Inhibition of pathogen-induced apoptosis by
a Coxiella burnetii type IV effector protein
Anja Lhrmanna,b,1, Catarina V. Nogueiraa,c,1, Kimberly L. Careya, and Craig R. Roya,2
a
Section of Microbial Pathogenesis, Yale University School of Medicine, New Haven, CT 06536; bMicrobiology Institute, University Clinic Erlangen, Friedrich-
Alexander University of Erlangen-Nuremberg, 91054 Erlangen, Germany; and cGraduate Program in Areas of Basic and Applied Biology, Instituto de Cincias
Biomedicas Dr. Abel Salazar, Universidade do Porto, 4099-003 Porto, Portugal
Edited by Ralph R. Isberg, Tufts University School of Medicine, Boston, MA, and approved September 21, 2010 (received for review April 1, 2010)
Coxiella burnetii and Legionella pneumophila are evolutionarily re-
lated pathogens with different intracellular infection strategies.
C. burnetii persists within and is transmitted by mammalian hosts,
whereas, L. pneumophila is found primarily in the environment
associated with protozoan hosts. Although a type IV secretion sys-
tem encoded by the defect in organelle trafcking (dot) and intra-
cellular multiplication (icm) genes is a virulence determinant that
remains highly conserved in both bacteria, the two pathogens en-
code a different array of effector proteins that are delivered into
host cells by the Dot/Icm machinery. This difference suggests that
adaptations to evolutionarily distinct hosts may be reected in the
effector protein repertoires displayed by these two pathogens.
Here we provide evidence in support of this hypothesis. We show
that a unique C. burnetii effector from the ankyrin repeat (Ank)
family called AnkG interferes with the mammalian apoptosis path-
way. AnkG was found to interact with the host protein gC1qR
(p32). Either the addition of AnkG to the repertoire of L. pneumo-
phila effector proteins or the silencing of p32 in mouse dendritic
cells resulted in a gain of function that allowed intracellular repli-
cation of L. pneumophila in these normally restrictive mammalian
host cells by preventing rapid pathogen-induced apoptosis. These
data indicate that p32 regulates pathogen-induced apoptosis and
that AnkG functions to block this pathway. Thus, emergence of an
effector protein that interferes with a proapoptotic signaling path-
way directed against intracellular bacteria correlates with adap-
tation of a pathogen to mammalian hosts.
|
Legionella pneumophila ankyrin repeat proteins | gC1qR (p32) |
|
type IV secretion pyroptosis
T he bacterial pathogen Legionella pneumophila replicates in-
side protozoan hosts in soil and freshwater ecosystems (1). A
type IV secretion apparatus encoded by the defect in organelle
trafcking (dot) and intracellular multiplication (icm) genes is an
essential virulence determinant used by L. pneumophila to deliver
bacterial effector proteins into the eukaryotic cell (2, 3). The Dot/
Icm effectors delivered into host cells by L. pneumophila play an
important role in modulating host vesicular transport processes to
facilitate the biogenesis of a vacuole that enables intracellular
replication (4).
Although human infections sometimes can result in a severe
pneumonia known as Legionnaires disease (5), under most
conditions aerosolized L. pneumophila that gain access to the lungs
of a mammalian host are detected and cleared without signs of
clinical disease, indicating that the mammalian immune system
can recognize this pathogen efciently and mount a response that
limits replication (6). One mechanism used by mammalian hosts to
limit replication of L. pneumophila is to initiate a cell-death re-
sponse shortly after intracellular infection. Mouse dendritic cells
have been shown to block intracellular replication of L. pneumo-
phila by rapidly activating a mitochondrial-dependent apoptosis
pathway (7). Mouse macrophages and dendritic cells can in-
dependently restrict intracellular replication of L. pneumophila by
sensing agellin through the host sensors nucleotide-binding do-
main, leucine-rich repeat containing protein (NLR) family, caspase
www.pnas.org/cgi/doi/10.1073/pnas.1004380107
recruitment domains (CARD) domain-containing 4 (NLRC4) and
NLR family apoptosis inhibitory protein 5 (Naip5) (8), which acti-
vate caspase-1 and trigger a form of cell death called pyroptosis
(911). Activation of pyroptosis and apoptosis by L. pneumophila
is observed only when cells are infected with bacteria having a func-
tional Dot/Icm system, indicating that mammalian cells respond to
the activities controlled by this secretion apparatus.
Coxiella burnetii is an intracellular pathogen of mammalian
hosts that causes an acute disease, Q-fever. Phylogenetic analysis
of rRNA sequences revealed that C. burnetii is evolutionarily re-
lated to L. pneumophila (12), and the families Legionellaceae and
Coxiellaceae now comprise the order Legionellales. The genome
sequence of C. burnetii conrmed this phylogenetic relationship
and revealed that C. burnetii encodes a Dot/Icm apparatus that is
similar in sequence and function to the Dot/Icm apparatus in
L. pneumophila (13). More than 150 genes have been identied in
L. pneumophila that encode effector proteins translocated into
host cells by the Dot/Icm system (2, 3). Although some of the
predicted C. burnetii effectors contain sequence motifs that are
found in L. pneumophila effectors, there does not appear to be
signicant overlap in the repertoires of the Dot/Icm effectors in
the genomes of these two organisms (1316). This lack of overlap
suggests that different selective pressures applied by their natural
hosts may have shaped the repertoire of effector proteins in
each pathogen.
C. burnetii has a robust ability to interfere with apoptosis upon
infection of mammalian cells (17, 18), distinguishing it from
L. pneumophila. If changes in the type IV effector repertoire are
shaped in part by pathogen adaptations to new hosts, it is possible
that C. burnetii might encode effectors that play a specic role in
preventing apoptosis in mammalian cells. The only C. burnetii
proteins that have been demonstrated to be delivered into host
cells by the Dot/Icm system are those belonging to the Ankyrin
repeat (Ank) family of effectors containing ankyrin repeat ho-
mology domains (ARHDs) (19, 20). The role and function of
MICROBIOLOGY
these effectors during bacterial infection remain unknown. Thus,
in an effort to determine whether C. burnetii has acquired effec-
tors with a potent ability to prevent cell death, we decided to test
whether any of the Ank proteins might have the capacity to
block apoptosis.
Results
AnkG Is an Effector That Interferes with Apoptosis. To determine
if any of the C. burnetii Ank proteins shown previously to
be translocated into host cells by the Dot/Icm system might be
Author contributions: A.L., C.V.N., K.L.C., and C.R.R. designed research; A.L., C.V.N., and
K.L.C. performed research; A.L., C.V.N., K.L.C., and C.R.R. analyzed data; and A.L., C.V.N.,
and C.R.R. wrote the paper.
The authors declare no conict of interest.
This article is a PNAS Direct Submission.
1
A.L. and C.V.N. contributed equally to this work.
2
To whom correspondence should be addressed: E-mail: craig.roy@yale.edu.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.
1073/pnas.1004380107/-/DCSupplemental.
PNAS | November 2, 2010 | vol. 107 | no. 44 | 1899719001
sufcient to interfere with host-cell apoptosis, we ectopically A
produced these proteins in CHO cells and measured apoptosis 40
B
35 Lysate IP (-GFP)
after stimulation with the proapoptotic agent staurosporine. Nu-

