ORIGINAL RESEARCH

Oxytocin-Stimulated NFAT Transcriptional Activation

in Human Myometrial Cells

Jason N. A. Pont, Craig A. McArdle, and Andrs Lpez Bernal

Bristol University, School of Clinical Sciences, Bristol BS1 3NY, United Kingdom

Oxytocin (OXT) is a peptide hormone that binds the OXT receptor on myometrial cells, initiating
an intracellular signaling cascade, resulting in accumulation of intracellular calcium and smooth
muscle contraction. In other systems, an elevation of intracellular Ca2! stimulates nuclear trans-
location of the transcription factor, nuclear factor of activated T cells (NFAT), which is transcrip-
tionally active in arterial and ileal smooth muscle. Here we have investigated the role of NFAT in
the mechanism of action of OXT. Human myometrial cells expressed all five NFAT isoforms
(NFATC1C4 and -5). Myometrial cells were transduced with a recombinant adenovirus expressing
a NFATC1-EFP reporter, and a semi-automated imaging system was used to monitor effects of OXT
on reporter localization in live cells. OXT induced a concentration-dependent nuclear transloca-
tion of NFATC1-EFP in a reversible manner, which was inhibited by OXT antagonists and calcineu-
rin inhibitors. Pulsatile stimulation with OXT caused intermittent, pulse-frequency-dependent,
nuclear translocation of NFATC1-EFP, which was more efficient than sustained stimulation. OXT
induced nuclear translocation of endogenous NFAT that was transcriptionally active, because OXT
stimulated activity of a NFAT-response element-luciferase reporter and induced calcineurin-NFAT
dependent expression of RGS2, RCAN1, and PTGS2 (COX2) mRNA. Furthermore, OXT-dependent
transcription was dependent on protein neosynthesis; cycloheximide abolished RGS2 transcription
but augmented RCAN1 and COX2 transcriptional readouts. This study identifies a novel signaling
mechanism within the myometrium, whereby calcineurin-NFAT signaling mediates OXT-induced
transcriptional activity. Furthermore, we show NFATC1-EFP is responsive to pulses of OXT, a
mechanism by which myometrial cells could decode OXT pulse frequency. (Molecular
Endocrinology 26: 17431756, 2012)

T he uterus primarily functions as a quiescent environ-

ment for the developing fetus during pregnancy, be-
fore switching from a relaxed to a contractile state at term
resulting in parturition. Complications arise when partu-
rition occurs too early or too late, but more often when it
is premature. Ten percent of births worldwide are pre-
term (defined as delivery preceding 37 wk gestation) (1)
with 85% of infant morbidity and mortality attributed to
prematurity (2). Interestingly, nearly 50% of preterm
births are idiopathic, with no obvious etiology (1), and
are therefore potentially preventable (3, 4). However, the
mechanisms by which labor is initiated have yet to be fully
elucidated, making intervention and treatment of preterm
labor problematic (5, 6).
Oxytocin (OXT) is a potent uterotonic hormone, re-
leased from the posterior pituitary in a pulsatile manner.
As parturition progresses, OXT pulse frequency and du-
ration increase (7), thus enhancing the frequency and
force of myometrial contractions. Although the clinical
use of OXT in the induction and augmentation of labor is
well established (8, 9), its importance in initiating partu-
rition physiologically is debatable. Animal experiments
have shown that OXT-deficient mice exhibit normal la-
bor and delivery, although the pups do not survive due to

ISSN Print 0888-8809 ISSN Online 1944-9917 Abbreviations: AM, Acetoxymethyl ester; BAPTA, 1,2-bis(o-aminophenoxy)ethane-
Printed in U.S.A. N,N,N",N"-tetraacetic acid; [Ca2!]i, intracellular calcium; COX2, cyclooxygenase 2; CX,
Copyright 2012 by The Endocrine Society cycloheximide; CyclA, cyclosporin A; FCS, fetal calf serum; !-Gal, !-galactosidase; GPCR,
doi: 10.1210/me.2012-1057 Received February 20, 2012. Accepted July 12, 2012. G protein-coupled receptor; N:C, nuclear to cytoplasmic ratio; NFAT, nuclear factor of
First Published Online August 17, 2012 activated T cells; NF"B, nuclear factor "-light-chain-enhancer of activated B cells; OXT,
oxytocin; OXTR, OXT receptor; PFA, paraformaldehyde; pfu, plaque-forming units; PSS,
physiological salt solution; qPCR, real-time PCR; RCAN1, regulator of calcineurin 1; RGS2,
regulator of G protein signaling 2.

