J Appl Physiol 103: 11891195, 2007.
First published July 12, 2007; doi:10.1152/japplphysiol.00172.2007.
Role of TLR2, TLR4, and MyD88 in murine ozone-induced airway
hyperresponsiveness and neutrophilia
Alison S. Williams,1 Sum-Yee Leung,1 Puneeta Nath,1 Nadia M. Khorasani,1 Pankaj Bhavsar,1 Razao Issa,1
Jane A. Mitchell,2 Ian M. Adcock,1 and Kian Fan Chung1
1
Experimental Studies and Airway Disease Section and 2Cardiothoracic Medicine Section, National Heart and Lung Institute,
Imperial College, London, United Kingdom
Submitted 11 February 2007; accepted in final form 10 July 2007
Williams AS, Leung S-Y, Nath P, Khorasani NM, Bhavsar P,
Issa R, Mitchell JA, Adcock IM, Chung KF. Role of TLR2, TLR4,
and MyD88 in murine ozone-induced airway hyperresponsiveness
and neutrophilia. J Appl Physiol 103: 11891195, 2007. First pub-
lished July 12, 2007; doi:10.1152/japplphysiol.00172.2007.Expo-
sure to air pollutants such as ozone (O3) induces airway hyperrespon-
siveness (AHR) and airway inflammation. Toll-like receptors (TLR)
are first-line effector molecules in innate immunity to infections
and signal via adapter proteins, including myeloid differentiation
factor-88 (MyD88). We investigated the sensing of ozone by TLR2,
TLR4, and MyD88. Ozone induced AHR in wild-type (WT) C57BL/6
mice, but AHR was absent in TLR2/, TLR4/, and MyD88/
mice. Bronchoalveolar lavage neutrophilia induced by ozone was
inhibited at 3 h but not at 24 h in TLR2/ and TLR4/ mice, while
in MyD88/ mice, this was inhibited at 24 h. We investigated the
expression of inflammatory cytokines and TLR2, TLR4, and MyD88
in these mice. Ozone induced time-dependent increases in inflamma-
tory gene expression of keratinocyte chemoattractant (KC) and IL-6
and of TLR2, TLR4, and MyD88 in WT mice. IL-6 and KC expres-
sion induced by ozone was inhibited in TLR2/, TLR4/, and
MyD88/ mice. Expression of MyD88 was increased in TLR2/
and TLR4/ mice, while induction of TLR2 or TLR4 was reduced
in TLR2/ and TLR4/ mice, respectively. TLR2 and TLR4
mediate AHR induced by oxidative stress such as ozone, while the
adapter protein MyD88, but not TLR2 or TLR4, is important in
mediating ozone-induced neutrophilia. TLR2 and TLR4 may also be
important in regulating the speed of neutrophilic response. Therefore,
ozone may induce murine AHR and neutrophilic inflammation
through the activation of the Toll-like receptor pathway that may
sense noninfectious stimuli such as oxidative stress.
Toll-like receptor 2; Toll-like receptor 4; myeloid differentiation
factor-88; knockout mouse; oxidative stress
OZONE is a potent oxidizing pollutant. High levels of ambient
ozone are a significant threat to respiratory health and are
linked to the worsening of symptoms and increased hospital-
izations of patients with obstructive lung disease, such as
asthma and chronic obstructive pulmonary disease (COPD) (2,
8, 10, 23, 27, 33, 38). Experimental ozone exposure induces
airway hyperresponsiveness (AHR) to bronchoconstrictor
agents and lung neutrophilia (6, 9, 21, 30, 31, 39). The
mechanisms underlying ozone-induced release of AHR and
inflammation are unclear; the influx of neutrophils may be due
to their recruitment by ozone-induced proinflammatory cyto-
kines and chemokines, such as cytokine-induced neutrophil
Address for reprint requests and other correspondence: K. F. Chung,
Experimental Studies, National Heart and Lung Institute, Imperial College
London, Dovehouse St., London SW3 6LY, United Kingdom (e-mail:
f.chung@imperial.ac.uk).
http://www. jap.org 8750-7587/07 $8.00 Copyright 2007 the American Physiological Society
chemoattractant (CINC), macrophage inflammatory protein-2
(MIP-2), TNF-, and IL-1 (4, 5, 12, 15, 17, 21, 28).
Toll-like receptors sense pathogens and exhibit sequence
and functional homology with the interleukin-1 receptor (Toll/
IL-1R or TIR domain). The TIR domain is common to all
TLRs and is required to initiate intracellular signaling. Follow-
ing ligand binding, one of four common adapter proteins
Downloaded from http://jap.physiology.org/ by 10.220.33.2 on November 23, 2017
containing the TIR domain, such as myeloid differentiation
factor-88 (MyD88), is recruited to the TLR. TLR and MyD88
combine to signal through IL-1 receptor-associated kinase
(IRAK)-1 and -4 and tumor necrosis factor receptor-associated
factor 6 (TRAF-6). IRAK and TRAF-6 initiate a series of
signaling cascades that terminate in activation of the transcrip-
tion factors AP-1 and NF-B via IB kinase (IKK)-mediated
and mitogen-activated protein kinase (MAPK) pathways, re-
spectively (36). Over 10 TLRs have been cloned in mammals,
and each member recognizes individual groups of pathogens.
