International Immunopharmacology 61 (2018) 100–108

Contents lists available at ScienceDirect

International Immunopharmacology
journal homepage: www.elsevier.com/locate/intimp

Prophylactic herpes simplex virus type 2 vaccine adjuvanted with a T

universal CD4 T cell helper peptide induces long-term protective immunity
against lethal challenge in mice
⁎ ⁎⁎
Xiaoquan Lia, Shouhua Zhangb, Jun Leib, Ying Zhuc, Xin Zhoud, Juhua Xiaod, , Tianxin Xiangc,
a
Department of Neonatology, The First Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shanxi 710061, China
b
Department of General Surgery, Jiangxi Provincial Children's Hospital, Nanchang, Jiangxi 330006, China
c
Department of Infectious Disease, The First Affiliated Hospital of Nanchang University, Nanchang, Jiangxi 330006, China
d
Department of Ultrasound, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006, China

A R T I C LE I N FO A B S T R A C T

Keywords: Induction of robust and long-term immune responses at the portal of entry remains a big challenge for HSV-2
Herpes simplex virus type 2 vaccine development. The adoption of a CD4 T cell helper peptide in the vaccine is thought to be beneficial for
Universal CD4 T cell helper peptide the enhancement of immune responses, however, its effect on HSV-2 vaccines has not yet been studied. In this
Vaccine study, we designed a DNA vaccine (gD-TpD) simultaneously expressing HSV-2 gD ectodomain and a universal
Long-term immunity
CD4 T cell helper peptide (TpD), and tested its efficacy on a murine model. Mice were immunized 3 times with
gD-TpD or control DNA formulations, and then were rested until Day 150 when they were vaginally challenged
with lethal doses of HSV-2. Our data showed that gD-TpD significantly increased gD-specific IgG and IgA in both
sera and vaginal washes. Furthermore, the increased antibody responses showed enhanced neutralization ac-
tivity in vitro. In addition, gD-TpD induced balanced Th1/2 cellular responses and CD8+ T cell-dependent CTL
activity. Although immune responses dropped over time after the final immunization, robust and rapid antibody
and T cell responses were induced upon virus challenge in gD-TpD group. Moreover, gD-TpD provided full
protection against lethal viral challenge in immunized mice. Together, our findings indicate that the inclusion of
the CD4 T cell helper peptide TpD in HSV-2 gD subunit vaccine could induce long-term protective immunity,
providing information for a rational design of vaccines against HSV-2 or even other viruses.

1. Introduction
Herpes simplex virus type 2 (HSV-2), a sexually transmitted virus, is
the leading cause of genital herpes [1,2]. In neonates and im-
munocompromised patients, HSV-2 can cause encephalitis and even
death [3]. In addition, HSV-2 is also associated with increased risk of
HIV-1 infection and transmission [4]. Up to now, more than 400 million
people are infected with HSV-2, with around 19 million new infections
each year [5]. Despite research to develop prophylactic or therapeutic
treatments started decades ago, there is still neither curative treatment
nor licensed vaccine till now [6–8].
Glycoproteins are popular antigen candidates for HSV-2 subunit
vaccines. Among them, glycoprotein D (gD), given to its unique char-
acteristics, is the mostly used one [9]. First, gD is expressed on the
surface of viral particles and is targeted by most neutralization anti-
bodies. Second, gD interaction with a host cell receptor is required for
successful infection while blocking this interaction could abort the in-
fection [9]. Various studies have also evidenced that gD is a promising
antigen for HSV-2 vaccine, however, improvements still need to be
made for a vaccine that could induce long-term protective immunity
against HSV-2 at the portal of entry [10–15].
To improve the immunogenicity of an antigen, there are a variety of
options while adjuvantation remains the simplest but most effective
way [16,17]. It has been established that humoral and cellular immune
responses are interconnected and CD4 T cells is of importance in hu-
moral immune response by providing help to B cell maturation and
immunoglobulin class switching and affinity maturation. In order to
provide such help, CD4 T cells must be stimulated by MHC II epitopes
that exist in the immunogen. Some immunogens do not have effective
MHC II epitopes to induce sufficient T cell helper responses, leading to
poor antibody responses as well. Therefore, to design and include a
universal CD4 T cell helper peptide in a vaccine may be beneficial for

⁎
Correspondence to: J. Xiao, Department of Ultrasound, Jiangxi Provincial Maternal and Child Health Hospital, No.318, Bayi Road, Nanchang 330006, China.
