L reaction
mixture containing 40 pmol oligo (dT) primer, 1
reaction buffer with 10 mmol/L dNTP mix and 200 U
of Moloney Murine Leukemia virus reverse transcriptase
enzyme (MBI Fermentas, Hanover, USA). The reaction
mixture was incubated at 42 C for 1 h, and the cDNA
generated was used as the template for PCR-based
cloning (Sambrook et al, 1989) and gene expression.
Gene expression
To examine the expression of OsWRKY72, semi-
quantitative reverse transcriptase-polymerase chain
reaction (RT-PCR) was carried out using the gene-
specific forward (OsWRKY72a-F2 and OsWRKY72b-
F3) and reverse (OsWRKY72a-R2 and OsWRKY72b-
R3) primers (Table 1). The PCR was performed in a
20 L reaction mixture at an annealing temperature of
54 C with 35 cycles for OsWRKY72b, and 58 C with
30 cycles for OsWRKY72a. The house-keeping gene,
OsActin, was used as the loading control, and
OsLEA14 was used to confirm stress effect in plant
tissue. The amplified products were separated by
agarose gel electrophoresis, and product intensities
were quantified using ImageJ 1.45s software
(http://imagej.nih.gov/ij). The ratio of band intensities
of the target gene to house-keeping gene, OsActin was
calculated to assess the quantitative differences in
expression. Three replicates were used to calculate the
relative expression ratio.
Cloning and sequence analysis of OsWRKY72
The full length OsWRKY72 sequence information
from NCBI database (http://www.ncbi.nlm.gov/) was
used for designing the forward (OsWRKY72-F1) and
reverse (OsWRKY72-R1) primers (Table 1). The
stressed and control first strand cDNA were pooled
Narasimha ASHWINI, et al. OsWRKY72 Variant in Indica
Table 1. Primers used in this study.
Name Sequence (53)
OsWRKY72-F1 TCGATTGGTCGAGATGGAGAAC
OsWRKY72-R1 CAGTGTGGCATTGGCATTGA
OsWRKY72a-F2 CCCAAATGCACATCTACTCC
OsWRKY72a-R2 CAGTGTGGCATTGGCATTGA
OsWRKY72b-F3 CGAGAGGAGAACTTCCCGATACTCTTTGC
OsWRKY72b-R3 GTGAGGATGTGCTCGAAGTTGTCGTTGG
OsLEA14-F GCTACTCGCTGAAGAGCGCCGGG
OsLEA14-R GATGGGGAGGTCGACGGTGAGGC
OsActin-F TCCATAATGAAGTGTGATGT
OsActin-R GGACCTGACTCGTCATACTC
respectively and used as templates for PCR in a total
of 20 L reaction volume containing Phusion DNA
polymerase (Finnzymes, Thermo Fisher Scientific,
USA) with an annealing temperature of 54 C. The
genomic DNA was isolated from the 10-day-old seedlings
using the DNeasy Plant Mini Kit (QIAGEN, USA)
according to the manufacturers protocol. PCR was
carried out using the gene-specific forward and reverse
primers with an annealing temperature of 60 qC and an
initial denaturation for 8 min. The PCR amplified
products were cloned into T/A cloning vector using
InsT/A Clone PCR Product Cloning Kit (Fermentas,
Hanover, USA), and sequenced (ABI 3730Xl sequencer).
The identity of the cloned gene was confirmed by
BLASTn and BLASTx analyses, and the conserved
domain was identified in NCBI database.
Bioinformatic analysis
The intrinsic disorder of the cloned OsWRKY72 and
its variant were predicted using the software
Predictors of Natural Disordered Regions (PONDR,
http://www.pondr.com/research.html; Romero et al, 1997)
employing VL-XT predictor with default parameters.
Protein phosphorylation was predicted using NetPhos
(http://www.cbs.dtu.dk/services/NetPhos/; Blom et al,
1999) from ExPASy (http://www.expasy.org).
Statistical analysis
The growth data were analyzed by analysis of
variance (ANOVA, SPSS software package for
Windows, release 15.0; SPSS Inc., Chicago, USA).
Significance differences between means were assessed
by the Duncans multiple range test (P = 0.05)
(Gomez and Gomez, 1976).
RESULTS
Salinity stress response in Rasi and Tellahamsa
Salinity stress caused significant reduction in root and
299
Application
Full length amplification
Full length amplification
Expression of variant-a
Expression of variant-a
Expression of variant-b
Expression of variant-b
Stress confirmation
Stress confirmation
Internal control
Internal control
shoot growth of Rasi and Tellahamsa directly exposed
to 250 mmol/L NaCl, compared to those of the
seedlings induced before being subjected to lethal
stress (Fig. 1). The reductions in root and shoot at the
end of induction stress in Rasi were 5.44% and 6.99%,
whereas those in Tellahamsa were 28.07% and
14.06%, respectively. Similarly, reductions in root and
shoot growth at the end of lethal stress were 5.74%
and 7.34% in Rasi, whereas 20.87% and 9.36% in
Tellahamsa, respectively (Fig. 1-C and -D). The
growth data indicated that Tellahamsa is sensitive to
salinity stress when compared to Rasi.
Expression of OsLEA14 in indica genotypes under
salinity stress
To assess the effect of salinity stress at the cellular
level, we analyzed the transcript levels of OsLEA14, a
known stress responsive gene, highly expressed under
stressful conditions. Expression of OsLEA14 was
induced under induction and lethal stress at 12 h in
Rasi, while in Tellahamsa the expression was noticed
only under lethal stress. At 24 h, the expression of
OsLEA14 in Tellahamsa was similar under induction
and non-induction stress. However, in Rasi, the expression
was relatively more under induction stress (Fig. 2).
Expression of OsWRKY72 under salinity stress
The expression pattern of OsWRKY72 was studied
under salinity stress in Rasi and Tellahamsa. The
transcript levels were up-regulated at 12 h in Rasi
under induction and lethal stress. In Tellahamsa, the
increase in expression was observed under lethal
stress, however, upon induction there was an increase
in expression as compared to control (Fig. 3-A and -C).
At 24 h in Rasi, the expression was higher under
induction stress, as compared to direct lethal and
control (Fig. 3-B and -D). However, the expression in
Tellahamsa remained similar under both stress, but the
gene was up-regulated compared to control.
300 Rice Science, Vol. 23, No. 6, 2016

