J Phytopathol

SHORT COMMUNICATION

First Report of Peronospora belbahrii on Sweet Basil in Baja

California Sur, Mexico
Mirella Romero Bastidas1, Liliana Saucedo Picazo2, Bernardo Murillo Amador1, Alejandra Nieto Garibay1,
Hever Latisnere Barragan1 and Luis G. Hernandez Montiel1
1 Centro de Investigaciones Biologicas del Noroeste, Calle Instituto Politecnico Nacional 195, Col. Playa Palo de Santa Rita Sur, 23096 La Paz, Baja
California Sur, Mexico
2 Facultad de Ciencias Agrcolas, Universidad Veracruzana, Circuito Universitario Gonzalo Aguirre Beltran s/n, Zona Universitaria, 91090 Xalapa,
Veracruz, Mexico

Keywords Abstract
Basil downy mildew, Ocimum basilicum,
Peronospora belbahrii In Baja California Sur, Mexico, a foliar disease occurred on sweet basil
which seriously affected its quality and yield. The most common symp-
Correspondence toms were yellowing and necrosis on leaves, caused by a downy myce-
L.G. Hernandez Montiel, Centro de lium growth on the lower leaf surface. Symptomatic leaves from two
Investigaciones Biologicas del Noroeste, sampling sites were collected for morphological studies and molecular
La Paz, Mexico.
analysis of pathogen DNA. Based on morphological characteristics
E-mail: lhernandez@cibnor.mx
(sporangiophore size of 240530 9 711 lm, branches of 58 order and a
Received: January 15, 2015; accepted: March sporangia size of 2731 9 2125 lm) and molecular analysis (the Gen-
16, 2015. Bank blast of the PCR assays showed unique rDNA sequence data with
99% similarity to P. belbahrii), the pathogen was identified as Peronospora
doi: 10.1111/jph.12391 belbahrii, the causal agent of basil downy mildew. This is the first report of
P. belbahrii affecting sweet basil in Mexico.

which under certain environmental conditions (15

Introduction
Sweet basil (Ocimum basilicum L., Family: Lamiaceae)
worldwide is an aromatic herb of major economic
importance. It is a rich source of essential oils, which
makes it attractive for culinary use, perfumery and
aromatherapy products (Wyenandt et al. 2010). The
leaves have a higher content of secondary metabolites
such as terpenes and phenylpropanoids which are
responsible for the distinctive aroma of the plant
(Viuda-Martos et al. 2011). Currently, there are
approximately 150 species of sweet basil distributed
worldwide (Sajjadi 2006) with high demand from
international markets, such as the US and the Euro-
pean Union. In Baja California Sur, Mexico, the pro-
duction of sweet basil is approximately 1900 t with a
retail value of $1 966 711 USD at the end of 2013
cycle, with the var. Nuffar, the main sweet basil
grown in the state (SAGARPA 2014).
In the past 6 years, the yield and quality of sweet
basil have been seriously affected due to the presence
of a foliar disease caused by a species of Peronospora,
27C and 70% RH) can cause chlorosis on leaves
particularly near the central vein. Within few days, a
grey downy growth becomes evident on the lower
side of leaves resulting in necrosis. These symptoms
are related to Peronospora belbahrii, the causal agent of
basil downy mildew (Belbahri et al. 2005; Garibaldi
et al. 2007). Currently, in Mexico, there are no
reports of P. belbahrii affecting sweet basil. Therefore,
the objective of this study was to identify the causal
agent of downy mildew on this aromatic herb grown
in Baja California Sur, Mexico, by morphological
studies and molecular techniques.
Materials and Methods
Sampling and isolation
Sweet basil plants were collected in the Municipality
of La Paz, Baja California Sur, Mexico, at two
sites (Los Planes: 23960 69 N, 109930 61 W; El
Pescadero: 23210 51 N, 110100 06 W). Leaves

