Nucleotide Oligomerization Domains 1

and 2: Regulation of Expression and

This information is current as
of March 17, 2010
Function in Preadipocytes
Thorsten Stroh, Arvind Batra, Rainer Glauben, Inka
Fedke, Ulrike Erben, Anjo Kroesen, Markus M.
Heimesaat, Stefan Bereswill, Stephen Girardin, Martin
Zeitz and Britta Siegmund

J. Immunol. 2008;181;3620-3627
http://www.jimmunol.org/cgi/content/full/181/5/3620

Downloaded from www.jimmunol.org on March 17, 2010

References This article cites 43 articles, 19 of which can be accessed free at:
http://www.jimmunol.org/cgi/content/full/181/5/3620#BIBL

1 online articles that cite this article can be accessed at:

http://www.jimmunol.org/cgi/content/full/181/5/3620#otherarticl
es

Subscriptions Information about subscribing to The Journal of Immunology is

online at http://www.jimmunol.org/subscriptions/

Permissions Submit copyright permission requests at

http://www.aai.org/ji/copyright.html

Email Alerts Receive free email alerts when new articles cite this article. Sign
up at http://www.jimmunol.org/subscriptions/etoc.shtml

The Journal of Immunology is published twice each month by

The American Association of Immunologists, Inc., 9650
Rockville Pike, Bethesda, MD 20814-3994.
Copyright ©2008 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
 The Journal of Immunology

Nucleotide Oligomerization Domains 1 and 2: Regulation of

Expression and Function in Preadipocytes1

Thorsten Stroh,* Arvind Batra,* Rainer Glauben,* Inka Fedke,* Ulrike Erben,*
Anjo Kroesen,† Markus M. Heimesaat,‡ Stefan Bereswill,§ Stephen Girardin,¶ Martin Zeitz,*
and Britta Siegmund2*
Translocation of bacteria into the mesenteric fat during intestinal inflammation and the expression of functional TLR1–9 in murine
preadipocytes and adipocytes suggest an active role for these cells in innate immunity. The present study focuses on nucleotide oli-
gomerization domains 1 and 2 representing intracellular pattern recognition receptors that sense motifs derived from bacterial pepti-
doglycans. On mRNA level nucleotide oligomerization domain 1 was found to be constitutively expressed in the preadipocyte cell line
3T3L1 and in primary preadipocytes isolated from murine mesenteric fat, while nucleotide oligomerization domain 2 was only weakly
expressed by these cells. Treatment with lactyl-tetra-diaminopimelic acid, muramyl dipeptide, LPS, IL-1␤, and TNF-␣ did not affect
cellular nucleotide oligomerization domain 1 mRNA amounts. Except muramyl dipeptide, all factors significantly increased nucleotide
oligomerization domain 2 mRNA in mesenteric fat preadipocytes after 4 h. However, specific stimulation of nucleotide oligomerization
domain 1 induced IL-6 synthesis in preadipocytes from wild-type or TLR2/4-deficient mice. Confirming nucleotide oligomerization

Downloaded from www.jimmunol.org on March 17, 2010

domain 1 specificity, transfection of nucleotide oligomerization domain 1-specific small interfering RNA significantly blocked the effect
of lactyl-tetra-diaminopimelic acid on IL-6 production. With specific inhibitors and a NF-␬B reporter plasmid, nucleotide oligomer-
ization domain 1-mediated activation of NF-␬B was shown to be responsible for the induction of IL-6 in preadipocytes. In addition,
expression of functional nucleotide oligomerization domain 1 could be confirmed in primary human preadipocytes. In summary, we here
identified preadipocytes as a novel cell population expressing nucleotide oligomerization domains 1 and 2. Not regulated on transcrip-
tional level, nucleotide oligomerization domain 1 in preadipocytes serves as a sensor for bacterial degradation products and triggers
proinflammatory effector responses. Thus, our results further strengthen the allocation of the mesenteric fat and especially of preadi-
pocytes to the innate immune system. The Journal of Immunology, 2008, 181: 3620 –3627.

T he fat body in Drosophila has been attributed to the im-
mune defense system (1), while the adipose tissue in ver-
tebrates has long been considered primarily as energy
storage. Recent data indicate that the adipose tissue also not only
participates in the regulation of the immune system but also might
be part of it. More than 50 adipocyte-derived mediators so-called
adipokines have been identified so far (2). In vitro and in vivo data
provide evidence that adipokines like leptin, adiponectin, and vis-
fatin contribute to immune regulation (3).
In addition, preadipocytes and adipocytes were found to exert
properties characteristic for cells of the immune system. For in-
stance, preadipocytes have the potential to differentiate into the
macrophage lineage and have been shown to phagocytose (4). Our
group demonstrated that adipocytes and preadipocytes express
functional TLR in a leptin-dependent manner (5) suggesting that
these cells might belong to the innate immune system.
*Department of Medicine I, †Department of Surgery, and ‡Institute for Infection
Biology, Microbiology and Virology, Campus Benjamin Franklin, and §Institute for
Microbiology and Hygiene, Campus Charité-Mitte and Campus Benjamin Franklin,
Charité Universitätsmedizin Berlin, Berlin, Germany; and ¶Department of Immunol-
ogy, University of Toronto, Toronto, Canada
Received for publication December 5, 2007. Accepted for publication July 2, 2008.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
The contributions of M.M.H. and S.B. were financed by Fritz-Thyssen Foundation
Grant A.Z. 10.05.2.194 and German Research Foundation Grant SFB633/A12.
2
Address correspondence and reprint requests to Dr. Britta Siegmund, Charité - Uni-
versitätsmedizin Berlin, Campus Benjamin Franklin, Medical Department I, Hinden-
burgdamm 30, 12200 Berlin, Germany. E-mail address: britta.siegmund@charite.de
A second group of intracellular pattern recognition receptors,
which include nucleotide oligomerization domains 1 and 2, com-
prise nucleotide-binding sites and leucine-rich repeats (6). Nucle-
otide oligomerization domain 1 is primarily expressed by various
epithelial cell lines (7). Lactyl-tetra-diaminopimelic acid (LT-
DAP),3 a motif mainly found in peptidoglycans from Gram-neg-
ative bacteria, has been identified as nucleotide oligomerization
domain 1-specific ligand (8). Functional studies revealed that
proinflammatory responses are triggered by invasive enteropatho-
gens like Shigella flexneri and enteroinvasive Escherichia coli (9,
10) but also by the noninvasive pathogen Helicobacter pylori (11)
via nucleotide oligomerization domain 1 signaling. Expression of
nucleotide oligomerization domain 2 is more restricted to cells of the
myeloid lineage (12). The peptidoglycan muramyl dipeptide (MDP),
derived from the cell wall of Gram-positive bacteria, represents a
specific ligand for nucleotide oligomerization domain 2 (13). Recent
studies summarize the function of nucleotide oligomerization
domain 2 as an adjuvant receptor in cooperation with TLRs for
activation of the adaptive immune system (14). For both receptors,
an interaction with the Rip2/RICK/CARDIAK kinase through
their caspase recruitment domain occurs after ligand binding re-
sulting in an activation of the transcription factor NF-␬B (12, 15).
Phenotypically, in animal models, chronic inflammation has
been associated with a hypertrophy of the fat tissue surrounding
3
Abbreviations used in this paper: LT-DAP, lactyl-tetra-diaminopimelic acid; MDP,
peptidoglycan muramyl dipeptide; iE-DAP, ␥-D-glutamyl-meso-diaminopimelic
acid; iE-Lys, ␥-D-glutamyl-lysine; WT, wild type; siRNA, small interfering RNA.
Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00

www.jimmunol.org
The Journal of Immunology 3621

Table I. Oligonucleotides used in this study

Function Template Sequence (5⬘-3⬘)