Mol Endocrinol, October 2012, 26(10):17431756 mend.endojournals.org 1743

1744 Pont et al. Oxytocin-Induced NFAT Activation
loss of the milk ejection reflex (10, 11). This suggests that
OXT may play an essential role in the establishment of
lactation, but only a permissive role during parturition. In
women, there is an increase in OXT receptor (OXTR)
density in the myometrium during late pregnancy; how-
ever, there is no further increase near the onset of labor
(12, 13), indicating that OXTR density is not a defining
factor in initiating parturition. Maternal plasma OXT
levels are not elevated before the onset of parturition in
women (14); however, in addition to being released into
the circulation by the posterior pituitary, OXT is also
synthesized and secreted by the decidua, with OXT
mRNA and protein expression in this tissue increasing
prepartum (1517). This suggests a possible paracrine
mechanism by which locally synthesized OXT may be
involved in the initiation of parturition at term.
OXT binds to the OXTR, a G protein-coupled recep-
tor (GPCR), on myometrial cells to initiate an intracellu-
lar signaling pathway culminating in intracellular calcium
([Ca2!]i) accumulation (18, 19), and thus uterine smooth
muscle contraction through activation of myosin light
chain kinase (20 22). In conjunction with contraction,
Ca2! signaling also mediates activation of certain tran-
scription factors, i.e. nuclear factor "-light-chain-en-
hancer of activated B cells (NF"B), c-JUN N-terminal
kinases and nuclear factor of activated T cells (NFAT).
NFAT was first identified in T cells, being essential for
induction of cytokine gene expression during the immune
response (23). Outside the immune system, NFAT has
been physiologically implicated in skeletal (24) and car-
diac (25, 26) muscle hypertrophy, skeletal muscle growth
and development (27, 28), heart valve formation (29),
and vascular development (30 32). To date, there have
been no studies on the function of NFAT in the myome-
trium; however, experiments in mice have shown that
inhibition of NFAT signaling at term delays delivery by
several hours (33), suggesting that the NFAT pathway
may be involved in the initiation of parturition.
Five members of the NFAT family of transcription fac-
tors have been isolated: NFATC2 (NFAT1/p) (34),
NFATC1 (NFAT2) (35), NFATC4 (NFAT3) (36),
NFATC3 (NFAT4/x) (36 38), and NFAT5 (TonEBP)
(39, 40). NFATC1 4 signaling is mediated by the Ca2!/
calmodulin-dependent phosphatase calcineurin (41),
whereas NFAT5 activity is activated by osmotic stress
(40). In resting cells, the four calcineurin-sensitive
NFATC1 4 transcription factors are predominantly lo-
calized to the cytosol in a phosphorylated state. On ele-
vation of [Ca2!]i, calcineurin induces NFAT dephosphor-
ylation, unmasking nuclear localization signals (42) and
stimulating cotranslocation of the calcineurin-NFAT
complex to the nucleus (43). In the nucleus, NFAT binds
Mol Endocrinol, October 2012, 26(10):17431756
the NFAT-binding motif in DNA promoter regions and
cooperates with cofactors, i.e. activator protein 1, globin
transcription factor 1, and myocyte enhancer factor 2 to
enhance gene expression (44, 45). As [Ca2!]i declines,
NFAT is rephosphorylated by kinases such as c-JUN N-
terminal kinase and glycogen synthase kinase 3 (46 48),
promoting nuclear export of NFAT via a chromosome
region maintenance protein 1/exportin mechanism (49).
Pulsatile release of hormones is important for regulat-
ing physiological processes and coordinating Ca2! signal-
ing and thus transcription within a cell; i.e. pulses of OXT
determine luteolysis and maintenance of pregnancy in the
sheep (50), and pulses of GnRH regulate gene expression
in the gonadotrophs (51, 52). A pulsatile system is phys-
iologically advantageous in comparison with sustained
release of a hormone for several reasons: intermittent
stimulation of a receptor does not result in desensitization
and internalization of the receptor, as with sustained
stimulation (53), and allows for recycling of the receptor
to the surface between stimulations for a maximal re-
sponse. Moreover, the energy cost to the cell of intermit-
tently elevating [Ca2!]i is far less than the energy required
to maintain elevated [Ca2!]i levels for a sustained period
of time. Furthermore, pulse frequency is an important
mechanism for encoding transcriptional responses; i.e.
GnRH pulse frequency is decoded within gonadotrophs
to stimulate differential transcriptional readouts (51),
and a similar system may be involved in GH-regulated
gene transcription (54). NFAT nuclear shuttling has been
shown to be dependent on Ca2! oscillation and hormonal
pulse frequency, with the greater the frequency, the
greater the amplitude of NFAT nuclear localization (51,
55, 56). This suggests that NFAT is an important mech-
anism in decoding pulse frequency to differentially regu-
late gene transcription.
In this report, we demonstrate for the first time that
NFAT is involved in the mechanism of action of OXT in
human myometrial cells. OXT induces translocation of
NFAT to the nucleus via a calcineurin-mediated mecha-
nism, with NFAT nuclear localization mirroring pulses of
OXT in a frequency-dependent manner. We show that
pulsatile OXT can provide a more efficient signal for
NFAT activation than a sustained stimulus and that
OXT-induced gene expression is dependent on calcineu-
rin-NFAT activity.
Materials and Methods
Reagents
DMEM, fetal calf serum (FCS), collagenase type II, dispase,
penicillin, streptomycin Hoechst nuclear stain, fluo4 Ca2! in-
Mol Endocrinol, October 2012, 26(10):17431756
dicator, !-mercaptoethanol, and primers were ordered from In-
vitrogen (Paisley, UK). Deoxyribonuclease, elastase, atosiban,
coenzyme A, and ATP was purchased from Sigma (Dorset, UK).
L368899, cyclosporin A (CyclA), FK506, and cycloheximide
(CX) were purchased from Tocris (Bristol, UK). OXT was from
Calbiochem (Darmstadt, Germany), ionomycin from Ascent
Scientific (Abcam, Cambridge, UK), and luciferin from Promega
(Southampton, UK). All basic chemicals were from Sigma unless
otherwise stated.
Antibodies
Primary antibodies were mouse monoclonal anti-NFATC1
(7A6) antibody (SC7294) from Santa Cruz Biotechnology
(Santa Cruz, CA) and rabbit polyclonal antidesmin (ab15200),
mouse monoclonal anti-actin (ab18147), and rabbit monoclo-
nal anticalponin (ab46794) from Abcam (Cambridge, UK). Sec-
ondary antibodies were Alexa fluor 488 goat antirabbit IgG
(heavy and light chains) from Invitrogen, and DyLight 488 Af-
finiPure donkey antimouse IgG (heavy and light chains) from
Jackson ImmunoResearch Laboratories (Suffolk, UK).
Myometrial cell dispersion and culture
This study was approved by the South West Research Ethics
Committee. Human myometrial biopsies were obtained, with
informed consent from premenopausal women at hysterectomy.
Myometrial cell isolation and culture was adapted from the
protocol described by Phaneuf et al. (57). Briefly, dissected tis-
sue was incubated at 37 C, with gentle shaking, in DMEM (4.5
g/liter glucose, glutamate), with 300 U/ml collagenase type II,
0.3 U/ml dispase, 30 U/ml deoxyribonuclease, and 0.09 U/ml
elastase for 1 h. The supernatant was spun for 10 min at 378 #
g, and the cell pellet was resuspended in DMEM supplemented
with 10% FCS and 1% penicillin-streptomycin. After two ad-
ditional incubations, collected cells were pooled into T75 flasks
for culture. Cultured cells were used experimentally from pas-
sages 310.
IN Cell Analyzer 1000 image acquisition
Imaging experiments were performed using the IN Cell An-
alyzer 1000 (GE Healthcare, Buckinghamshire, UK) semiauto-
mated imaging platform as previously described (51). Images
were acquired in a single field of view for live cell imaging and
three fields for fixed cell imaging. Experiments were performed
in triplicate wells with 50 200 cells per field.
Measurement of [Ca2!]i
Myometrial cells were seeded at 5000 cells per well in black-
walled 96-well sample plates (Appleton Woods, Birmingham,
UK). Next day, cells were washed before loading with 2.5 #M
fluo4 Ca2! indicator and 0.5 #M Hoechst nuclear stain, along
with other compounds if required (as described in figure leg-
ends), in phenol red-free DMEM (10% FCS, 25 mM HEPES)
and incubated at 37 C for 30 min. After incubation, sample
plates were loaded into the IN Cell Analyzer 1000 for imaging.
Live cell populations were imaged before stimulation with OXT
(as described in figure legends), using a robotic needle, with
subsequent images acquired every 12 sec for 60 sec.
mend.endojournals.org 1745
NFATC1-EFP nuclear translocation
Myometrial cells were seeded at 5000 cells per well in black-
walled 96-well plates. Next day, cells were transduced with a
NFATC1-EFP adenovirus (GE Healthcare, Buckinghamshire,
UK), at 2 # 104 plaque-forming units (pfu)/#l in DMEM (2%
FCS) for 16 24 h. On the day of experiment, cells were loaded
with 0.5 #M Hoechst nuclear stain in physiological salt solution
(PSS) [127 mM NaCl, 0.5 mM NaH2PO4, 1.8 mM CaCl2, 2 mM
MgCl2, 5 mM KCl2, 5 mM NaHCO3, 10 mM HEPES (pH 7.5),
0.1% BSA, 10 mM glucose] and incubated at 37 C for 30 min.
For live cell experiments, cell populations were imaged before
stimulation with OXT, with subsequent images being acquired
at the relevant time points after stimulation (see figure legends).
For repeated stimulation experiments, cells were washed five
times with PSS between 5-min stimulations with OXT (the fre-
quency and amplitude of stimulation is described in the figure
legends). For fixed cell imaging, cells were pretreated with the
relevant compound (as described in figure legends) and stimu-
lated with OXT or ionomycin before terminating the reaction
with ice-cold PBS, fixation in 4% paraformaldehyde (PFA) for
20 min, and imaging.
IN Cell Analyzer image analysis
Image analysis and fluorescence quantification was per-
formed using the IN Cell Analyzer Work station version 3.5
software (IN Cell Investigator; GE Healthcare). Cytoplasmic
and nuclear regions were defined by green channel (fluo4 and
NFATC1-EFP) and blue channel (Hoechst nuclear stain) im-
ages, respectively. The fluorescence readouts for each region
were used to calculate cell population and individual cell fluo-
rescence. For graphical representation and statistical analysis,
fluo4 nuclear intensity (background subtracted) was standard-
ized to resting cell nuclear intensity, and NFATC1-EFP cyto-
plasmic and nuclear intensity were used to calculate the nuclear
to cytoplasmic ratio (N:C) as previously described (51).
Immunocytochemistry
Myometrial cells were seeded at 5000 cells per well in black-
walled 96-well plates. Next day, cells were washed with PBS,
fixed in 4% PFA for 20 min, and permeabilized with 0.1%
Triton X-100 for 10 min. Nonspecific primary antibody binding
was blocked with normal goat serum (Invitrogen) (desmin and
calponin) or normal donkey serum (Sigma) (NFATC1 and ac-
tin) for 2 h. Cells were treated with primary antibody for 24 h at
4 C. Primary antibodies used were NFATC1 (1:100), desmin
(1:150), actin (1:400), and calponin (1:150). Next day, cells
were washed in PBS six times before incubation with goat anti-