% fragmented nuclei
30 + + HA-AnkGFL
clear morphology visualized by DAPI staining revealed that the + + HA-AnkG92-157
25 + + HA-AnkG1-69
expression of GFP-AnkG protected cells from staurosporine- 20 * + + HA-AnkG70-339
induced apoptosis (Fig. 1A). Conversely, expression of other 15 * *
+ + + + + + + + GFP-p32
kDa
C. burnetii Ank proteins was not sufcient to interfere with apo- 10 37
26
ptosis when compared with the expression of GFP alone (Fig. 1A). 5 -HA
19
These results suggest that AnkG is a C. burnetii effector protein 14

39

39
7
oc

-6
15
that interferes with the apoptosis pathway.

-3
m

1
1-

2-

kG

70
kG

9
64 -GFP

kG
An
To understand how the AnkG protein prevents apoptosis, host

kG
An

An
An
proteins that interact with AnkG were identied by afnity
chromatography (Fig. S1). The identity of host proteins that as- C 35
sociated with AnkG, and not with GST alone, was determined by

% fragmented nuclei
30
mass spectrometry and validated by coimmunoprecipitation 25
studies. Testing interactions between GFP-tagged AnkG and 20
15
*
candidate host proteins tagged with HA validated a complex 10
containing AnkG and gC1qR (p32) (Fig. S1). The host protein 5
p32 was found to interact with AnkG and not with other C. bur- _
+
_
+
_
+ UV
netii Ank proteins tested (Fig. 1B). An interaction between GFP- mock p32 control siRNA
AnkG and endogenous p32 was also detected (Fig. 1C). Thus, the
Fig. 2. The AnkG antiapoptotic domain mediates binding to the pro-
binding of p32 to AnkG is specic, and p32 binding is not a gen-
apoptotic protein p32. (A) CHO cells ectopically expressing the indicated HA-
eral property displayed by C. burnetii Ank proteins. tagged truncations of AnkG were incubated with staurosporine. The cells
were stained with DAPI and HA-specic antibody. The nuclear morphology
Inhibition of Apoptosis Correlates with AnkG Binding p32. Trunca- of HA-expressing cells was scored as in Fig.1A. *P < 0.003. (B) HEK 293 cells
tion derivatives were used to identify the amino acid regions in were cotransfected with plasmids encoding GFP-tagged p32 and the in-
AnkG required for inhibition of apoptosis. The production of dicated HA-tagged truncations of AnkG. Proteins were precipitated from the
HA-AnkG inhibited staurosporine-induced apoptosis (Fig. 2A), cell lysates with an anti-GFP antibody. Immunoblot analysis was used to
conrming the antiapoptotic activity observed for GFP-AnkG. detect p32 (-GFP) and AnkG (-HA) in the lysates and immunoprecipitates
The HA-AnkG92157 protein inhibited staurosporine-induced (IP). (C) HeLa cells transfected with control siRNA (control), with p32 siRNA
(p32), or untransfected (mock) were exposed to UV light as indicated. The
apoptosis, indicating that the ARHDs encoded in the deleted re-
cells were stained with DAPI, and nuclear morphology was scored. The
gion were not essential for the antiapoptotic activity of AnkG percentage of cells with apoptotic nuclear morphology was calculated. One
hundred nuclei per sample from three independent experiments were
counted. *P < 0.006.

A 65
%fragmented nuclei

60
55 (Fig. 2A). Production of HA-AnkG169 was sufcient to interfere
50 with apoptosis, and production of HA-AnkG70339 did not in-
45 * terfere with apoptosis (Fig. 2A). Similar deletion derivatives were
40 used to identify the p32-interacting region in AnkG. Coprecipi-
35 tation of HA-p32 was observed with GFP-AnkG1339, GFP-
AnkG92157, and GFP-AnkG169 but not with AnkG70339 (Fig.
FP

2B). Thus, the amino terminal AnkG169 region encodes a domain

nk
nk

nk

nk
G

-A
-A

-A

-A
FP
FP

FP

FP

that is both necessary and sufcient for inhibition of apoptosis and

G
G

Lysate IP
p32 interaction.
B C
32

32
32

32
32

32

Reducing the levels of p32 in mammalian cells has been shown

+p

+p
+p

+p
+p

+p
kG

kG
kA

kA
kF

kF

to make them more resistant to apoptosis (21, 22), suggesting

kG

G
An

An

An

An

An

An

kDa kDa
An

An

that p32 has a proapoptotic activity. Consistent with these data,

P-

P-
P

49
GF

GF

GF

GF

64
49
-GFP -HA
Fig. 1. AnkG interferes with apoptosis and binds the host protein p32. (A) CHO
cells ectopically expressing GFP or the indicated GFP-tagged C. burnetii Anks
were incubated with staurosporine. The nuclei were stained with DAPI, and
nuclei of GFP-expressing cells were scored for fragmentation. One hundred
nuclei from GFP-expressing cells per sample from four independent experi-
ments were counted. *P < 0.001. (B) HEK 293 cells were cotransfected with
plasmids encoding HA-tagged p32 and the indicated GFP-tagged C. burnetii
ankyrin repeat-containing proteins. Proteins were precipitated from the cell
lysates with an anti-GFP antibody and analyzed by immunoblot. The -GFP blot
shows Ank protein levels in the immunoprecipitate (IP), and the -HA blot
shows p32 levels in the immunoprecipitate (IP) and lysate. (C) HEK 293 cells
were transfected with a plasmid encoding GFP-AnkG or the GFP control. Pro-
teins were precipitated from the cell lysates with an anti-GFP antibody, and
endogenous p32 was analyzed by immunoblotting with an anti-p32 antibody.
kDa when p32 levels were reduced using siRNA (Fig. S2) and cells
IP 37 were exposed to UV light, apoptosis was diminished in the si-
37 lenced cells (Fig. 2C). Taken together, these data suggest that
IP: -GFP
WB: -p32
AnkG may interfere with p32-dependent activities important for
Lysate activating apoptosis.
Translocated AnkG Interferes with Pathogen-Induced Apoptosis. Al-
though AnkG was able to interfere with apoptosis when over-
produced in mammalian cell lines, it remained to be determined
whether delivery of the native AnkG protein by the Dot/Icm
system was sufcient to interfere with apoptosis during bacterial
infection. Because the construction of an isogenic C. burnetii
ankG mutant is not feasible, a gain-of-function analysis was con-
ducted to determine if L. pneumophila producing AnkG could
prevent apoptosis. Staurosporine-induced apoptosis was reduced
signicantly in CHO-FcR cells infected with L. pneumophila that
produced the C. burnetii AnkG protein, whereas the majority of
cells infected with L. pneumophila containing vector alone or con-
taining vector producing the control C. burnetii AnkB protein

18998 | www.pnas.org/cgi/doi/10.1073/pnas.1004380107 Lhrmann et al.