Standard PCR nucleotide oligomerization domain 1

forward CTTGCATTCAATGGCATCTC
reverse ACATCGGTGTGCACTGTGGA
nucleotide oligomerization domain 2
forward AGCAGAACTTCTTGTCCCTGA
reverse TCACAACAAGAGTCTGGCGT
human nucleotide oligomerization domain 1
forward ATCCGCAATACTCAGTGTCT
reverse ACGACTTTGCTCTGAGTGAG
human nucleotide oligomerization domain 2
forward TGGACACCGTCTGGAATAAG
reverse GCTTTCACCGTGGCAAGATC
GAPDH
forward ACCACAGTCCATGCCATCAC
reverse TCCACCACCCTGTTGCTGTA
Quantitative PCR nucleotide oligomerization domain 1
forward CCTGTCAGGAGCCCACACCT
reverse CCCTGCTGGCTTTGAGTGG
nucleotide oligomerization domain 2
forward GCAACAGGGAGGAGCTTCCA
reverse ACATCAGGCCAGCAGCAGTG
GAPDH
forward

Downloaded from www.jimmunol.org on March 17, 2010

CATCCTGCACCACCAACTGC
reverse ACGCCACAGCTTTCCAGAGG
siRNA nucleotide oligomerization domain 1
sense GCUCAUUCGGACCAAAACUTT
antisense AGUUUUGGUCCGAAUGAGCTG
noncoding
sense UUCUCCGAACGUGUCACGUdTdT
antisense ACGUGACACGUUCGGAGAAdTdT
Probes nucleotide oligomerization domain 1 FAM–CGCGGCTGAGACCCTGCAGA–TAMRA
nucleotide oligomerization domain 2 FAM–TGCGTGGCCAAACCGCTGTC–TAMRA

the draining lymph nodes (16). Remarkably, in Crohn’s disease,
the hypertrophy of the mesenteric fat attached to the inflamed seg-
ments of the intestine represents a characteristic finding. However,
the significance of this hypertrophy for the disease course remains
unknown at the moment (17). Mutations in nucleotide oligomer-
ization domain 1 have been associated with asthma and inflam-
matory bowel disease (18, 19), while homozygous mutations in
nucleotide oligomerization domain 2 have been associated with a
20- to 40-fold increase in the risk of developing Crohn’s disease
(20 –22).
In transmural inflammations of the large or small intestine in
Crohn’s disease, bacterial translocation into the mesenteric fat tis-
sue has been described (17) suggesting direct access of bacteria-
derived molecules to preadipocytes and adipocytes. To further de-
fine a role of the local fat in intestinal inflammation as a part of the
innate immune system, the present study investigated expression
and function of nucleotide oligomerization domains 1 and 2 in
primary preadipocytes from the mesenteric fat of wild-type (WT)
and TLR 2/4-deficient mice (TLR2/4⫺/⫺).
Perfect designer software (Invitrogen) (Table I) and were manufactured by
TIB MolBiol. The NF-␬B-luciferase reporter plasmid and the plasmid
pEGFP-N1 were from and from BD Pharmingen, respectively. All other
chemicals were obtained from Sigma-Aldrich. Endotoxin contamination of
all reagents used in cell culture settings was excluded using the Limulus
amebocyte lysate assay (Hemochrom Diagnostica).
Mice
Animal protocols were approved by the regional animal study committee
of Berlin, Germany. Six- to eight-week-old female C57BL/6J and
C57BL/10 WT mice were bred under specific pathogen-free conditions at
the “Forschungsinstitut für Experimentelle Medizin,” Charité Berlin, Ger-
many. C57BL/10 TLR 2/4-deficient mice (TLR2/4⫺/⫺) were a kind gift
from M. Freudenberg (Max-Planck-Institut für Immunbiologie, Freiburg,
Germany) and bred and kept under the same conditions as the respective
WT control animals. In experiments with cells from TLR2/4⫺/⫺ mice,
C57BL/10 mice were used as WT control, in all other experiments prea-
dipocytes isolated from C57BL/6J were referred to as WT. The animals
were housed at controlled temperature with light-dark cycles, fed standard
mice chow pellets, had access to tap water from bottles, and were accli-
matized before being studied. Upon the end of an experimental period,
mice were killed by cervical dislocation under CO2 anesthesia.

Materials and Methods

Reagents
FCS was obtained from LINARIS Biologische Produkte. Further cell cul-
ture reagents were from PAA Laboratories and cell culture plates from
Nunc. Insulin was from Aventis Pharma, hydrocortisone from Pharmacia,
and MDP, ␥-D-glutamyl-meso-diaminopimelic acid (iE-DAP), ␥-D-glu-
tamyl-lysine (iE-Lys), 17-DMAG, as well as ultra-pure LPS were from
InvivoGen. Human TNF-␣, murine M-CSF, murine IL-1␤, and murine
IFN-␥ were used as recombinant proteins from PeproTech. LT-DAP was
provided by the Department of Laboratory Medicine and Pathobiology of
the University of Toronto (Toronto, Canada). Reagents for reverse tran-
scription and for standard and quantitative PCR were obtained from In-
vitrogen and Promega. Primer for PCR were designed using the Oligo-
Isolation of mouse preadipocytes and cell culture
Mesenteric adipose tissue was excised, minced, and washed in HBSS. Tis-
sue was digested within 25 min at 37°C in HBSS containing 1.5 mg/ml
collagenase II, 3.5% BSA, and 550 ␮M glucose. The cell suspension was
subsequently mashed through a 100 ␮m-nylon net (BD Pharmingen), sedi-
mented at 200 g for 10 min, and washed twice in DMEM/HAMS F-12
containing 10% FCS and penicillin/streptomycin (100 U/ml each). After
24-h incubation in 48-well plates (5 ⫻ 105 cells/well), nonadherent cells
were discarded and adherent cell layers were propagated to establish prea-
dipocyte cell lines that were used up to the 10th passage. Cells of the
murine preadipocyte cell line 3T3L1 (ATCC CL-173) were propagated in
DMEM containing 10% FCS and penicillin/streptomycin (100 U/ml each).
3622 NUCLEOTIDE OLIGOMERIZATION DOMAINS 1 AND 2 IN PREADIPOCYTES

The potential to give rise to fully differentiated adipocytes from all prea-
dipocyte cell lines used in this study was confirmed by lipid droplet stain-
ing with Oil red O after incubation with insulin, dexamethasone, and
3-isobutyl-1-methylxanthine as described previously (23). All obtained pri-
mary cells were periodically tested for mycoplasma contamination using a
commercial PCR test (Minerva).