rabbit (1:200) (desmin and calponin) and donkey antimouse
(1:200) (NFATC1 and actin) secondary antibody. Cells were
again washed with PBS six times before staining with Hoechst
nuclear stain for 30 min and image acquisition by the IN Cell
Analyzer 1000 as previously described. Image analysis was by
IN Cell Analyzer work station version 3.5 software as previ-
ously described. Primary antibody cytoplasmic fluorescence was
defined by green channel images. A filter was set for cytoplasmic
intensity at 260, 250, and 300 arbitrary fluorescent units for
desmin, actin, and calponin images, respectively, to calculate the
percentage of positive cells for each primary antibody. For
graphical representation and statistical analyzes, a NFATC1
1746 Pont et al. Oxytocin-Induced NFAT Activation
N:C was calculated as previously described and normalized to
the untreated control.
Luciferase assay
Myometrial cells were seeded at 5000 cells per well in black-
walled 96-well plates. Next day, cells were transduced with a
NFAT response element luciferase reporter (NFAT-RE-Luc)
(Addgene, Cambridge, UK; plasmid 10959) and !-galactosidase
(!-Gal) adenovirus as previously described (51, 58) at 1 # 104
pfu/#l and 5 # 103 pfu/#l, respectively, in DMEM (2% FCS) for
16 24 h. Cells were treated with inhibitors where necessary and
stimulated with OXT in PSS at the desired concentration and
time (see figure legends) before the reaction was terminated with
ice-cold PBS, treated with lysis buffer, and frozen then thawed to
aid lysis. Luciferase reagent [33.3 mM dithiothreitol, 270 #M
coenzyme A, 530 #M ATP, 470 #M luciferin in assay buffer
containing 20 mM Tricene, 0.1 mM EDTA, 1.07 mM
(MgCO3)4Mg(OH)2, and 2.67 mM MgSO4] was added to cell
lysates to assess luminescence with a Lumat LB 9507 luminom-
eter (Berthold Technologies, Hertfordshire, UK). !-Gal activity
was used to correct for adenovirus transduction efficiency, be-
ing measured by incubation of the remaining lysate with chlo-
rophenol-red-galactopyranoside (Roche Applied Sciences, West
Sussex, UK) mix (878 #M chlorophenol-red-galactopyranoside,
175 #M !-mercaptoethanol, 60 mM Na2HPO4, 40 mM
NaH2PO4, 10 mM KCl, and 1 mM MgSO4) at 37 C for 48 h, with
!-Gal activity measured using a microplate reader (Revelation
version 4.22; Dynex Technologies, West Sussex, UK). Light
units were standardized to !-Gal activity and normalized to
control for graphical representation and statistical analysis.
Quantitative real-time PCR
Myometrial cells were seeded at 100,000 cells per well in
six-well plates and grown to 60 80% confluency. Cells were
treated with OXT, plus or minus inhibitors, for the appropriate
times (as described in figure legends). The stimulations were
terminated with ice-cold PBS (ribonuclease free) before addition
of lysis buffer (50 #M mercaptoethanol). RNA was isolated
using an RNeasy mini kit (QIAGEN, West Sussex, UK), accord-
ing to the manufacturers protocol. Quantity and quality of
RNA was assessed by the NanoDrop 1000 full spectrum 220/
750-nm spectrophotometer (Labtech International, East Sussex,
UK). cDNA was synthesized using the High Capacity cDNA
Reverse Transcription Kit (Applied Biosystems, Foster City,
CA) following the manufacturers instructions and diluted
TABLE 1. Primer pairs for qPCR
Gene nomenclature Forward primer (5!3!)
RNA18S1 (18s) (1332) ATGGCCGTTCTTAGTTGGTG
POLR2A (RNAPOLII) (4453) GCACCACGTCCAATGACATTG
NFATC2 (NFAT1) (2114) AAGAGCCAGCCCAACATGC
NFATC1 (NFAT2) (1302) CTGTGCAAGCCGAATTCTCTGG
NFATC4 (NFAT3) (2189) GTCCTGATGGGAAGCTGCAATGG
NFATC3 (NFAT4) (303) GCGGCCTGCAGATCTTGAGC
NFAT5 (2458) GACACTGGCGGTGGACTGCG
RGS2 (236) CTTTCATCAAGCCTTCTCCTGA
RCAN1 (DSCR1) (493)GCTCAGACCTTACACATAGGAAGC
PTGS2 (COX2) (590) CAAAGGTAAAAAGCAGCTTCCTG
The gene sequence position of each primers 5"-terminal nucleotide is indicated in parentheses preceding each primer sequence.
Mol Endocrinol, October 2012, 26(10):17431756
4-fold on reaction completion. Gene expression was quantified
by real-time PCR (qPCR) with Power SYBR Green Master Mix
(Applied Biosystems, Foster City, CA), using a 7500 real-time
PCR system (Applied Biosystems, Foster City, CA). A template
of 2 #l cDNA was run per reaction in a final reaction volume of
20 #l (75 nM forward and reverse primers, Table 1) for 45 cycles
of 95 C for 15 sec and 60 C for 60 sec. A dissociation stage
followed to ensure the amplification of a single product. Rela-
tive mRNA expression levels were quantified by the Pfaffl
method of relative quantification (59), as used by Peeters et al.
(60), and standardized to the housekeeping genes 18S and RNA
polymerase II. Expression levels were normalized to control val-
ues for graphical representation and statistical analysis.
Promoter sequence analysis for NFAT-binding
motifs
Regulator of G protein signaling 2 (RGS2), regulator of cal-
cineurin 1 (RCAN1), and cyclooxygenase 2 (COX2) promoter
sequences were derived using the UCSC genome browser (UCSC
Genome Bioinformatics, University of California, Santa Cruz,
CA). The promoter sequences were entered into the Meme Suite
program (61) and using the Fimo Algorithm (62) scanned for
NFAT-binding motifs. Statistical significance was taken as P $
0.001.
Statistical analysis
Statistical analysis was performed with GraphPad Prism ver-
sion 5 (GraphPad Software, La Jolla, CA) using one-way or
two-way ANOVA with Dunnetts or Bonferroni post hoc test as
indicated. Results shown are mean % SEM, with P $ 0.05 con-
sidered statistically significant. All experiments were repeated at
least three times using cells from three or more separate donors.
Results
Characterization of myometrial cell phenotype
The phenotype of myometrial cells in our culture sys-
tem were validated using primary antibodies for the
smooth muscle cell markers desmin, actin, and calponin
(Supplemental Fig. 1, published on The Endocrine Soci-
etys Journals Online web site at http://mend.endojour-
nals.org). From a sample size of 1200 2400 cells, 95.4 %
Reverse primer (5!3!)
(1548) CGCTGAGCCAGTCAGTGTAG
(4719) GTGCGGCTGCTTCCATAAGC
(2220) CGTTTTCTCTTCCCATTGATGAC
(1379) ACTGACGTGAACGGGGCTGG
(2258) AGCGTCACCTCGTTGCTCTGC
(404)TGATGTGGTAAGCAAAGTGGTGTGGT
(2517) CTGGCTTCGACATCAGCATTCCT
(299) GCTAGCAGCTCGTCAAATGC
(598) CCACTTGTTTCCATCCCACTG
(671) CTGGGGATCAGGGATGAACT
Mol Endocrinol, October 2012, 26(10):17431756
1.3% of cells were positive for desmin, 94 % 0.28% pos-
itive for actin, and 99.1 % 0.33% positive for calponin.
Within the no-primary-antibody control group, 96.3 %
0.54% of cells were negative for desmin, 99 % 0.003%
negative for actin, and 98.4 % 0.9% negative for
calponin.
Expression of NFAT isoforms in human
myometrium
Because there has been no previous description of
NFAT expression in myometrial smooth muscle, we de-
signed probes to identify NFAT isoforms by real-time
PCR and found that NFATC1, NFATC2, NFATC3,
NFATC4, and NFAT5 were expressed in cultured myo-
metrial cells. The calcineurin-insensitive NFAT5 was ex-
pressed in greatest abundance in comparison with the
calcineurin-dependent NFATC1 4 (P $ 0.001). The levels
of expression of the calcineurin-sensitive isoforms were
NFATC4 more than NFATC1, and NFATC3 (P $ 0.01)
and NFATC4 more than NFATC2 (P $ 0.001) (Fig. 1).
OXT-induced NFATC1-EFP nuclear translocation in
human myometrial cells
The NFAT signaling pathway is activated by an eleva-
tion of [Ca2!]i in arterial and ileal smooth muscle cells
(63, 64). To confirm OXT induction of Ca2! signaling in
myometrial cells, a fluo4-acetoxymethyl ester (AM) Ca2!
indicator was used. Treatment of myometrial cells with
OXT caused a concentration-dependent (EC50 & 1.18 %
0.18 nM) and time-dependent increase in [Ca2!]i (Fig.
2A). The response was maximal 12 sec after stimulus at
the higher concentrations (10'6 and 10'7 M) and 24 sec
for the lower concentrations (10'8-10'10 M), with
FIG. 1. NFAT mRNA expression in human myometrial cells. Real-time
PCR was performed on cDNA collected from cultured human
myometrial cells. Data shown are relative mRNA copy number,
mean % SE, from five independent donors, calculated by the Pfaffl
method of analysis and normalized to the housekeeping genes 18S
and RNA polymerase II. Statistical analysis was performed by one-way
ANOVA, with Bonferroni multiple-comparison post hoc test. Statistics
shown are in comparison with relative NFATC4 expression. *, P $
0.01; **, P $ 0.001.
mend.endojournals.org 1747
fluo4-AM intensity returning to near baseline within 1
min (Fig. 2A).
To assess the effect of OXT on NFAT activity, myo-
metrial cells were transduced with a recombinant adeno-
virus expressing a NFATC1-EFP imaging reporter. In un-
stimulated cells, NFATC1-EFP was largely cytoplasmic;
however, on treatment with OXT, NFATC1-EFP trans-
located to the nucleus (Fig. 2 and Supplemental Fig. 1).
This effect was quantified by an automated imaging sys-
tem, which defined the NFATC1-EFP fluorescence inten-
sity in the cytoplasm and nucleus to calculate the
NFATC1-EFP (N:C) intensity ratio in cell populations
and individual cells (Supplemental Fig. 2). Sustained
treatment with OXT induced a concentration-dependent
increase in NFATC1-EFP N:C ratio (EC50 & 1.14 % 0.15
nM) (Fig. 2B) within the cell population, which paralleled
the effect of OXT on fluo4-AM intensity. The effect was
slower in onset than [Ca2!]i accumulation, with
NFATC1-EFP translocating to the nucleus within 5 min.
The NFATC1-EFP N:C ratio was maximal from 30 40
min and remained sustained for at least 70 min (Fig. 2B).
OXT-induced translocation of NFATC1-EFP to the
nucleus was inhibited by the OXTR antagonists atosiban
and L368899 (Fig. 3A) and by the calcineurin inhibitors
CyclA and FK506 (Fig. 3B). Pretreatment with the intra-
cellular Ca2! chelator BAPTA [1,2-bis(o-aminophe-
noxy)ethane-N,N,N",N"-tetraacetic acid]-AM or the use
of Ca2!-free PSS blocked NFATC1-EFP nuclear translo-
cation in response to OXT (Fig. 3C). The Ca2! ionophore
ionomycin also induced NFATC1-EFP nuclear localiza-
tion, the effect being suppressed by CyclA, FK506,
BAPTA-AM, and Ca2!-free media (Fig. 3, B and C) but
not inhibited by L36899 or atosiban.
Effect of pulsatile OXT on NFATC1-EFP nuclear
translocation
To investigate whether NFATC1-EFP nuclear translo-
cation is dependent on sustained OXTR occupancy or
triggered by the initial binding of OXT to its receptor, we
measured responses in the presence of brief or sustained
OXT exposure. Myometrial cells were treated with OXT
for 5 min followed by a repeated wash period to remove
the agonist (Fig. 4). Within the initial 5-min stimulation,
NFATC1-EFP translocated to the nucleus (35% of max-
imal response seen with sustained receptor occupancy).
After the wash, there was no additional increase in the
NFATC1-EFP N:C ratio, with the signal gradually declin-
ing toward baseline within 40 min. This shows that OXT-
induced nuclear translocation of NFATC1-EFP is revers-
ible and requires constant receptor occupancy for a
sustained signal. This reversibility raised the possibility
that pulsatile OXT treatment would, in turn, cause pul-
1748 Pont et al. Oxytocin-Induced NFAT Activation Mol Endocrinol, October 2012, 26(10):17431756

