See related commentary on pg 1026 ORIGINAL ARTICLE

Skin Commensal Malassezia globosa

Secreted Protease Attenuates
Staphylococcus aureus Biofilm Formation
Hao Li1, Bee Na Goh1, Wooi Keong Teh2, Zhenze Jiang3, Joleen Pei Zhen Goh4, Amelia Goh5,
Guangxi Wu6, Shawn S. Hoon1, Manfred Raida7, Andrea Camattari5, Liang Yang2,
Anthony J. O’Donoghue3 and Thomas L. Dawson, Jr.4,8

Skin provides the first defense against pathogenic micro-organisms and is also colonized by a diverse micro-
biota. Phylogenetic analysis of whole skin microbiome at different skin sites in health and disease has
generated important insights on possible microbial involvement in modulating skin health. However, func-
tional roles of the skin microbial community remain unclear. The most common sebaceous skin commensal
yeasts are the basidiomycetes, Malassezia. Here, we characterized the dominant secreted Malassezia globosa
protease in culture and subsequently named it Malassezia globosa Secreted Aspartyl Protease 1 (MgSAP1). We
defined recombinant MgSAP1’s substrate cleavage profile using an unbiased, mass-spectrometry
based
technique. We show that this enzyme is physiologically relevant as mgsap1 expression was detected on at least
one facial skin site of 17 healthy human volunteers. In addition, we demonstrated that this protease rapidly
hydrolyzes Staphylococcus aureus protein A, an important S. aureus virulence factor involved in immune
evasion and biofilm formation. We further observed that MgSAP1 has anti-biofilm properties against S. aureus.
Taken together, our study defines a role for the skin fungus Malassezia in inter-kingdom interactions and
suggests that this fungus and the enzymes it produces may be beneficial for skin health.
Journal of Investigative Dermatology (2018) 138, 1137e1145; doi:10.1016/j.jid.2017.11.034

INTRODUCTION 2016). While advancing our knowledge of microbial popu-

Our skin harbors a rich and diverse community of
microbes—bacteria, viruses, and fungi—collectively known
as the skin microbiome (Grice and Segre, 2011; Turnbaugh
et al., 2007). Understanding the roles these cutaneous mi-
crobial communities play in influencing human skin health is
important, especially in the etiology and treatment of skin
diseases. Culture-independent molecular techniques coupled
with next-generation sequencing have enabled detailed
characterization of skin microbiome composition in healthy
and diseased cutaneous surfaces (Costello et al., 2009;
Findley et al., 2013; Gemmer et al., 2002; Grice et al.,
2009; Human Microbiome Project, 2012; Oh et al., 2014,
1
Molecular Engineering Laboratory, Biomedical Sciences Institute, Agency
for Science Technology and Research, Singapore; 2Singapore Centre for
Environmental Life Sciences Engineering, Nanyang Technological
University, Singapore; 3Skaggs School of Pharmacy, University of
California-San Diego, La Jolla, California; 4Institute of Medical Biology
Agency for Science Technology and Research, Singapore; 5Bioprocessing
Technology Institute, Agency for Science Technology and Research,
Singapore; 6Genome Institute of Singapore, Agency for Science Technology
and Research, Singapore; 7Life Sciences Institute, National University of
Singapore, Singapore; and 8Department of Drug Discovery, School of
Pharmacy, Medical University of South Carolina, Charleston, South
Carolina, USA
Correspondence: Hao Li, Molecular Engineering Laboratory, Biomedical
Sciences Institute, Agency for Science Technology and Research, 61 Biopolis
Way, Singapore. E-mail: li_hao@bmsi.a-star.edu.sg
Abbreviations: MgSAP1, Malassezia globosa Secreted Aspartyl Protease 1;
qPRC, quantitative PCR; SpA, Staphylococcus aureus protein A
Received 31 August 2017; revised 23 November 2017; accepted 30
November 2017; accepted manuscript published online 12 December 2017;
corrected proof published online 17 February 2018
lation distribution at specific skin sites compared to culture-
based studies, these surveys provide limited information on
the functional roles of the skin microbial community.
The majority of microbiome studies to date have focused
on skin bacteria, as it is the most abundant microbial class on
the skin (Huffnagle and Noverr, 2013). However, the skin
fungal community is an important constituent, especially
because the skin surface has higher fungal abundance than
other body sites (Oh et al., 2014). In recent years, several
groups have characterized skin fungal communities in detail
(de Hoog et al., 2017; Findley et al., 2013; Underhill and
Iliev, 2014). Malassezia is the dominant skin-residing fungal
class in mammals, and is particularly enriched in sebaceous
sites, such as scalp, facial skin, and back (Cabañes, 2014;
Gaitanis et al., 2012; Gupta et al., 2004). While Malassezia
spp. are commonly regarded as commensals, they are also
associated with skin disorders, such as seborrhoeic derma-
titis, pityriasis versicolor, and atopic dermatitis (Chng et al.,
2016; Saunders et al., 2012; Tajima et al., 2008; Velegraki
et al., 2015).
Our previous Malassezia comparative genomics high-
lighted the importance of secretory enzymes across 14 spe-
cies of this fungal class (Wu et al., 2015). We reasoned that
interactions with the host and members of the microbial
community likely necessitate secretion of extracellular fac-
tors (Peleg et al., 2010). We had previously profiled the
secretome of Malassezia globosa, one of the two
most common human skin-residing Malassezia species
(Xu et al., 2007). Fungi are known to secrete enzymes and, in
particular, proteases that are capable of degrading proteins at