Patients, isolation of human preadipocytes, and cell culture

Mesenteric adipose tissue was obtained from patients undergoing intestinal
surgery performed at the Charité University Hospital in Berlin. All patients
provided informed consent. Samples from 10 tumor patients (noninvolved
areas) were investigated. This study was approved by the local ethics com-
mittee of the Charité Universitätsmedizin Berlin. Procedure of isolating
preadipocytes was identical with the preparation of preadipocytes of mice.
The potential to give rise to fully differentiated adipocytes from all human
preadipocytes was performed as described previously (24).

Generation of bone marrow-derived macrophages

Bone marrow-derived macrophages were generated according to standard
protocols (25). In brief, femurs from C57BL/6J mice were dissected and
flushed with DMEM. Once dispersed by passing through a 25-gauge nee-
dle, the cells were cultured overnight in plastic dishes (Ø 10 cm) in DMEM
containing 10% FCS. Nonadherent cells transferred to new plastic dishes
were cultured with 10 ng/ml M-CSF. For 7 days, medium was completely
exchanged every other day.

Downloaded from www.jimmunol.org on March 17, 2010

Standard and quantitative RT-PCR
Cells were incubated with MDP (10 ␮g/ml), LT-DAP (200 nM), LPS
(1 ␮g/ml), IL-1␤ (100 ng/ml), or TNF-␣ (100 ng/ml) at 37°C and were
harvested after 1, 4, and 8 h as indicated. Total RNA (1.5 ␮g) isolated from
detached cells using the RNAeasy kit (Qiagen) was reversely transcribed.
Standard PCR was performed in a thermal cycler with three independent
heating blocks (Biometra) in a total volume of 50 ␮l with 27, 35, and 20
cycles for nucleotide oligomerization domains 1 and 2 and GAPDH, re-
spectively, using specific oligonucleotides (Table I) as primers. PCR prod-
ucts were electrophoretically separated in an agarose gel (2%) and were
visualized after ethidium bromide staining. Quantitative PCR containing
5 pmol of sense and antisense primers and SYBR Green were set up in
duplicates in total volumes of 20 ␮l. Specificity of the LightCycler (Roche)
PCR over 40 cycles was confirmed by the molecular mass of the products
and a melting curve analysis. Data analyzed according to a standard curve FIGURE 1. Baseline expression of nucleotide oligomerization domains
generated from a pool of all samples tested were normalized to coamplified 1 (NOD1) and 2 (NOD2) in preadipocytes. Copy numbers of nucleotide
GAPDH (26), and changes were calculated in relation to nontreated con- oligomerization domains 1- and 2-specific mRNA per cell was determined
trols of the respective time point.
by quantitative PCR using plasmid standards and specific fluorescence
Absolute quantification of nucleotide oligomerization domains 1 probes. Bars represent the mean of n ⫽ 4 ⫾ SEM.
and 2 expression using plasmid standards
Murine nucleotide oligomerization domains 1 and 2 cDNA were amplified
by standard PCR from WT cells. Sequences cloned into the vector pCR2.1
(Invitrogen) were verified in comparison to GenBank accession no. cyte lines and ⬃82% of 3T3L1 cells. Cell viability as determined by pro-
NM_172729 and NM_145857, respectively. Plasmid DNA was linearized pidium iodide staining was 92–96%. For assessment of NF-␬B activation,
with BamHI, again purified, and concentration was determined by spec- 2 ⫻ 105 preadipocytes were transfected with 4 ␮g of a NF-␬B-luciferase
trophotometry using a NanoDrop ND-1000 device (NanoDrop Technolo- reporter plasmid. For RNAi targeting of endogenous nucleotide oligomer-
gies). Plasmid copy numbers were calculated from the concentration and ization domain 1, 1.5 ⫻ 105 cells mixed with 150 ␮l siPort buffer (Ambion)
molecular mass of the plasmid DNA. Single-use aliquots of these were and 120 pmol of nucleotide oligomerization domain 1-specific small in-
stored at ⫺80°C. The PCR mixture contained 4 ␮l plasmid standard or the terfering RNA (siRNA) or a noncoding control siRNA (Table I) received
cDNA generated of 2 ⫻ 103 cells, 5 pmol of sense and antisense primers, a single square pulse at 600 V and 300 ␮s. After the electroporation, cells
2.5 pmol of FAM/TAMRA-labeled and platinum qPCR supermix (Invitro- were left to rest for 3 min before being transferred in prewarmed DMEM
gen) in a total volume of 20 ␮l. Polymerase activation and target ampli- containing 10% FCS. Finally, 1.5 ⫻ 105 cells in 1 ml DMEM containing
fication were performed using the following protocol: 4 min at 95°C, 40 10% FCS in 24-well plates were treated with various ligands as indicated
cycles at 95°C for 25 s and 60°C for 45 s. A series of 10-fold dilutions from for 24 h.
2 ⫻ 108 to 2 ⫻ 101 copies of the purified plasmid DNA identified the
threshold of detection and generated a standard curve for quantification.
Cytokine production
Transient transfection of preadipocytes
Murine preadipocytes and macrophages were incubated with MDP, LT-
Detached cells (2 ⫻ 105) were resuspended in 100 ␮l electroporation buffer DAP, and LPS as described above. Cell-free culture supernatants were
containing 90 mM phosphate buffer (pH 7.2), 10 mM MgCl2, and 50 mM collected and stored at ⫺80°C. Subsequently, concentrations of IL-6,
glucose before 4 ␮g pEGFP-N1 were added. In a cuvette for electropora- TNF-␣, and IL-1␤ were determined by specific ELISA using the EIA kit