FIG. 2. OXT induces accumulation of [Ca2!]i and NFATC1-EFP nuclear translocation. Human myometrial cells were loaded with fluo4-AM (A) or
transduced with a NFATC1-EFP adenovirus (B) and stained with Hoechst nuclear stain before imaging. Cells were stimulated with OXT, in a
concentration-dependent manner at the concentration (molar) and time indicated. The concentration of OXT used (molar) is indicated by the
symbols, which apply to both A and B. The control (Ctrl) group was not stimulated with OXT. Live cell image acquisition and analysis was
performed as described in Materials and Methods. Representative images shown are before and after treatment with OXT (10'7 M). Scale bar, 60
#m. Data shown are fluo4 intensity (background subtracted) normalized to time zero (A) and NFATC1-EFP intensity (background subtracted) N:C
ratio (B), mean % SE, from three separate experiments and independent donors. Statistical analyses were performed by one-way ANOVA, with
Dunnetts post hoc test, which show statistical difference compared with the untreated control in terms of area under the curve in A and B, as
follows: for a concentration of OXT of 10'9 M, P $ 0.01, and for 10'8-10'6 M, P $ 0.001.

satile NFATC1-EFP translocation responses, so we exam- by five washes, over a time course of 3 h, at varying
ined the effect of repeated 5-min pulses of OXT on concentrations and pulse frequency. Each exposure to
NFATC1-EFP nuclear localization. Myometrial cells OXT caused a concentration-dependent translocation of
were subjected to 5-min stimulations with OXT, followed NFATC1-EFP to the nucleus, with similar kinetics, i.e.

FIG. 3. OXT-induced NFATC1-EFP nuclear translocation is inhibited by OXT antagonists, calcineurin inhibitors, and inhibition of Ca2! signaling. Human
myometrial cells were transduced with a NFATC1-EFP adenovirus before pretreatment with OXT antagonists atosiban (10'5 M) and L368899 (10'5 M)
(A), calcineurin inhibitors CyclA (10'6 M) and FK506 (10'6 M) (B), and the [Ca2!]i chelator BAPTA-AM (10'6 M) and replacement of PSS with Ca2!-free
solution (C) for 30 min. Cells were stimulated with OXT (10'7 M) or ionomycin (2 #M) for 60 min before terminating the reaction with ice-cold PBS, fixing
in 4% PFA, and staining with Hoechst. Fixed cell image acquisition and analysis were performed as described in Materials and Methods. Data shown are
NFATC1-EFP intensity (background subtracted) N:C ratio, mean % SE, from three separate experiments and independent donors. Statistical analyses were
performed by one-way ANOVA with Dunnetts post hoc test compared with the untreated control. *, P $ 0.01; **, P $ 0.001.
Mol Endocrinol, October 2012, 26(10):17431756
FIG. 4. OXT induction of NFATC1-EFP nuclear translocation is
reversible. Human myometrial cells were transduced with a NFATC1-
EFP adenovirus and stained with Hoechst nuclear stain before imaging.
Cells were stimulated with either sustained OXT (10'7 M) for 70 min,
or briefly, 5 min, followed by five washes (gray rectangle). The control
(Ctrl) group was not stimulated with OXT. Images were acquired at the
time points indicated. Data shown are NFATC1-EFP intensity
(background subtracted) N:C ratio, mean % S.E. from three separate
experiments and independent donors. Statistical analysis was by two
way ANOVA which demonstrated that brief vs. sustained stimulation
with OXT was a significant source of variation, P $ 0.01.
maximal response at 5 min, followed by a gradual decline
of NFATC1-EFP N:C after washing, despite the variance
in amplitude (Fig. 5A) and pulse frequency (Fig. 5, B and
C). Treatment of cells with a pulse of OXT every 30 min
resulted in the NFATC1-EFP signal not returning to base-
line between pulses, resulting in a cumulative effect (Fig.
5B). Furthermore, the areas under the curve of the
NFATC1-EFP N:C traces in response to sustained treat-
ment with OXT and pulsatile stimulation (30-min wash
periods) over a 3-h time course were of similar magnitude
(Fig. 5D).
OXT stimulates endogenous NFAT nuclear
translocation and transcriptional activity
Because OXT stimulated translocation of a NFATC1-
EFP reporter construct to the nucleus of myometrial cells,
we investigated the effect of OXT on endogenous NFAT
nuclear localization using a NFATC1 primary antibody.
A 30-min treatment with OXT (10'6 M) stimulated trans-
location of NFATC1 to the nucleus with CyclA inhibiting
the response (Fig. 6). NFATC1 nuclear translocation was
also induced by ionomycin [NFATC1 N:C ratio (fold
change): control, 1 % 0; ionomycin, 1.62 % 0.19; data not
shown].
To assess endogenous NFAT transcriptional activity,
myometrial cells were transduced with a NFAT response
element luciferase reporter (NFAT-RE-Luc). Cells were
then stimulated with a sustained concentration of OXT
for 6 h, which elicited a concentration- and time-depen-
mend.endojournals.org 1749
dent increase in NFAT-RE-Luc activity (EC50 & 84.6 %
0.24 nM) (Fig. 7, A and B). OXT-stimulated (10'7 M)
NFAT-RE luciferase activity was abolished after pretreat-
ment with the OXTR antagonist L368899 (10'5 M) and
with the calcineurin inhibitor CyclA (10'6 M), [luciferase
activity (fold induction): control, 1 % 0; OXT, 2 % 0.11;
L368889, 0.65 % 0.15; CyclA, 0.86 % 0.14; data not
shown].
The increase in NFAT-RE-Luc activity in response to
OXT led us to investigate the effect of OXT on transcrip-
tional activity. For this, we chose genes whose expression
was known to be either OXT dependent in the myome-
trium or NFAT dependent in other smooth muscle cells.
The genes selected for analysis were RGS2 (65) and pros-
taglandin-endoperoxide synthase 2 (PTGS2/COX2) (66)
(OXT dependent) and RCAN1 (67), coagulation factor II
(thrombin) receptor (F2R/PAR1) (68), and transient re-
ceptor potential cation channel, subfamily C, member 1
(TRPC1) (69) (NFAT dependent). COX2 expression has
also been shown to be NFAT dependent (67). Gene acti-
vation was measured by real-time PCR.
Exposure of myometrial cells to OXT increased
mRNA levels of RGS2, RCAN1, and COX2 (Fig. 8A).
The response was significant after 4 6 h of stimulation
with OXT, with a 2.5- to 4-fold increase in mRNA. Pre-
treatment with L368899 or CyclA prevented the increase
in mRNA (Fig. 8B), indicating that OXT-induced gene
expression is mediated through the OXTR and dependent
on the calcineurin-NFAT signaling pathway. OXT did
not influence expression of PAR1 or TRPC1 (data not
shown).
The effect of OXT on gene expression requires
both transcription and translation
Despite induction of RGS2 gene expression being me-
diated by the calcineurin-NFAT pathway, it has previ-
ously been reported that the RGS2 promoter does not
contain the NFAT consensus-binding motif (67), raising
the question whether OXT-induced activation of gene
expression may involve the synthesis of intermediary pro-
teins. To search for NFAT-binding motif expression in
the promoter regions of RGS2, RCAN1, and COX2, we
used the Meme Suite program as described in Materials
and Methods. The search identified NFAT-binding motifs
within the promoter regions of RCAN1 and COX2 but
did not identify the sequence within %2.5 kb of the RGS2
promoter. Therefore, we investigated the role protein
neosynthesis may play in OXT-induced gene expression.
Human myometrial cells were pretreated with the protein
synthesis inhibitor CX before stimulation with OXT. CX
alone did not influence RGS2 transcription but had a
tendency to increase transcription of RCAN1 and COX2.
1750 Pont et al. Oxytocin-Induced NFAT Activation Mol Endocrinol, October 2012, 26(10):17431756

