Gene & Chromosomal mutation

Chicken

Genetics Exam 1, F2009

90
78
80
70 62
60
50
38
40 Series1
30 22
20
10 6

0
A's B's C's D F

Chicken??? New York State Fair Genetics Display

Scientific American, October 2005, Vol. 293 (4) pp.78-85

Mutations can be divided into three Genetic variation
main types:
allele
- One of the different forms of a
1. Single-gene mutations
Relatively small changes in DNA structure that
gene that exist at a single locus.
occur within a particular gene (promoter or locus - location of the gene on a
transcriptional unit) chromosome
2. Chromosome mutations Where do different alleles come from?
Changes in chromosome structure recombination of functional gene
3. Genome mutations domains and gene mutation (base
Changes in chromosome number
deletions, additions, or substitutions)
mutate - to change

Gene mutation terms Think: Mutation and Nature

wild-type (wt): designated standard According to evolutionary theory, all genes
(either in nature or lab) are mutant genes, we arbitrarily name
forward mutation - any change away certain alleles as wt. Genes must mutate
from wt to evolve!
reverse mutation - any change back Todays mutation is tomorrows allele
to the wt allele Mutation is the foundation of the diversity
also called reversion or back mutation found in nature and agriculture.
Remember the chickens

IGF1 allele is the major determinate of small size

in dogs
What causes gene mutations?
 Gene Mutations Change the DNA Sequence Gene Mutations Change the DNA Sequence

A point mutation is a change in a single base pair Mutations may also involve the addition or deletion
It involves a base substitution of short sequences of DNA

5 AACGCTAGATC 3 5 AACGCGAGATC 3 5 AACGCTAGATC 3 5 AACGCTC 3

3 TTGCGATCTAG 5 3 TTGCGCTCTAG 5 3 TTGCGATCTAG 5 3 TTGCGAG 5
Deletion of four base pairs
A transition is a change of a pyrimidine (C, T) to
another pyrimidine or a purine (A, G) to another purine
5 AACGCTAGATC 3 5 AACAGTCGCTAGATC 3
A transversion is a change of a pyrimidine to a purine or 3 TTGCGATCTAG 5 3 TTGTCAGCGATCTAG 5
vice versa
Addition of four base pairs
Transitions are more common than transversions

Movie - nonsense mutation

Movie - supressor mutation Movie - example DNA repair

 Movie - slippage mutation Mutations Due to Trinucleotide Repeats

Several human genetic diseases are caused by an

unusual form of mutation called trinucleotide repeat
expansion (TNRE)
The term refers to the phenomenon that a sequence of 3
nucleotides can increase from one generation to the next

These diseases include

Huntington disease (HD)
Fragile X syndrome (FRAXA)

Certain regions of the chromosome contain
trinucleotide sequences repeated in tandem
In normal individuals, these sequences are transmitted
from parent to offspring without mutation
However, in persons with TNRE disorders, the length of a
trinucleotide repeat increases above a certain critical size
It also becomes prone to frequent expansion
This phenomenon is shown here with the trinucleotide repeat CAG
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
n = 11
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
n = 18
In some cases, the expansion is within the coding
sequence of the gene
Typically the trinucleotide expansion is CAG (glutamine)
Therefore, the encoded protein will contain long tracks of
glutamine
This causes the proteins to aggregate with each other
This aggregation is correlated with the progression of the disease
In other cases, the expansions are located in
noncoding regions of genes
These expansions are hypothesized to cause abnormal
changes in RNA structure
Thereby producing disease symptoms