tion with a gap of 2 mm (Biozym), cells were subjected to a single square (BD Pharmingen) within a range of 15–1000 pg/ml. Human preadipocytes
pulse of 600 V for 600 ␮s, allowed to rest for 1 min, and transferred in were stimulated with the specific agonist for human nucleotide oligomer-
prewarmed DMEM containing 10% FCS. A total of 1 ⫻ 105 transfected ization domain 1 iE-DAP (50 ␮g/ml) (27) or with iE-Lys (50 ␮g/ml),
cells were seeded in 1 ml culture medium to a 24-well plate. Transfection which is not recognized by nucleotide oligomerization domain 1. Super-
efficiencies estimated by EGFP expression after 48 h and monitored by natants were collected after 24 and 48 h. Concentration of IL-6 was de-
flow cytometry using a FACSCalibur device and the CellQuest software termined by specific ELISA using EIA kit (BD Pharmingen) within a range
(BD Biosciences) were ⬃70% of the cells of newly established preadipo- of 15–300 pg/ml.
The Journal of Immunology
FIGURE 2. Regulation of nucleotide oligomerization domain 2 expres-
sion. RNA from preadipocytes was isolated and quantitative PCR was per-
formed to analyze nucleotide oligomerization domain 2 (NOD2) expres-
sion in the presence or absence of nucleotide oligomerization domain 1-,
nucleotide oligomerization domain 2-, TLR4-specific ligands or the proin-
flammatory cytokines IL-1␤ or TNF-␣, respectively. The expression pat-
tern after 1, 4, and 8 h of stimulation is shown. Relative quantification of
nucleotide oligomerization domain 2 expression was performed using
quantitative PCR. Data are shown as fold expression calculated in com-
parison to unstimulated controls of n ⫽ 4; ⴱ, p ⱕ 0.05; ⴱⴱ, p ⱕ 0.01; and
ⴱⴱⴱ, p ⱕ 0.001.
Assessment of NF-␬B activation using luciferase assay
Cells transiently transfected with the NF-␬B-luciferase reporter plasmid
received MDP (20 ␮g/ml), LT-DAP (200 nM), or LPS (1 ␮g/ml) 24 h after
transfection. Alternatively, MDP (10 ␮g/ml) was present during the pulse
and LPS (1 ␮g/ml) was added immediately after transfection. Cells were
incubated for 24 h, washed twice with PBS, and lysed in 80 ␮l of reporter
lysis buffer (Promega). Protein concentrations were determined using the
Bradford reagent (Bio-Rad). Samples (20 ␮l) were transferred into a white
96-well plate, 60 ␮l of luciferase substrate were added, and the reactions
mixed for 5 s. Luciferase activity was measured for 0.5 s using a Mithras
LB 940 luminescence reader (Berthold Technologies,). NF-␬B activation
state was estimated in relative light units corresponding to equal protein
amounts.
Statistical analysis
Significance of differences between treatment and control groups was de-
termined by the Kruskal Wallis nonparametric test using Prism 4 software
for Windows (GraphPad Software).
Results
Murine preadipocytes from the mesenteric fat constitutively
express nucleotide oligomerization domain 1 and only minor
nucleotide oligomerization domain 2
First, we asked for baseline expression levels of nucleotide oli-
gomerization domains 1 and 2 and compared preadipocytes from
the mouse embryonic fibroblast-derived cell line 3T3L1 with pri-
mary preadipocytes derived from murine mesenteric fat. Nucleo-
tide oligomerization domain 1 mRNA could be detected in all
primary preadipocytes analyzed. Remarkably, nucleotide oli-
gomerization domain 1 mRNA expression in WT and in TLR2/4⫺/⫺
preadipocytes was expressed to higher levels as in macrophages. To
determine the differences in expression, the copy number of nu-
3623
Downloaded from www.jimmunol.org on March 17, 2010
FIGURE 3. Responsiveness of nucleotide oligomerization domains 1
and 2 in WT and TLR 2/4⫺/⫺ preadipocytes. A, Preadipocytes from the
3T3L1 cell line or preadipocytes derived from WT and TLR2/4⫺/⫺ mice
were stimulated in the presence or absence of nucleotide oligomerization
domain 1-, nucleotide oligomerization domain 2-, or TLR4-specific li-
gands. The cells were cultured for 48 h in the presence of LT-DAP
(112 ng/ml), MDP (10 ␮g/ml), or LPS (1 ␮g/ml). B, Bone marrow-derived
macrophages were incubated with LPS (1 ␮g/ml) alone or in combination
with MDP (10 ␮g/ml). After 48 h, IL-6 was determined in the supernatant
by ELISA. Bars represent the mean of n ⫽ 4 ⫾ SEM; ⴱ, p ⱕ 0.05;
ⴱⴱ, p ⱕ 0.01; ⴱⴱⴱ, p ⱕ 0.001.
cleotide oligomerization domains 1 and 2 per cell was evaluated
(Fig. 1). WT preadipocytes expressed ⬃4 copies of nucleotide oli-
gomerization domain 1 mRNA per cell while TLR2/4⫺/⫺ preadi-
pocytes expressed ⬃13 copies/cell. In macrophages, only one nu-
cleotide oligomerization domain 1 mRNA copy per cell could be
measured. Baseline expression of nucleotide oligomerization do-
main 2 mRNA in the 3T3L1 cell line and in primary preadipocytes
was very low. Statistically, only 5% of primary preadipocytes and
30% of macrophages expressed one molecule of nucleotide oli-
gomerization domain 2 mRNA per cell.
These data confirm a constitutive expression of both nucleotide
oligomerization domains 1 and 2 in primary cells, indicating a
potential physiological role in vivo.
Expression of nucleotide oligomerization domain 2, but not 1,
mRNA is regulated by specific ligands and proinflammatory
cytokines
Next, effects of bacterial cell wall-derived compounds and of cy-
tokines representing a proinflammatory milieu were questioned.
3624 NUCLEOTIDE OLIGOMERIZATION DOMAINS 1 AND 2 IN PREADIPOCYTES