Fig. 1. Responses of Rasi and Tellahamsa seedlings to salinity stress.

A, Phenotypes of Rasi and Tellahamsa seedlings at 12 h of NaCl stress; B, Phenotypes of Rasi and Tellahamsa seedlings at 24 h of NaCl stress;
C, Percent reductions in root length (RL) and shoot length (SL) of Rasi and Tellahamsa over its control at 12 h; D, Percent reductions in root length
(RL) and shoot length (SL) of Rasi and Tellahamsa over its control at 24 h.
100250 mmol/L NaCl represents 100 mmol/L NaCl for 12 h followed by 250 mmol/L NaCl for 12 h.
Significant differences at the 0.05 level are indicated by lowercase letters.

Fig. 2. Expression analyses of OsLEA14 in the seedlings of Rasi and Tellahamsa.

Lanes 1, 2 and 3 correspond to expression in Tellahamsa, whereas lanes 4, 5 and 6 correspond to expression in Rasi. At 12 h, lanes 1 and 4
represent induction stress with 100 mmol/L NaCl; At 24 h, lanes 1 and 4 represent 100 mmol/L NaCl for 12 h followed by 250 mmol/L NaCl for 12
h; Lanes 2 and 5 are in lethal stress with 250 mmol/L NaCl, and lanes 3 and 6 are in control (distilled water) at 12 h and 24 h, respectively.
Narasimha ASHWINI, et al. OsWRKY72 Variant in Indica 301