For example, TLR2 recognizes ligands including bacterial
lipoproteins and peptidoglycan from gram-positive bacteria,
while TLR4 recognizes ligands including gram-negative bac-
teria (25). TLR2 can form heterodimers with TLR1 or TLR6
and signals through MyD88, while TLR4 can act dependently
or independently of MyD88. Each combination of receptor and
signaling response leads to the transcription of distinct profiles
of genes.
In addition to a role for TLRs in immune responses to
infection, there may be a role for TLRs in the pathogenesis of
noninfectious events. Using inbred strains of mice derived
from ozone-susceptible and ozone-resistant progenitors, Klee-
berger et al. (20) found that TLR4 was differentially expressed
between these mice after ozone exposure. Hollingsworth et al.
(13) found that TLR4/ mice did not develop AHR after
ozone exposure but still exhibited a neutrophilic inflammatory
response to ozone. On the other hand, in airway epithelial cells,
particulates stimulated IL-8 release through oxidative stress
pathways, dependent on TLR2 pathways (3). Therefore, both
TLR2 and TLR4 may mediate effects of oxidative stress.
We therefore investigated the sensing of oxidative stress by
TLR2, TLR4, and MyD88 in a model of ozone exposure using
TLR2, TLR4, and MyD88 knockout mice.
METHODS
The protocols were approved by the Imperial College BioSciences
Group and performed under a Project License from the British Home
Office, UK, under the Animals (Scientific Procedures) Act 1986.
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked advertisement
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1189
1190 ROLE OF TLRs AND MyD88 AFTER OZONE EXPOSURE
Mice. Genetically modified male mice (20 25 g) deficient in
TLR2, TLR4, or the common adapter protein MyD88 were genotyped
during an initial breeding program. Breeding pairs of mice deficient in
TLR2 or TLR4 receptors were originally kindly supplied by Dr. O.
Takeuchi (34), and mice deficient in MyD88 were originally kindly
supplied by Dr. S. Akira (1). The mice used in this study were
homozygotes of either TLR2/, TLR4/, or MyD88/ genotype
and were back-bred for more than seven generations with C57BL6
mice; thus C57BL6 were used as wild-type (WT) controls.
Ozone exposure. TLR2/, TLR4/, MyD88/, or WT
C57BL6 mice were exposed to ozone generated from an ozonizer
(model 500 Sander Ozoniser) mixed with air to provide a concentra-
tion of 3 parts per million (ppm) in a sealed Perspex container for 3 h.
We used 3 ppm concentration because, in preliminary ozone concen-
tration-response studies in C57Bl6 mice, we found the 3-ppm expo-
sure for 3 h to induce the maximal degree of AHR at 20 24 h
associated with significant neutrophilic response. Ozone concentration
was continually monitored with a probe from ATi, Oldham, UK.
Control animals received air only. Two groups of each strain were
studied (one exposed to ozone and the other to air) at two time points,
3 h and 20 24 h following exposure, except for MyD88/ mice,
which were studied at 20 24 h only.
Assessment of AHR. Twenty-four hours following exposure, mice
were anesthetized with an intraperitoneal injection of anesthetic so-
lution containing midazolam (Roche Products, Welwyn Garden City,
UK) and Hypnorm (0.315 mg/ml fentanyl citrate and 10 mg/ml
fluanisone; Janssen Animal Health, Wantage, UK). Mice were trache-
ostomized and ventilated (MiniVent type 845, Hugo Sach Electronic;
rate 250 breaths/min and tidal volume 250 l). Mice were monitored
in a whole body plethysmograph with a pneumotachograph connected
to a transducer (EMMS, Hants, UK). Transpulmonary pressure was
assessed via an esophageal catheter (EMMS). Instantaneous calcula-
tion of pulmonary resistance (RL) was obtained. Increasing concen-
trations of acetylcholine chloride (ACh) (Sigma, Dorset, UK) (4 256
mg/ml) were administered with an ultrasonic nebulizer, and RL was
recorded for a 5-min period following each concentration. RL after
each concentration was expressed as percent change from baseline RL
measured following nebulized PBS (Sigma, Dorset, UK). The con-
centration of acetylcholine required to increase RL by 250% from
baseline was calculated (PC250).
Bronchoalveolar lavage. We used a previously published method
(24). Briefly, following an overdose of anesthetic, mice were
lavaged with six aliquots of 0.5 ml PBS via the endotracheal tube
and retrieved as the bronchoalveolar lavage (BAL) fluid. Total cell
counts and differential cell counts from cytospin preparations stained
by May-Grunwald-Giemsa stain were determined under an optical
microscope (Olympus BH2, Olympus Optical, Tokyo, Japan). At least
400 cells were counted per mouse and identified as macrophages,
eosinophils, lymphocytes, and neutrophils according to standard mor-
phology under 400 magnification.