There are two particularly unusual features that

TNRE disorders have in common Mutation induction
1. The severity of the disease tends to worsen in future
generations What is the leading cause of gene
This phenomenon is called anticipation mutation?
2. The severity of the disease depends on whether it is
DNA replication
inherited from the father or mother (paternal imprinting)
In Huntington disease, the TNRE is more likely to occur if inherited Inherent inaccuracy
from the father evolved to be inaccurate?
In myotonic muscular dystrophy, the TNRE is more likely to occur if
inherited from the mother advantageous to viruses (flu, Aids, etc.)
therefore,cancers occur more often in
The DNA cause of TNRE is not well understood quickly dividing cells
TNREs may produce alterations in DNA structure (such as skin, lungs, digestive tract, mammary glands,
stem-loops), thereby leading to errors in DNA replication liver, reproductive organs
Mutation Rates and Frequencies Mutation Rates and Frequencies
mutation rate - likelihood that a gene will be altered Within the same individual, some genes mutate at a
by a new mutation much higher rate than other genes
expressed as the number of new mutations in a given gene
per generation Some genes are larger than others
This provides a greater chance for mutation
range of 10-5 to 10-9 per generation
Some genes have locations within the chromosome that
mutation rate for a given gene is not constant
make them more susceptible to mutation
It can be increased by the presence of mutagens These are termed hot spots

Mutation rates vary substantially between species Note: Hot spots can be also found within a single gene
and even within different strains of the same species

Mutation Rates and Frequencies

The mutation frequency for a given gene is the
number of mutant forms of this gene divided by the
total number of these genes in a population
If 1 million bacteria were plated and 10 were mutant
The mutation frequency would be 1 in 100,000 or 10-5

Contain many mutations

at exactly the same site
within the gene

Mutation Rates and Frequencies Gene mutation

The mutation frequency for a gene is the number of mutant genes
divided by the total number of genes in a population
mutation rate - likelihood that a gene will be altered by a new mutation Two classes (in multi-celled eukaryotes)
expressed as the number of new mutations in a given gene per somatic mutation
generation
mutation in vegetative cells, therefore
Achondroplasia and hypochondroplasia. Comments on frequency,
usually not passed on to next
mutation rate, and radiological features in skull and spine, by F generation.
Oberklaid, DM Danks, F Jensen, L Stace and S Rosshandler involved in aging & cancers
An attempt was made to ascertain all the dwarfs in the State of
Victoria. The incidence of achondroplasia proved to be approximately germinal mutation
1 in 26,000 live births in the period 1969 to 1975 when ascertainment source of new alleles which can be
was nearly complete. This indicates a mutation rate of 1.93 X 10(-5)
per generation in this locus. Paternal age was shown to influence
passed on to the next generation
mutation.
 Mutant types:
The size of the patch loss-of-function mutations
will depend on the
timing of the mutation
The earlier the mutation,
null or leaky
the larger the patch
usually recessive or incomplete
An individual who has
dominant
somatic regions that are
genotypically different
from each other is called
gain-of-function mutations (rare)
a genetic mosaic
Therefore, the
usually dominant or codominant
mutation can be
passed on to future
generations
Therefore, the mutation cannot be
passed on to future generations silent mutations
no phenotypic change, only genotypic
change (some exceptions)

Silent mutations Most of our produce are mutants

Ruby red grapefruit
arose as a spontaneous mutant in 1926
loss-of-function mutation - enzyme that
coverts red pigment to colorless pigment
Texas red grapefruit (Rio Red)
radiation breeding, 1988
Over 2000 crop varieties were
developed by radiation mutation

Mutation and Cancer  Mutation and Cancer

(oncogene/suppressor model) (note: DNA damage can range from point mutation to sequence

deletions, insertions, sequence or gene duplications, etc.)
cancer is caused by somatic cell mutations
gene or chromosome mutations
most cancer cells must:
gain rapid cell division (forms a tumor)
gain a new blood supply
gain ability to move and invade other tissues
(metastasis)
all are normal developmental functions caused by
proto-oncogenes
Turn on cell growth & division
controlled by tumor suppressor genes
Suppress cell growth & division
 Mutation and Cancer Mutation and Cancer
(note: DNA damage can range from point mutation to sequence (note: DNA damage can range from point mutation to sequence

deletions, insertions, sequence or gene duplications, etc.)
deletions, insertions, sequence or gene duplications, etc.)

Mutation and Cancer Mutation and Cancer

(note: DNA damage can range from point mutation to sequence (note: DNA damage can range from point mutation to sequence

deletions, insertions, sequence or gene duplications, etc.)
deletions, insertions, sequence or gene duplications, etc.)