 B the intracellular replication of L. pneumophila (7). If translocated
% Infected DCs TUNEL+
A 70
60
% TUNEL+ cells
50
40 * licate in DCs from wild-type mice. Consistent with this hypothesis,
30
20
10
pJV400 AnkG AnkB
C flaA + pJV400 flaA + AnkB
D flaA + AnkG1-69 flaA + AnkG70-339
Fig. 3. Translocation of AnkG prevents rapid pathogen-induced apoptosis,
allowing L. pneumophila replication in DCs. (A) CHO-FcR cells infected with
L. pneumophila harboring the vector pJV400, pJV400-AnkB (AnkB), or
pJV400-AnkG (AnkG) were incubated with staurosporine. L. pneumophila
was stained with a specic anti-Legionella antibody, and the nuclei were
scored by the TUNEL assay. The nuclei of at least 100 infected cells per
sample from three independent experiments were counted. *P < 0.01. (B)
Bone marrow DCs derived from B6 mice were infected for 6 h with
L. pneumophila aA expressing the pJV400 vector, AnkG, or AnkB or with
L. pneumophila dotA expressing AnkG. L. pneumophila was stained
with a specic anti-Legionella antibody, and the nuclei of infected cells were
scored by the TUNEL assay. Data shown are the mean SD of 300 cells
counted per each coverslip in triplicate and are representative of two in-
dependent experiments. **P < 0.01. (C and D) Representative uorescence
micrographs of B6 DCs infected with (C) L. pneumophila aA + pJV400,
aA + AnkB, or aA + AnkG and (D) L. pneumophila aA expressing
AnkG169 or AnkG70339 or L. pneumophila dotA expressing full-length
AnkG. DCs were xed at 10 h postinfection and were stained with an anti-
body specic for MHC class II (red), DAPI (blue), and an anti-Legionella an-
tibody (green).
showed signs of apoptosis, as determined by TUNEL staining (Fig.
3A). Thus, translocated AnkG is sufcient to block staurosporine-
induced apoptosis in immortalized CHO FcR cells.
L. pneumophila infection causes rapid apoptosis in mouse bone
marrow-derived dendritic cells (DCs), and this pathogen-induced
event limits the capacity of L. pneumophila to replicate in these
cells (7). We reasoned that if the AnkG protein was a type IV
effector with the ability to limit pathogen-induced apoptosis, then
the addition of AnkG to the repertoire of L. pneumophila effector
proteins might enable this pathogen to block apoptosis following
infection of primary mouse DCs. A agellin-decient (aA)
strain of L. pneumophila was used to avoid activating the caspase-
1dependent pyroptosis pathway of cell death regulated by the
host sensors Naip5 and NLRC4. Approximately 50% of the DCs
infected for 6 h with L. pneumophila aA containing vector alone
(pJV400) had apoptotic nuclei as determined by TUNEL staining,
whereas that percentage decreased signicantly, to roughly 10%,
in DCs infected with the isogenic L. pneumophila aA strain
encoding AnkG (graphs in Fig. 3B and images in Fig. S3). Bac-
terial uptake was not affected by the addition of AnkG (Fig. S3),
suggesting that the AnkG delivered by the L. pneumophila Dot/
Icm system is able to disrupt pathogen-induced apoptosis in DCs.
DCs obtained from mice that have genetic alterations that in-
terfere with induction of apoptosis have been shown to support
Lhrmann et al.
60
AnkG were sufcient to limit pathogen-induced apoptosis, then
50
40
L. pneumophila producing AnkG should gain the ability to rep-
30
large vacuoles harboring replicating bacteria were abundant in
20
** DCs infected with L. pneumophila aA producing AnkG but not
10
** in DCs infected with L. pneumophila aA with vector alone or
with a vector encoding AnkB from C. burnetii (images in Fig. 3C
flaA+ flaA+ flaA+ dotA+
pJV400 AnkG AnkB AnkG and graphs in Fig. S3). Bcl-2associated X (Bax) and BCL2-
antagonist/killer (Bak) are host pore-forming proteins that regu-
flaA + AnkG late cytochrome c release from mitochondria and are required for
induction of pathogen-induced apoptosis (7, 23). Replication of
L. pneumophila producing AnkG was not enhanced in DCs de-
cient in Bax and Bak compared with control DCs (Fig. S3),
suggesting that these proteins are in the same pathway. This ep-
istatic relationship supports a genetic interaction between AnkG
and host proapoptotic regulatory factors.
dotA+ AnkG Truncation derivatives of AnkG were used to map the region
required for inhibition of pathogen-induced apoptosis. Using
adenylate cyclase toxin fusion proteins to measure protein delivery
into the cytosol, we determined that both truncation derivatives
AnkG169 and AnkG70339 were translocated into mammalian
cells by the L. pneumophila Dot/Icm apparatus (Fig. S4). Rep-
lication in DCs was observed for L. pneumophila producing
AnkG169 but not for L. pneumophila producing AnkG70339
(images in Fig. 3D and graphs in Fig. S3). Thus, the p32-interacting
region of AnkG is both necessary and sufcient for inhibition of
pathogen-induced apoptosis.
Pathogen-Induced Apoptosis Is Regulated by p32. Our results sug-
gest that AnkG prevents pathogen-induced apoptosis by in-
terfering with p32 function and thus predict that p32 would be
required for restriction of L. pneumophila replication in mouse
DCs. To test this hypothesis, p32 protein levels were reduced in
mouse DCs using siRNA (Fig. S5). Pathogen-induced apoptosis
was reduced in p32-silenced DCs infected with L. pneumophila
aA to levels similar to those observed for L. pneumophila aA
producing AnkG and the Dot/Icm-decient mutant (dotA) (Fig.
4A). Bacterial uptake was unaffected by DCs after silencing of
p32 (Fig. S5). Importantly, the blocking of pathogen-induced
apoptosis resulting from p32 silencing was sufcient to allow
replication of L. pneumophila aA in mouse DCs (graphs in Fig.
4B and images in Fig. S5). The ability of L. pneumophila aA to
replicate in DCs and the associated defects in pathogen-induced
apoptosis that resulted from silencing of p32 with a siRNA pool
also were observed using individual siRNAs directed against
nonoverlapping regions of the transcript encoding p32 (Fig. S5),
MICROBIOLOGY
indicating that these effects are specic to the silencing of p32.
Last, it was determined that wild-type L. pneumophila expressing
agellin were unable to replicate in DCs after p32 silencing, in-
dicating that p32 is not important for the pyroptotic cell death
pathway controlled by Naip5 and NLRC4 (Fig. 4C). Thus, p32
plays a critical role in the pathogen-induced apoptosis pathway
resulting from L. pneumophila infection.
Discussion
In addition to having a well-dened and critical role in de-
velopment, apoptosis is emerging as an important innate immune
response that enables cells damaged by either infectious agents
or noninfectious pathological conditions to be cleared from the
body. Although many intracellular pathogens inhibit apoptosis to
enhance their intracellular survival and replication, the mecha-
nisms that are used to interfere with apoptosis are not well un-
derstood. C. burnetii, the etiological agent of the human disease Q
fever, was found to inhibit induction of apoptosis by targeting
pathways upstream of cytochrome c release (17, 18). Although
bacterial protein synthesis was shown to be required for inhibition
of apoptosis, C. burnetii protein(s) involved in this process were
PNAS | November 2, 2010 | vol. 107 | no. 44 | 18999
 A DCs B DCs C wt
60 DCs mock DCs mock 20 flaA

% Infected apoptotic DCs

% Infected DCs with R.V.