⁎⁎
Correspondence to: T. Xiang, Department of Infectious Disease, The First Affiliated Hospital of Nanchang University, No. 17 Yongwai Road, Nanchang 330006, China.
E-mail addresses: xjh1230@163.com (J. Xiao), txxiangmed@hotmail.com (T. Xiang).

https://doi.org/10.1016/j.intimp.2018.05.024
Received 16 January 2018; Received in revised form 12 May 2018; Accepted 23 May 2018
1567-5769/ © 2018 Published by Elsevier B.V.
X. Li et al.
immune response enhancement. Till now, a number of universal CD4 T
cell helper peptides have been designed and investigated mostly in
cancer research, but their use in antiviral vaccine development is still
very limited [18–21]. A previous study has designed a chimeric uni-
versal CD4 T cell helper peptide (TpD) with epitopes from tetanus
toxoid and diphtheria toxoid linked by an internal cathepsin cleavage
site, and this peptide is proven to be potently active in mice, non-
human primates and human [22]. However, whether this CD4 T cell
helper peptide could induce immune response enhancement to an HSV-
2 vaccine remains to be investigated.
In this study, we designed a DNA vaccine, designated as gD-TpD,
simultaneously expressing an HSV-2 antigen (gD ectodomain) and the
CD4 T cell helper peptide TpD, and tested its ability to induce long-term
protective immunity on a murine model.
2. Materials and methods
2.1. Ethical statement
All the protocols involving animals were reviewed and approved by
the Institutional Ethics Review Committee (XJUA201600012) and
performed in accordance with the provincial guidelines.
2.2. Virus, cells and plasmids
HSV-2 (strain 333) was purchased from the American Type Culture
Collection (ATCC) and cultured on Vero cells. Virus was titrated on
Vero cells by plaque assay and aliquoted and stored at −80 °C.
HEK293T and Vero cell lines were both purchased from ATCC and
cultured in DMEM supplemented with 10% fetal calf serum (FCS) and
antibiotics in a 37 °C 5% CO2 incubator.
Eukaryotic expression vector pcDNA3.1(+) and prokaryotic ex-
pression vector pET28a(+) were purchased from Invitrogen, Thermo
Scientific and Novagen, Merck Millipore respectively and used for the
construction of all the plasmids used in the current study. Ectodomain
of gD (aa 1–339) was subsequently amplified from whole virus genome
and subcloned into pcDNA3.1(+), designated as gD, and pET28a(+),
designated as pET-gD, respectively. IRES2 sequence was amplified from
pIRES2-AcGFP1 vector while (G4S)6 and TpD sequences were in-
troduced by PCR primers, to construct bivalent expression vectors ex-
pressing ectodomain of gD together with (G4S)6, designated as gD-GS,
and expressing ectodomain of gD together with universal CD4 T help
peptide TpD, designated as gD-TpD, respectively. All primers used for
plasmid construction were listed in Table 1 while an illustration of the
constructed plasmids was shown in Fig. 1A.
2.3. Transfection and protein expression
All transient protein expression in vitro was done by transfection of
Table 1
Primer pairs used in the current study.
Primer name Sequence (5′ → 3′)a
gD-F TGAAGCTTATGGGGCGTTTGACCTCCGG
gD-R ATGAATTCCTACGGGTTGCTGGGGGCGG
IRES-F TATGAATTCGCCCCTCTCCCTCCCCCCCC
IRES-R CCGCTCGAGGGTTGTGGCCATATTATCAT
gD-F As above
gD-GS-R1 GGACCCACCACCGCCGGAGCCACCGCCACCCATGGTTGTGGCCATATTATCAT
gD-GS-R2 GGACCCACCACCGCCGGAGCCACCGCCACCGGACCCACCACCGCCGGAGC
gD-GS-R3 TATCTAGACTAGGACCCACCACCGCCGGAGCCACCGCCACCGGACCCACCACCGCCGGAGC
gD-F As above
gD-TpD-R1 TGAACTTGGAGTTGGCCTTGATGTACTGCATGAGGATCATGGTTGTGGCCATATTATCAT
gD-TpD-R2 GAGAGGGCGATGGACTGGCGGACGGAGACCTTGATGCCGATGAACTTGGAGTTGGCCTTG
gD-TpD-R3 TATCTAGATTACTGGGCGACCATGAGGGAGGAGAGGGCGATGGACTGGCG
a
Endoenzyme restriction sites were underlined and in bold.