Identification of OsWRKY72 variant in indica genotype
Using the available rice genome information, we
cloned 738 bp and 849 bp cDNAs from Rasi and
Tellahamsa, respectively. The sequence analysis using
NCBI BLASTn indicated 100% identity with Oryza
sativa subsp. indica WRKY72, and hence, these two
clones were designated as OsWRKY72a and OsWRKY72b.
Sequence analysis revealed that in OsWRKY72b, 111
bp is fragmentally duplicated from different regions of
the coding sequence with 45 nucleotides within the
domain and 66 nucleotides from the start of the open
reading frame (Fig. 4). This sequence is deposited in
NCBI GenBank with the accession number KT373801.
The additional region in OsWRKY72b was cloned
from genomic DNAs of Rasi and Tellahamsa, and
sequenced. Sequence analysis indicated the presence
of extra sequence in the genomic DNA of Rasi and
Tellahamsa (data not shown). Analysis of the
translated product of OsWRKY72b revealed an
interrupted WRKY domain due to the presence of the
additional sequence.
Expression of OsWRKY72b in salinity stress
We analyzed the expression pattern of OsWRKY72b to
understand the relevance of this variant under salinity
stress. In Tellahamsa, the transcript level of
OsWRKY72b was lower at 12 h as compared to the

Fig. 3. Expression analyses of OsWRKY72a by semi-quantitative reverse transcriptase-PCR.

Lanes 1, 2 and 3 correspond to expression in Tellahamsa, whereas lanes 4, 5 and 6 correspond to expression in Rasi. At 12 h, lanes 1 and 4
represent induction stress with 100 mmol/L NaCl; At 24 h, lanes 1 and 4 represent 100 mmol/L NaCl for 12 h followed by 250 mmol/L NaCl for 12
h; Lanes 2 and 5 are in lethal stress with 250 mmol/L NaCl, and lanes 3 and 6 are in control (distilled water) at 12 h and 24 h, respectively.

Fig. 4. Identification of OsWRKY72b in indica rice genotype.

Alignments of OsWRKY72a and OsWRKY72b amino acid sequence. The region within red colored arrow indicates the WRKY domain, and
additional sequence present in OsWRKY72b is represented by colored amino acids.
302 Rice Science, Vol. 23, No. 6, 2016

control and was not detected at 24 h of induction and
direct lethal stress (Fig. 5). However, in Rasi,
increases in expression upon induction stress were
noticed at 12 h and 24 h when compared to lethal
stress and the control.
Disorder prediction of OsWRKY72
The disordered regions of OsWRKY72a and OsWRKY72b
were predicted using the predictor of natural
disordered regions (PONDR) tool. The overall
disorder percent in OsWRKY72a was 60.82, with the
longest disordered region of 96 residues, and the
shortest of 8 residues. The total number of disordered
regions in the protein was five, with majority of them
being in the N-terminal. However, the region outside
the WRKY domain at the C-terminal end was also

Fig. 5. Expression of OsWRKY72b in seedlings of Rasi and Tellahamsa under salinity stress.
Lanes 1, 2 and 3 correspond to expression in Tellahamsa, whereas lanes 4, 5 and 6 correspond to expression in Rasi. At 12 h, lanes 1 and 4
represent induction stress with 100 mmol/L NaCl; At 24 h, lanes 1 and 4 represent 100 mmol/L NaCl for 12 h followed by 250 mmol/L NaCl for 12
h; Lanes 2 and 5 are in lethal stress with 250 mmol/L NaCl, and lanes 3 and 6 are in control (distilled water) at 12 h and 24 h, respectively.

Fig. 6. In silico analysis of OsWKY72a and OsWKY72b.