Measurement of BAL protein and IL-6 levels. Protein concentra-
tions for each BAL sample were determined using a protein assay
reagent kit (Pierce Chemical, Rockford, IL) according to the manu-
facturers instructions. Levels of IL-6 were measured in the same
Table 1. Primer sequences for real-time PCR
Gene Forward
GAPDH AACGACCCCTTCATTGAC
KC CGCTGCTGCTGCTGGCCACCA
IL-6 CACAGAGGATACCACTCC CAACA
TLR2 GCCACCATTTCCACGGACT
TLR4 AGAAATTCCTGCAGTGGGTCA
MyD88 CATGGTGGTGGTTGTTTCTGAC
GAPDH, glyceraldehyde 3-phosphate dehydrogenase; KC, keratinocyte chemoattractant; IL-6, interleukin-6; TLR2 and TLR4, Toll-like receptor-2 and -4,
respectively; MyD88, myeloid differentiation factor-88.
J Appl Physiol VOL 103 OCTOBER 2007
sample using a DuoSet ELISA kit (R & D Systems) according to the
manufacturers instructions.
cDNA synthesis, reverse transcription, and real-time PCR. RNA
extracted from frozen lung tissue samples was amplified using PCR.
RNA was extracted from stored lung tissue using an RNeasy Mini kit
(Qiagen). RNA yield was then amplified via PCR using an Omniscript
Reverse Transcriptase kit (Qiagen) and stored at 80C until re-
quired. Five micrograms per sample of RNA was used to synthesize
single-stranded complementary DNA (cDNA) using random hexam-
ers and an avian myeloblastosis virus reverse transcriptase (Promega).
The cDNA generated was used as a template in subsequent real-time
PCR analyses. Transcript levels were determined by real-time PCR
(Rotor Gene 3000, Corbett Research) using SYBR Green PCR Master
Mix Reagent (Qiagen). The murine forward and reverse primers (0.5
M) used are specified in Table 1. Cycling conditions were as
follows: step 1, 15 min at 95C; step 2, 20 s at 94C; step 3, 20 s at
60C; step 4, 20 s at 72C, with step 2 to step 4 repeated 45 times. The
standard curves used to determine relative expression for each primer
were obtained by running real-time PCR for a diluted sample, for
example, to 1:1, 1:10, 1:100, and 1:1,000. mRNA gene expression
Downloaded from http://jap.physiology.org/ by 10.220.33.2 on November 23, 2017
was expressed as a ratio of gene of interest mRNA to GAPDH mRNA.
Data analysis. Data are presented as means SE. For multiple
comparisons of different groups, we used the Kruskal-Wallis test for
ANOVA. If the Kruskal-Wallis test for ANOVA was significant, we
performed the Dunn test for comparison between two individual
groups or Mann-Whitney test. A P value of 0.05 was accepted as
significant.
RESULTS
AHR. There were no significant differences in the baseline
lung resistance values following PBS challenge in the six
experimental groups. Twenty to twenty-four hours following
ozone exposure, AHR to ACh in WT ozone-exposed mice was
increased (ozone: log PC250: 1.384 0.124, n 8) com-
pared with WT air-exposed mice (1.788 0.119; n 6, P
0.05). TLR2/, TLR4/, and MyD88/ mice exposed to
ozone did not exhibit AHR compared with air-exposed mice.
Mean log PC250 of TLR2/, TLR4/, or MyD88/ mice
exposed to ozone was less than that of WT mice exposed to
ozone. TLR2/ mice exposed to ozone had a reduced AHR
compared with TLR4/ mice (ozone: log PC250: 2.178
0.129, n 6; air: 1.775 0.107, n 6; P 0.05) (Fig. 1).
BAL fluid. Total BAL cells were increased time dependently
at 3 h and at 20 24 h following ozone exposure compared with
air exposure in all mice (Fig. 2A). The total cell increase
observed in ozone-exposed MyD88/ mice was less than that
of ozone-exposed WT mice, 20 24 h following exposure (P
0.001, n 6). At 3 h and 20 24 h following exposure,
macrophage numbers were increased by ozone in all mouse
strains, except in MyD88/ mice (Fig. 2B). The number of
macrophages in MyD88/ mice after ozone was less than in
Reverse
TCCACGACATACTCAGCAC
GGCTATGACTTCGGTTTGGGTGCAG
TCCACGATTTCCCAGAGAACA
GGCTTCCTCTTGGCCTGG
TCTCTACAGGTGTTGCACATGTCA
TGGAGACAGGCTGAGTGCAA
www.jap.org
 ROLE OF TLRs AND MyD88 AFTER OZONE EXPOSURE
WT ozone-exposed mice (P 0.001, n 6). At 3 h following
ozone, the number of neutrophils after ozone exposure in
TLR2/ and TLR4/ was less compared with ozone-ex-
posed WT mice (P 0.001). However, at 20 24 h following
exposure, there was no difference between the numbers of
neutrophils recovered from ozone-exposed WT compared with
those in TLR2/ or TLR4/ mice. Neutrophil counts from
ozone-exposed MyD88/ mice were less compared with
controls (P 0.001, n 6).