101
International Immunopharmacology 61 (2018) 100–108
HEK293T cells using Lipofectamine 2000 according to the manufac-
turer's instructions (Thermo Scientific). In brief, cells were seeded in 6-
well plates 1 day before transfection. On the day of transfection, cells
were transfected with empty vector pcDNA3.1, gD, gD-GS or gD-TpD,
respectively. Forty-eight hours after transfection, cell culture super-
natants were harvested and filtrated through 0.45 μm filters. Cells were
lysed with Pierce IP/Lysis buffer (Thermo Scientific) supplemented
with protease inhibitor cocktail (Roche) and centrifuged at 10,000g for
10 min at 4 °C and supernatants were collected. Collected samples were
either used immediately for Western blot analysis or aliquoted and
stored at −80 °C until use.
2.4. Western blot
Samples were mixed with Bolt LDS sample buffer (Thermo
Scientific) and reducing agent (Thermo Scientific) and incubated at
70 °C for 10 min. Prepared samples were then separated by 4–12% Bis-
Tris gel and transferred onto a PVDF membrane. Membrane was then
blocked with 5% nonfat milk and incubated sequentially with primary
and HRP-conjugated secondary antibodies. After extensive washes with
PBST, immunobands were visualized with Immobilon Western
Chemiluminescent HRP Substrate (Merck Millipore) under a CCD
camera (Bio-Rad). The following antibodies were used in this study for
Western blot: mouse anti-HSV-2 gD antibody (Santa Cruz) and HRP-
conjugated goat anti-mouse IgG (Sigma-Aldrich).
2.5. Animal immunization, virus challenge and sampling
Six to eight weeks old female BALB/c mice were used in the current
study and animal immunization and sampling were carried out as
previously described with modifications [23]. In brief, mice were im-
munized intramuscularly with 5 μg gD, gD-GS or gD-TpD for 3 times at
2 week intervals and were challenged with lethal dose (200 LD50,
1 × 106 PFU) of HSV-2 on Day 150. Blood and vaginal wash samples
were collected before and 1 week after final immunization (Day 35),
1 week before challenge (Day 143) and at the end of study or at the time
of death. After virus challenge, survival rate, weight loss, disease
symptom severity and virus shedding were monitored daily. Disease
symptom severity was scored according to the previously described 5-
point scoring system [24]: 0, no apparent symptoms; 1, mild in-
flammation of the external genitals; 2, moderate swelling and redness of
the genitals; 3, severe redness and swelling of the genitals; 4, severe
inflammation and ulceration; 5, hind limb paralysis and death.
2.6. Endpoint antibody titer measurement
HSV-2 gD-specific IgG and IgA titers in sera and vaginal wash
samples were determined by endpoint titer ELISA, as previously de-
scribed with modifications [23,25]. In brief, Nunc Maxisorp 96-well
Note
For gD construction
Amplification of IRES2
For gD-GS construction
For gD-TpD construction
X. Li et al.
ELISA plates (Thermo Scientific) were coated with purified gD (5 μg/
ml, 50 μl/well) overnight at 4 °C. Plates were then washed with PBST,
blocked with 1% BSA for 1 h at 37 °C, and then incubated with serially
diluted serum or vaginal wash samples for another 1 h at 37 °C. After
incubation, plates were then washed again with PBST, and then in-
cubated with HRP-conjugated goat anti-mouse IgG (Santa Cruz) for 1 h
at 37 °C (antigen-specific IgG detection), or sequentially incubated with
biotin-conjugated goat anti-mouse IgA (Southern Biotechnology) for 1 h
and streptavidin-HRP (Santa Cruz) for 30 min at 37 °C respectively
(antigen-specific IgA detection). After incubation, plates were ex-
tensively washed with PBST and colorimetric reaction was developed
by incubation of TMB solution (Sigma-Aldrich) for 5 min at room
temperature in the dark and stopped by the addition of H2SO4. Optical
values were then read by an ELISA plate reader (Tecan) at a test wa-
velength of 450 nm and a reference wavelength of 570 nm. Endpoint
titers were calculated by GraphPad Prism 7.03 with the cut-off value set
as OD450 of the negative control plus 2 standard deviation.