ª 2017 The Authors. Published by Elsevier, Inc. on behalf of the Society for Investigative Dermatology. www.jidonline.org 1137
 H Li et al.
Malassezia Protease Inhibits S. aureus Biofilm
the host
fungal interface (Clarke et al., 2016; Koziel and
Potempa, 2012; Naglik et al., 2003; O’Donoghue and
Knudsen, 2015). We hypothesize that Malassezia-secreted
proteases likely have crucial roles in interactions with the
host and microbial community spatially located in the same
skin niche.
In this study, we used protease activity assays and gene
expression data to detect and identify an abundant aspartyl
protease in M. globosa
conditioned media. The protein was
previously defined as the hypothetical aspartyl protease,
MGL_1932. This active enzyme, which we have named
Malassezia globosa Secreted Aspartyl Protease 1 (MgSAP1),
was found to contribute the majority of the secreted protease
activity detected in the culture. We performed detailed
biochemical characterization and determined its substrate
cleavage profile. By directly sampling from healthy human
facial sites, we were able to detect transcript expression of
mgsap1 in 17 out of 18 volunteers. We showed that recom-
binant MgSAP1 degraded a major virulence protein of
Staphylococcus aureus and blocked its biofilm proliferation.
Taken together, this study defines a role for Malassezia-
secreted proteases in inter-kingdom interactions that has
potential implications for skin health.
RESULTS
Expression of M. globosa Secreted Proteases
Our analysis of the M. globosa CBS 7966 genome identified
21 open reading frames encoding putative secreted proteases
(Xu et al., 2007). Of these 21 putative proteases, 15 were
predicted to be aspartyl proteases. Using our previous global
RNA expression data (Wu et al. 2015), we determined that
aspartyl proteases MGL_3328 and MGL_1932 were highly
expressed during exponential growth in rich (modified
Dixon) media (Figure 1a). In minimal media, we again
observed that the three most highly expressed extracellular
proteases are aspartyl proteases—MGL_0534, MGL_1932,
and MGL_3328 (Figure 1a). As aspartyl proteases dominate
the expression profile, we compared these 15 predicted
M. globosa proteases with other aspartyl proteases from hu-
man and eukaryotic microbes. Most proteases of fungal
origin cluster into a separate clade from human aspartyl
proteases (Figure 1b). However, 12 of the M. globosa aspartyl
proteases cluster and are distinct from other secreted fungal
protease, such as the well-characterized Candida albicans
secreted aspartyl proteases.
Aspartyl Protease Activity Is Dominant in Culture
To determine the functional activity of the secreted proteases,
we assayed the supernatant (Supplementary Figure S1a
online) obtained from M. globosa CBS7966 grown in rich
media against a diverse panel of 19 internally quenched
fluorescent substrates. We observed strong cleavage of
RPKPYAvWM (S9) and RPKPVEvWR (S12) substrates
(v: norvaline) (Figure 2a). We analyzed the extracellular
proteolytic activity throughout the growth phases of
M. globosa and determined that activity increases during log
phase (0e16 hours), but decreases sharply from late log
phase to stationary phase (Figure 2b).
To determine the class of protease responsible for this ac-
tivity, we treated the conditioned media with class-specific
1138 Journal of Investigative Dermatology (2018), Volume 138
protease inhibitors. Inhibitors of serine proteases (AEBSF),
cysteine proteases (E-64), and metalloproteases (EDTA) had
no effect on protease activity. The specific aspartyl protease
inhibitor pepstatin A blocked protease activity as assessed by
both substrates S9 and S12 (Figure 2c, Supplementary
Figure S1b). These studies correlate with our RNA expres-
sion data that showed abundant expression of M. globosa
genes encoding aspartyl proteases.
Because pepstatin A is a reversible aspartyl protease in-
hibitor, we used pepstatin A-agarose resin to selectively
enrich for the enzymes from the M. globosa
conditioned
media. We observed a dose-dependent depletion of the su-
pernatant’s proteolytic activity with increasing pepstatin
A-agarose (Supplementary Figure S1c). To our surprise, a
single protein of approximately 33 kDa was enriched from
the media (Figure 2d). The isolated enzyme cleaved the same
substrates as observed in whole culture supernatant
(Figure 2e). We further observed that this protease has a pH
optimum between 4 and 5 (Supplementary Figure S1d),
which is physiologically relevant for the acidic skin surface
(Lambers et al., 2006).
Identification and Recombinant Expression of MgSAP1
We performed in-gel trypsin digest followed by mass
spectrometry and identified the major protein isolated from
the pepstatin A-agarose enrichment to be MGL_1932
(Supplementary Figure S2 online). This protease is hereby
named MgSAP1. We further used N-terminal sequencing and
whole protein mass spectrometry to determine the sequence
of the mature protease. We found that the mature 33.27 kDa
MgSAP1 was produced by a cleavage of the prodomain be-
tween Arg88 and Asp89 (Figure 3a).
We next expressed and purified recombinant MgSAP1 in
Pichia pastoris. The full-length protein was cloned and
expressed with C-terminal hexa-histidines (Figure 3a). Thirty-
two colonies were screened for His-tag abundance using a
dot-blot (Figure 3b) and for activity using substrate S12
(Figure 3c). The clone with the highest expression and activity
was selected for subsequent assays. We also expressed re-
combinant MgSAP1 without a C-terminal tag and this protein
was enriched from the media using pepstatin A-agarose. The
untagged recombinant enzyme was found to have the same
molecular mass as the native enzyme, while the tagged protein
had an additional mass corresponding to the histidine tag
(Figure 3d). This confirmed that only the mature, active form of
each recombinant MgSAP1 was isolated from P. pastoris me-
dia. In addition, we compared the activity of the tagged and
untagged enzymes and determined they have similar catalytic
activities (Figure 3e). Due to high-protein yield in P. pastoris
and ease of purification, the MgSAP1-6xHis enzyme was used
for all downstream biochemical studies.
Substrate Profiling of Secreted Protease MgSAP1
The substrate cleavage specificity of proteases is crucial for
revealing the physiological role of proteases in health and dis-
ease. Using recombinant MgSAP1-6xHis we determined that
cleavage of both the RPKPYAvWM(S9) and RPKPVEvWR(S12)
substrates occurred between hydrophobic amino acids norva-
line(v) and tryptophan (Figure 4a, 4b). In order to uncover the
substrate specificity, we incubated MgSAP1-6xHis with a pool
of 228 synthetic tetradecapeptides containing diverse amino
 H Li et al.
Malassezia Protease Inhibits S. aureus Biofilm