DCs + p32 siRNA 40 DCs + p32 siRNA

% Infected DCs with R.V.

15
40 30

10
20
20
10 5

N.D. N.D. N.D.

flaA flaA + dotA flaA flaA + dotA mock p32 siRNA
AnkG AnkG

Fig. 4. Rapid pathogen-induced apoptosis in DCs requires p32 function. (A) DCs untreated, treated with siRNA against p32, or mock treated were infected
with L. pneumophila aA, aA expressing AnkG, or dotA. L. pneumophila were stained with a specic anti-Legionella antibody, and the nuclei of infected
cells were scored using DAPI staining. Data shown are from one experiment representative of ve independent experiments that yielded similar results. n =
200 MHC class II-positive DCs. (B) DCs untreated (black bars), treated with siRNA against p32 (white bars), or mock treated (gray bars) were infected with
L. pneumophila aA, aA expressing AnkG, or dotA. Vacuoles containing replicating bacteria at 10 h postinfection were counted. Data shown are from
one representative experiment representative of ve independent experiments that yielded similar results. n = 200 MHC class II-positive DCs. N.D., vacuoles
containing replicating bacteria were not detectable; R.V., vacuoles containing replicating bacteria. (C) DCs treated with p32 siRNA (Right) or mock treated
(Left) were infected with L. pneumophila aA or with L. pneumophila WT. Vacuoles containing replicating bacteria at 10 h postinfection were counted. Data
are shown from one experiment representative of two independent experiments that yielded similar results. n = 200 MHC class II-positive DCs.

not identied, and the mechanism by which they might function
remained unknown. Here, we show that AnkG, a C. burnetii
protein demonstrated to be a substrate of the Dot/Icm type IV
secretion system (19, 20), had an activity that interfered with the
induction of apoptosis.
The AnkG protein has a calculated mass of 39 kDa and is
predicted to contain two ARHDs. Deletion derivatives revealed
that the amino terminal 69 amino acids of AnkG, which did not
contain either of the predicted ARHDs, were both necessary and
sufcient for the antiapoptotic activity of this C. burnetii protein.
This region of the AnkG protein was found to bind specically to
the mammalian protein p32. Thus, both the antiapoptotic activity
and the p32-binding activity were localized to this amino terminal
region in AnkG. The specicity of AnkG binding to p32 and the
correlation between the region involved in p32 binding and in-
hibition of apoptosis strongly suggested that AnkG targeting of
p32 could explain the mechanism by which AnkG interferes with
host-cell apoptosis.
It has been speculated that p32 may participate in the regula-
tion of apoptosis (24). Previous studies have shown that silencing
of p32 reduced cisplatin-, harakiri-, and p14ARF-p16INK4a locus-
induced apoptosis (21, 22, 25). Similarly, we found that p32 si-
lencing conferred protection against UV-induced apoptosis. Our
data also indicate that p32 may play a physiologically important
role in regulating apoptosis in response to microbial infection.
The bacterial replication and cell-death phenotypes observed
when AnkG was added to the repertoire of L. pneumophila ef-
fector proteins were duplicated when p32 was silenced in mouse
DCs. This result provides additional evidence that interfering with
p32 function would be a possible mechanism to prevent pathogen-
induced apoptosis from occurring during infection and that AnkG
has evolved to function in this capacity.
Analysis of the genomes sequenced for L. pneumophila and
C. burnetii revealed extensive plasticity in the type IV effector
repertoires and conservation in components of the Dot/Icm ap-
paratus (1316). The versatility of the Dot/Icm apparatus in me-
diating the translocation of a large number of structurally diverse
effector proteins into evolutionarily distinct eukaryotic host cells
probably has contributed to the retention of the apparatus as
members of the order Legionellales diverged. By contrast, effector
plasticity probably is driven by the ease with which new genes
obtained by horizontal transfer can be incorporated into the type
IV effector repertoire and the ease with which effectors can be lost
because of functional redundancy. As a result, L. pneumophila and
C. burnetii now are remarkably different organisms, as reected by
an extensive nonoverlapping repertoire of effectors. Work pre-
sented in this study shows how the horizontal transfer of a single
effector protein can result in a phenotypic change that enables
L. pneumophila to replicate in a new eukaryotic host cell. In the
example shown here, the protein AnkG was found to be an ef-
fector that inhibits apoptosis. Induction of apoptosis is an im-
portant host-cell defense mechanism of mammalian cells, the
natural host for C. burnetii, but not of the protozoan host of
L. pneumophila. Thus, AnkG illustrates how infection strategies
for a specic host can be reected in the repertoire of type
IV effector proteins.
Materials and Methods
Reagents, Cell Lines, and Bacterial Strains. Unless otherwise noted, chemicals
were purchased from Sigma. Complete protease inhibitor and Fugene 6 were
from Roche. Protein A and Protein G Sepharose were from Pharmacia. CHO and
CHO-FcR broblasts were grown in alpha-MEM (Gibco) containing 10% heat-
inactivated FBS. HeLa and HEK293 cells were maintained in DMEM containing
10% FBS. Bone marrow derived-DCs were prepared as described in ref. 7.
Ted Hackstadt (NIH Rocky Mountain Laboratories, Hamilton, MT) generously
provided a plaque-puried isolate of the C. burnetii phase II Nine Mile strain.
Cultivation and host-cell infection by C. burnetii were conducted as described
(17). Escherichia coli strains DH5 and BL21 (DE3) were cultivated in LB me-
dium. L. pneumophila serogroup 1 strains were grown on charcoal yeast ex-
tract plates as described (19).
Mice. C57BL/6 mice were purchased from Jackson Laboratories. All animals
were maintained in accordance with the guidelines of the Yale Institutional
Animal Use and Care Committee.
Plasmids and Primers. Plasmids and primers used in this study are described in
Tables S1 and S2.
Apoptosis Assays. Details of the assays used to analyze apoptosis in the cells
transfected with the indicated plasmids or infected with Coxiella burnetii or
Legionella pneumophila are provided in SI Materials and Methods.
Assays to Measure Replication and Vacuole Formation in DCs. Single-cell assays
to measure uptake and formation of vacuoles that support L. pneumophila
replication and cfu-based assays to measure intracellular replication of
L. pneumophila in mouse DCs were conducted as described previously (7).
Coimmunoprecipitation, Immunoblotting, and siRNA Silencing. Protein A
Sepharose was used for all immunoprecipitations studies. ON-TARGETplus
SMARTpools and the corresponding set of four individual siRNAs for siRNA si-
lencing of p32 in human and mouse cells were purchased from Thermo Scientic.