FIGURE 4. Nucleotide oligomerization domain 1 specificity of LT-

DAP stimulation. WT preadipocytes were transfected with 800 nM nucle-
otide oligomerization domain 1-specific or a noncoding control siRNA.
Then, 24 h after transfection, cells were stimulated with either LT-DAP
(200 nM) or LPS (1 ␮g/ml). After another 24 h, IL-6 production was

Downloaded from www.jimmunol.org on March 17, 2010

determined in the supernatant by ELISA. Bars represent the mean of n ⫽
4 ⫾ SEM; ⴱⴱ, p ⱕ 0.01.

Preadipocytes from the mesenteric fat of WT mice and 3T3L1

cells were stimulated with either the specific ligands for nucleotide
oligomerization domains 1 and 2, TLR4, or with the proinflam-
matory cytokines IL-1␤ or TNF-␣, respectively. Nucleotide oli-
gomerization domains 1 and 2 mRNA expression was evaluated
after 1, 4, and 8 h of stimulation as indicated (Fig. 2). In the 3T3L1
preadipocyte cell line, neither the nucleotide oligomerization do-
main 1-specific stimulus LT-DAP, the nucleotide oligomerization
domain 2-specific stimulus MDP, nor the TLR4-specific stimulus
LPS resulted in an increase of nucleotide oligomerization domain 2
mRNA expression. However, stimulation with the proinflammatory
cytokine TNF-␣ was followed by a significant up-regulation after
1 and 4 h, while IL-1␤ did not alter baseline nucleotide oligomer-
ization domain 2 expression.
Remarkably, regulation of nucleotide oligomerization domain 2
mRNA expression was different in primary preadipocytes isolated
from the mesenteric fat of WT mice. In this study, nucleotide oli-
gomerization domain 1-specific stimulation with LT-DAP resulted
in a significant increase after 4 h. Furthermore, LPS stimulation
was followed by an ⬃40-fold increase of nucleotide oligomeriza-
tion domain 2 mRNA expression. The LPS mediated up-regulation
of nucleotide oligomerization domain 2 mRNA was neither af-
fected by the neutralization of TNF-␣ nor of IL-1␤, but was sen-
sitive to inhibition of the NF-␬B-pathway (data not shown). Com-
parable to the 3T3L1 preadipocytes, MDP did not change
nucleotide oligomerization domain 2 mRNA expression in these
cells. However, in WT preadipocytes, both proinflammatory cyto-
kines resulted in a profound up-regulation of nucleotide oligomer-
ization domain 2 mRNA after 1 and 4 h, respectively.
In contrast to nucleotide oligomerization domain 2 mRNA, nu-
cleotide oligomerization domain 1 mRNA expression in neither
3T3L1 nor WT preadipocytes was changed significantly after stim-
ulation with either LT-DAP, MDP, LPS, IL-1␤, or TNF-␣, respec-
tively. In contrast, an up-regulation of nucleotide oligomerization
domain 1 mRNA expression could be achieved after stimulation
with IFN-␥ (data not shown).
FIGURE 5. Nucleotide oligomerization domain 1 mediated NF-␬B-ac-
tivation. A, Preadipocytes were stimulated with LT-DAP in the presence or
absence of 17-DMAG. Bars represent the mean of n ⫽ 4 ⫾ SEM;
ⴱⴱⴱ, p ⱕ 0.01. B, Preadipocytes were transfected with a NF-␬B reporter
plasmid and cotransfected with either LT-DAP or MDP; LPS was added
shortly after transfection. Then, 24 h after transfection, cells were lysed and
luciferase activity was determined using a luminescence reader. Bars rep-
resent the mean of n ⫽ 6 ⫾ SEM; ⴱⴱ, p ⱕ 0.01; ⴱⴱⴱ, p ⱕ 0.001.
Induction of IL-6 by specific activation of nucleotide
oligomerization domain 1 in primary preadipocytes
To further characterize the functionality of nucleotide oligomer-
ization domains 1 and 2 in preadipocytes, either the 3T3L1 prea-
dipocyte cell line or preadipocytes isolated from the mesenteric fat
of WT or TLR2/4⫺/⫺ mice were stimulated with LT-DAP or
MDP. For any functional analysis with defined derivates from the
bacterial cell wall, it was crucial to exclude LPS contamination
within the experimental system. Thus, preadipocyte cell lines de-
ficient in TLR2/4 were established and included as control. TLR4
stimulation was included as positive control. IL-6, known to be
produced in large amounts by preadipocytes, was selected for end-
point determination. As indicated by Fig. 3A, nucleotide oligomer-
ization domain 1-specific stimulation resulted in a significant in-
crease of IL-6 in WT and TLR2/4⫺/⫺ preadipocytes. Stimulation
with LPS was followed by an up-regulation of IL-6 synthesis in
3T3L1 preadipocytes as well as in WT cells, while no increase was
observed in TLR2/4⫺/⫺ preadipocytes.
Under comparable conditions, nucleotide oligomerization do-
main 2-specific stimulation with MDP did not result in an IL-6
The Journal of Immunology
FIGURE 6. Nucleotide oligomerization domains 1 and 2 expression and
responsiveness in human preadipocytes. A, For detection of nucleotide oli-
gomerization domain 1-specific mRNA, total mRNA was extracted and
transcribed into cDNA. Nucleotide oligomerization domain 1 (NOD1) was
amplified with 25 PCR cycles. The housekeeping gene GAPDH was co-
amplified with 20 PCR cycles. Shown are the results of four different cell
lines, derived from four different patients. B, Human preadipocytes were
stimulated in the presence of iE-DAP, IE-LYS, MDP, and LPS for 48 h.
Bars represent the mean of n ⫽ 6 ⫾ SEM; ⴱ, p ⱕ 0.05.
increase (Fig. 3A). To facilitate MDP entry into the cell, to be
available for the intracellularly located nucleotide oligomerization
domain 2, MDP stimulation was assisted by electroporation. How-
ever, no IL-6 induction was observed. In addition, neither IL-1␤
nor TNF-␣ was found in the cell supernatant (data not shown).
Functionality of the MDP used was confirmed by the previously
described synergism for MDP- and LPS-stimulated bone marrow-
derived macrophages that was not detected in any of the preadi-
pocytes investigated (Fig. 3B).
Nucleotide oligomerization domain 1-specific siRNA partially
abrogates IL-6 production in preadipocytes
Concentrating on the nucleotide oligomerization domain 1 speci-
ficity of LT-DAP in preadipocytes, the RNAi technique was ap-
plied. Achieved knockdown of nucleotide oligomerization domain 1
by specific siRNA in comparison to a noncoding siRNA was ⬃70%
after 24 h and ⬃50% after 48 h as analyzed by quantitative PCR
(data not shown). Cells transfected with the nucleotide oligomer-
ization domain 1-specific siRNA (800 nM) and subsequently stim-
ulated with LT-DAP showed a significant decrease in IL-6 pro-
duction in comparison to stimulated cells transfected with a
noncoding control siRNA (Fig. 4). However, the response to LPS
stimulation was not affected by transfection with either nucleotide
oligomerization domain 1-specific siRNA or noncoding control
siRNA, respectively, hence confirming the specificity of the
knockdown (Fig. 4). These data verify that nucleotide oligomer-
3625
ization domain 1 in preadipocytes is specifically activated by
LT-DAP.
IL-6 production is mediated by nucleotide oligomerization
domain 1-induced NF-␬B activation in preadipocytes