a 8000
Aspartyl Metallo Serine

Rich media
Minimal media
6000
RPKM

4000

2000

0
34

99

60

32

25

95

27

28

29

30

31

65

53

43

67

66

06

47

49

15

85
05

05

12

19

21

31

33

33

33

33

33

35

40

42

42

08

25

36

36

08

02
L_

L_

L_

L_

L_

L_

L_

L_

L_

L_

L_

L_

L_

L_

L_

L_

L_

L_

L_

L_

L_
G

G
M

M
b Human beta-secretase 1 BACE1
Human cathepsin D CTSD
74 Human renin REN
98
87 Plasmodium falciparum 3D7 plasmepsin-1 PF14_0076
Human cathepsin E CTSE
100 Human gastricsin PGC
93 95
Human pepsin A-3 PGA3
Saccharomyces cerevisiae ATCC 204508 saccharopepsin PEP4
100 Ustilago maydis FGSC 9021 UMAG_04926
96
M. globosa CBS 7966 MGL_3195
Candida albicans candidapepsin-1 SAP3
97
Candida albicans candidapepsin-1 SAP2
96
Candida albicans candidapepsin-1 SAP1
100 Candida albicans candidapepsin-1 SAP4
80
Candida albicans candidapepsin-1 SAP6
98
Candida albicans candidapepsin-1 SAP5
Aspergillus fumigatus CBS 101355 aspergillopepsin-1 pepA
100
Magnaporthe oryzae FGSC8958 MGG_06647
Ustilago maydis FGSC 9021 UMAG_00064
93
89 M. globosa CBS 7966 MGL_1932 (MgSAP1)
87 96 M. globosa CBS 7966 MGL_4053
M. globosa CBS 7966 MGL_2125
100
43 M. globosa CBS 7966 MGL_4267
100 M. globosa CBS 7966 MGL_4243
49
M. globosa CBS 7966 MGL_3327
84
49 M. globosa CBS 7966 MGL_3328
62
M. globosa CBS 7966 MGL_3329
66
63 M. globosa CBS 7966 MGL_3565
M. globosa CBS 7966 MGL_3331
100
100 M. globosa CBS 7966 MGL_3330
M. globosa CBS 7966 MGL_0534
Ustilago maydis FGSC 9021 UMAG_02597
100
M. globosa CBS 7966 MGL_1260
90 Ustilago maydis FGSC 9021 UMAG_11908
99
94 M. globosa CBS 7966 MGL_0599
Cryptococcus neoformans CBS10515 CNAG_05872
0.1

Figure 1. Secreted proteases from Malassezia globosa CBS 7966. (a) Reads per kilobase of transcript per million mapped reads (RPKM) of M. globosa
transcripts of secreted proteases in the exponential culture growth phase of rich (modified Dixon media) or minimal media. The National Center
for Biotechnology Information gene locus tag is used for each protease and the specific class of protease is indicated. Error bars represent standard
deviation from n ¼ 3 biological replicates for rich media and n ¼ 4 biological replicates for minimal media. (b) Unrooted phylogenetic tree of the 15
M. globosa
secreted aspartyl proteases, selected fungal proteases, and several well-characterized aspartyl proteases. Number at each node indicates the
bootstrap value.

www.jidonline.org 1139
 H Li et al.
Malassezia Protease Inhibits S. aureus Biofilm

a 3 b
10 5

8 4

Activity (RFU/sec)
2
Activity (RFU/sec)

6 3

OD600
1 4 2

2 1

0 0 0
0 10 20 30 40 50
Time (hours)
S1
S2
S3
S4
S5
S6
S7
S8
S9

0
1
2
3
4
5
6
7
8
9
S1
S1
S1
S1
S1
S1
S1
S1
S1
S1
OD600 S9 S12
Fluorogenic substrates

c d e 3
I E
150
% activity of DMSO control

160
2

Activity (RFU/sec)
100 80
60

50 1
40
*
* 30
0
20 0
S5 S10
Substrates
S1
S2
S3
S4
S5
S6
S7
S8
S9
0
1
2
3
4
5
6
7
8
9
S1
S1
S1
S1
S1
S1
S1
S1
S1
S1
AEBSF E64
EDTA Pepstatin A Fluorogenic substrates

Figure 2. Detection of protease activities in Malassezia globosa culture supernatant. (a) Protease activity of 24-hour culture supernatant assessed using 19
quenched substrates. (b) S9 and S12 were used to determine proteolytic activity of culture supernatant isolated from indicated growth (assessed by OD600) time
point. (c) Twenty-four hour culture supernatant was treated with AEBSF (2 mM), E64 (20 mM), EDTA (10 mM), and pepstatin A (50 mM) and the resulting
proteolytic activity was determined. *P < 0.005 from unpaired Student t test. (d) Silver stain of SDS-PAGE of the extracellular media (input-I) and the enriched
fraction (elute-E) from pepstatin A-agarose affinity purification. (e) Same as in (a), except the enriched fraction from (d) was used for the assay. Error bars
represent standard deviation from n ¼ 3.