19000 | www.pnas.org/cgi/doi/10.1073/pnas.1004380107 Lhrmann et al.

HeLa cell transfection of siRNA was conducted following the manufacturers
recommended protocol. DCs were electroporated with p32 siRNA as described
previously (26). Details are provided in SI Materials and Methods.
Protein Purication. AnkG-GST and GST were expressed in E. coli BL21 (DE3)
and were puried by using glutathioneSepharose columns (GE Healthcare).
Proteins were coupled to Af-Gel 15 (BioRad) and were incubated with CHO
cell lysate. Bound proteins were eluted, separated by SDS/PAGE, and ana-
lyzed by MALDI-TOF. Details are provided in SI Materials and Methods.
1. Fields BS (1996) The molecular ecology of Legionellae. Trends Microbiol 4:286290.
2. Ninio S, Roy CR (2007) Effector proteins translocated by Legionella pneumophila:
Strength in numbers. Trends Microbiol 15:372380.
3. Ensminger AW, Isberg RR (2009) Legionella pneumophila Dot/Icm translocated
substrates: A sum of parts. Curr Opin Microbiol 12:6773.
4. Isberg RR, OConnor TJ, Heidtman M (2009) The Legionella pneumophila replication
vacuole: Making a cosy niche inside host cells. Nat Rev Microbiol 7:1324.
5. Fraser DW, et al. (1977) Legionnaires disease: Description of an epidemic of
pneumonia. N Engl J Med 297:11891197.
6. Shin S, Roy CR (2008) Host cell processes that inuence the intracellular survival of
Legionella pneumophila. Cell Microbiol 10:12091220.
7. Nogueira CV, et al. (2009) Rapid pathogen-induced apoptosis: A mechanism used by
dendritic cells to limit intracellular replication of Legionella pneumophila. PLoS
Pathog 5:e1000478.
8. Lighteld KL, et al. (2008) Critical function for Naip5 in inammasome activation by
a conserved carboxy-terminal domain of agellin. Nat Immunol 9:11711178.
9. Molofsky AB, et al. (2006) Cytosolic recognition of agellin by mouse macrophages
restricts Legionella pneumophila infection. J Exp Med 203:10931104.
10. Zamboni DS, et al. (2006) The Birc1e cytosolic pattern-recognition receptor
contributes to the detection and control of Legionella pneumophila infection. Nat
Immunol 7:318325.
11. Ren T, Zamboni DS, Roy CR, Dietrich WF, Vance RE (2006) Flagellin-decient
Legionella mutants evade caspase-1- and Naip5-mediated macrophage immunity.
PLoS Pathog 2:e18.
12. Weisburg WG, et al. (1989) Phylogenetic diversity of the Rickettsiae. J Bacteriol 171:
42024206.
13. Seshadri R, et al. (2003) Complete genome sequence of the Q-fever pathogen Coxiella
burnetii. Proc Natl Acad Sci USA 100:54555460.
14. Chien M, et al. (2004) The genomic sequence of the accidental pathogen Legionella
pneumophila. Science 305:19661968.
Lhrmann et al.
ACKNOWLEDGMENTS. We thank Eva Campodonico for editorial assistance,
the Roy laboratory for helpful discussions, Jan Schulze-Lhrmann for assis-
tance with the RT-PCR analysis, and Claudia Giessler and Rita Eckart for
technical assistance. This work was supported by a Fellowship from the
Deutsche Forschungsgemeinschaft (to A.L.), by Ruth L. Kirschstein National
Research Service Award Individual Postdoctoral Fellowship AI066547 (to
K.L.C.), by Fundao para a Cincia e Tecnologia Grant BD/11758/2003 (to
C.V.N.), and by National Institutes of Health Grants R01-AI064559 and R01-
AI048770, and Northeast Biodefense Center Grant U54-AI057158-Lipkin
(to C.R.R).
15. Cazalet C, et al. (2004) Evidence in the Legionella pneumophila genome for
exploitation of host cell functions and high genome plasticity. Nat Genet 36:
11651173.
16. Beare PA, et al. (2009) Comparative genomics reveal extensive transposon-mediated
genomic plasticity and diversity among potential effector proteins within the genus
Coxiella. Infect Immun 77:642656.
17. Lhrmann A, Roy CR (2007) Coxiella burnetii inhibits activation of host cell apoptosis
through a mechanism that involves preventing cytochrome c release from mito-
chondria. Infect Immun 75:52825289.
18. Voth DE, Howe D, Heinzen RA (2007) Coxiella burnetii inhibits apoptosis in human
THP-1 cells and monkey primary alveolar macrophages. Infect Immun 75:42634271.
19. Pan X, Lhrmann A, Satoh A, Laskowski-Arce MA, Roy CR (2008) Ankyrin repeat
proteins comprise a diverse family of bacterial type IV effectors. Science 320:
16511654.
20. Voth DE, et al. (2009) The Coxiella burnetii ankyrin repeat domain-containing protein
family is heterogeneous, with C-terminal truncations that inuence Dot/Icm-
mediated secretion. J Bacteriol 191:42324242.
21. Sunayama J, et al. (2004) Physical and functional interaction between BH3-only
protein Hrk and mitochondrial pore-forming protein p32. Cell Death Differ 11:
771781.
22. Kamal A, Datta K (2006) Upregulation of hyaluronan binding protein 1 (HABP1/p32/
gC1qR) is associated with Cisplatin induced apoptosis. Apoptosis 11:861874.
23. Lindsten T, et al. (2000) The combined functions of proapoptotic Bcl-2 family
members bak and bax are essential for normal development of multiple tissues. Mol
Cell 6:13891399.
24. Jiang J, Zhang Y, Krainer AR, Xu RM (1999) Crystal structure of human p32,
a doughnut-shaped acidic mitochondrial matrix protein. Proc Natl Acad Sci USA 96:
35723577.
25. Itahana K, Zhang Y (2008) Mitochondrial p32 is a critical mediator of ARF-induced
apoptosis. Cancer Cell 13:542553.
26. Jantsch J, et al. (2008) Small interfering RNA (siRNA) delivery into murine bone
marrow-derived dendritic cells by electroporation. J Immunol Methods 337:7177.
MICROBIOLOGY
PNAS | November 2, 2010 | vol. 107 | no. 44 | 19001
Supporting Information
Lhrmann et al. 10.1073/pnas.1004380107
SI Materials and Methods
Apoptosis Assays. CHO cells were transfected with the indicated
plasmids. The cells were incubated with staurosporine (0.5 g/mL)
for 5 h. The cells were xed with 3% (wt/vol) paraformaldehyde for