phospholipase C-coupled GPCR, to in-

crease [Ca2!]i and activate Ca2! effec-
tor proteins, such as myosin light chain
kinase, to initiate myometrial contrac-
tions. In this study, we are interested in
the potential for other Ca2! effector
proteins (i.e. transcription factors such
as NFAT) to mediate longer-time ef-
fects of OXT on gene expression. We
focused on NFAT for two reasons:
first, NFAT is a Ca2!-dependent tran-
scription factor that regulates gene ex-
pression in other smooth muscle cells
(6770); second, NFAT activation is
known to be dependent on stimulus
pulse frequency in other systems (51,
55, 56), and therefore, NFAT may de-
code OXT pulse frequency. In this re-
port, we have defined NFAT isoform
expression in myometrial cells by
qPCR, monitored NFAT activation by
the OXTR with a NFATC1-EFP re-
porter, assessed endogenous NFAT ac-
tivity with an NFATC1 primary anti-
body and NFAT-RE-Luc construct,
FIG. 5. NFATC1-EFP nuclear translocation during pulsatile OXT treatment. Human and finally, used qPCR to investigate
myometrial cells were transduced with a NFATC1-EFP adenovirus and stained with Hoechst putative NFAT and OXT target genes
nuclear stain before imaging. AC, Cells were stimulated with either sustained or 5-min within the myometrium.
pulses of OXT at the indicated concentration (molar) (A) or at 10'7 M (B and C) and indicated
time points, followed by washes (five times) (gray rectangle). D, Histogram of area under the Myometrial cells in our cell culture
curves of NFATC1-EFP traces in B and C. Ctrl, Control; PF, pulse frequency. Live cell image system were characterized using pri-
acquisition and analysis were performed as described in Materials and Methods. Data shown mary antibodies raised toward the
are NFATC1-EFP intensity (background subtracted) N:C ratio, mean % SE, from at least three
separate experiments and independent donors. In A, the y-axis is offset for clarity so the
smooth muscle cell markers desmin,
traces are clearly distinguishable, the amplitude of the offset is as follows: 10'9, !0.5 N:C; actin, and calponin. Over 90% of all
10'8, !1 N:C; 10'7, !1.5 N:C. Statistical analysis was by two-way ANOVA with Bonferroni myometrial cells were positive for
post hoc test, which demonstrated that OXT concentration was a significant source of
desmin, actin, and calponin, indicating
variation at P $ 0.05 (A), and one-way ANOVA with Dunnetts post hoc test compared with
the untreated control: *, P $ 0.05; ** P $ 0.01 (D). that cell dispersion from myometrial
biopsies yielded a 90% pure myocyte
Joint stimulation with OXT and CX inhibited OXT-in- population. In addition, myometrial
duced RGS2 transcription but amplified the OXT-in- cells in our cell culture system have previously demon-
2!
duced transcriptional readouts for RCAN1 and COX2 strated robust phospholipase C and Ca signals in re-
(Fig. 9). These data indicate initiation of RGS2 transcrip- sponse to OXT (19, 57), thus indicating they retain their
tion is dependent on protein neosynthesis, whereas induc- functional responsiveness in culture and are a good model
tion of RCAN1 and COX2 transcription is protein neo- for investigating OXT-stimulated NFAT activation.
synthesis independent. This is the first description of NFAT isoforms in the
myometrium, defined by qPCR. mRNA for all known
NFAT isoforms (NFATC1C4 and -5) were expressed, in
Discussion contrast with arterial and ileal smooth muscle, which ex-
press only NFATC1, -C3, and -C4 (70) and NFATC3 and
OXT is a neuropeptide hormone that stimulates contrac- -C4 (64), respectively, indicating NFAT isoform expres-
tion of the pregnant uterus; it is involved in the augmen- sion is tissue specific.
tation and possibly the initiation of parturition and uter- Expression of NFAT isoforms in the myometrium led
otonic activity after delivery. OXT acts via the OXTR, a us to study the effect of Ca2! on NFAT activation by
Mol Endocrinol, October 2012, 26(10):17431756 mend.endojournals.org 1751

stimulated NFATC1-EFP nuclear lo-

calization with similar response kinet-
ics (data not shown), demonstrating
that translocation of NFATC1-EFP is
dependent on Ca2! entry as opposed to
other aspects of OXTR signaling.
GPCR activation and ionomycin have
previously been shown to stimulate nu-
clear translocation of NFATC1-EFP in
gonadotrophs and HeLa cells with sim-
ilar kinetics (51). However, in arteries
stimulated with endothelin NFATC3,
nuclear translocation is slower in onset
than in the myometrium, and nuclear
localization is not sustained (70),
whereas in the ileum, ionomycin failed
to induce NFATC3 nuclear transloca-
tion (64), indicating that NFAT activa-
tion is likely to be isoform, tissue, and
stimulus dependent.
FIG. 6. OXT-induced nuclear translocation of endogenous NFATC1. Human myometrial cells OXT-induced nuclear translocation
were stimulated with OXT (10'6 M) for 30 min or pretreated with CyclA (10'6 M) for 30 min
before stimulation with OXT. After stimulation, the reaction was terminated with ice-cold PBS
of NFATC1-EFP is mediated through
and fixed in 4% PFA. Immunocytochemistry was performed as described in Materials and the OXTR and calcineurin, as demon-
Methods. Images show myometrial cells stained with NFATC1 primary antibody. The control strated by inhibition of NFAT activity
(Ctrl) group was not stimulated with OXT. Images were acquired and analyzed as described in
by the OXT antagonists atosiban and
Materials and Methods. Images shown are representative of 2500 3000 cells. Scale bar, 60
#m. Data shown are NFATC1 N:C fold change over control group, mean % SE, from at least L368899 and the calcineurin inhibitors
three separate experiments and independent donors. Statistical analysis was by one-way CyclA and FK506. Furthermore, re-
ANOVA with Dunnetts post hoc test compared with the untreated control. *, P $ 0.01 moval of extracellular Ca2! and the
use of the [Ca2!]i chelator BAPTA-AM
using NFATC1-EFP, because translocation of this re- both abolished the NFATC1-EFP response, indicating
porter from the cytoplasm to the nucleus can provide a that Ca2! influx into the cell and elevation of [Ca2!]i is
live cell readout for NFAT activation (51), as opposed to necessary for the initiation of NFATC1-EFP nuclear
immunocytochemistry for endogenous NFAT, which re- translocation.
quires cell fixation. First, we demonstrated that OXT Because prolonged exposure of OXT to myometrial
2! 2!
stimulates accumulation of [Ca ]i using a fluo4 Ca cells induced sustained nuclear localization of NFATC1-
indicator with an EC50 in the low nanomolar range as EFP, we investigated whether NFATC1-EFP nuclear
previously described (19). The fluo4 response peaked translocation is dependent on constant receptor occu-
faster with high concentrations of OXT than at lower pancy or whether the initial binding of OXT to its recep-
concentrations; this delay could simply reflect the fact tor is sufficient to generate a sustained NFATC1-EFP re-
that augmenting the concentration of OXT increases the sponse. We found that washing off OXT after stimulation
rate at which OXT-sensitive intracellular stores are de- resulted in nuclear export of NFATC1-EFP, demonstrat-
pleted and Ca2! mobilized. ing that nuclear localization of NFATC1-EFP is revers-
To assess whether mobilization of Ca2! by activation ible. This is in concordance with previous work in other
of the OXTR induces an NFAT response myometrial cells systems that found sustained GPCR occupancy, and
were transduced with a NFATC1-EFP and stimulated [Ca2!]i elevation is required to maintain NFATC1-EFP
with OXT. We found that OXT stimulated NFATC1- localization in the nucleus (51, 55, 56).
EFP translocation to the nucleus with an EC50, similar to To assess the physiological importance of stimulus
2!
OXT-induced accumulation of [Ca ]i. NFATC1-EFP pulse frequency on NFATC1-EFP nuclear translocation,
translocation is far slower in onset than Ca2! mobiliza- we studied the effect of pulses of OXT on the NFATC1-
tion (within minutes rather than seconds), suggesting EFP N:C. We found that NFATC1-EFP N:C mirrored
there is a rate-limiting step between Ca2! release and OXT pulse frequency in a concentration-dependent man-
nuclear translocation of NFATC1-EFP. Ionomycin also ner, demonstrating a cumulative, sawtooth effect. This is
1752 Pont et al. Oxytocin-Induced NFAT Activation
FIG. 7. OXT induces transcriptional activity of endogenous NFAT.
Human myometrial cells were transduced with Ad-NFAT-RE-Luc and
Ad-!-Gal before sustained stimulation with OXT (10'6 M) for the
indicated time points (A) or in a concentration-dependent manner for
6 h (B). The control (Ctrl) group was not stimulated with OXT. After
stimulation, the reaction was terminated with ice-cold PBS before cell
lysis. Data shown are luciferase activity in luminescence units,
standardized to !-Gal activity, and normalized to control. Mean % SE is
displayed for at least three separate experiments and independent
donors. Statistical analyses were performed by one-way ANOVA with
Dunnetts post hoc test compared with time zero (A) or the untreated
control (B). *, P $ 0.05; **, P $ 0.01; ***, P $ 0.001.
in concordance with previous work that shows NFATC1-
EFP nuclear translocation in response to pulsatile GnRH
(51). OXT is released in pulses in vivo; therefore, it is
important that NFATC1-EFP is responsive to a pulsatile
OXT system, which highlights the physiological rele-
vance of NFATC1-EFP N:C being dependent on OXT
pulse frequency. Pulsatile systems are important for pre-
venting desensitization, signaling efficiency, and encod-
ing information. Within our system, there was no reduc-
tion in the amplitude of the NFATC1-EFP N:C ratio with
each pulse, indicating that NFATC1-EFP nuclear trans-
location is not desensitized within the conditions studied.
Furthermore, the amplitude of the NFATC1-EFP N:C
ratio with pulsatile OXT stimulation over 4 h was similar
to that with sustained treatment, suggesting a pulsatile
system is a more efficient mechanism of OXT-stimulated
NFATC1-EFP nuclear translocation than a sustained
stimulus (although this observation cannot be extended
Mol Endocrinol, October 2012, 26(10):17431756
and has not yet been tested in regard to OXT-induced
gene expression). Moreover it costs the cell less energy to
maintain high [Ca2!]i levels for repeated short intervals
than for a constant time period. Interestingly, pulsatile
administration of OXT is more efficient than constant
infusion for the induction/augmentation of labor in
women (8, 71).
OXT-stimulated nuclear translocation of the
NFATC1-EFP reporter construct led us to investigate the
role of OXT in inducing endogenous NFAT nuclear
translocation and transcriptional activity using a
NFATC1 primary antibody and NFAT-RE-Luc reporter,
respectively. OXT stimulated endogenous NFATC1 nu-
clear translocation with the effect being mediated by cal-
cineurin, indicating NFATC1-EFP nuclear translocation
can be extended to an endogenous mechanism. OXT also
induced a time- and concentration-dependent increase in
NFAT-RE-Luc activity, demonstrating that activation of
NFAT by OXT in myometrial cells results in a transcrip-
tional output.
We have also investigated whether OXT induces gene
expression through the calcineurin-NFAT pathway. We
have shown for the first time that OXT stimulates the
expression of the calcineurin inhibitory factor RCAN1 in
the myometrium. Moreover, we have confirmed that
OXT induces expression of RGS2 (a regulator of G pro-
tein signaling) and COX2 (an enzyme involved in pros-
taglandin synthesis) as previously shown in myometrial
cells (65, 66). The calcineurin inhibitor CyclA attenuated
OXT-induced expression of all three genes, demonstrat-
ing the importance of the calcineurin-NFAT signaling
pathway in mediating OXT-induced gene expression in
the myometrium. The physiological significance of OXT-
induced up-regulation of RGS2 and RCAN1 in myome-
trial cells is not established, but its likely to be important
for the negative regulation of OXT signaling; RGS2 un-
couples G protein-coupled receptor subunits (72), there-
fore controlling OXT signaling at the level of the OXTR.
RCAN1 inhibits calcineurin activity (73), thus inhibiting
NFAT-induced gene transcription in response to OXT.
On the other hand, the induction of COX2 by OXT
would result in production of prostaglandins and ampli-
fication of the parturition cascade (66). Prostaglandins
are uterotonic agonists that could work in synergy with
OXT to induce myometrial contractions at term; more-
over, they participate in cervical ripening, which would
facilitate a successful vaginal delivery (74).
Although the increase in RGS2 was found to be medi-
ated by calcineurin-NFAT, the absence of the NFAT con-
sensus-binding motif in the RGS2 promoter suggests that
NFAT itself is not directly responsible for enhancing
RGS2 gene expression, and there must be another inter-
Mol Endocrinol, October 2012, 26(10):17431756 mend.endojournals.org 1753