acid sequences. Degradation of peptides was monitored using genomic DNA contamination. We used M. globosa actin
liquid chromatography tandem mass spectrometry at multiple (mgl_1986) as a reference gene to normalize for expression of
time intervals between 5 minutes and 20 hours. An iceLogo plot MgSAP1 in all samples. Furthermore, melt curve analysis was
that considers both cleaved and uncleaved positions in the performed for all samples and selected qPCR products were
peptide library was employed to represent the fold-enrichment cloned and sequenced to ensure that the amplified sequence
and de-enrichment of amino acids flanking each cleavage site has a good match to the expected gene fragment
(Figure 4c). We determined that MgSAP1 has a clear preference (Supplementary Figure S3 online).
for aromatic residues in the P1ʹ position directly adjacent to the M. globosa was found on the scalp of 16 individuals (89%)
cleavage site and, in particular, Trp. In addition, it generally and on the retroauricular crease of 14 individuals (78%).
cleaved peptides containing Lys, Arg, Phe, Tyr, or Nle (norleu- Expression of mgsap1 on the nose and cheek were each
cine) in the P1 position, Nle and Glu at P2, and Arg and Val at found in only 7 individuals (39%) (Figure 5b). When
P2ʹ. expression of mgsap1 was normalized to mgl_1986 the me-
dian expression was consistent across different skin sites and
MgSAP1 Is Expressed on Human Facial Skin individuals (Figure 5c). We observed that in all samples
To determine if this enzyme is expressed on human skin, we expression of mgsap1 was detected together with the refer-
recruited 18 healthy volunteers (10 males, 8 females) and ence gene actin; absence of protease transcripts always
sampled their left facial skin at eight sites (scalp, forehead, correlated with absence or undetectable presence of
temple, ala crease, cheek, jaw, neck, and retroauricular M. globosa. In total, 17 of the 18 volunteers had at least one
crease) using tape strips (total of 144 samples, Figure 5a). sampling site positive for mgsap1 expression.
Total RNA was isolated and mgsap1 expression was quanti- We constructed a heatmap based on relative expression (in
fied by reverse transcriptase quantitative PCR (qPCR). As the ratio) of mgsap1 to M. globosa actin for each site across all
MgSAP1 transcript lacks introns, we included noereverse the volunteers (Figure 5d, Supplementary Figure S4 online).
transcriptase controls for all samples to control for possible In both the female and male volunteers, protease expression

1140 Journal of Investigative Dermatology (2018), Volume 138

 H Li et al.
Malassezia Protease Inhibits S. aureus Biofilm

1 2 3 4 Figure 3. Characterization of
a b A secreted protease MgSAP1. (a)
1 21 89 pro-MgSAP1 Domain architecture of the

P. pastoris anti-His dot blot

N SP
c H
His-tag expression (pix intensity)
B proenzyme, mature protease and
PP Protease C
C recombinant MgSAP1-6xHis. Signal
MgSAP1 peptide is predicted using SignalP. The
N Protease C D numbers refer to amino acid residues
MgSAP1-6xHis on the full-length MgSAP1. (b) Dot
E
Protease
blot image using anti-6x His antibody
N C
F of each Pichia pastoris colony
6xHis
transformed with MgSAP1-6xHis
G
construct. (c) Plot of 6x-His tag
expression in arbitrary pixel intensity

60000
from (b) against proteolytic activity
(substrate S12) of culture supernatant
d Input Elution from each colony. (d) SDS-PAGE gel of
40000
His No-His His No-His Native the extracellular media of P. pastoris
expressing MgSAP1-6xHis (His) and
R2=0.608 MgSAP1 (No His), with the
20000 corresponding purified protease. The
enriched fraction from M. globosa
culture supernatant (Native) was also
included for comparison. (e) Enzyme
-5 0 5 10 15 20 kinetics parameters of the
S12 Activity (RFU/sec) 60 kDa recombinant proteases in (d) against
substrate S12. MgSAP1, Malassezia
50 kDa
e globosa Secreted Aspartyl Protease 1.
40 kDa
His No-His
30 kDa
kcat (s-1) 3.3+/-0.1 4.3+/-0.2

Km ( µM) 3.2+/-0.2 3.4 +/- 0.2 20 kDa

15kDa

was most readily detected on scalp. We also noted that more interaction of the yeast with the external environment.
male than female volunteers were positive for M. globosa S. aureus, an opportunistic invasive skin pathogen (Daum,
gene expression. 2007; Gordon and Lowy, 2008) that co-colonizes various
skin sites with M. globosa produces a virulence factor, Protein
MgSAP1 Blocks Biofilm Formation in S. aureus A (SpA) that mediates biofilm formation (Merino et al., 2009;
The ubiquitous expression of MgSAP1 on human skin likely Speziale et al., 2014) and hinders opsonophagocytosis by
indicates that it has important roles in facilitating the immune cells (Falugi et al., 2013). SpA is an extracellular

a c Figure 4. Substrate cleavage profile

(MCA)-RPKPVEv of MgSAP1-6xHis. Mapping cleavage
54
Relative Abundance

100
S12: (MCA)-RPKPVEvWR-K(DNP) site preferences of MgSAP1. Mass

nn
80 spectrometry analysis of (a)
60 27 RPKPVEvWR (S12) and (b)
Percent difference

40 RPKPYAvWM (S9) substrates before

20 20 min n
(in blue) and after incubation (in red)
0 0 min P4 P3 P2 P1 * P1’ P2’ P3’ P4’ with MgSAP1. Both peptides were
13 14 15 16 17 18
hydrolyzed between norvaline (v) and
Retention time (minutes)
tryptophan (W). (c) iceLogo plot
-27 illustrating the substrate specificity
b profile of MgSAP1. Only the top 44
(MCA)-RPKPYAv
n=44
Relative Abundance

S9: (MCA)-RPKPYAvWM-K(DNP) -54 cleavage sites ranked by Kcat/km

100
80 values were used for iceLogo plot. Red
60 asterisk represents the site of peptide
40 WM-K(DNP) bond cleavage. Lowercase “n”
.

20 . 5 min corresponds to norleucine. MgSAP1,

0 0 min
Malassezia globosa Secreted Aspartyl
13 14 15 16 17 18 19 20 21
Protease 1.
Retention time (minutes)

www.jidonline.org 1141
 H Li et al.
Malassezia Protease Inhibits S. aureus Biofilm

a b c

expression
100 3

% of population positive
80 2

mgsap1
60
1
40

Normalized
0
20

0 -1
A B C D E F G H A B C D E F G H
Site Site

d Male Female
0
A >0-0.2

Relative mgsap1 expression

B 0.2-0.4
0.4-0.6
C
0.6-0.8
D
0.8-1
E 1-1.2

F 1.2-1.4
1.4-1.6
G
1.6-1.8
H 1.8-2
HV1 HV2 HV3 HV4 HV5 HV6 HV7 HV8 HV9 HV10 HV11 HV12 HV13 HV14 HV15 HV16 HV17 HV18

Figure 5. MgSAP1 is expressed on facial skin of healthy volunteers. (a) Illustration of the sites sampled on the volunteers. Sites are: scalp (A), forehead (B),
temple (c), ala crease (D), cheek (E), jaw (F), neck (G) and retroauricular crease (H). (b) Percent of sampled volunteers positive for Malassezia globosa gene
expression (as assessed by M. globosa actin mgl_1986) at each site. (c) Box plot on the relative gene expression of mgsap1 (normalized to mgl_1986) at each site
for all the sampled volunteers. (d) Heatmap of the relative gene expression of mgsap1 (as in c) of each site for all volunteers. MgSAP1, Malassezia globosa
Secreted Aspartyl Protease 1.