Protein and IL-6 levels in bronchoalveolar fluid. Protein
concentrations in the supernatant collected at 20 24 h were
significantly increased in all ozone-exposed mice compared
with their respective air-exposed controls. Protein levels in
ozone-exposed MyD88/ were the least elevated compared
with ozone-exposed WT, TLR2/, and TLR4/ mice (all
n 6) (Fig. 3A). Ozone increased the levels of IL-6 at 20 24
h in WT mice, but the increase in IL-6 levels did not achieve
significance in TLR4/ and TLR2/ mice (n 6 in each
group; Fig. 3B). There was no increase in IL-6 levels in
ozone-exposed MyD88/ mice; these levels were signifi-
cantly less compared with ozone-exposed WT mice (n 6,
P 0.05).
Real-time PCR. Ozone induced the expression of IL-6 and
keratinocyte-derived chemokine (KC) at 3 h and 20 24 h
compared with air-exposed WT mice, although the increase for
IL-6 at 20 24 h was not significant (Fig. 4A). Expression of
IL-6 was less in ozone-exposed TLR2/ mice at 3 h and in
MyD88/ mice at 20 24 h compared with WT ozone-ex-
posed mice (both P 0.05, n 6). The increased expression
of IL-6 in TLR4/ exposed mice was not significantly af-
fected. Ozone-induced KC expression was blunted in TLR2/
(P 0.05, n 6), TLR4/ (P 0.05, n 6), and
MyD88/ mice compared with WT at 3 h (Fig. 4B). mRNA
J Appl Physiol VOL
1191
Fig. 1. Mean percentage increase in lung resistance (RL) to
increasing concentrations of acetylcholine (ACh). Ozone (O3)
increased RL in wild-type (WT) mice compared with air-
exposed mice. Ozone did not increase RL in Toll-like receptor
(TLR)-2 knockout (TLR2/; A), TLR4 knockout (TLR4/;
B), or myeloid differentiation factor-88 knockout (MyD88/)
mice (C). Open and filled symbols in A, B, and C correspond to
group definitions shown on x-axis in D. D: log PC250, where
PC250 is the concentration of ACh required to increase RL by
250% from baseline. Airway hyperresponsiveness (AHR) in all
strains of ozone-exposed knockout mice was less compared
with ozone-exposed WT mice, requiring a larger dose of ACh
to elicit a 250% increase in lung resistance from baseline. Data
are expressed as means SE. Horizontal bars in D indicates
means. ***P 0.001 compared with air-exposed mice of
Downloaded from http://jap.physiology.org/ by 10.220.33.2 on November 23, 2017
corresponding strain. ##P 0.01, ###P 0.001 compared
with ozone-exposed WT mice.
expression for TLR2, TLR4, and MyD88 was not increased
following ozone in their respective knockout mice, and these
expression levels were less than ozone-exposed WT mice
(Fig. 5). At 3 h following ozone, TLR2 expression was in-
creased in TLR4/ mice, and TLR4 expression was increased
in TLR2/ mice, although these increases were not signifi-
cant. MyD88 expression was elevated at 3 h and 20 24 h in
TLR2/ and TLR4/ mice compared with air-exposed con-
trols (P 0.05, n 6).
DISCUSSION
We have investigated the role of TLR2, TLR4, and the
common adapter molecule MyD88 in the lung response to the
oxidant ozone. AHR induced by ozone exposure in WT mice
was absent in TLR2/ and MyD88/ mice, while it was
significantly reduced in TLR4/ mice. BAL neutrophil counts
from TLR2/ or TLR4/ mice exposed to ozone were
significantly less compared with WT mice at 3 h but not at
20 24 h, while in MyD88/ mice, they were reduced at
20 24 h. Ozone-induced expression of IL-6 was reduced in
TLR2/ and MyD88/ mice but was intact in TLR4/
mice, and the larger increase in KC expression in WT exposed
mice at 3 h was blunted in all knockout ozone-exposed species.