We next addressed the mechanism by which nucleotide oligomer-
ization domain 1 activation results in an increase of IL-6 produc-
tion. In the presence of the NF-␬B inhibitor 17-DMAG, the IL-6
production following nucleotide oligomerization domain 1-spe-
cific stimulation was significantly decreased (Fig. 5A). To further
evaluate whether nucleotide oligomerization domain 1-specific
stimulation results in an activation of NF-␬B in preadipocytes, a
NF-␬B reporter plasmid assay was performed. In this study, nu-
cleotide oligomerization domain 1-specific stimulation induced a
strong NF-␬B activation in the 3T3L1 preadipocyte cell line as
well as in the WT preadipocytes (Fig. 5B). Remarkably, NF-␬B
activation in LT-DAP-stimulated preadipocytes was comparable to
LPS-stimulated cells. No NF-␬B activation occurred in any of the
cell lines investigated after stimulation with the nucleotide oli-
gomerization domain 2 ligand MDP (Fig. 5B).
Expression and function of nucleotide oligomerization
Downloaded from www.jimmunol.org on March 17, 2010
domains 1 and 2 in human preadipocytes
To allow a transfer of the murine data into the human system,
preadipocytes isolated from the mesenteric fat of patients under-
going intestinal surgery were investigated. As evaluated by RT-
PCR, nucleotide oligomerization domain 1 was expressed consti-
tutively in human preadipocytes (Fig. 6A) while nucleotide
oligomerization domain 2 could be detected in only 2 of 10 sam-
ples (data not shown). After nucleotide oligomerization domain 1-spe-
cific stimulation with iE-DAP the baseline IL-6 production was
significantly up-regulated whereas no increase occurred in the
presence of the negative control iE-Lys which is not recognized by
nucleotide oligomerization domain 1, thus underlining the func-
tionality of nucleotide oligomerization domain 1 in human prea-
dipocytes. Stimulation with the nucleotide oligomerization domain 2
ligand MDP resulted in no change of IL-6 production (Fig. 6B).
Discussion
Preadipocytes have initially been described as precursors of adi-
pocytes and thus as cells of the endocrine and metabolic system.
Recent data indicate an additional function for this cell population
since they are not only capable of phagocytosis but, furthermore,
have been shown to express functional TLR (5). With the present
study, the expression and function of the nucleotide-binding site
and leucine-rich repeat protein nucleotide oligomerization do-
mains 1 and 2, belonging to the recently discovered family of
pattern recognition receptor family localized in the cytoplasm,
were characterized in preadipocytes.
In contrast to TLRs that are mostly associated with the plasma
membrane or, in some cases, with lysosomal vesicles, both nucle-
otide oligomerization domains 1 and 2 are expressed predomi-
nantly in the cytoplasm (28). Concordant with this intracellular
localization, both receptors do not recognize native microbial
products but rather fragments that are derived from the degradation
of bacterial cell wall peptidoglycans (13, 27, 29, 30). Both recep-
tors have so far been reported to be expressed by APC such as
macrophages and dendritic cells but not in B or T cells (12, 28, 31).
Nucleotide oligomerization domain 1 is expressed by epithelial
cell lines including intestinal epithelia-derived cell lines and pri-
mary intestinal epithelial cells, while nucleotide oligomerization
domain 2 mRNA is detectable in most epithelial cell lines, the
protein is below detection limits (32, 33). In primary cells, nucle-
otide oligomerization domain 2 expression seems to be restricted
3626 NUCLEOTIDE OLIGOMERIZATION DOMAINS 1 AND 2 IN PREADIPOCYTES
to Paneth cells, located at the base of the intestinal crypt (34).
Thus, preadipocytes are a novel cell type expressing nucleotide
oligomerization domains 1 and 2, nucleotide oligomerization do-
main 1 at significantly higher levels than nucleotide oligomeriza-
tion domain 2. Interestingly, in TLR2/4⫺/⫺ preadipocytes, nucle-
otide oligomerization domain 2 expression is significantly
enhanced when compared with WT preadipocytes.
The regulation of nucleotide oligomerization domains 1 and 2
expression by proinflammatory cytokines is well described. Nu-
cleotide oligomerization domain 1 is constitutively expressed and
can be up-regulated by IFN-␥ but not by TNF-␣ (35). Accordingly,
also in preadipocytes constitutive high expression of nucleotide
oligomerization domain 1 is not affected by nucleotide oligomer-
ization domain 1-, nucleotide oligomerization domain 2-, or
TLR4-specific stimuli or by the proinflammatory cytokines IL-1␤
and TNF-␣, respectively. Differently, nucleotide oligomerization
domain 2 baseline protein expression in epithelial cells is low;
TNF-␣ induces an up-regulation that is further enhanced in the
presence of IFN-␥ (36). Nucleotide oligomerization domain 2-spe-
cific stimulation has been reported to result in an activation of
NF-␬B and subsequent up-regulation of nucleotide oligomeriza-
tion domain 2 itself (12, 36). Our data indicate that, comparable to
epithelial cells, nucleotide oligomerization domain 2 expression in
preadipocytes is up-regulated by the proinflammatory stimuli LPS,
IL-1␤, and TNF-␣. In addition, specific stimulation of nucleotide
oligomerization domain 1 resulted in an increased nucleotide oli-
gomerization domain 2 expression, thus confirming the previously
described nucleotide oligomerization domain 2-dependent regula-
tion by activation of the NF-␬B pathway expression for the first
time in preadipocytes (12).
Nucleotide oligomerization domains 1 and 2 recognize specific
peptidoglycans. For instance, LT-DAP has been established as a
specific ligand for murine nucleotide oligomerization domain 1
while MDP has been identified as specific ligand for nucleotide
oligomerization domain 2, respectively (27, 29). MDP is part of
the cell wall of Gram-positive and -negative bacteria. Conse-
quently, nucleotide oligomerization domain 2 functions as sensor
of most, if not all, bacteria. Nucleotide oligomerization domain 1
mainly senses degradation products from Gram-negative bacteria
(27, 37, 38). To activate nucleotide oligomerization domains 1 or 2,
the specific ligands need to reach the respective nucleotide oli-
gomerization domain protein in the cytosol. For APC, it has been
suggested that phagocytosis might participate in this process (39,
40), which could also represent the critical mechanism for the up-
take of bacterial Ags by preadipocytes (4). In line with this hy-
pothesis, we observed that electroporation facilitated the access of
the specific ligands to nucleotide oligomerization domain 1 (data
not shown).
Stimulation of preadipocytes with the nucleotide oligomeriza-
tion domain 1-specific ligand LT-DAP resulted in increased IL-6