protein rich in lysine residues, making it a possible substrate
of MgSAP1, which has strong affinity for cleavage between
Lys and aromatic residues.
We incubated recombinant SpA with MgSAP1-6xHis at a
range of substrate to protease ratios (50, 100, 200, 500,
1,000) for 2 hours at pH 5.0 and 30 C, a physiologically
relevant condition. We observed degradation of recombinant
SpA even when the protease is 200-fold less abundant
(Figure 6a). We then performed a time course of recombinant
SpA degradation with the substrate concentration at 100-fold
that of the recombinant protease, and observed that recom-
binant SpA is fully hydrolyzed within 4 hours (Figure 6b). No
degradation was observed when MgSAP1-6xHis was heat
inactivated, or with cathepsin D, an aspartyl protease pro-
duced by keratinocytes (Egberts et al., 2004).
Because SpA is an extracellular protein involved in biofilm
formation, we next sought to determine whether MgSAP1
interfered with S. aureus biofilm formation. We incubated
200 ng/ml active or heat-inactivated MgSAP1-6xHis for 24
hours with S. aureus 15981 and imaged the S. aureus after
staining with SYTO9 green fluorescent stain. We observed
significant reduction in biofilm volume with MgSAP1-6xHis
(Figure 6c, 6d), but not with heat-inactivated protease,
demonstrating that reduced biofilm formation was dependent
on protease activity. Treatment of S. aureus growing in
planktonic culture with MgSAP1-6xHis did not affect growth
(Supplementary Figure S5 online), indicating that this enzyme
cleaved one or more S. aureus proteins that were specific to
biofilm formation. Furthermore, immunoblot of the extra-
cellular medium and cell wall fractions of S. aureus subjected
to the same protease treatment mentioned revealed that
MgSAP1 degraded SpA in situ (Figure 6e, 6f). We observed
that the extent of degradation for the secreted SpA in the
culture medium was slightly higher than that of the SpA on
the cell wall (Figure 6f).
DISCUSSION
Fungi, in particular the skin-dominant class Malassezia, are
important members of the skin microbiome (Limon et al.,
2017). In this study, we show that an aspartyl protease
highly abundant at the transcript and protein level in
M. globosa culture is expressed on healthy human skin.
Extensive biochemical characterization of MgSAP1 further
indicated that this protease degrades a major virulence pro-
tein of S. aureus and inhibits biofilm formation of this
opportunistic pathogen.
We focused on MgSAP1 as it has abundant mRNA
expression that correlates well to the high protein level in
culture. The mass spectrometry approach we adopted to
uncover the substrate specificity of aspartyl proteases was
previously used for Candida albicans and Cryptococcus
neoformans (Clarke et al., 2016; Winter et al., 2016).

1142 Journal of Investigative Dermatology (2018), Volume 138

 H Li et al.
Malassezia Protease Inhibits S. aureus Biofilm

a Figure 6. Malassezia globosa

c secreted protease degrades
Protease MgSAP1 CatD p>0.1 Staphylococcus aureus protein A and
Ratio of rSpA to protease inhibits biofilm formation. (a)

% Biofilm volume of control

150 p<0.001
0 1000 500 200 100 50 50 50 MgSAP1-6xHis incubated with
40kDa different amounts of recombinant
100 S. aureus protein A (rSpA).
HI HI-heat inactivated MgSAP1-6xHis;
50 Cat D- recombinant human cathepsin
Time (h)
b D. (b) Time-dependent degradation of
0 0.5 1 2 4 6 8 24 rSpA by MgSap1-6xHis. (c) Volume of
40kDa
0 S. aureus biofilm quantified from
Buffer MgSAP1 HI MgSAP1 images in (d) and Figure S5b.
rSpA
(d) SYTO9 stained S. aureus at each
treatment condition. The simulated
d S. aureus + Buffer S. aureus + MgSAP1 S. aureus + HI MgSAP1 3D confocal images were generated
using Bitplane. Scale bar ¼ 10 mm.
(e) Immunoblotting in mock,
MgSAP1-6xHis or HI MgSAP1-6xHis
treated S. aureus to detect SpA in
extracellular medium and cell wall.
(f) Quantification of immunoblots as
in (e), from three biological replicates.
P-value was determined using
unpaired Student t-test. Error bars
represent standard deviation.

e f
% SpA relative to control

200 p>0.1 p>0.1

MgSAP1 – + HI
150 p<0.001 p<0.001
57kDa SpA Medium
100
57kDa SpA
Cell 50
Wall
31kDa SSL10 0
l
1