2.7. Neutralization assay
Neutralization activities of sera and vaginal wash samples were
determined by plaque assay as previously described with modifications
[26]. In brief, heat-inactivated sera (56 °C, 1 h) or vaginal wash samples
were serially diluted and incubated with 100 PFU HSV-2 for 1 h at
37 °C. After incubation, the mixture was transferred into 48-well plates
with growing Vero cell monolayers and continued to incubate for an-
other 48 h. After incubation, cells were fixed and stained by crystal
violet and plaques were counted. Neutralization activity was calculated
as the sample dilution that showed 50% of neutralization.
2.8. Th1/2 cytokine measurement
HSV-2 gD-specific Th1/2 cytokines (IL-2, IL-4, IL-5, IFN-γ and TNF)
by splenocytes were measured by Cytometric Bead Array Mouse Th1/
Th2 cytokine kit (BD Biosciences), according to the manufacturer's in-
structions. In brief, spleens were freshly harvested and splenocytes were
isolated by mouse lymphocyte separation medium (Dakewe) according
102
International Immunopharmacology 61 (2018) 100–108
Fig. 1. Design, in vitro expression of plasmids and
immunization schedule. (A) An illustration of gD,
gD-GS and gD-TpD. (B) In vitro expression of gD, gD-
GS and gD-TpD. One representative result out of
three is shown. (C) Mice immunization schedule.
Mice were intramuscularly immunized 3 times with
gD, gD-GS or gD-TpD in two week intervals. One
week after the final immunization and 1 week before
virus challenge, sera and vaginal wash samples were
collected. Mice were challenged with lethal doses of
HSV-2 at Day 150 and mice were monitored and
samples were collected at a daily basis.
to the manufacturer's instructions. Freshly isolated splenocytes were
stimulated with purified gD for 3 days and then cell culture super-
natants were collected and filtrated through 0.45 μm filters. Cleared
supernatants were then incubated with beads capturing IL-2, IL-4, IL-5,
IFN-γ and TNF respectively, and PE-conjugated detection reagent for
2 h at room temperature in the dark. After incubation, beads were
washed and data acquisition was performed on a BD LSRFortessa
platform and data were analyzed by FCAP Array software 3.0.
2.9. Cytotoxic T lymphocyte (CTL) assay
CTL assay was performed as previously described with modifica-
tions [27]. In brief, splenocytes were freshly isolated as described above
and stimulated with purified gD protein (2.5 μg/ml) in vitro. Stimulated
cells were then incubated with HSV-2 infected A20 B cell lymphoma
target cells to assess the cytolytic activity in a 3 h Europium (Eu3+)-
release assay. Unifected A20 cells were used as target cells for back-
ground lysis. For CD8+ T cell depletion, stimulated splenocytes were
separated with mouse CD8+ T cell magnetic isolation columns (Mil-
tenyi) according to the manufacturer's instructions.
2.10. Quantification of virus shedding
Virus shedding was quantified by plaque assay. In brief, vaginal
wash samples were 1:10 diluted and cultured with Vero cell monolayers
for 48 h at 37 °C. Post-incubation, cells were fixed and stained by crystal
violet and plaques were counted.
2.11. Statistical analysis
All data in the current study were expressed as mean ± SD. For
comparisons between two groups, student's t-test was adopted. For
comparisons among three or more groups, One-way ANOVA plus SNK
post-hoc were used. All statistical analyses were performed with
GraphPad Prism 7.03 and a p value < 0.05 was considered statistically
significant.