122 J Phytopathol 164 (2016) 122124 2015 Blackwell Verlag GmbH

M. R. Bastidas et al.
(a)
Fig. 1 Peronospora spp. on sweet basil plants. (a) crop of sweet basil var. Nuffar in El Pescadero, Baja California Sur, Mexico; (b) diseased leaves with
chlorotic lesions, (c) grey to black coloured sporangiophores emerging out of stomata on the abaxial leaf surface of basil leaf.
showing chlorotic and necrotic symptoms with downy
mycelium growth were collected from 30 plants per
sampling site (Fig. 1ac).
Morphological identification
Spores of the phytopathogen were scraped from basil
leaves and transferred to microscope slides and
mounted in lactophenol for microscopic evaluation.
Morphological characteristics of the samples were
scrutinized as described by Thines et al. (2009) using
a compound light microscope (Eclipse E 200-LED,
Nikon, Konan, Tokyo, Japan). The micrographs were
prepared from five samples from each site and two
electron micrographs were taken of each sample (a
total 10 photographs per site) by scanning using the
electron microscope (S-3000N, Hitachi, Tokyo,
Japan). The samples were fixed by immersion (2.5%
v/v glutaraldehyde in phosphate buffer, 0.1 M, pH 7)
for 24 h using the modified protocol of Caires et al.
(2014).
(a)
Fig. 2 Micrograph of Peronospora belbahrii.
(a) typically branched sporangiophores (com-
pound light microscope); (b) ellipsoidal sporan-
gia (scanning electron microscope).
J Phytopathol 164 (2016) 122124 2015 Blackwell Verlag GmbH
Basil downy mildew on sweet basil
(b) (c)
Molecular identification
Spores on the surface of leaves per sample site
were isolated with a microbiological loop and pre-
served in a saline solution (NaCl2 0.85%) until
DNA extraction. A volume of 200 ll (containing
about 1500 spores) was collected and transferred to
a 1.7-ml tube and centrifuged at 3578 g for DNA
extraction. Total genomic DNA was extracted by
phenolchloroform and ethanol precipitation as
described by Sambrook and Russell (2001) by
mechanical maceration with glass beads (0.2 lm)
and vortex at maximum speed. In addition, enzy-
matic digestion with chitinase and Proteinase K was
performed. The DNA samples were run in a 1%
agarose gel, stained with GelRed and visualized
with UV light. The DNA samples were quantified
by spectrophotometry in a NanoDrop (Thermo
Fisher Scientific, Waltham, MA, USA), and the
samples were diluted to 20 ng/ll. The ITS and 5.8S
regions were amplified by PCR using universal
(b)
123
Basil downy mildew on sweet basil
primers ITS-5 (50 GGAAGTAAAAGTCGTAACAAGG
30 ) and ITS-4 (50 TCCTCCGCTTATTGATATGC 30 )
(White et al. 1990). The PCR protocol was per-
formed as follows: the reaction mix (25 ll) con-
sisted of 19 PCR Buffer, 1.5 mM of MgCl2, 1 lM of
each primer, 0.2 mM of dNTPs, 1 ll of DNA and
0.04 U/ll of Platinum Taq Polymerase. PCR amplifi-
cation was performed in the Applied Biosystems
Veriti 96-well thermal cycler (Applied Biosystems,
Foster City, CA, USA) with following cycle parame-
ters: initial denaturation at 94C for 5 min, 35
cycles at 94C for 1 min, at 55C for 50 s, 72C for
1 min and a final cycle of 72C for 10 min. All the
positive PCR products were purified with QIAquick
PCR purification kit and sent for sequencing to
GENEWIZ (USA). The ITS and 5.8S rDNA regions
of each sample were compared to sequences from
type strains held in GenBank DNA database using
BLAST (Altschul et al. 1990).
Results and Discussion
Based on microscopic observations, the morphologi-
cal characteristics of the pathogens isolated from
symptomatic basil leaves collected from two different
sampling sites corresponded to those of Peronospora