TLR2, TLR4, and MyD88 expression were increased in WT
mice exposed to ozone and reduced in their respective knock-
out strains. It is of interest that expression of IL-6, KC, TLR2,
TLR4, and MyD88 was not significantly increased following
ozone in MyD88/ mice. Together, these data show TLR2,
TLR4, and MyD88 are important in the development of ozone-
induced AHR, with TLR4 being less dependent. MyD88 ap-
pears to be the most important in regulating ozone-induced
neutrophil recruitment, with TLR2 and TLR4 playing a role in
103 OCTOBER 2007 www.jap.org
1192 ROLE OF TLRs AND MyD88 AFTER OZONE EXPOSURE
Fig. 2. Time-dependent effect of ozone exposure on bronchoalveolar lavage
(BAL) cells. A: total BAL cells. B: BAL macrophages. C: BAL neutrophils. At
3 h and 20 24h, increases in total cells and macrophages were not different in
TLR2/ or TLR4/ mice compared with WT mice. Ozone-induced neutro-
phil numbers were blunted in TLR2/ (P 0.05, n 6) and TLR4/ (P
0.05, n 6) mice compared with WT mice but were comparable to WT 20 24
h following exposure. Total cells, macrophages, and neutrophils were blunted
in MyD88/ mice (P 0.05, n 6). Data are expressed as means SE.
*P 0.05, **P 0.01, ***P 0.001 compared with air-exposed mice of
corresponding strain. P 0.05, P 0.01 compared with ozone-exposed
WT at 3 h. ##P 0.01 compared with ozone-exposed WT mice at 20 24 h.
hastening neutrophilic influx. We also observed a decrease in
macrophage numbers in BAL fluid of TLR4/ and
MyD88/ mice at 20 24 h after ozone exposure, indicating
that TLR4 and MyD88 may be involved in the recruitment of
macrophages to the lungs.
Our data regarding the role of TLR4 in ozone-induced AHR
and neutrophilic inflammation is similar to that reported by
Hollingsworth et al. (13). A mutant TLR4 allele in a C3H
mouse strain has been shown to confer resistance to ozone-
induced hyperpermeability (14). Our data indicate that in the
J Appl Physiol VOL
C57/Bl6, the WT TLR2 or TLR4 gene does not modulate
ozone-induced hyperpermeability. However, these toll recep-
tors play a role in ozone-induced lung effects. Thus TLR2
appears to be more important than TLR4 in AHR, and TLR2
and TLR4 may also have a role in hastening neutrophilic
inflammation. Additional information from our studies places a
most important role for MyD88 in ozone-induced AHR and
neutrophilic inflammation. In addition, although we did not
examine MyD88/ mice at the 3-h time point after ozone, our
data indicate that MyD88 is also important for the induced
expression of KC and IL-6 at 24 h. Interestingly, in TLR2/
and TLR4/ mice, the induced expression of IL-6 and KC
was reduced at 3 h (more so in TLR2/ mice) but increased
at 24 h toward levels seen in WT mice. This temporal pattern
is reminiscent of that observed with lavage neutrophilia. Be-
cause KC and IL-6 are cytokines that have been implicated in
ozone-induced neutrophilia (18, 19), it would be reasonable to
hypothesize that TLR2 and TLR4 are important in accelerating
Downloaded from http://jap.physiology.org/ by 10.220.33.2 on November 23, 2017
the induction of these cytokines. The measurement of IL-6
protein in BAL fluid at 20 24 h corroborates well with the
gene expression in the lungs. These studies confirm the essen-
tial role of MyD88 in regulating IL-6 and KC production
induced by ozone.
Our data therefore indicate that MyD88 is most important
for ozone-induced AHR, neutrophilic inflammation, and KC
and IL-6 expression. Thus, following activation of TLR2 or
TLR4, MyD88 is recruited to these receptor complexes, and
Fig. 3. A: protein levels in bronchoalveolar lavage (BAL) fluid, 20 24 h
following exposure to ozone, was increased in all 4 strains of mice. B: IL-6
levels were increased in WT, TLR4/, and TLR2/ mice after ozone
exposure but not in MyD88/ mice. Data are expressed as means SE. *P
0.05, **P 0.01, ***P 0.001 compared with air-exposed mice of corre-
sponding strain. #P 0.05 compared with ozone-exposed WT mice.
103 OCTOBER 2007 www.jap.org
 ROLE OF TLRs AND MyD88 AFTER OZONE EXPOSURE 1193
and MyD88. However, what has not been determined is
whether the gene expression is accompanied by a functional
increase of these components. The molecular mechanisms by
which oxidative stress regulates these components of the innate
immune system are unknown.
Because ozone itself is not a receptor ligand, we considered
the nature of TLR activation in this model. This model of
ozone exposure is an oxidant model since we have shown that
N-acetylcysteine can prevent ozone-induced AHR and neutro-
philia in mice (Leung SY, Blanc FX, Williams A, and Chung
KF, personal communication). Activation of TLR4 particularly
by endogenous ligands other than bacterial components such as
hyaluronan, heat shock proteins, fibronectin, fibrinogen, and
surfactant protein A has been reported (11, 16, 26, 32, 35, 37).