A and C, Predictor of natural disordered regions (PONDR) profiles for disorder; B and D, Phosphorylation site prediction using NetPhos 2 serv.
The black rectangle on the threshold line indicates the region interacts with its binding partners.
Narasimha ASHWINI, et al. OsWRKY72 Variant in Indica
disordered (Fig. 6-A). In OsWRKY72b, the overall
disorder percent was 52.84 with the longest disorder
region of 96 residues and the shortest being 8 residues.
The additional sequence within the WRKY domain
was not disordered (Fig. 6-C). Therefore, in OsWRKY72b,
the additional sequence was ordered, which is
probably essential to maintain the structural integrity
of the WRKY domain that interacts with the major
groove of DNA.
Phosphorylation of OsWRKY72 and its variant
The N-terminals of OsWRKY72a and OsWRKY72b,
stretch of residues S14, S15, S16, S18, S19, S20, S25
S28, S63 S64, S71, S73 and S88 probably are
potential phosphorylation sites (Fig. 6-B and -D). In
the variant sequence, residues S161, S176, S194 and
S197 showed a score of 0.7830.957, indicating
potential phosphorylation targets (Fig. 6-B and -D). A
stretch of serine residues were identified at the C-
terminal of OsWRKY72a and OsWRKY72b, of which
S228 and S265, respectively, were predicted to be
phosphorylated.
DISCUSSION
In this study, we have shown that high temperature
tolerant indica rice Rasi is also tolerant to salinity
stress at the seedling stage (Fig. 1). Gene expression
analysis indicated that the stress responsive OsLEA14
is up-regulated upon induction and lethal salinity
stress in Rasi. And, Tellahamsa, a genotype sensitive
to high temperature and salinity stress, did not show
the similar pattern and the expression of OsLEA14
was noticed only at lethal stress (without induction)
(Fig. 2). In Arabidopsis, LEA14 is up-regulated under
high light, dehydration, cold, and salt stress (Singh et al,
2005). In sweet potato, LEA14 is induced by
dehydration, salt and abscisic acid (Park et al, 2011).
Since Rasi has shown early induction of OsLEA14, it
might be having efficient mechanism to activate early
stress response.
In Rasi, OsWRKY72a is up-regulated upon
induction stress at 12 h and 24 h when compared to
Tellahamsa, which showed high expression only
under lethal stress at 12 h (Fig. 3). This suggests that
induction stress is sufficient to activate WRKY72a in
Rasi that in turn can activate genes with W box.
Previously, it has been documented that WRKYs from
O. sativa subsp. japonica are up-regulated under
different abiotic stress (Ramamoorthy et al, 2008).
The expression of nine WRKY genes (OsWRKY8,
303
OsWRKY12, OsWRKY13, OsWRKY14, OsWRKY16,
OsWRKY17, OsWRKY23, OsWRKY26 and OsWRKY45)
as shown by northern blot analysis, is influenced by
high salinity (Qiu et al, 2004). OsWRKY72 in O.
sativa subsp. japonica is also up-regulated under
salinity stress (Song et al, 2010b).
We identified 738 bp and 849 bp cDNAs for
OsWRKY72a and OsWRKY72b, respectively, from
two indica genotypes. We noticed an interruption in
the WRKY domain of OsWRKY72b (Fig. 4). Using
the rice genome automated annotation system and
GENSCAN software, alignments of the existing
Expressed Sequence Tags and WRKY domain,
respectively, confirm the presence of an intron in the
domain (Wu et al, 2005; Xie et al, 2005). The size and
sequence of the intron are variable, but the position of
the intron within the group is highly conserved
(Eulgem et al, 2000). Amino acid sequence comparison
between OsWRKY72a and OsWRKY72b showed that
the codon R was followed by the additional sequence,
which is in accordance with the previous report that R
type intron (splicing of the intron at the codon R) was