20 min, permeabilized with ice-cold methanol for 30 s, quenched
with 50 mM NH4Cl for 15 min, and labeled with HA-specic an-
tibody (Convance Research Products) and uorescein-labeled sec-
ondary antibody (Molecular Probes) or left unlabeled. Cells were
mounted using ProLong Gold with DAPI (Invitrogen) to visu-
alize the nucleus. The nuclear morphology of transfected cells
was scored using a Nikon TE-200 inverted microscope.
CHO FcR cells were incubated with anti-Legionella pneumo-
phila antibody 30 min before infection with wild-type L. pneu-
mophila or with the defect in organelle trafcking (dotA) mutant
expressing the indicated plasmids at a multiplicity of infection
(MOI) of 30 for 1 h (1). The cells were washed with PBS and
treated with staurosporine (0.4 g/mL) for 5 h. L. pneumophila
were detected using an Alexa Fluor 594 secondary antibody
(Molecular Probes). Nuclear DNA fragmentation was assayed by
TUNEL with the in situ cell death detection kit (Roche). The
nuclei were analyzed as described above.
After being isolated using CD11c magnetic beads (2), dendritic
cells (DCs) were infected with L. pneumophila at an MOI of 25
and assayed for nuclear DNA fragmentation by TUNEL with the
in situ cell death detection kit (Roche). Samples then were ana-
lyzed by uorescence microscopy. All data points represent the
average number of TUNEL-positive cells SD obtained from
three independent coverslips.
Coimmunoprecipitation. HEK 293 cells were transfected with the
indicated plasmids. Cells were lysed in lysis buffer [20 mM Hepes
(pH 7.5), 200 mM NaCl, 1 mM EDTA, 0.1% (vol/vol) Nonidet
P-40, 10% (vol/vol) Glycerol, 1 protease inhibitor, 1 mM DTT]
for 30 min on ice and centrifuged for 10 min, 16,000 g. at 4 C.
The supernatants were incubated with anti-GFP rabbit antiserum
(Invitrogen) for 3 h at 4 C. Complexes were precipitated using
protein A Sepharose beads (40 min at 4 C). The beads were
washed three times with buffer [20 mM Hepes (pH 7.5), 200 mM
NaCl, 1 mM EDTA, 0.1% (vol/vol) Nonidet P-40]. Precipitated
proteins were analyzed by immunoblotting.
Immunoblotting. Proteins were separated by SDS/PAGE and
transferred to PVDF membrane (Millipore). The membranes
were probed with antibodies specic for GFP (Roche), HA
(Convance Research Products), and gC1qR (p32) (Santa Cruz).
Proteins were visualized using HRP-conjugated secondary anti-
bodies (Zymed) and a chemiluminescence detection system
(Perkin-Elmer).
1. Kagan JC, Roy CR (2002) Legionella phagosomes intercept vesicular trafc from
endoplasmic reticulum exit sites. Nat Cell Biol 4:945954.
2. Nogueira CV, et al. (2009) Rapid pathogen-induced apoptosis: A mechanism used by
dendritic cells to limit intracellular replication of Legionella pneumophila. PLoS Pathog
5:e1000478.
Lhrmann et al. www.pnas.org/cgi/content/short/1004380107
Protein Purication. Escherichia coli BL21 (DE3) cells transformed
with plasmids producing either GST or GST- ankyrinG (AnkG)
were grown to an OD = 0.4. Isopropyl -D-1-thiogalactopyr-
anoside was added, and samples were incubated for 4 h at 30 C.
Cells were resuspended in PBS containing protease inhibitor.
After disruption by French press, the lysates were claried by
centrifugation at 15,000 g for 30 min. Supernatants were loaded
onto glutathioneSepharose columns (GE Healthcare). Bound
proteins were eluted with 10 mM glutathione in PBS. Proteins
were dialyzed and coupled to Af-Gel 15 (BioRad) according to
the manufacturers protocol.
CHO cells were resuspended in lysis buffer [0.5% (vol/vol)
Triton X-100, 50 mM Tris (pH 7.5), 100 mM NaCl] for 1 h on ice.
After centrifugation (20.000 g for 20 min at 4 C and 100,000 g
for 45 min at 4 C), the supernatant was incubated with GST or
GST-AnkG coupled to Af-Gel for 34 h at 4 C). Beads were
washed with lysis buffer and TBS [10 mM Tris (pH 7.5), 150 mM
NaCl]. Bound proteins were eluted in 100 mM glycine (pH 2.4)
and 150 mM NaCl and neutralized with 1 M Tris (pH 8.0). Eluted
proteins were precipitated using trichloroacetic acid and sepa-
rated by SDS/PAGE. The gel was stained with silver, and unique
bands from the GST-AnkG column were excised and analyzed by
MALDI-TOF (Protana Analytical Services).
siRNA Knock Down. The Dharmacon protocol for siRNA trans-
fection of HeLa cells was used. Three days after the cells were
transfected with 10 nM p32 siRNA, the cells were washed with PBS
and exposed to UV light (600 J/m2) in a transilluminator box
(Stratagene). After fresh medium was added, cells were incubated
for 5 h. The cells were xed, permeabilized, quenched, and
mounted as described above. The nuclear morphology of cells was
scored as described above.
siRNA knock-down in mouse bone marrow DCs was per-
formed as described previously with some alterations (3). Briey,
8 d after DC differentiation, 6 g of siRNA single oligonucleo-
tide (A, B, C, D) or 6 g of a pool of four siRNA oligonucleo-
tides directed against mouse p32 were introduced into the cells
by electroporation. DCs electroporated with no siRNA were
used as control (mock treatment). The efciency of knock-down
was conrmed 48 h post electroporation by immunoblotting
using a p32-specic antibody from Abcam. DCs then were sorted
using CD11c magnetic beads (Miltenyi Biotec) and infected with
wild-type L. pneumophila, a agellin-decient strain of L.
pneumophila (aA), aA expressing AnkG, or dotA for 1 and
10 h. At each time point, DCs were xed and stained, and
consequently assays to measure uptake and formation of va-
cuoles containing replicating L. pneumophila in DCs were con-
ducted as previously described (2).
3. Jantsch J, et al. (2008) Small interfering RNA (siRNA) delivery into murine bone
marrow-derived dendritic cells by electroporation. J Immunol Methods 337:7177.
1 of 6
 A B