M rol

gS P1
1
M ntro
IM P
AP

AP
t
H SA

IM A
on
gS

H gS
o
C

C
g

Medium Cell wall

However, only 44 unique peptide cleavage products were
detected compared to the more than 140 cleavage products
detected with the other fungal enzymes. Human aspartyl
proteases, such as cathepsin D, cathepsin E, and gastricin, do
not hydrolyze peptides on the C-terminal side of Lys residues
(Ivry et al., 2017; Rawlings, 2016). The strong preference for
Trp in the P1ʹ position is unusual for aspartyl proteases and is
likely the reason behind the narrow specificity. Taken
together, the substrate cleavage profile of MgSAP1 is distinct
from that of human proteases, suggesting this protease
cleaves a unique set of proteins.
We assessed expression of mgsap1 on facial skin of hu-
man volunteers as these are sebaceous sites and more likely
to be abundant with Malassezia. Reverse transcriptase qPCR
allows assessment of M. globosa gene expression levels
from metabolically active M. globosa, highly relevant
considering functions of secreted proteases. From this, we
observed that the median level of MgSAP1 expression
relative to the presence of Malassezia was similar across
different skin sites and individuals suggesting basal level of
MgSAP1 expression on healthy skin. Follow-up studies that
compare protease expression in healthy subjects and pa-
tients with skin diseases may uncover a role for MgSAP1 in
disease pathogenesis.
It was initially surprising that M. globosa, a species often
associated with skin diseases, has potential beneficial roles
for the host skin environment. However, the exact roles of
Malassezia in pathogenesis remain controversial, as skin
diseases are often dependent on individual susceptibility and
environmental factors. Indeed, M. globosa has a widespread
distribution on healthy skin and is a component of the stable
skin microbiome in healthy adults (Oh et al., 2016). Chng
et al. reported that M. globosa abundance was significantly
reduced in atopic dermatitis patients relative to healthy in-
dividuals (Chng et al., 2016). More recent studies on sebor-
rhoeic dermatitis, a disease historically associated strongly
with this yeast has revealed little differences, if not slightly
less relative abundance of M. globosa compared to healthy
scalps (Tanaka et al., 2014; Xu et al., 2016). These reports
highlight that it is not only important to understand compo-
sition of the microbiome, but assessment of expression of
microbial products in situ is critical to complement

www.jidonline.org 1143
 H Li et al.
Malassezia Protease Inhibits S. aureus Biofilm
metagenomic information in understanding the underlying
causes of skin diseases.
It is also important to recognize that multiple microbial
community members co-exist on the same skin sites and
can produce exogenous factors that structure microbial
diversity (Schommer and Gallo, 2013). One example is the
secretion of Esp, a serine protease produced by Staphylo-
coccus epidermidis, that regulates nasal colonization and
biofilm formation of S. aureus (Iwase et al., 2010). While
inter-bacterium interactions are better characterized,
fungal
bacterium ecologic interactions are poorly under-
stood. Malassezia species and S. aureus share a
common skin niche in several sebaceous sites and the
anterior nare (Oh et al., 2014) and human nare coloniza-
tion by S. aureus is thought to involve establishment of
S. aureus biofilm (Iwase et al., 2010; Sugimoto et al.,
2013). It is thus tempting to postulate that Malassezia
produces exogenous factors that make it unfavorable for
S. aureus colonization.
In conclusion, we have demonstrated that M. globosa, a
fungal species prevalent on sebaceous human skin, produces
an enzyme that mediates fungal
bacterium interaction with
potential benefits for the host skin. We are currently investi-
gating the roles this protease plays in host
microbial
interactions.
MATERIALS AND METHODS
Malassezia Culture and Enrichment of Aspartyl Protease
M. globosa CBS7966 was obtained from ATCC (Manassas, VA)
(MYA-4612). M. globosa was cultured in modified Dixon media as
reported previously (DeAngelis et al., 2007). Supernatant was ob-
tained by spinning down the yeast culture at 2,000 rpm and filtering
the supernatant through 0.22-mm vacuum filter. Aspartyl proteases
were enriched from the culture supernatant using pepstatin A-
agarose resin (Sigma Aldrich, St. Louis, MO) as detailed in
Supplementary Materials and Methods (online).
Cloning and Expression of Recombinant MgSAP1
MgSAP1 was codon-optimized and synthesized as gBlock (IDT,
Singapore). Synthetic MgSAP1 genes were amplified with Q5 proof-
reading DNA polymerase (NEB, Singapore) with or without histidine
tag. Plasmid constructs were transformed in P. pastoris GS115
following the condensed transformation protocol (Lin-Cereghino
et al., 2005). Culture supernatants were harvested after 72 hours of
methanol induction and protease production was assessed by dot
blot and substrate activity assay. Details on molecular cloning and
production of MgSAP1 are found in the Supplementary Materials
and Methods.
Protease Substrate Profiling
Forty nanograms per milliliter of MgSAP1-6xHis was incubated in
triplicate with a mixture of 228 synthetic tetradecapeptides (0.5 mM
each) in 50 mM sodium citrate buffer (pH 4.2). Ten percent of the
reaction mixture was removed after 5, 15, 60, 240, and 1,200 mi-
nutes of incubation and the enzyme activity was quenched with 6.4
M GuHCl and stored immediately at
80 C. Tandem mass spec-
trometry was performed for each reaction sample (details in
Supplementary Materials and Methods) and IceLogo software was
used for visualization of amino-acid frequency surrounding the
cleavage sites.
1144 Journal of Investigative Dermatology (2018), Volume 138
Skin Sampling and Reverse Transcriptase qPCR
This study was approved by the Institutional Review Board of the
National University of Singapore under B-15-237 and all subjects
provided written, informed consent before participation.
Eighteen healthy volunteers with no obvious facial skin
conditions were recruited, sampled for 50 times at each site with
tape strips (CuDerm, Dallas, TX) and TRIZol was added before
freezing samples at
80 C. Exclusion criteria and detailed sampling
method are described in the Supplementary Materials and Methods.
Tape strips in TRIzol were thawed and bead beating was performed
on the FastPrep-24 (MP Biomedicals, Santa Ana, CA) for 30 seconds
at maximum speed at room temperature. Total RNA isolation was
performed as per manufacturer’s protocol with on-column
DNase treatment (Direct-zol RNA mini-prep kit, Zymo Research,
Irvine, CA). First-strand cDNA synthesis was performed using
random hexamers and the SuperScript III Reverse Transcriptase
kit (Thermo Fisher Scientific, Waltham, MA). Quantitative
PCR was performed with Maxima SYBR Green/ROX qPCR
Mastermix (Thermo Fisher Scientific) as per manufacturer’s protocol
on the Applied Biosystem StepOne Plus Real-Time PCR
System (Thermo Fisher Scientific), using the M. globosa actin
(mgl_1986) specific primers 50 AGAAGATCTGGCACCACACG-30 and
50 GACCAGAGGCGTACAAGGAG-30 and the mgl_1932 specific
primer 50 TTGCTGGCATGTCATTCCCT30 and 50 AAATG
GAGCGTTGAGCCTGA 30 . Controls for the qPCR are detailed in the
Supplementary Materials and Methods.
S. aureus Biofilm Assays
Overnight culture of S. aureus 15981 prepared from single colony
was diluted (1:100) in Tryptic Soy broth (pH 5.4) (BD, Franklin Lakes,
NJ). To the diluted culture, sodium citrate buffer, protease, or heat
inactivated (80 C for 10 minutes) protease was added to a final
concentration of 0.5% or 200 ng/ml, respectively. Two hundred
microliters of these prepared cultures were added to ibiTreat m-Slide
8 well (ibidi, Martinsried, Germany), and incubated at 37 C for 24
hours. The culture supernatant was removed, and the biofilms
attached to the surface were washed twice with 0.9% NaCl, before
being stained with SYTO9 (1:500 from stock) (Thermo Fisher Sci-
entific). Biofilm images were acquired using LSM780 inverted
confocal laser scanning microscopy (Carl Zeiss, Oberklochen, Ger-
many) with excitation at 488 nm. The images were processed using
Imaris version 8.2.0 (Bitplane, Belfast, UK), and subjected to biofilm
biomass quantification by using Comstat version 2.1 (www.comstat.
dk, Technical University of Denmark, Denmark), with threshold set
to 20 (Heydorn et al., 2000). Secreted proteins in the S. aureus
biofilm culture supernatant and the cell-wall anchoring proteins
were isolated as previously described (Sugimoto et al., 2013). Pro-
teins were separated by SDS-PAGE and transferred to polyvinylidene
difluoride membrane and analyzed by immunoblotting using rabbit
IgG (Sigma Aldrich, St Louis, MO). SpA expression was quantified by
ImageJ (National Institutes of Health, Bethesda, MD) and normalized
to total protein content.
Statistics
All statistical analyses in the figures are represented as mean 
standard deviation. Statistical significance, where shown, is deter-
mined using unpaired Student t test.
CONFLICT OF INTEREST
The authors state no conflict of interest.