FIG. 8. OXT induces gene expression via a calcineurin-NFAT-dependent pathway. Human myometrial cells were stimulated with sustained OXT
(10'7 M) for the indicated time points (A) or pretreated with L368899 (10'5 M) or CyclA (10'6 M) for 30 min before treatment with sustained OXT
(10'7 M) for 4 h (B). The control (Ctrl) group was not stimulated with OXT. After stimulation, the reaction was terminated with ice-cold PBS before
RNA extraction and cDNA conversion. Real-time PCR was performed on cDNA to quantify mRNA of RGS2, RCAN1, and COX2. Data shown are
relative mRNA expression calculated by the Pfaffl method of analysis, standardized to the housekeeping genes 18S and RNA polymerase II and
normalized to time zero (A) or the untreated control (B). Mean % SE is displayed for at least three separate experiments from independent donors.
Statistical analyses were performed by one-way ANOVA with Dunnetts post hoc test compared with time zero or untreated control. *, P $ 0.05;
**, P $ 0.01.

mediary factor. To test this, we pretreated cells with CX
(an inhibitor of protein synthesis) before stimulation with
OXT. CX was found to completely inhibit OXT-induced
RGS2 gene transcription, suggesting that protein neosyn-
thesis is necessary for this mechanism of OXT action.
Because the calcineurin inhibitor CyclA inhibited Oxt in-
duced RGS2 gene expression independently, it is possible
that in OXT-stimulated cells NFAT participates in the tran-
scription of another transcription factor that, when trans-
lated into active protein, in turn induces RGS2 expression.