found in the WRKY domain of genes in the group I,
IIc, IId and III (Wu et al, 2005). Previously, variant
forms have been identified for OsWRKY1, OsWRKY8,
OsWRKY35, OsWRKY39 and OsWRKY57. In OsWRKY35,
54 nucleotides of the fourth intron are retained,
whereas OsWRKY39 retains the first intron of the
predicted gene (Xie et al, 2005). Here, we report the
sequence of OsWRKY72b encompassing an intron of
111 bp in the WRKY domain. The significance of
introns has been studied in other cases. For example,
rice Tubulin (OsTub6) in the 5-UTR has 446 bp
leader intron, which is capable of intron mediated
enhancement of gene expression as shown in transient
assay (Gian et al, 2009). In Arabidopsis MHX, 5-
UTR intron of 416 bp is shown to increase gene
expression, without acting as a transcriptional
enhancer (Akua et al, 2010). An internal element
within the intron has been shown to be essential for
expression of a reporter gene, which can enhance
translation efficiency, and is dependent on its location
in the 5-UTR (Akua and Shaul, 2013). The intron that
we have reported is in the coding region 504 bp from
the transcriptional start site. However, significance of
this intron in OsWRKY72b is unclear.
The expression levels of OsWRKY72b were high in
Rasi under induction stress at 12 h and 24 h when
compared to in Tellahamsa (Fig. 5). The difference in
the expression of the variant detected could be low
primarily due to low transcript levels. The sequences
304
in the WRKY domain are fragmentally duplicated
from regions of the coding sequence. It is reported that
group III WRKY genes in rice have evolved by tandem
and segmental gene duplication compared to
Arabidopsis (Agarwal et al, 2011). In this study, we
observed the expression of the variant under salinity
stress only. Further studies under other abiotic and
biotic stress can give a better understanding on the
role of OsWRKY72b in stress response.
By using PONDR profile, we predicted that in
OsWRKY72a and OsWRKY72b, the N-terminal region
was disordered, whereas the WRKY domain in the C-
terminal was ordered. The PONDR score for the
WRKY domain is 0.58, which is slightly above the
threshold of 0.50. In OsWRKY72b even in the presence
of the additional sequence, the WRKY domain was
ordered (Fig. 6-C). This can be justified since the
domain is required for DNA binding and maintenance
of the tertiary structure which is a prerequisite for
execution of protein function. The N- and C-terminal
regions are disordered which could be involved in
protein-protein interactions.
Analysis of protein microarray probed, with different
Arabidopsis activated mitogen-activated protein
kinases (MPKs), indicated that WRKY transcription
factors are phosphorylated. The WRKY53, WRKY62
and WRKY6 are phosphorylated by MPK7, MPK6,
and MPK10 respectively, and phosphorylation determines
the stability of WRKY6 (Popescu et al, 2009). We
predicted the phosphorylation sites in OsWRKY72a
and OsWRKY72b, and a few serine residues were
found to be phosphorylated (Fig. 6-B and -C).
Previous study has shown that OsWRKY30 (group I)
has multiple SP (serine residue followed by proline
residue) sites that are phosphorylated by MPK3, and
this confers drought tolerance in transgenic rice,
mutation of the SP sites abolishes phosphorylation and
does not impart drought tolerance when compared to
wild type (Shen et al, 2012). However, in OsWRKY72a
and OsWRKY72b, we did not observe multiple SP
sites as reported in group I, but serine residues are
present at the N-terminal region, and also within the
additional sequence which we have predicted to be