X. Li et al.
3. Results
3.1. Design and in vitro expression of the three plasmids
To determine the adjuvant effect of the universal CD4 T cell help
peptide TpD to an HSV-2 subunit vaccine (gD ectodomain), gD ecto-
domain and TpD peptide sequences were linked by an internal ribosome
entry site, IRES2, and cloned into expression vector pcDNA3.1 (gD-
TpD). Together, two control plasmids were also constructed, with one
expressing gD only while another expressing gD plus (G4S)6 linker
peptide (gD-GS). An illustration of the three plasmids was shown in
Fig. 1A. An in vitro expression analysis of these plasmids was first
performed. As shown in Fig. 1B, all three plasmids were successfully
expressed in vitro at a similar expression level, indicating that the ad-
dition of peptide sequences (TpD or G4S) had no apparent impairment
to protein expression.
3.2. gD-TpD increases antigen-specific antibody responses in both serum
and mucosal site
In vivo evaluation the adjuvant effect of TpD was performed on a
BALB/c mouse model. Mice were immunized intramuscularly with gD,
gD-GS or gD-TpD for 3 times at two-week intervals. One week after final
immunization, sera and vaginal wash samples were collected and gD-
specific IgG and IgA were determined by endpoint titer ELISA. As
shown in Fig. 2, immunization of gD-TpD significantly increased an-
tigen-specific serum IgG, vaginal IgG and IgA, but not serum IgA. On
the contrary, gD-GS did not show apparent enhancement on antigen-
specific IgG or IgA in either sera or vaginal wash samples. These results
Fig. 2. gD-TpD enhances antigen-specific antibody response in sera and mucosal site. One week after final immunization, sera and vaginal wash samples were
collected and gD-specific (A) serum IgG, (B) serum IgA, (C) vaginal IgG and (D) vaginal IgA were determined by endpoint titer ELISA. Data shown are mean ± SD of
three independent experiments (n = 10). ns, not statistically significant; **, p < 0.01; ***, p < 0.001.
103
International Immunopharmacology 61 (2018) 100–108
indicate that the inclusion of CD4 T cell peptide TpD could enhance
antigen-specific systemic and mucosal antibody responses.
3.3. gD-TpD enhances neutralization activity
We next investigated whether the enhanced antibody titers in sera
and vaginal wash samples would result in increased neutralization. As
shown in Fig. 3, immunization of gD and gD-GS showed similar neu-
tralization activities against HSV-2 virus in both sera and vaginal wash
samples. Whereas mice received gD-TpD had significantly increased
neutralization activities in both sera and vaginal wash samples com-
paring to mice received gD or gD-GS. Of notice, mice immunized with
empty vector pcDNA3.1 also showed marginal but noticeable neu-
tralization activities in both sera and vaginal wash samples. In addition,
neutralization was observed in higher titers in sera than in vaginal wash
samples. Taken together, these data indicate that inclusion of TpD re-
sulted in enhanced neutralization activities in both serum and mucosal
surface.
3.4. gD-TpD induces balanced Th1/2 cellular responses
Th1/2 cell-mediated antigen-specific responses were next evaluated
by measuring Th1/2 associated cytokines. One week after the final
immunization, mice were sacrificed and splenocytes were isolated and
stimulated with purified gD in vitro for gD-specific cytokine production.
Post-stimulation, Th1 (IL-2, IFN-γ and TNF) and Th2 (IL-4 and IL-5)
associated cytokines were measured. As shown in Fig. 4, gD seemed to
induce a Th1-biased cellular response, demonstrating significantly
higher IFN-γ and TNF levels than the rest three cytokines.
X. Li et al.
Fig. 3. gD-TpD enhances neutralization activities in sera and mucosal surface. One week after the final immunization, (A) sera and (B) vaginal wash samples were
collected and neutralization activities against HSV-2 were measured. Data shown are mean ± SD of three independent experiments (n = 10). ns, not statistically
significant; *, p < 0.05; **, p < 0.01; ***, p < 0.001.
Immunization of gD-GS had no apparent impact on the expression of
the tested 5 cytokines when comparing to gD group, while immuniza-
tion of gD-TpD increased the production of all the tested cytokines,
indicating a balanced enhancement on Th1/2 responses. pcDNA3.1
group had very low level of cytokines detected, with many of them
beyond detection limit.