spp. Sporangiophore size varied between 240 to
530 9 7 and 11 lm, branched dichotomically
between 5 and 8 orders (Fig. 2a). The sporangia were
brown, ellipsoidal subglobose or ellipsoid with a size
of 27 to 31 9 21 to 25 lm, with a length/width ratio
of 1.121.29. Based on the morphological character-
istics proposed by Thines et al. (2009), the pathogen
was identified as Peronospora belbahrii in the two sam-
pling sites. The micrographs included the typical
structures of sporangia of P. belbahrii (Fig. 2b).
In PCR assays, the DNA of all applied samples could
be amplified and sequenced. The DNA was found to
be always the same sequence. The ITS and 5.8S rDNA
sequences were about 850 bp. The GenBank blast of
unique sequence data showed 99% similarity to
P. belbhrii (Accession no. HQ730979). Based on symp-
toms of the host, morphological characteristics and
molecular data, the pathogen was identified as Pero-
nospora belbahrii for both sampling sites. This globally
important pathogen can cause losses of nearly 100%
in sweet basil production (Wyenandt et al. 2010;
Nagy and Horvath 2011). In Baja California Sur, Mex-
ico, this is the first report of the presence of Peronos-
pora belbahrii, the causal agent of downy mildew in
sweet basil.
124
M. R. Bastidas et al.
Acknowledgements
We thank CONACyT (Consejo Nacional de Ciencia y
Tecnolog a, Grant 183700, Mexico) for the financial
support provided to M. Romero Bastidas. We also
thank M. Aguilar Garc a and E. Daz Rivera for their
excellent technical assistance and M. Cordoba Matson
for provided final editorial services.
References
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ.
(1990) Basic local alignment search tool. J Mol Biol
215:403410.
Belbahri L, Calmin G, Pawlowski J, Lefort F. (2005) Phylo-
genetic analysis and real time PCR detection of a pre-
sumably undescribed Peronospora species on sweet basil
and sage. Mycol Res 109:12761287.
Caires PN, Rodrigues FA, Furtado Q. (2014) Infection pro-
cess of Botrytis cinerea on Eucalypt leaves. J Phytopathol.
doi:10.1111/jph.12360.
Garibaldi A, Bertetti D, Gullino ML. (2007) Effect of leaf
wetness duration and temperature on infection of
downy mildew (Peronospora sp.) of basil. J Plant Dis
Protect 114:68.
Nagy G, Horvath A. (2011) Occurrence of downy mildew
caused by Peronospora belbahrii on sweet basil in Hun-
gary. Plant Dis 95:1034.
SAGARPA. (2014) Secretaria de Agricultura, Ganader a,
Desarrollo Rural, Pesca y Alimentario Servicio de In-
formacion Agroalimentaria y Pesquera (SIAP), Mexico.
Sajjadi SE. (2006) Analysis of the essential oils of two culti-
vated basil (Ocimum basilicum L.) from Iran. Daru
14:128130.
Sambrook J, Russell DW. (2001) Molecular cloning. A lab-
oratory manual, Vol 1. CSHL, Plymounth, 2100p.
Thines M, Telle S, Ploch S, Runge F. (2009) Identity of the
downy mildew pathogens of basil, coleus, and sage with
implications for quarantine measures. Mycol Res
113:532540.
Viuda-Martos M, Ru iz-Navajas Y, Fernandez-Lopez J,
Perez-A lvarez JA. (2011) Spices as functional foods. Crit
Rev Food Sci 51:1328.
White TJ, Bruns TD, Lee SB, Taylor JW. (1990) Amplifica-
tion and direct sequencing of fungal ribosomal RNA
genes for phylogenetics. In: Innis MA, Gelfand DH,
Sninsky JJ, White TJ. (eds) PCR protocols: A Guide to
Methods and Applications. New York, Academic Press,
pp 315322.
Wyenandt CA, Simon JE, Mcgrath MT, Ward L. (2010)
Susceptibility of basil cultivars and breeding lines to
downy mildew (Peronospora belbahrii). HortScience
45:14161419.
J Phytopathol 164 (2016) 122124 2015 Blackwell Verlag GmbH