(4 g)
(1 G- )
GFP-AnkG GFP

ST 76

g
g T
An 4

80 GS
(1

-L 2A

A
2

2
ST

HA 2 PP2
HA DB1

HA DB1
HA NP3

HA NP3
k

P
G

HA 2

2
P
HA 5
-p3

HA 5
-p3
kDa

-D

-D
2
-A

-A

-L
-I

-I
HA

HA
160
120 DDB1
100
80
70
60
50

IP: -GFP
WB: -HA
40 I2PP2A
L5
ANP 32

30 p32

Fig. S1. Identication of host-cell proteins that bind to AnkG. (A) Af-Gel columns with immobilized GST-AnkG or GST alone were incubated with lysates
from CHO. Bound proteins were analyzed by SDS/PAGE and silver staining after elution. Arrows indicate the position of ve unique bands that were excised
and analyzed by MALDI-TOF. Protein identities as predicted by mass spectrometry are indicated next to each arrow. (B) HEK 293 cells were cotransfected with
plasmids encoding GFP-AnkG or a control GFP along with the potential AnkG binding partners tagged with the HA epitope. Proteins in the lysates were
immunoprecipitated with an anti-GFP antibody (IP) and analyzed by immunoblotting (WB) with an anti-HA antibody.

mock 0.05 0.2 1.0 5.0 20 50 p32 siRN A

-p32

-actin

Fig. S2. siRNA silencing of p32. HeLa cells were transfected with indicated concentrations of p32 siRNA (nM). The efciency of p32 silencing was determined
3 d posttransfection by immunoblot analysis using an anti-p32 antibody. The anti-actin immunoblot was used as a control for equal protein loading.

Lhrmann et al. www.pnas.org/cgi/content/short/1004380107 2 of 6

 A flaA + pJV400
TUNEL
flaA + AnkG
B
L. pneumophila
DAPI 100

Fold-increase in CFUs 36h p.i.

**

flaA + AnkB
flaA + AnkB dotA + AnkG 10 flaA + AnkG
dotA + AnkG

N.D.
1
B6

C D E

% Infected DCs with R.V.

% Infected DCs with R.V.
% Infected DCs with R.V. at 10h p.i.

100 35 AnkG
pJV400 20 * *
30 AnkG1-69
30 ** AnkB
% Infected DCs at 2h p.i.

15 AnkG70-339
75 AnkG
25 20 dotA+AnkG
flaA + pJV400 10
20 flaA + AnkB
flaA + AnkG 10 5
50
15 dotA + AnkG
N.D.
10
25
5
N.D.
B6 Bax-/-Bak-/- Bax-/-Bak-/-

Fig. S3. The antiapoptotic effects of AnkG during L. pneumophila infection are sufcient to allow bacterial intracellular replication in DCs. (A) Fluorescence
micrographs show TUNEL staining (green) of DCs derived from B6 mice infected for 6 h with L. pneumophila aA (red) expressing the pJV400 vector (aA +
pJV400) (Upper Left), pJV400-AnkG (aA + AnkG) (Upper Right), pJV400-AnkB (aA + AnkB) (Lower Left), or L. pneumophila dotA expressing AnkG (dotA +
AnkG) (Lower Right). Note that in the aA + AnkG cell there were no obvious signs of apoptosis despite the presence of a large replicative vacuole containing L.
pneumophila. Total DNA was stained with DAPI (blue), and bacteria were stained in red. (Scale bar: 10 m.) (B) B6 DCs were infected with L. pneumophila aA
expressing AnkB (aA + AnkB) (black bars) or AnkG (aA + AnkG) (white bars) or with L. pneumophila dotA + AnkG (gray bars) for 36 h. The efciency of
intracellular replication was determined by dividing the number of L. pneumophila cfus recovered at 36 h postinfection by the number of cfus recovered at 1 h
postinfection. Data for each time point are the average of values obtained from three independent wells. **P < 0.01. N.D., not detectable. (C) Graphical rep-
resentations of the percentage of B6 and Bcl-2associated X (Bax)/ BCL2-antagonist/killer (Bak)/ DCs infected at 2 h (Left) and the percentage of infected
Bax/Bak/ DCs with vacuoles containing replicating bacteria at 10 h postinfection (Right). Data represent the mean SD of 300 cells counted per coverslip in
triplicate. R.V., vacuoles containing replicating bacteria. There were no vacuoles containing replicating bacteria detected (N.D.) for the dotA + AnkG strain,
which would have been indicated with a light gray bar. (D and E) Graphical representations of the percentage of infected B6 DCs with (D) L. pneumophila aA +
pJV400 (black bar), aA + AnkB (gray bar), and aA + AnkG (white bar) and (E) L. pneumophila aA expressing AnkG (black bar), AnkG169 (light gray bar) or
AnkG70339 (white bar). There were no vacuoles containing replicating bacteria detected (N.D.) for the dotA + AnkG strain, which would have been indicated
with a dark gray bar. Vacuoles containing replicating bacteria at 10 h postinfection were counted. Shown are mean SD of 300 cells counted per coverslip in
triplicate in at least three independent experiments. **P < 0.05; *P < 0.01.

106
flaA
dotA
105
Total cAMP (fmol)

104

103

102

101
Uninf. Cya Cya-RalF Cya-AnkG Cya-AnkG1-69 Cya-AnkG70-339

Fig. S4. AnkG169 and AnkG70339 are translocated by the Dot/Icm secretion apparatus during L. pneumophila infection. CHO FcRII cells were left uninfected
(gray bars) or were infected with either L. pneumophila aA (black bars) or dotA (white bars) expressing the indicated adenylate cyclase (Cya) fusion proteins.
After 1 h of infection, tissue culture cells were lysed, and cAMP was extracted from the sample. Total cAMP (indicated as fmol) production induced by trans-
location of the hybrid was quantied using an enzyme-immunoassay system. Results represent average values SD of experiments performed in triplicate.

Lhrmann et al. www.pnas.org/cgi/content/short/1004380107 3 of 6

 DCs mock pool A B C D
A
- p32

- actin

B DCs

% Infected DCs at 1h p.i.