Increased levels of hyaluronan and fibronectin have been
reported following ozone exposure (7, 22) and could therefore
activate TLR4 and to a lesser extent TLR2. Recently, oxidative
stress in the form of hydrogen peroxide has been shown to

Downloaded from http://jap.physiology.org/ by 10.220.33.2 on November 23, 2017

cause the recruitment of TLR4 from cytoplasmic compart-
ments to the cell surface into lipid rafts, conferring increased
responsiveness to stimulation with TLR4 ligands such as lipo-
polysaccharide (29). This mechanism may also interact with
Fig. 4. Time-dependent effect of ozone on IL-6 and keratinocyte chemoat-
tractant (KC) expression. We measured time-dependent changes in expression
of IL-6 (A) and KC (B) in lung tissue homogenates from ozone- or air-exposed
WT, TLR2/, TLR4/, and MyD88/ mice at 3 h and 20 24 h following
exposure. IL-6 mRNA expression was increased by ozone at 3 h in WT (P
0.05, n 6) and TLR4/ (P 0.05, n 6) mice compared with air-exposed
controls. Ozone-induced KC expression was blunted in TLR2/ (P 0.05,
n 6) and TLR4/ (P 0.05, n 6) mice compared with WT at 3 h. Data
are expressed as means SE. *P 0.05 compared with air-exposed mice of
corresponding strain. #P 0.05 compared with ozone-exposed WT mice at
20 24 h. P 0.05 compared with ozone-exposed WT at 3 h.

this step appears to be crucial for mediating the oxidant effects

of ozone in the lungs.
It is interesting that ozone exposure itself importantly mod-
ulates the expression of TLR2, TLR4, and MyD88, effects that
need to be taken into account in the interpretation of the results
we have obtained. Thus, in TLR2/ mice, as expected, the
expression of baseline and of ozone-induced TLR-2 was abro-
gated, while in TLR4/ mice, the expression of TLR2 was
significantly increased at 3 h with a pattern similar to that
found in WT mice. Conversely, in TLR4/ mice, TLR4
expression was ablated at baseline and after ozone exposure
but increased after ozone exposure in TLR2/ mice, similar
to WT mice, albeit nonsignificantly. Of greater significance is
the significant expression of MyD88 in WT mice exposed to
ozone particularly at 24 h, an effect that is preserved in
TLR2/ and TLR4/ mice; as expected, the expression of
MyD88 was virtually ablated in MyD88 mice following ozone
exposure at 24 h. It is of interest that the high levels of MyD88
expression in the lungs of ozone-exposed TLR2/ and
TLR4/ mice were associated with lack of AHR, likely to be
due to the suppressed levels of upstream TLR2 and TLR4 Fig. 5. mRNA expression for TLR2, TLR4, and MyD88. These were in-
receptors, respectively. On the other hand, in terms of the creased after ozone exposure in WT mice but not in their respective knockout
neutrophilic response, it is possible that its persistence in the strains. MyD88 mRNA expression was increased at 3 h and at 20 24 h
lungs of ozone-exposed TLR2/ and TLR4/ mice may be following ozone in TLR2/ and TLR4/ mice. Data are expressed as
means SE. Similar numbers of mice as in Fig 4. *P 0.05 compared with
related to the upregulation of MyD88. This is the first time that air-exposed mice of corresponding strain at corresponding time point. P
an oxidant stress has been shown to induce the expression of 0.01 compared with ozone-exposed WT mice at 3 h. #P 0.05, ##P 0.01
three components of the TLR pathway, namely, TLR2, TLR4, compared with ozone-exposed WT mice at 20 24 h.

J Appl Physiol VOL 103 OCTOBER 2007 www.jap.org

1194 ROLE OF TLRs AND MyD88 AFTER OZONE EXPOSURE
the increased gene expression of TLR2, TLR4, and MyD88
observed in our study following oxidant stress induced by
ozone. It is possible ozone itself or secondary oxidizing species
generated by ozone may oxidize one or all TLRs, in turn
altering the affinity of the receptor(s) for adapter proteins, such
as MyD88, thereby facilitating and exaggerating TLR signal-
ing. So far, no evidence is available to support this.
In conclusion, we report that TLR2, TLR4, and MyD88 are
involved in the development of ozone-induced AHR; in par-
ticular, the common adapter protein MyD88 is most crucial for
not only ozone-induced AHR but also for the induction of
neutrophilia and the cytokines IL-6 and KC.
ACKNOWLEDGMENTS
We thank Dr. Caetano Reiss e Souza and Dr. Neil Rogers of the Cancer
Research Institute, London, UK, for supplying us with adult MyD88/ mice.
REFERENCES
1. Adachi O, Kawai T, Takeda K, Matsumoto M, Tsutsui H, Sak-
agami M, Nakanishi K, Akira S. Targeted disruption of the MyD88
gene results in loss of IL-1- and IL-18-mediated function. Immunity 9:
143150, 1998.
2. Balmes JR, Aris RM, Chen LL, Scannell C, Tager IB, Finkbeiner W,
Christian D, Kelly T, Hearne PQ, Ferrando R, Welch B. Effects of
ozone on normal and potentially sensitive human subjects. I. Airway
inflammation and responsiveness to ozone in normal and asthmatic sub-
jects. Res Rep Health Eff Inst 137, 1997.