production. In line with the findings that expression of nucleotide
oligomerization domain 1 is only one copy per cell, it was not
surprising that LT-DAP did not induce IL-6 in bone marrow-de-
rived macrophages. These differences to data found in the litera-
ture might be attributed to the isolation protocol for peritoneal
macrophages, which were exposed to thioglycolate and cytocha-
lasin D (8). Cytochalasin D destabilizes the cytoskeleton by actin
disruption and might thus enable the ligand to enter the cytoplasm,
and to stimulation of nucleotide oligomerization domain 1 (41).
Nucleotide oligomerization domain 1 specificity was further sup-
ported by the finding that, in the presence of nucleotide oligomer-
ization domain 1-specific siRNA stimulation, IL-6 production was
only increased with the TLR4 ligand LPS but not with the nucle-
otide oligomerization domain 1-specific LT-DAP. One of the main
signaling pathways activated by nucleotide oligomerization do-
main 1 is NF-␬B as indicated by nucleotide oligomerization do-
main 1-induced NF-␬B activation in epithelial cells that had been
transfected with WT nucleotide oligomerization domain 1 (30).
Our data using the NF-␬B reporter plasmid assay clearly support
these findings for preadipocytes.
In contrast to nucleotide oligomerization domain 1, the expres-
sion of nucleotide oligomerization domain 2 in unstimulated pri-
mary preadipocytes was very low but could be up-regulated by
proinflammatory stimuli. Although an immediate role of nucleo-
tide oligomerization domain 2 in preadipocytes remained unclear,
it has to be different from nucleotide oligomerization domain 1. As
described for epithelial cell lines, nucleotide oligomerization do-
main 2-specific stimulation with MDP did neither induce IL-6 pro-
duction nor result in NF-␬B activation (7). Activation of NF-␬B
via nucleotide oligomerization domain 2 has so far only been de-
scribed for nucleotide oligomerization domain 2 over-expressing
transfected epithelial cells (8, 13). The copy numbers of each re-
ceptor per cell might provide the explanation to this finding. The
copy number for nucleotide oligomerization domain 1 is ⬃25-fold
higher than the copy number for nucleotide oligomerization do-
main 2, thus one can conclude that a higher copy number is re-
Downloaded from www.jimmunol.org on March 17, 2010
quired for a response that is underlined by the data acquired in
nucleotide oligomerization domain 2 over-expressing transfected
epithelial cells (8, 13).
The synergistic effect of LPS and MDP shown earlier for bone-
marrow-derived macrophages (42, 43) lacked in preadipocytes.
What might be the in vivo significance of nucleotide oligomer-
ization domain 1 in preadipocytes as sensor for bacterial wall frag-
ments? Preadipocytes from the mesenteric fat tissue are of partic-
ular interest for two reasons: although cause and meaning remain
unclear, the hypertrophy of the mesenteric fat tissue surrounding
the inflamed segments of the intestine is a characteristic finding in
Crohn’s disease (17). During intestinal inflammation, bacterial
translocation in the mesenteric fat tissue is well-described, thus
allowing for a direct activation of preadipocytes through bacteria
or bacterial wall fragments. Keeping also in mind that homozygous
mutations in nucleotide oligomerization domain 2 are associated
with a 20- to 40-fold increased risk in developing Crohn’s disease
(18, 19), the understanding of the relevance of these receptors
within the mesenteric fat tissue seems to be crucial.
In conclusion, with the present work, we demonstrate for the
first time nucleotide oligomerization domains 1 and 2 expression
in preadipocytes. We provide evidence that nucleotide oligomer-
ization domain 1 here serves as a sensor for bacteria and is capable
to induce an effector responses via NF-␬B activation. These results
further strengthen the role of the mesenteric fat tissue and of prea-
dipocytes within the innate immune system.
Disclosures
The authors have no financial conflict of interest.
References
1. Samakovlis, C., D. A. Kimbrell, P. Kylsten, A. Engstrom, and D. Hultmark.
1990. The immune response in Drosophila: pattern of cecropin expression and
biological activity. EMBO J. 9: 2969 –2976.
2. Trayhurn, P., and I. S. Wood. 2004. Adipokines: inflammation and the pleiotropic
role of white adipose tissue. Br. J. Nutr. 92: 347–355.
3. Tilg, H., and A. R. Moschen. 2006. Adipocytokines: mediators linking adipose
tissue, inflammation, and immunity. Nat. Rev. Immunol. 6: 772–783.
4. Charriere, G., B. Cousin, E. Arnaud, M. Andre, F. Bacou, L. Penicaud, and
L. Casteilla. 2003. Preadipocyte conversion to macrophage: evidence of plastic-
ity. J. Biol. Chem. 278: 9850 –9855.
5. Batra, A., J. Pietsch, I. Fedke, R. Glauben, B. Okur, T. Stroh, M. Zeitz, and
B. Siegmund. 2007. Leptin-dependent toll-like receptor expression and respon-
siveness in preadipocytes and adipocytes. Am. J. Pathol. 170: 1931–1941.
6. Inohara, N., Y. Ogura, and G. Nunez. 2002. Nods: a family of cytosolic proteins
that regulate the host response to pathogens. Curr. Opin. Microbiol. 5: 76 – 80.
The Journal of Immunology
7. Uehara, A., Y. Fujimoto, K. Fukase, and H. Takada. 2007. Various human epi-
thelial cells express functional Toll-like receptors, NOD1 and NOD2 to produce
anti-microbial peptides, but not proinflammatory cytokines. Mol. Immunol. 44:
3100 –3111.
8. Magalhaes, J. G., D. J. Philpott, M. A. Nahori, M. Jehanno, J. Fritz, L. L. Bourhis,
J. Viala, J. P. Hugot, M. Giovannini, J. Bertin, et al. 2005. Murine Nod1 but not
its human orthologue mediates innate immune detection of tracheal cytotoxin.
EMBO Rep. 6: 1201–1207.
9. Girardin, S. E., R. Tournebize, M. Mavris, A. L. Page, X. Li, G. R. Stark,
J. Bertin, P. S. DiStefano, M. Yaniv, P. J. Sansonetti, and D. J. Philpott. 2001.
CARD4/Nod1 mediates NF-␬B and JNK activation by invasive Shigella flexneri.
EMBO Rep. 2: 736 –742.
10. Kim, J. G., S. J. Lee, and M. F. Kagnoff. 2004. Nod1 is an essential signal
transducer in intestinal epithelial cells infected with bacteria that avoid recogni-
tion by toll-like receptors. Infect. Immun. 72: 1487–1495.
11. Viala, J., C. Chaput, I. G. Boneca, A. Cardona, S. E. Girardin, A. P. Moran,
R. Athman, S. Memet, M. R. Huerre, A. J. Coyle, et al. 2004. Nod1 responds to
peptidoglycan delivered by the Helicobacter pylori cag pathogenicity island. Nat.
Immunol. 5: 1166 –1174.
12. Ogura, Y., N. Inohara, A. Benito, F. F. Chen, S. Yamaoka, and G. Nunez. 2001.
Nod2, a Nod1/Apaf-1 family member that is restricted to monocytes and activates
NF-␬B. J. Biol. Chem. 276: 4812– 4818.
13. Girardin, S. E., I. G. Boneca, J. Viala, M. Chamaillard, A. Labigne, G. Thomas,
D. J. Philpott, and P. J. Sansonetti. 2003. Nod2 is a general sensor of peptidogly-
can through muramyl dipeptide (MDP) detection. J. Biol. Chem. 278:
8869 – 8872.
14. Kobayashi, K. S., M. Chamaillard, Y. Ogura, O. Henegariu, N. Inohara,
G. Nunez, and R. A. Flavell. 2005. Nod2-dependent regulation of innate and
adaptive immunity in the intestinal tract. Science 307: 731–734.
15. Inohara, N., T. Koseki, J. Lin, L. del Peso, P. C. Lucas, F. F. Chen, Y. Ogura, and
G. Nunez. 2000. An induced proximity model for NF-␬B activation in the Nod1/
RICK and RIP signaling pathways. J. Biol. Chem. 275: 27823–27831.
16. Pond, C. M. 2005. Adipose tissue and the immune system. Prostaglandins Leu-
kotrienes Essent. Fatty Acids 73: 17–30.
17. Peyrin-Biroulet, L., M. Chamaillard, F. Gonzalez, E. Beclin, C. Decourcelle,
L. Antunes, J. Gay, C. Neut, J. F. Colombel, and P. Desreumaux. 2007. Mesen-
teric fat in Crohn’s disease: a pathogenetic hallmark or an innocent bystander?
Gut 56: 577–583.
18. Hysi, P., M. Kabesch, M. F. Moffatt, M. Schedel, D. Carr, Y. Zhang,
B. Boardman, E. von Mutius, S. K. Weiland, W. Leupold, et al. 2005. NOD1
variation, immunoglobulin E and asthma. Hum. Mol. Genet. 14: 935–941.
19. McGovern, D. P., P. Hysi, T. Ahmad, D. A. van Heel, M. F. Moffatt, A. Carey,
W. O. Cookson, and D. P. Jewell. 2005. Association between a complex inser-
tion/deletion polymorphism in NOD1 (CARD4) and susceptibility to inflamma-
tory bowel disease. Hum. Mol. Genet. 14: 1245–1250.
20. Kanazawa, N., I. Okafuji, N. Kambe, R. Nishikomori, M. Nakata-Hizume,
S. Nagai, A. Fuji, T. Yuasa, A. Manki, Y. Sakurai, et al. 2005. Early-onset
sarcoidosis and CARD15 mutations with constitutive nuclear factor-␬B activa-
tion: common genetic etiology with Blau syndrome. Blood 105: 1195–1197.
21. Hugot, J. P., M. Chamaillard, H. Zouali, S. Lesage, J. P. Cezard, J. Belaiche,
S. Almer, C. Tysk, C. A. O’Morain, M. Gassull, et al. 2001. Association of
NOD2 leucine-rich repeat variants with susceptibility to Crohn’s disease. Nature
411: 599 – 603.
22. Ogura, Y., D. K. Bonen, N. Inohara, D. L. Nicolae, F. F. Chen, R. Ramos,
H. Britton, T. Moran, R. Karaliuskas, R. H. Duerr, et al. 2001. A frameshift
mutation in NOD2 associated with susceptibility to Crohn’s disease. Nature 411:
603– 606.
23. Engelman, J. A., M. P. Lisanti, and P. E. Scherer. 1998. Specific inhibitors of p38
mitogen-activated protein kinase block 3T3-L1 adipogenesis. J. Biol. Chem. 273:
32111–32120.
24. Hemmrich, K., D. von Heimburg, K. Cierpka, S. Haydarlioglu, and N. Pallua.
2005. Optimization of the differentiation of human preadipocytes in vitro. Dif-
ferentiation 73: 28 –35.
3627
25. Vicente, R., A. Escalada, C. Soler, M. Grande, A. Celada, M. M. Tamkun,
C. Solsona, and A. Felipe. 2005. Pattern of Kv ␤ subunit expression in macro-
phages depends upon proliferation and the mode of activation. J. Immunol. 174:
4736 – 4744.
26. Jurk, M., F. Heil, J. Vollmer, C. Schetter, A. M. Krieg, H. Wagner, G. Lipford,
and S. Bauer. 2002. Human TLR7 or TLR8 independently confer responsiveness
to the antiviral compound R-848. Nat. Immunol. 3: 499.
27. Chamaillard, M., M. Hashimoto, Y. Horie, J. Masumoto, S. Qiu, L. Saab,
Y. Ogura, A. Kawasaki, K. Fukase, S. Kusumoto, et al. 2003. An essential role
for NOD1 in host recognition of bacterial peptidoglycan containing diamin-
opimelic acid. Nat. Immunol. 4: 702–707.
28. Inohara, N., and G. Nunez. 2003. NODs: intracellular proteins involved in in-
flammation and apoptosis. Nat. Rev. Immunol. 3: 371–382.
29. Girardin, S. E., I. G. Boneca, L. A. Carneiro, A. Antignac, M. Jehanno, J. Viala,
K. Tedin, M. K. Taha, A. Labigne, U. Zahringer, et al. 2003. Nod1 detects a
unique muropeptide from gram-negative bacterial peptidoglycan. Science 300:
1584 –1587.
30. Inohara, N., Y. Ogura, A. Fontalba, O. Gutierrez, F. Pons, J. Crespo, K. Fukase,
S. Inamura, S. Kusumoto, M. Hashimoto, et al. 2003. Host recognition of bac-
terial muramyl dipeptide mediated through NOD2: implications for Crohn’s dis-
ease. J. Biol. Chem. 278: 5509 –5512.
31. Gutierrez, O., C. Pipaon, N. Inohara, A. Fontalba, Y. Ogura, F. Prosper,
G. Nunez, and J. L. Fernandez-Luna. 2002. Induction of Nod2 in myelomono-
cytic and intestinal epithelial cells via nuclear factor-␬B activation. J. Biol. Chem.
277: 41701– 41705.
32. Hisamatsu, T., M. Suzuki, H. C. Reinecker, W. J. Nadeau, B. A. McCormick, and
D. K. Podolsky. 2003. CARD15/NOD2 functions as an antibacterial factor in
human intestinal epithelial cells. Gastroenterology 124: 993–1000.
33. Lala, S., Y. Ogura, C. Osborne, S. Y. Hor, A. Bromfield, S. Davies, O. Ogunbiyi,
G. Nunez, and S. Keshav. 2003. Crohn’s disease and the NOD2 gene: a role for
Downloaded from www.jimmunol.org on March 17, 2010
paneth cells. Gastroenterology 125: 47–57.
34. Ogura, Y., S. Lala, W. Xin, E. Smith, T. A. Dowds, F. F. Chen, E. Zimmermann,
M. Tretiakova, J. H. Cho, J. Hart, et al. 2003. Expression of NOD2 in Paneth
cells: a possible link to Crohn’s ileitis. Gut 52: 1591–1597.
35. Hisamatsu, T., M. Suzuki, and D. K. Podolsky. 2003. Interferon-␥ augments
CARD4/NOD1 gene and protein expression through interferon regulatory fac-
tor-1 in intestinal epithelial cells. J. Biol. Chem. 278: 32962–32968.
36. Rosenstiel, P., M. Fantini, K. Brautigam, T. Kuhbacher, G. H. Waetzig,
D. Seegert, and S. Schreiber. 2003. TNF-␣ and IFN-␥ regulate the expression of
the NOD2 (CARD15) gene in human intestinal epithelial cells. Gastroenterology
124: 1001–1009.
37. Inohara, N., M. Chamaillard, C. McDonald, and G. Nunez. 2005. NOD-LRR
proteins: role in host-microbial interactions and inflammatory disease. Annu. Rev.
Biochem. 74: 355–383.
38. Pauleau, A. L., and P. J. Murray. 2003. Role of nod2 in the response of macro-
phages to toll-like receptor agonists. Mol. Cell. Biol. 23: 7531–7539.
39. Araki, Y., T. Nakatani, R. Makino, H. Hayashi, and E. Ito. 1971. Isolation of
glucosaminyl-␤(1– 4)-muramic acid and phosphoric acid ester of this disaccha-
ride from acid hydrolysates of peptidoglycan of Bacillus cereus AHU 1356 cell
walls. Biochem. Biophys. Res. Commun. 42: 684 – 690.
40. Gupta, D. K., N. Theisen, K. von Figura, and A. Hasilik. 1985. Comparison of
biosynthesis and subcellular distribution of lysozyme and lysosomal enzymes in
U937 monocytes. Biochim. Biophys. Acta 847: 217–222.
41. Mortensen, K., and L. I. Larsson. 2003. Effects of cytochalasin D on the actin
cytoskeleton: association of neoformed actin aggregates with proteins involved in
signaling and endocytosis. Cell Mol. Life Sci. 60: 1007–1012.
42. Fritz, J. H., S. E. Girardin, C. Fitting, C. Werts, D. Mengin-Lecreulx, M. Caroff,
J. M. Cavaillon, D. J. Philpott, and M. Adib-Conquy. 2005. Synergistic stimu-
lation of human monocytes and dendritic cells by Toll-like receptor 4 and NOD1-
and NOD2-activating agonists. Eur. J. Immunol. 35: 2459 –2470.
43. Takada, H., S. Yokoyama, and S. Yang. 2002. Enhancement of endotoxin activity
by muramyldipeptide. J. Endotoxin Res. 8: 337–342.