phosphorylated. Mutational studies of these serine
residues and phosphorylation assay will provide
insight into the significance of phosphorylation in
OsWRKY72a and OsWRKY72b.
In conclusion, our results indicate that OsWRKY72a
is differentially expressed in indica genotypes. The
identified OsWRKY72b transcript variant retains an
intron within the WRKY domain, and is up-regulated
Rice Science, Vol. 23, No. 6, 2016
under salinity stress in Rasi. The predicted WRKY
domain and the potential serine residues of
OsWRKY72a and OsWRKY72b were found to be
ordered and phosphorylated. Further characterization
is needed to identify the diverse roles of the variant in
plant development and imparting stress tolerance.
ACKNOWLEDGEMENTS
We thank Niche Area of Excellence-Indian Council
for Agriculture Research [Grant No. 10(15)/2012] and
Department of Science and Technology-Fund for
Improvement of Science and Technology Infrastructure
Government of India for providing financial support.
REFERENCES
Agarwal P, Reddy M P, Chikara J. 2011. WRKY: Its structure,
evolutionary relationship, DNA-binding selectivity, role in stress
tolerance and development of plants. Mol Biol Rep, 38: 3883
3896.
Akua T, Berezin I, Shaul O. 2010. The leader intron of AtMHX can
elicit, in the absence of splicing, low-level intron-mediated
enhancement that depends on the internal intron sequence. BMC
Plant Biol, 10: 93102.
Akua T, Shaul O. 2013. The Arabidopsis thaliana MHX gene
includes an intronic element that boosts translation when
localized in a 5 UTR intron. J Exp Bot, 64: 42554270.
Blom N, Gammeltoft S, Brunak S. 1999. Sequence- and structure-
based prediction of eukaryotic protein phosphorylation sites. J
Mol Biol, 294(5): 13511362.
Chen L G, Song Y, Li S J, Zhang L P, Zou C S, Yu D Q. 2012. The
role of WRKY transcription factors in plant abiotic stresses.
Biochim Biophys Acta, 1819(2): 120128.
Ciolkowski I, Wanke D, Birkenbihl R P, Somssich I E. 2008.
Studies on DNA-binding selectivity of WRKY transcription
factors lend structural clues into WRKY-domain function. Plant
Mol Biol, 68: 8192.
Eulgem T, Rushton P J, Robatzek S, Somssich I E. 2000. The
WRKY superfamily of plant transcription factors. Trends Plant
Sci, 5(5): 199206.
Gian S, Altana A, Campanoni P, Morello L, Breviario D. 2009. In
transgenic rice, alpha- and beta-tubulin regulatory sequences
control GUS amount and distribution through intron mediated
enhancement and intron dependent spatial expression.
Transgenic Res, 18(2): 151162.
Gomez K A, Gomez A A. 1976. Statistical Procedures for
Agricultural Research with Emphasis on Rice. Los Banos, the
Philippines: International Rice Research Institute.
Hinderhofer K, Zentgraf U. 2001. Identification of a transcription
factor specifically expressed at the onset of leaf senescence.
Planta, 213(3): 469473.
Jayaprakash T L, Ramamohan G, Krishnaprasad B T, Ganeshkumar,
Prasad T G, Mathew M K, Udayakumar M. 1998. Genotypic
Narasimha ASHWINI, et al. OsWRKY72 Variant in Indica
variability in differential expression of lea2 and lea3 genes and
proteins in response to salinity stress in fingermillet (Eleusine
coracana Gaertn) and rice (Oryza sativa L.) seedlings. Ann Bot,
82: 513522.
Johnson C S, Kolevski B, Smyth D R. 2002. TRANSPARENT
TESTA GLABRA2, a trichome and seed coat development gene
of Arabidopsis, encodes a WRKY transcription factor. Plant
Cell, 14(6): 13591375.
Li R, Zhou J, Li D Y, Wang X M, Yang Y, Yu C L, Cheng Y, Yan
C Q, Chen J P. 2015. Expression of OsWRKY7 in rice. Chin J
Rice Sci, 29(6): 559570. (in Chinese with English abstract)
Maeo K, Hayashi S, Kojima-Suzuki H, Morikami A, Nakamura K.
2001. Role of conserved residues of the WRKY domain in the