3. Becker S, Mundandhara S, Devlin RB, Madden M. Regulation of
cytokine production in human alveolar macrophages and airway epithelial
cells in response to ambient air pollution particles: Further mechanistic
studies. Toxicol Appl Pharmacol 207: 269 275, 2005.
4. Bhalla DK, Gupta SK. Lung injury, inflammation, and inflammatory
stimuli in rats exposed to ozone. J Toxicol Environ Health A 59: 211228,
2000.
5. Bhalla DK, Reinhart PG, Bai C, Gupta SK. Amelioration of ozone-
induced lung injury by anti-tumor necrosis factor-. Toxicol Sci 69:
400 408, 2002.
6. Cho HY, Zhang LY, Kleeberger SR. Ozone-induced lung inflammation
and hyperreactivity are mediated via tumor necrosis factor- receptors.
Am J Physiol Lung Cell Mol Physiol 280: L537L546, 2001.
7. Choi AM, Elbon CL, Bruce SA, Bassett DJ. Messenger RNA levels of
lung extracellular matrix proteins during ozone exposure. Lung 172:
1530, 1994.
8. Eiswerth ME, Douglass Shaw W, Yen ST. Impacts of ozone on the
activities of asthmatics: revisiting the data. J Environ Management 77:
56 63, 2005.
9. Fabbri LM, Aizawa H, Alpert SE, Walters EH, OByrne PM, Gold
BD, Nadel JA, Holtzman MJ. Airway hyperresponsiveness and changes
in cell counts in bronchoalveolar lavage after ozone exposure in dogs. Am
Rev Respir Dis 129: 288 291, 1984.
10. Galan I, Tobias A, Banegas JR, Aranguez E. Short-term effects of air
pollution on daily asthma emergency room admissions. Eur Respir J 22:
802 808, 2003.
11. Guillot L, Balloy V, McCormack FX, Golenbock DT, Chignard M,
Si-Tahar M. Cutting edge: the immunostimulatory activity of the lung
surfactant protein-A involves Toll-like receptor 4. J Immunol 168: 5989
5992, 2002.
12. Haddad EB, Salmon M, Koto H, Barnes PJ, Adcock I, Chung KF.
Ozone induction of cytokine-induced neutrophil chemoattractant (CINC)
and nuclear factor-kappa b in rat lung: inhibition by corticosteroids. FEBS
Lett 379: 265268, 1996.
13. Hollingsworth JW II, Cook DN, Brass DM, Walker JKL, Morgan DL,
Foster WM, Schwartz DA. The role of Toll-like receptor 4 in environmental
airway injury in mice. Am J Respir Crit Care Med 170: 126 132, 2004.
14. Kleeberger SR, Reddy S, Zhang LY, Jedlicka AE. Genetic susceptibil-
ity to ozone-induced lung hyperpermeability: role of Toll-like receptor 4.
Am J Respir Cell Mol Biol 22: 620 627, 2000.
J Appl Physiol VOL 103 OCTOBER 2007
15. Inoue H, Aiziwa H, Nakano H, Matsumoto K, Kuwano K, Nadel JA,
Hara N. Nitric oxide synthase inhibitors attenuate ozone-induced airway
inflammation in guinea pigs. Possible role of interleukin-8. Am J Respir
Crit Care Med 161: 249 256, 2000.
16. Jiang D, Liang J, Fan J, Yu S, Chen S, Luo Y, Prestwich GD,
Mascarenhas MM, Garg HG, Quinn DA, Homer RJ, Goldstein DR,
Bucala R, Lee PJ, Medzhitov R, Noble PW. Regulation of lung injury
and repair by Toll-like receptors and hyaluronan. Nat Med 11: 11731179,
2005.
17. Johnston CJ, Stripp BR, Reynolds SD, Avissar NE, Reed CK, Finkel-
stein JN. Inflammatory and antioxidant gene expression in C57BL/6J
mice after lethal and sublethal ozone exposures. Exp Lung Res 25: 8197,
1999.
18. Johnston RA, Mizgerd JP, Shore SA. CXCR2 is essential for maximal
neutrophil recruitment and methacholine responsiveness after ozone ex-
posure. Am J Physiol Lung Cell Mol Physiol 288: L61L67, 2005.
19. Johnston RA, Schwartzman IN, Flynt L, Shore SA. Role of interleu-
kin-6 in murine airway responses to ozone. Am J Physiol Lung Cell Mol
Physiol 288: L390 L397, 2005.
20. Kleeberger SR, Reddy S, Zhang LY, Jedlicka AE. Genetic susceptibil-
ity to ozone-induced lung hyperpermeability. Role of Toll-like receptor 4.
Downloaded from http://jap.physiology.org/ by 10.220.33.2 on November 23, 2017
Am J Respir Cell Mol Biol 22: 620 627, 2000.