Predisposition for Cancer Predisposition for Cancer

 Gene mutations that help lead to cancer Min. number of mutations
Oncogenes
Tumor suppressors Retinoblastoma: 2 mutations
Mutator genes usually in children
Genes involved with DNA repair if mutated
allow higher levels of mutation in general colon cancer: 4-5 mutations
Telomerase genes usually in adults
If mutated to turn on when it should be turned small-cell lung cancer: 10-15 mutations
off, could lead to immortal cells (i.e. unlimited
cell division) usually in adults with high exposure to
mutagens, i.e. smokers

Smokers lungs

Mutations Can Alter

Chromosome Structure
(Chromosome mutations)

Deficiency (or deletion)

Human
The loss of a chromosomal segment chromosome 1

Duplication
The repetition of a chromosomal segment compared to
the normal parent chromosome
Inversion
A change in the direction of the genetic material along a
single chromosome Human
chromosome 21
Translocation
A segment of one chromosome becomes attached to a
different chromosome
Simple translocations
One way transfer
Reciprocal translocations
Two way transfer
 Regulatory sequences

Changes in Chromosome Structure are often bidirectional

Can Affect Gene Expression

Can cause a break in a gene
gene may be left intact, but its expression altered
because of its new location
This is termed a position effect
1. Movement next to regulatory sequences

2. Movement to a heterochromatic region

Chromosomal rearrangements Lysozyme

duplications
may or may not produce changes in the
phenotype
if not detrimental, provides an opportunity
for gene evolution without the loss of the
original gene product
example: lysozyme
degrades the cell wall of bacteria
normally found in the tears of mammals

Lysozyme Lysozyme - gene duplication

Lysozyme - gene duplication Lysozyme - gene duplication

Changes (mutation) in 
chromosome number Euploids (multiples of X)
Terms: 1x - monoploid
monoploid number (X) - number of sets male bees, wasps, and ants
of chromosomes (# genomes) artificially derived plants
No duplicated or homologous 2x - diploid
chromosomes in a set
3x - triploid
can be different than haploid number (n) polyploids
- the number found in gametes 4x - tetraploid
Examples: 5x - pentaploid
human: 46 chromosomes (2n = 2x) 6x - hexaploid
wheat: 42 chromosomes (2n = 6x)

Polyploids (>2x) Genetic

modification
(1n but 2X)
two types of wheat
autopolyploids - multiple (2n but 4X)
Many Brassica species
chromosome sets from one species rutabaga
allopolyploids - chromosome sets oil rape
mustards
from different species (1n but 3X)
chromosome sets must be
homeologous (2n but 6X)
partially homologous which allows pairing
example: Triticale (wheat x rye)
Triploids Polyploidy in animals
result from a cross of a tetraploid (4x) much more rare than in plants
with a diploid (2x) examples: flatworms, leeches, brine
sterile due to problems with pairing shrimp, some amphibians, and some
during meiosis fish
example: bananas (no developed Salmonidae (Salmon and trout)
seeds!) thought to be polyploids because
example 2: seedless watermelon they contain twice as much DNA that
other odd number of chromosome
closely related fish
sets will give similar results

Aneuploidy Aneuploidy
chromosome number differs from causedby nondisjunction during
wt by part of a chromosomal set meioses or mitosis
(not euploid) disjunction is the normal separation of
nomenclature: chromosomes to opposite poles during
2n-1 = monosomic nuclear division
2n+1 = trisomic homologs in meiosis or sister
2n-2 = nullisomic chromatids in mitosis failing to separate
n+1 = disomic (in haploids)
generally deleterious

Aneuploidy - human disease Aneuploidy - human disease

Down syndrome - trisomic (2n+1)
chances of nondisjunction increases
extra copy of autosome #21
most common human aneuploid
with age
1:600-700 of all births Example: Down syndrome
multiple phenotypes (vary): mother age 20 - 1:2,300
mental retardation mother age 30 - 1:1,200
broad flat face
mother age 40 - 1:100
short stature
heart problems mother age 45 - 1:46
etc.
 Downs syndrome

5% of cases linked to nondisjunction

in father
Mothers age more important
eggs resting - incomplete meiosis
meiosis completed only after conception

Most aneuploids
die before birth Somatic Aneuploids
occur during mitosis in early
development
mosaics called gynandromorphs
example: Io Moth (1/2 male, 1/2 female)