DNA-binding of tobacco WRKY family proteins. Biosci Biotech
Bioch, 65(11): 24282436.
Pandey S P, Somssich I E. 2009. The role of WRKY transcription
factors in plant immunity. Plant Physiol, 150: 16481655.
Park S C, Kim Y H, Jeong J C, Kim C Y, Lee H S, Bang J W,
Kwak S S. 2011. Sweet potato late embryogenesis abundant 14
(IbLEA14) gene influences lignification and increases osmotic-
and salt stress-tolerance of transgenic calli. Planta, 233(3): 621634.
Popescu S C, Popescu G V, Bachan S, Zhang Z, Gerstein M,
Snyder M, Dinesh-Kumar S P. 2009. MAPK target networks in
Arabidopsis thaliana revealed using functional protein
microarrays. Gene Dev, 23(1): 8092.
Qiu Y P, Jing S J, Fu J, Li L, Yu D Q. 2004. Cloning and analysis
of expression profile of 13 WRKY genes in rice. Chin Sci Bull,
49: 21592168. (in Chinese with English abstract)
Ramamoorthy R, Jiang S Y, Kumar N, Venkatesh P N, Ramachandran
S. 2008. A comprehensive transcriptional profiling of the WRKY
gene family in rice under various abiotic and phytohormone
treatments. Plant Cell Physiol, 49(6): 865879.
Romero P, Obradovic Z, Dunker A K. 1997. Sequence data analysis
for long disordered regions prediction in the calcineurin family.
Genome Inform Workshop Genome Inform, 8: 110124.
Sajeevan R S, Shivanna M B, Nataraja K N. 2014. An efficient
protocol for total RNA isolation from healthy and stressed
tissues of mulberry (Morus sp.) and other species. Am J Plant
Sci, 5(13): 20572065.
Sambrook J, Fritsch E F, Maniatis T. 1989. Molecular Cloning: A
305
Laboratory Manual. 2nd ed. New York, USA: Cold Spring
Harbor Laboratory Press.
Shen H S, Liu C T, Zhang Y, Meng X P, Zhou X, Chu C C, Wang
X P. 2012. OsWRKY30 is activated by MAP kinases to confer
drought tolerance in rice. Plant Mol Biol, 80(3): 241253.
Singh S, Cornilescu C C, Tyler R C, Cornilescu G, Tonelli M, Lee
M S, Markley J L. 2005. Solution structure of a late
embryogenesis abundant protein (LEA14) from Arabidopsis
thaliana, a cellular stress-related protein. Protein Sci, 14(10):
26012609.
Song Y, Ai C R, Jing S J, Yu D Q. 2010a. Research progress on
function analysis of rice WRKY gene. Rice Sci, 17(1): 6072.
Song Y, Chen L G, Zhang L P, Yu D Q. 2010b. Overexpression of
OsWRKY72 gene interferes in the abscisic acid signal and auxin
transport pathway of Arabidopsis. J Biosciences, 35(3): 459471.
Song Y, Jing S J, Yu D Q. 2009. Overexpression of the stress
induced OsWRKY08 improves the osmotic stress tolerance in
Arabidopsis. Chin Sci Bull, 54: 46714678. (in Chinese with
English abstract)
Uma S, Ravishankar K V, Prasad T G, Reid J L, Udaya Kumar M.
1993. Abscisic acid-responsive proteins induce salinity stress
tolerance in finger millet (Eleusine coracana Gaertn.) seedlings.
Curr Sci, 65: 549554.
Wu K L, Guo Z J, Wang H H, Li J. 2005. The WRKY family of
transcription factors in rice and Arabidopsis and their origins.
DNA Res, 12(1): 926.
Wu X L, Shiroto Y, Kishitani S, Ito Y, Toriyama K. 2009.
Enhanced heat and drought tolerance in transgenic rice seedlings
overexpressing OsWRKY11 under the control of HSP101
promoter. Plant Cell Rep, 28(1): 2130.
Xie Z, Zhang Z L, Zou X L, Huang J, Ruas P, Thompson D, Shen
Q J. 2005. Annotations and functional analyses of the rice
WRKY gene superfamily reveal positive and negative regulators
of abscisic acid signaling in aleurone cells. Plant Physiol, 137:
176189.
Yamasaki K, Kigawa T, Inoue M, Watanabe S, Tateno M, Seki M,
Shinozaki K, Yokoyama S. 2008. Structures and evolutionary
origins of plant-specific transcription factor DNA-binding
domains. Plant Physiol Bioch, 46(3): 394401.
(Managing Editor: WANG Caihong)