21. Koto H, Salmon M, Haddad e Huang TJ, Zagorski J, Chung KF. Role
of cytokine-induced neutrophil chemoattractant (CINC) in ozone-induced
airway inflammation and hyperresponsiveness. Am J Respir Crit Care
Med 156: 234 239, 1997.
22. Mayer D, Branscheid D. Exposure of human lung fibroblasts to ozone:
cell mortality and hyaluronan metabolism. J Toxicol Environ Health 35:
235246, 1992.
23. Medina-Ramon M, Zanobetti A, Schwartz J. The effect of ozone and
PM10 on hospital admissions for pneumonia and chronic obstructive
pulmonary disease: a national multicity study. Am J Epidemiol 163:
579 588, 2006.
24. Nath P, Eynott P, Leung SY, Adcock IM, Bennett BL, Chung KF.
Potential role of c-Jun NH2-terminal kinase in allergic airway inflamma-
tion and remodelling: effects of SP600125. Eur J Pharmacol 506: 273
283, 2005.
25. Ohashi PS, DeFranco AL. Making and breaking tolerance. Curr Opin
Immunol 14: 744 759, 2002.
26. Okamura Y, Watari M, Jerud ES, Young DW, Ishizaka ST, Rose J,
Chow JC, Strauss JF III. The extra domain A of fibronectin activates
Toll-like receptor 4. J Biol Chem 276: 10229 10233, 2001.
27. Peel JL, Tolbert PE, Klein M, Metzger KB, Flanders WD, Todd K,
Mulholland JA, Ryan PB, Frumkin H. Ambient air pollution and
respiratory emergency department visits. Epidemiology 16: 164 174,
2005.
28. Pendino KJ, Shuler RL, Laskin JD, Laskin DL. Enhanced production
of interleukin-1, tumor necrosis factor-alpha, and fibronectin by rat lung
phagocytes following inhalation of a pulmonary irritant. Am J Respir Cell
Mol Biol 11: 279 286, 1994.
29. Powers KA, Szaszi K, Khadaroo RG, Tawadros PS, Marshall JC,
Kapus A, Rotstein OD. Oxidative stress generated by hemorrhagic shock
recruits Toll-like receptor 4 to the plasma membrane in macrophages. J
Exp Med 203: 19511961, 2006.
30. Seltzer J, Bigby BG, Stulbarg M, Holtzman MJ, Nadel JA, Ueki IF,
Leikauf GD, Goetzl EJ, Boushey HA. O3-induced change in bronchial
reactivity to methacholine and airway inflammation in humans. J Appl
Physiol 60: 13211326, 1986.
31. Shore SA, Johnston RA, Schwartzman IN, Chism D, Krishna Murthy
GG. Ozone-induced airway hyperresponsiveness is reduced in immature
mice. J Appl Physiol 92: 1019 1028, 2002.
32. Smiley ST, King JA, Hancock WW. Fibrinogen stimulates macrophage
chemokine secretion through Toll-like receptor 4. J Immunol 167: 2887
2894, 2001.
33. Stenfors N, Pourazar J, Blomberg A, Krishna MT, Mudway I, Helle-
day R, Kelly FJ, Frew AJ, Sandstrom T. Effect of ozone on bronchial
mucosal inflammation in asthmatic and healthy subjects. Respir Med 96:
352358, 2002.
34. Takeuchi O, Hoshino K, Kawai T, Sanjo H, Takada H, Ogawa T,
Takeda K, Akira S. Differential roles of TLR2 and TLR4 in recognition
of gram-negative and gram-positive bacterial cell wall components.
Immunity 11: 443 451, 1999.
www.jap.org
 ROLE OF TLRs AND MyD88 AFTER OZONE EXPOSURE 1195
35. Taylor KR, Trowbridge JM, Rudisill JA, Termeer CC, Simon JC, 38. Vagaggini B, Carnevali S, Macchioni P, Taccola M, Fornai E, Bacci E,
Gallo RL. Hyaluronan fragments stimulate endothelial recognition of Bartoli ML, Cianchetti S, Dente FL, Di Franco A, Giannini D,
injury through TLR4. J Biol Chem 279: 17079 17084, 2004. Paggiaro PL. Airway inflammatory response to ozone in subjects with
36. Uematsu S, Akira S. The role of Toll-like receptors in immune disorders. different asthma severity. Eur Respir J 13: 274 280, 1999.
Expert Opinion Biol Ther 6: 203214, 2006. 39. Zhang LY, Levitt RC, Kleeberger SR. Differential susceptibility to
37. Vabulas RM, Wagner H, Schild H. Heat shock proteins as ligands of ozone-induced airways hyperreactivity in inbred strains of mice. Exp Lung
toll-like receptors. Curr Top Microbiol Immunol 270: 169 184, 2002. Res 21: 503518, 1995.

Downloaded from http://jap.physiology.org/ by 10.220.33.2 on November 23, 2017

J Appl Physiol VOL 103 OCTOBER 2007 www.jap.org