ACKNOWLEDGMENTS
This work was supported by Singapore National Medical Research Council’s
Young Individual Research grant NMRC/OFYIRG/0041/2017 (to H.L.), UC
San Diego Skaggs School of Pharmacy start-up funds (A.J.O.) and UC San
Diego Clinical and Translational Research Institute Grant UL1TR001442
(A.J.O.).
SUPPLEMENTARY MATERIAL
Supplementary material is linked to the online version of the paper at www.
jidonline.org, and at 10.1016/j.jid.2017.11.034.
REFERENCES
Cabañes FJ. Malassezia yeasts: how many species infect humans and animals?
PLoS Pathog 2014;10:e1003892e4.
Chng KR, Tay ASL, Li C, Ng AHQ, Wang JJ, Suri BK, et al. Whole metagenome
profiling reveals skin microbiome-dependent susceptibility to atopic
dermatitis flare. Nature Microbiol 2016;1:1e10.
Clarke SC, Dumesic PA, Homer CM, O’Donoghue AJ, La Greca F, Pallova L,
et al. Integrated activity and genetic profiling of secreted peptidases in
cryptococcus neoformans reveals an aspartyl peptidase required for low
pH survival and virulence. PLoS Pathog 2016;12:e1006051e30.
Costello EK, Lauber CL, Hamady M, Fierer N, Gordon JI, Knight R. Bacterial
community variation in human body habitats across space and time. Sci-
ence 2009;326:1694e7.
Daum RS. Clinical practice. Skin and soft-tissue infections caused by methicillin-
resistant Staphylococcus aureus. N Engl J Med 2007;357:380e90.
DeAngelis YM, Saunders CW, Johnstone KR, Reeder NL, Coleman CG,
Kaczvinsky JR, et al. Isolation and expression of a Malassezia globosa
lipase gene, LIP1. J Invest Dermatol 2007;127:2138e46.
de Hoog S, Monod M, Dawson T, Boekhout T, Mayser P, Graser Y. Skin fungi from
colonization to infection. Microbiol Spectrum 2017;5:FUNK-0049-2016.
Egberts F, Heinrich M, Jensen JM, Winoto-Morbach S, Pfeiffer S, Wickei M,
et al. Cathepsin D is involved in the regulation of transglutaminase 1 and
epidermal differentiation. J Cell Sci 2004;117:2295e307.
Falugi F, Kim HK, Missiakas DM, Schneewind O. Role of protein A in the
evasion of host adaptive immune responses by Staphylococcus aureus.
mBio 2013;4:e00575e13.
Findley K, Oh J, Yang J, Conlan S, Deming C, Meyer J, et al. Topographic diversity
of fungal and bacterial communities in human skin. Nature 2013;498:367e70.
Gaitanis G, Magiatis P, Hantschke M, Bassukas ID, Velegraki A. The Malassezia
genus in skin and systemic diseases. Clin Microbiol Rev 2012;25:106e41.
Gemmer CM, DeAngelis YM, Theelen B, Boekhout T, Dawson TLJ. Fast,
noninvasive method for molecular detection and differentiation of Malas-
sezia yeast species on human skin and application of the method to
dandruff microbiology. J Clin Microbiol 2002;40:3350e7.
Gordon RJ, Lowy FD. Pathogenesis of methicillin-resistant Staphylococcus
aureus infection. Clin Infect Dis 2008;46(Suppl. 5):S350e9.
Grice EA, Kong HH, Conlan S, Deming CB, Davis J, Young AC, et al. Topo-
graphical and temporal diversity of the human skin microbiome. Science
2009;324:1190e2.
Grice EA, Segre JA. The skin microbiome. Nat Rev Microbiol 2011;9:244e53.
Gupta AK, Batra R, Bluhm R, et al. Skin diseases associated with Malassezia
species. J Am Acad Dermatol 2004;51:785e98.
Heydorn A, Nielsen AT, Hentzer M, Sternberg C, Givskov M, Ersboll BK, et al.
Quantification of biofilm structures by the novel computer program
COMSTAT. Microbiology 2000;146:2395e407.
Huffnagle GB, Noverr MC. The emerging world of the fungal microbiome.
Trends Microbiol 2013;21:334e41.
Human Microbiome Project Consortium. Structure, function and diversity of
the healthy human microbiome. Nature 2012;486:207e14.
Ivry SL, Sharib JM, Dominguez DA, Roy N, Hatcher SE, Yip-Schneider MT,
et al. Global protease activity profiling provides differential diagnosis of
pancreatic cysts. Clin Cancer Res 2017;23:4865e74.
Iwase T, Uehara Y, Shinji H, Tajima A, Seo H, Takada K, et al. Staphylococcus
epidermidis esp inhibits Staphylococcus aureus biofilm formation and
nasal colonization. Nature 2010;465:346e9.
H Li et al.
Malassezia Protease Inhibits S. aureus Biofilm
Koziel J, Potempa J. Protease-armed bacteria in the skin. Cell Tissue Res