FIG. 9. The effect of inhibiting protein neosynthesis on OXT-induced gene expression. Human myometrial cells were stimulated with sustained
OXT (10'7 M) for 4 h, with or without pretreatment with CX (50 #M) for 30 min. After stimulation, the reaction was terminated with ice-cold PBS
before RNA extraction and cDNA conversion. Real-time PCR was performed on cDNA to quantify mRNA of RGS2, RCAN1, and COX2. Data shown
are relative mRNA expression calculated by the Pfaffl method of analysis, standardized to the housekeeping genes 18S and RNA polymerase II and
normalized to the untreated control. Mean % SE is displayed for at least three separate experiments from independent donors. Statistical analyses
by two-way ANOVA revealed OXT and CX to be significant sources of variation: RGS2, P $ 0.05 (OXT and CX); RCAN1, P $ 0.001 (OXT) and P $
0.01 (CX); COX2, P $ 0.001 (OXT and CX). The OXT-CX interaction was also found to be significant: RGS2, P $ 0.05; RCAN1, P $ 0.05; COX2,
P $ 0.01. Post hoc Bonferroni tests revealed statistical differences between treatment and control groups. *, P $ 0.05; **, P $ 0.01; ***, P $
0.001.
1754 Pont et al. Oxytocin-Induced NFAT Activation
In contrast, we have shown that CX does not inhibit
OXT-induced transcription of RCAN1 and COX2, indi-
cating this mechanism of OXT action is protein synthesis
independent. Instead, CX amplifies the effect of OXT
stimulation. A similar increase in transcription has also
been reported in fibroblasts pretreated with CX before
stimulation with TNF$ (75). Protein neosynthesis-depen-
dent negative feedback loops are often found in signaling
cascades; for example, ERK-mediated expression of dual-
specificity phosphatases (52, 76) and NF"B-mediated ex-
pression of nuclear factor of " light polypeptide gene en-
hancer in B-cells inhibitor $ (75), where the phosphatases
and I"B$ negatively regulate ERK and NF"B activity,
respectively. The same could be true of NFAT-mediated
expression of RCAN1 and COX2, where CX blocks pro-
tein synthesis, removing putative negative regulators of
NFAT signaling, thus increasing the transcriptional re-
sponse of NFAT target genes. These hypotheses need to
be tested in additional experiments.
We have identified a novel signaling pathway within
the myometrium, whereby OXT initiates NFAT signal-
ing, inducing transcriptional activity. These findings are
likely to be of physiological significance in the context of
parturition. Pregnant mice administered with the cal-
cineurin inhibitor FK506 experienced delayed labor (33);
thus, it is possible that OXT, through induction of the
calcineurin-NFAT pathway, is responsible for the regula-
tion of the initiation of labor. The transcriptional activity
stimulated by OXT in the myometrium could produce
factors involved in the initiation and maintenance of uter-
ine contraction, i.e. COX2 through the synthesis of pros-
taglandins, or regulatory factors such as RCAN1 and
RGS2. Identification of a wider array of OXT- and cal-
cineurin-NFAT-responsive genes in the myometrium will
provide insight into how parturition is initiated, enabling
development of therapies to prevent spontaneous prema-
ture labor.
In summary, we have shown that human myometrial
cells express the four Ca2!/calcineurin-sensitive NFAT
isoforms (NFATC1C4) as well as the Ca2!/calcineurin-
insensitive NFAT5. We demonstrate for the first time that
the OXTR mediates translocation of a NFATC1-EFP re-
porter from the cytoplasm to the nucleus and that this
mechanism is mediated by calcineurin. We also show how
NFATC1-EFP translocation kinetics can make signaling
more efficient with a pulsatile OXT signal in contrast to
sustained stimulation. Furthermore, we show that OXT
induces nuclear translocation of endogenous NFATC1
and stimulates endogenous NFAT-mediated activation of
a NFAT-Luc reporter. Moreover, we identify OXT tran-
scriptional induction of three calcineurin-NFAT-sensitive
genes (RGS2, RCAN1, and COX2) as well as providing
Mol Endocrinol, October 2012, 26(10):17431756
preliminary evidence for translation-dependent negative
feedback regulation of OXTR-mediated NFAT signaling.
The data provide novel insights into the role of OXT in
uterine function.
Acknowledgments
We thank Alison Kirby and staff at St. Michaels Hospital, Bris-
tol, UK, for the collection of myometrial tissue, Professor James
Uney for kindly donating the !-galactosidase adenovirus, and
Dr. Chris Helps for assistance in analysis of qPCR data.
Address all correspondence and requests for reprints to: Ja-
son N. A. Pont, Bristol University, School of Clinical Sciences,
Dorothy Hodgkin Building, Whitson Street, Bristol BS1 3NY,
United Kingdom. E-mail: jp5620@bris.ac.uk.
This work was supported by the BBSRC (Grant SG1525),
Wellcome Trust (Grant 083902/Z), and Action Medical Re-
search (Grant SP4612).
Disclosure Summary: The authors of this paper have nothing
to declare.
References
1. Beck S, Wojdyla D, Say L, Betran AP, Merialdi M, Requejo JH,
Rubens C, Menon R, Van Look PF 2010 The worldwide incidence
of preterm birth: a systematic review of maternal mortality and
morbidity. Bull World Health Organ 88:3138
2. Rush RW, Keirse MJ, Howat P, Baum JD, Anderson AB, Turnbull
AC 1976 Contribution of preterm delivery to perinatal mortality.
Br Med J 2:965968
3. Goldenberg RL, Culhane JF, Iams JD, Romero R 2008 Epidemiol-
ogy and causes of preterm birth. Lancet 371:75 84
4. Moutquin JM 2003 Classification and heterogeneity of preterm
birth. BJOG 110(Suppl 20):30 33
5. Lpez Bernal A, Europe-Finner GN, Phaneuf S, Watson SP 1995
Preterm labour: a pharmacological challenge. Trends Pharmacol Sci
16:129 133
6. Muglia LJ, Katz M 2010 The enigma of spontaneous preterm birth.
N Engl J Med 362:529 535
7. Fuchs AR, Romero R, Keefe D, Parra M, Oyarzun E, Behnke E
1991 Oxytocin secretion and human parturition: pulse frequency
and duration increase during spontaneous labor in women. Am J
Obstet Gynecol 165:15151523
8. Tribe RM, Crawshaw SE, Seed P, Shennan AH, Baker PN 2012
Pulsatile versus continuous administration of oxytocin for induc-
tion and augmentation of labor: two randomized controlled trials.
Am J Obstetrics Gynecol 206:230 e231238
9. Turnbull AC, Anderson AB 1968 Induction of labour. II. Intrave-
nous oxytocin infusion. J Obstetrics Gynaecol Brit Commonwealth
75:24 31
10. Nishimori K, Young LJ, Guo Q, Wang Z, Insel TR, Matzuk MM
1996 Oxytocin is required for nursing but is not essential for par-
turition or reproductive behavior. Proc Natl Acad Sci USA 93:
11699 11704
11. Young 3rd WS, Shepard E, Amico J, Hennighausen L, Wagner KU,
LaMarca ME, McKinney C, Ginns EI 1996 Deficiency in mouse
oxytocin prevents milk ejection, but not fertility or parturition.
J Neuroendocrinol 8:847 853
12. Kimura T, Takemura M, Nomura S, Nobunaga T, Kubota Y, Inoue
Mol Endocrinol, October 2012, 26(10):17431756
T, Hashimoto K, Kumazawa I, Ito Y, Ohashi K, Koyama M, Azuma
C, Kitamura Y, Saji F 1996 Expression of oxytocin receptor in
human pregnant myometrium. Endocrinology 137:780 785
13. Phaneuf S, Rodrguez Liares B, TambyRaja RL, MacKenzie IZ,
Lpez Bernal A 2000 Loss of myometrial oxytocin receptors during
oxytocin-induced and oxytocin-augmented labour. J Reprod Fertil
120:9197
14. Kuwabara Y, Takeda S, Mizuno M, Sakamoto S 1987 Oxytocin
levels in maternal and fetal plasma, amniotic fluid, and neonatal
plasma and urine. Arch Gynecol Obstet 241:1323
15. Blanks AM, Vatish M, Allen MJ, Ladds G, de Wit NC, Slater DM,
Thornton S 2003 Paracrine oxytocin and estradiol demonstrate a
spatial increase in human intrauterine tissues with labor. J Clin
Endocrinol Metab 88:33923400
16. Chibbar R, Miller FD, Mitchell BF 1993 Synthesis of oxytocin in
amnion, chorion, and decidua may influence the timing of human
parturition. J Clin Invest 91:185192
17. Chibbar R, Wong S, Miller FD, Mitchell BF 1995 Estrogen stimu-
lates oxytocin gene expression in human chorio-decidua. J Clin
Endocrinol Metab 80:567572
18. Phaneuf S, Europe-Finner GN, Carrasco MP, Hamilton CH, Lpez
Bernal A 1995 Oxytocin signaling in human myometrium. Adv Exp
Med Biol 395:453 467
19. Phaneuf S, Carrasco MP, Europe-Finner GN, Hamilton CH, Lpez
Bernal A 1996 Multiple G proteins and phospholipase C isoforms
in human myometrial cells: implication for oxytocin action. J Clin
Endocrinol Metab 81:2098 2103
20. Arthur P, Taggart MJ, Mitchell BF 2007 Oxytocin and parturition:
a role for increased myometrial calcium and calcium sensitization?
Front Biosci 12:619 633
21. Lpez Bernal A, Rivera J, Europe-Finner GN, Phaneuf S, Asbth G
1995 Parturition: activation of stimulatory pathways or loss of
uterine quiescence? Adv Exp Med Biol 395:435 451
22. Word RA, Stull JT, Casey ML, Kamm KE 1993 Contractile ele-
ments and myosin light chain phosphorylation in myometrial tissue
from nonpregnant and pregnant women. J Clin Invest 92:29 37
23. Shaw JP, Utz PJ, Durand DB, Toole JJ, Emmel EA, Crabtree GR
1988 Identification of a putative regulator of early T cell activation
genes. Science 241:202205
24. Musar A, McCullagh KJ, Naya FJ, Olson EN, Rosenthal N 1999
IGF-1 induces skeletal myocyte hypertrophy through calcineurin in
association with GATA-2 and NF-ATc1. Nature 400:581585
25. Bai S, Kerppola TK 2011 Opposing roles of FoxP1 and Nfat3 in
transcriptional control of cardiomyocyte hypertrophy. Mol Cell
Biol 31:3068 3080
26. Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Rob-
bins J, Grant SR, Olson EN 1998 A calcineurin-dependent tran-
scriptional pathway for cardiac hypertrophy. Cell 93:215228
27. Delling U, Tureckova J, Lim HW, De Windt LJ, Rotwein P, Molk-