40 DCs mock
DCs + p32 siRNA
30

20

10

flaA flaA dotA

+ AnkG

C flaA flaA + AnkG dotA

DCs
mock

DCs +
p32 siRNA

60
D 50
% Infected DCs

40
30
20

10

DCs mock pool A B C D

30
E
% flaA infected DCs with R.V.

20

10

DCs mock pool A B C D

Fig. S5. Knock-down of p32 prevents L. pneumophila-induced apoptosis and allows bacterial intracellular replication in DCs. (A) DCs derived from B6 mice
were electroporated with 6 g of a pool of siRNA directed against mouse p32. The individual nonoverlapping siRNA oligonucleotides (A, B, C, D) that comprised
the pool were also used to silence p32 as indicated. DCs electroporated with no siRNA were used as control (mock). Efciency of p32 silencing was determined
by immunoblot analysis 2 d after electroporation using a p32 antibody. An anti-actin immunoblot was used as a control for equal protein loading. (B) Shown
are the percentages of untreated DCs, DCs treated with p32 siRNA, or mock-treated DCs infected with L. pneumophila aA, aA + AnkG, or dotA I h
postinfection. Results of one experiment representative of three independent experiments are shown. These data indicate the efciency of bacterial uptake
was not affected adversely by the siRNA treatment or by the introduction of AnkG into the bacteria. (C) Fluorescence micrographs show DCs either treated
with siRNA against p32 or mock treated and then infected for 10 h with L. pneumophila aA, aA expressing AnkG, or dotA. DNA was stained with DAPI
(blue), and bacteria were stained with an anti-Legionella antibody (green). (Scale bar 10 m.) (D and E) DCs were electroporated with 6 g of siRNA single
oligonucleotides (A, B, C, D) or with 6 g of a pool of siRNA directed against mouse p32. DCs electroporated with no siRNA were used as control (mock). Two
days after electroporation the DCs were sorted using CD11c magnetic beads and were infected with L. pneumophila aA. (D) The percentage of infected DCs
at 1 h postinfection is presented for one experiment representative of three independent experiments that yielded similar results. (E) Vacuoles containing
replicating bacteria at 10 h postinfection were counted. Data are shown for one experiment representative of three independent experiments yielding similar
results. R.V., vacuoles containing replicating bacteria.

Lhrmann et al. www.pnas.org/cgi/content/short/1004380107 4 of 6

 Table S1. Plasmids and primers used in this study
Plasmid Primer* Reference

pGEX-5X-1 Amersham
pEGFP-C1 Clontech
pJV400 This study
pJV400-ankB 10, 371 This study
pJV400-ankG 26, 373 This study
pJV400-ankG(1-69) 373, 389 This study
pJV400-ankG(70-339) 390, 26 This study
pJV400-ankF 22, 372 This study
pJV450-ankG(1-69) 25, 389 This study
pJV450-ankG(70-339) 402, 26 This study
pGEX-5X-2-ankG 96, 97 This study
pEGFP-C2-ankA 30, 71 This study
pEGFP-C2-ankB 72, 73 This study
pEGFP-C2-ankF 40, 74 This study
pEGFP-C-ankG 34, 75 This study
pEGFP-C1- p32 185, 186 This study
pCMV-HA-ankG 80, 307 This study
pCMV-HA-ankG(92157) 80, 307, 324, 325 This study
pCMV-HA-ankG(1-69) 329, 338 This study
pCMV-HA-ankG(70-339) 332, 340 This study
pCMV-HA-anp32 301, 302 This study
pCMV-HA-ddb1 312, 313 This study
pCMV-HA-i2pp2a 303, 304 This study
pCMV-HA-l5 305, 306 This study
pCMV-HA- p32 This study
pCYA-AnkG Pan et al., 2008 (1)
pCYA-RalF Nagai et al., 2005 (2)
pCYA-AnkG (1-69) This study
pCYA-AnkG (70-339) This study

*Primer numbers are as in Table S2.

1. Pan X, Lhrmann A, Satoh A, Laskowski-Arce MA, Roy CR (2008) Ankyrin repeat proteins comprise a diverse family of bacterial type IV effectors. Science 320:16511654.
2. Nagai H, et al. (2005) A C-terminal translocation signal required for Dot/Icm-dependent delivery of the Legionella RalF protein to host cells. Proc Natl Acad Sci USA 102:826831.

Lhrmann et al. www.pnas.org/cgi/content/short/1004380107 5 of 6

 Table S2. Primers used in this study
Primer Sequence Site

10 AAGGCGCGCCttacatgtgcttacccggg AscI
22 aaggcgcgccctaccgctggaagccgc AscI
25 AAGGCGCGCCAAGTAGACGTGAGACTCCC AscI
26 AAGGCGCGCCtcaccgaggactagacag AscI
30 AAGGATCCttaaaacagtccggggcct BamHI
34 AAGGATCCtcaccgaggactagacaga BamHI
40 AAGGATCCctaccgctggaagccgc BamHI
71 CCGAATTCttgcagttggcagcccgt EcoRI
72 CCCCTGCAGatgtttaaccaattggaaatagt PstI
73 CCGGTACCttacatgtgcttacccggg KpnI
74 CCCCTGCAGTatgagacagcgtgaaattaat PstI
75 CCGGTACCGCatgagtagacgtgagactc KpnI
80 CCGGTACCtcaccgaggactagacaga KpnI
96 CCGGATCCCCatgagtagacgtgagactc BamHI
97 CCCCCCGGGtcaccgaggactagacaga SmaI
185 CCGGATCCCTACTGGCTCTTGACAAAACT BamHI
186 CCGGATCCCTGCACACCGACGGAGAC BamHI
301 ccggtaccatggagatgaagaagaagattaa KpnI
302 ccggtaccctagtcatcttcttcctctc KpnI
303 ccggtaccatgtcggcgccggcgg KpnI
304 ccggtaccctagtcatcttctccttcatc KpnI
305 ccggtaccatggggtttgttaaagttgttaa KpnI
306 ccggtaccttagctctcagcagcccg KpnI
307 ccggtaccATGAGTAGACGTGAGACTCC KpnI
312 ccggtaccatgtcgtacaactacgtggta KpnI
313 ccggtaccctaatggatccgagttagct KpnI
324 AGGTTCTGTCCTAAATCCGTCTTTGGCGGTAC
325 AAAGACGGATTTAGGACAGAACCTTTTAGAACT
329 ccaagatctctATGAGTAGACGTGAGACTCC BglII
332 ccaagatctctatgCTTCGCGGGGATTCTTTTCA BglII
338 ccggtacctcaGTAGTTTTTTATTATGTCTAAGCT KpnI
340 ccggtaccTCACCGAGGACTAGACAGA KpnI
341 ccgaattctatgtcgggaggtggtgtga EcoRI
342 cctctagattatgtacgagagcgagatct XbaI
343 GCATTCCTCGAGGGCGGATTTGAATGTAGGT XhoI
344 GCATTCGCGGCCGCGAGAGAAGCCCAGGATAGGAC NotI
345 GCATTCGCGGCCGCCCTGACCCTGCCCATCTCGTT NotI
346 GCATTCAAGCTTACCAGCGGTTGAAGCGTTCCT HindII
348 CCAGCGGTTGAAGCGTTCCT
351 TGATCTAGAGTCGCGGCCGA
353 GGAAGAGAACAGGACTGAGGC
354 GTTTTTGTTCGGGCCCAAGCTT
371 ccggccggccATGTTTAACCAATTGGAAATAGT FseI
372 ccggccggccatgagacagcgtgaaattaatg FseI
373 ccggccggccATGAGTAGACGTGAGACTCC FseI
389 ccggcgcgcctcagtagttttttattatgtctaagc AscI
390 ccggccggccatgcttcgcggggattcttttca FseI
402 ccggcgcgccaatgcttcgcggggattcttttca AscI

Boldface denotes the location of the restriction site indicated in the next column.

Lhrmann et al. www.pnas.org/cgi/content/short/1004380107 6 of 6