2012;351:325e37.
Lambers H, Piessens S, Bloem A, Pronk H, Finkel P. Natural skin surface pH is
on average below 5, which is beneficial for its resident flora. Int J Cosmet
Sci 2006;28:359e70.
Limon JJ, Skalski JH, Underhill DM. Commensal fungi in health and disease.
Cell Host Microbe 2017;22:156e65.
Lin-Cereghino J, Wong WW, Xiong S, Giang W, Luong LT, Vu J, et al. Condensed
protocol for competent cell preparation and transformation of the methylo-
trophic yeast Pichia pastoris. Biotechniques 2005;38:44e8.
Merino N, Toledo-Arana A, Vergara-Irigaray M, Valle J, Solano C, Calvo E,
et al. Protein A-mediated multicellular behavior in Staphylococcus aureus.
J Bacteriol 2009;191:832e43.
Naglik JR, Challacombe SJ, Hube B. Candida albicans secreted aspartyl
proteinases in virulence and pathogenesis. Microbiol Mol Biol Rev
2003;67:400e48.
O’Donoghue AJ, Knudsen GM, Beekman C, Perry JA, Johnson AD, DeRisi JL,
et al. Destructin-1 is a collagen-degrading endopeptidase secreted by
Pseudogymnoascus destructans, the causative agent of white-nose syn-
drome. Proc Natl Acad Sci USA 2015;112:7478e83.
Oh J, Byrd AL, Deming C, Colan S, NISC Comparative Sequencing Program,
Kong HH, et al. Biogeography and individuality shape function in the
human skin metagenome. Nature 2014;514:59e64.
Oh J, Byrd AL, Park M, NISC Comparative Sequencing Program, Kong HH, Segre J.
Temporal stability of the human skin microbiome. Cell 2016;165:854e66.
Peleg AY, Hogan DA, Mylonakis E. Medically important bacterialefungal
interactions. Nat Rev Microbiol 2010;8:340e9.
Rawlings ND. Peptidase specificity from the substrate cleavage collection in
the MEROPS database and a tool to measure cleavage site conservation.
Biochimie 2016;122:5e30.
Saunders CW, Scheynius A, Heitman J. Malassezia fungi are specialized to
live on skin and associated with dandruff, eczema, and other skin diseases.
PLoS Pathog 2012;8:e1002701e4.
Schommer NN, Gallo RL. Structure and function of the human skin micro-
biome. Trends Microbiol 2013;21:660e8.
Speziale P, Pietrocola G, Foster TJ, Geoghegan JA. Protein-based biofilm
matrices in Staphylococci. Front Cell Infect Microbiol 2014;4:171.
Sugimoto S, Iwamoto T, Takada K, Okuda K, Tajima A, Iwase T, et al.
Staphylococcus epidermidis esp degrades specific proteins associated with
Staphylococcus aureus biofilm formation and host-pathogen interaction.
J Bacteriol 2013;195:1645e55.
Tajima M, Sugita T, Nishikawa A, et al. Molecular analysis of Malassezia
microflora in seborrheic dermatitis patients: comparison with other dis-
eases and healthy subjects. J Invest Dermatol 2008;128:345e51.
Tanaka A, Cho O, Saito M, Tsuboi R, Kurakado S, Sugita T. Molecular char-
acterization of the skin fungal microbiota in patients with seborrheic
dermatitis. J Clin Exp Dermatol 2014;5:239.
Turnbaugh PJ, Ley RE, Hamady M, Fraser-Ligett CM, Knight R, Gordon JI. The
human microbiome project. Nature 2007;449:804e10.
Underhill DM, Iliev ID. The mycobiota: interactions between commensal
fungi and the host immune system. Nat Rev Immunol 2014;14:405e16.
Velegraki A, Cafarchia C, Gaitanis G, Iatta R, Boekhout T. Malassezia in-
fections in humans and animals: pathophysiology, detection, and treat-
ment. PLoS Pathog 2015;11:e1004523e6.
Winter MB, Salcedo EC, Lohse MB, Hartooni N, Gulati M, Sanchez H, et al.
Global identification of biofilm-specific proteolysis in Candida albicans.
mBio 2016;7(5).
Wu G, Zhao H, Li C, Rajapakse MP, Wong WC, Xu J, et al. Genus-wide
comparative genomics of Malassezia delineates its phylogeny, physiology,
and niche adaptation on human skin. PLoS Genet 2015;11:e1005614e26.
Xu J, Saunders CW, Hu P, Grant RA, Boekhout T, Kuramae KK, et al. Dandruff-
associated Malassezia genomes reveal convergent and divergent virulence
traits shared with plant and human fungal pathogens. Proc Natl Acad Sci
USA 2007;104:18730e5.
Xu Z, Wang Z, Yuan C, Liu XP, Yang F, Wang T, et al. Dandruff is associated
with the conjoined interactions between host and microorganisms. Sci Rep
2016;6:24877.
www.jidonline.org 1145