entin JD 2000 A calcineurin-NFATc3-dependent pathway regu-
lates skeletal muscle differentiation and slow myosin heavy-chain
expression. Mol Cell Biol 20:6600 6611
28. Horsley V, Friday BB, Matteson S, Kegley KM, Gephart J, Pavlath
GK 2001 Regulation of the growth of multinucleated muscle cells
by an NFATC2-dependent pathway. J Cell Biol 153:329 338
29. Ranger AM, Grusby MJ, Hodge MR, Gravallese EM, de la Brousse
FC, Hoey T, Mickanin C, Baldwin HS, Glimcher LH 1998 The
transcription factor NF-ATc is essential for cardiac valve forma-
tion. Nature 392:186 190
30. Graef IA, Chen F, Chen L, Kuo A, Crabtree GR 2001 Signals trans-
duced by Ca2!/calcineurin and NFATc3/c4 pattern the developing
vasculature. Cell 105:863 875
31. Guo X, Zhou C, Sun N 2011 The neuropeptide catestatin promotes
vascular smooth muscle cell proliferation through the Ca2!-cal-
cineurin-NFAT signaling pathway. Biochem Biophys Res Commun
407:807 812
32. Zeini M, Hang CT, Lehrer-Graiwer J, Dao T, Zhou B, Chang CP
mend.endojournals.org 1755
2009 Spatial and temporal regulation of coronary vessel formation
by calcineurin-NFAT signaling. Development 136:33353345
33. Tabata C, Ogita K, Sato K, Nakamura H, Qing Z, Negoro H,
Kumasawa K, Temma-Asano K, Tsutsui T, Nishimori K, Kimura T
2009 Calcineurin/NFAT pathway: a novel regulator of parturition.
Am J Reprod Immunol 62:44 50
34. McCaffrey PG, Luo C, Kerppola TK, Jain J, Badalian TM, Ho AM,
Burgeon E, Lane WS, Lambert JN, Curran T, et al 1993 Isolation of
the cyclosporin-sensitive T cell transcription factor NFATp. Science
262:750 754
35. Northrop JP, Ho SN, Chen L, Thomas DJ, Timmerman LA, Nolan
GP, Admon A, Crabtree GR 1994 NF-AT components define a
family of transcription factors targeted in T-cell activation. Nature
369:497502
36. Hoey T, Sun YL, Williamson K, Xu X 1995 Isolation of two new
members of the NF-AT gene family and functional characterization
of the NF-AT proteins. Immunity 2:461 472
37. Ho SN, Thomas DJ, Timmerman LA, Li X, Francke U, Crabtree
GR 1995 NFATc3, a lymphoid-specific NFATc family member that
is calcium-regulated and exhibits distinct DNA binding specificity.
J Biol Chem 270:19898 19907
38. Masuda ES, Naito Y, Tokumitsu H, Campbell D, Saito F, Hannum
C, Arai K, Arai N 1995 NFATx, a novel member of the nuclear
factor of activated T cells family that is expressed predominantly in
the thymus. Mol Cell Biol 15:26972706
39. Lopez-Rodrguez C, Aramburu J, Rakeman AS, Rao A 1999
NFAT5, a constitutively nuclear NFAT protein that does not coop-
erate with Fos and Jun. Proc Natl Acad Sci USA 96:7214 7219
40. Miyakawa H, Woo SK, Dahl SC, Handler JS, Kwon HM 1999
Tonicity-responsive enhancer binding protein, a rel-like protein
that stimulates transcription in response to hypertonicity. Proc Natl
Acad Sci USA 96:2538 2542
41. Rao A, Luo C, Hogan PG 1997 Transcription factors of the NFAT
family: regulation and function. Annu Rev Immunol 15:707747
42. Okamura H, Aramburu J, Garca-Rodrguez C, Viola JP, Raghavan
A, Tahiliani M, Zhang X, Qin J, Hogan PG, Rao A 2000 Concerted
dephosphorylation of the transcription factor NFAT1 induces a
conformational switch that regulates transcriptional activity. Mo-
lecular cell 6:539 550
43. Shibasaki F, Price ER, Milan D, McKeon F 1996 Role of kinases
and the phosphatase calcineurin in the nuclear shuttling of tran-
scription factor NF-AT4. Nature 382:370 373
44. Akazawa H, Komuro I 2003 Roles of cardiac transcription factors
in cardiac hypertrophy. Circ Res 92:1079 1088
45. Macin F, Lpez-Rodrguez C, Rao A 2001 Partners in transcrip-
tion: NFAT and AP-1. Oncogene 20:2476 2489
46. Chow CW, Rincn M, Cavanagh J, Dickens M, Davis RJ 1997
Nuclear accumulation of NFAT4 opposed by the JNK signal trans-
duction pathway. Science 278:1638 1641
47. Gomez MF, Bosc LV, Stevenson AS, Wilkerson MK, Hill-Eubanks
DC, Nelson MT 2003 Constitutively elevated nuclear export activ-
ity opposes Ca2!-dependent NFATc3 nuclear accumulation in vas-
cular smooth muscle: role of JNK2 and Crm-1. J Biol Chem 278:
46847 46853
48. Rinne A, Banach K, Blatter LA 2009 Regulation of nuclear factor of
activated T cells (NFAT) in vascular endothelial cells. J Mol Cell
Cardiol 47:400 410
49. Kehlenbach RH, Dickmanns A, Gerace L 1998 Nucleocytoplasmic
shuttling factors including Ran and CRM1 mediate nuclear export
of NFAT In vitro. J Cell Biol 141:863 874
50. Wathes DC, Lamming GE 1995 The oxytocin receptor, luteolysis
and the maintenance of pregnancy. J Reprod Fertil Supplement
49:53 67
51. Armstrong SP, Caunt CJ, Fowkes RC, Tsaneva-Atanasova K,
McArdle CA 2009 Pulsatile and sustained gonadotropin-releasing
hormone (GnRH) receptor signaling: does the Ca2!/NFAT signal-
1756 Pont et al. Oxytocin-Induced NFAT Activation
ing pathway decode GnRH pulse frequency? J Biol Chem 284:
35746 35757
52. Armstrong SP, Caunt CJ, Fowkes RC, Tsaneva-Atanasova K,
McArdle CA 2010 Pulsatile and sustained gonadotropin-releasing
hormone (GnRH) receptor signaling: does the ERK signaling path-
way decode GnRH pulse frequency? J Biol Chem 285:24360
24371
53. Smith MP, Ayad VJ, Mundell SJ, McArdle CA, Kelly E, Lpez
Bernal A 2006 Internalization and desensitization of the oxytocin
receptor is inhibited by Dynamin and clathrin mutants in human
embryonic kidney 293 cells. Mol Endocrinol 20:379 388
54. Sundseth SS, Alberta JA, Waxman DJ 1992 Sex-specific, growth
hormone-regulated transcription of the cytochrome P450 2C11
and 2C12 genes. J Biol Chem 267:39073914
55. Dolmetsch RE, Lewis RS, Goodnow CC, Healy JI 1997 Differential
activation of transcription factors induced by Ca2! response am-
plitude and duration. Nature 386:855 858
56. Tomida T, Hirose K, Takizawa A, Shibasaki F, Iino M 2003 NFAT
functions as a working memory of Ca2! signals in decoding Ca2!
oscillation. EMBO J 22:38253832
57. Phaneuf S, Europe-Finner GN, Varney M, MacKenzie IZ, Watson
SP, Lpez Bernal A 1993 Oxytocin-stimulated phosphoinositide
hydrolysis in human myometrial cells: involvement of pertussis tox-
in-sensitive and -insensitive G-proteins. J Endocrinol 136:497509
58. Caunt CJ, Armstrong SP, Rivers CA, Norman MR, McArdle CA
2008 Spatiotemporal regulation of ERK2 by dual specificity phos-
phatases. J Biol Chem 283:2661226623
59. Pfaffl MW 2001 A new mathematical model for relative quantifi-
cation in real-time RT-PCR. Nucleic Acids Res 29:e45
60. Peeters D, Peters IR, Helps CR, Gabriel A, Day MJ, Clercx C 2007
Distinct tissue cytokine and chemokine mRNA expression in canine
sino-nasal aspergillosis and idiopathic lymphoplasmacytic rhinitis.
Vet Immunol Immunopathol 117:95105
61. Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L,
Ren J, Li WW, Noble WS 2009 MEME SUITE: tools for motif
discovery and searching. Nucleic Acids Res 37:W202W208
62. Grant CE, Bailey TL, Noble WS 2011 FIMO: scanning for occur-
rences of a given motif. Bioinformatics 27:10171018
63. Gomez MF, Stevenson AS, Bonev AD, Hill-Eubanks DC, Nelson
MT 2002 Opposing actions of inositol 1,4,5-trisphosphate and
ryanodine receptors on nuclear factor of activated T-cells regula-
tion in smooth muscle. J Biol Chem 277:37756 37764
64. Stevenson AS, Gomez MF, Hill-Eubanks DC, Nelson MT 2001
Mol Endocrinol, October 2012, 26(10):17431756
NFAT4 movement in native smooth muscle. A role for differential
Ca2! signaling. J Biol Chem 276:15018 15024
65. Park ES, Echetebu CO, Soloff S, Soloff MS 2002 Oxytocin stimu-
lation of RGS2 mRNA expression in cultured human myometrial
cells. Am J Physiol Endocrinol Metab 282:E580 E584
66. Molnr M, Rig Jr J, Romero R, Hertelendy F 1999 Oxytocin
activates mitogen-activated protein kinase and up-regulates cyclo-
oxygenase-2 and prostaglandin production in human myometrial
cells. Am J Obstet Gynecol 181:42 49
67. Lee MY, Garvey SM, Baras AS, Lemmon JA, Gomez MF, Schoppee
Bortz PD, Daum G, LeBoeuf RC, Wamhoff BR 2010 Integrative
genomics identifies DSCR1 (RCAN1) as a novel NFAT-dependent
mediator of phenotypic modulation in vascular smooth muscle
cells. Hum Mol Genet 19:468 479
68. Rosenkranz AC, Rauch BH, Freidel K, Schrr K 2009 Regulation of
protease-activated receptor-1 by vasodilatory prostaglandins via
NFAT. Cardiovasc Res 83:778 784
69. Morales S, Diez A, Puyet A, Camello PJ, Camello-Almaraz C, Bau-
tista JM, Pozo MJ 2007 Calcium controls smooth muscle TRPC
gene transcription via the CaMK/calcineurin-dependent pathways.
Am J Physiol Cell Physiol 292:C553C563
70. Nilsson LM, Sun ZW, Nilsson J, Nordstrm I, Chen YW, Molken-
tin JD, Wide-Swensson D, Hellstrand P, Lydrup ML, Gomez MF
2007 Novel blocker of NFAT activation inhibits IL-6 production in
human myometrial arteries and reduces vascular smooth muscle
cell proliferation. Am J Physiol Cell Physiol 292:C1167C1178
71. Dawood MY 1995 Novel approach to oxytocin induction-augmen-
tation of labor. Application of oxytocin physiology during preg-
nancy. Adv Exp Med Biol 395:585594
72. Hepler JR 1999 Emerging roles for RGS proteins in cell signaling.
Trends Pharmacol Sci 20:376 382
73. Fuentes JJ, Genesc L, Kingsbury TJ, Cunningham KW, Prez-Riba
M, Estivill X, de la Luna S 2000 DSCR1, overexpressed in Down
syndrome, is an inhibitor of calcineurin-mediated signaling path-
ways. Hum Mol Genet 9:16811690
74. Mackenzie IZ 2006 Induction of labour at the start of the new
millennium. Reproduction 131:989 998
75. Sung MH, Salvatore L, De Lorenzi R, Indrawan A, Pasparakis M,
Hager GL, Bianchi ME, Agresti A 2009 Sustained oscillations of
NF-"B produce distinct genome scanning and gene expression pro-
files. PloS one 4:e7163
76. Zhang T, Roberson MS 2006 Role of MAP kinase phosphatases in
GnRH-dependent activation of MAP kinases. J Mol Endocrinol
36:4150