3.5. gD-TpD enhances gD-specific CTL activity
Antigen-specific CTL response is another important arm of cell-
mediated immune response and HSV gD-specific CTL response has been
successfully elicited by viral infection and gD DNA immunization
[28,29]. In this study, we next assessed whether gD-TpD could enhance
gD-specific CTL response. As shown in Fig. 5, gD successfully induced
gD-specific CTL activity, and gD-GS showed similar level of CTL re-
sponse as gD, whereas gD-TpD significantly increased the magnitude of
the gD-specific CTL response. Furthermore, this CTL response could not
be detected when CD8+ T cells were depleted, indicating that gD-in-
duced CTL response was CD8+ T cell dependent.
3.6. gD-TpD generates robust memory humoral and cellular responses
Previous study has reported that universal CD4 T cell peptide TpD
could induce long term memory immune response against nicotine,
therefore, we next continued to investigate whether this peptide would
also induce long term memory immune responses against HSV-2 gD
[22]. Mice were first immunized 3 times with gD, gD-GS or gD-TpD,
and then housed without any treatment till Day 150 when they were
challenged with lethal doses of HSV-2. Measurement of gD-specific
systemic IgG levels at various time points showed that gD or gD-GS
could induce high level of antigen-specific antibody response after 3
injections, and antibody titers would drop significantly after the fol-
lowing period without treatment. Upon virus challenge, antibody titers
were increased rapidly and remained at a high level for at least 15 days
(Fig. 6A). gD-TpD also showed similar tendency in the induction of
antigen-specific antibody response, only with significantly higher titers
at all time points than gD and gD-GS (Fig. 6A).
In accordance, serum neutralization for all groups was dropped
during the quiescent period but could be recalled upon virus challenge.
Of note, mice immunized with gD-TpD had significantly higher neu-
tralization than gD and gD-GS at one week after the final immunization,
and also after virus challenge. Negative control group (pcDNA3.1) had
minimal neutralization against HSV-2 before virus challenge, but a
slight increase in neutralization was observed one week after challenge
104
International Immunopharmacology 61 (2018) 100–108
(Fig. 6B).
T cell recall response was also determined by measuring gD-specific
IFN-γ expression. As shown in Fig. 6C, mice immunized with gD-TpD
had very high gD-specific IFN-γ response at one week after the final
immunization, then dropped to very low level during the time without
treatment and bounced back 3 days after virus challenge. Similar ten-
dencies could also be observed in gD and gD-GS groups, but sig-
nificantly lower IFN-γ responses were detected after virus challenge. As
to pcDNA3.1 group, detectable gD-specific IFN-γ response could only be
seen one week after virus challenge. Together, these data indicate that
gD-TpD could generate robust memory humoral and T cell responses.
3.7. gD-TpD generated memory responses protect mice from lethal challenge
Finally, we investigated whether TpD adjuvanted gD subunit vac-
cine would offer better long-term protection against lethal dose of HSV-
2 challenge. Mice were immunized and housed as above. On Day 150,
mice were challenged with lethal doses of HSV-2 and survival rate,
weight loss, disease symptom and vaginal virus shedding were recorded
on a daily basis for a total number of 15 days. As shown in Fig. 7A, mice
from pcDNA3.1 group started to die around 1 week after challenge and
were all died 10 days after challenge. Immunization with gD or gD-GS
showed some protection, representing 60% and 50% of survival, re-
spectively. Immunization with gD-TpD, of note, had full protection
against virus challenge. Monitoring weight loss showed that pcDNA3.1
group had sharp weight loss since Day 4 post-challenge. gD and gD-GS
groups also showed noticeable weight loss around Day 7–10 after
challenge, but at significantly lower pace. Unlike these three groups,
gD-TpD group gradually gained some weight instead of weight loss
during the observation period (Fig. 7B). In accordance to weight loss
results, severe disease symptoms were observed in pcDNA3.1 group,
moderate symptoms in gD and gD-GS groups, while no apparent
symptoms were seen in gD-TpD group (Fig. 7C). Although vaginal virus
shedding in all groups decreased over time, highest shedding was de-
tected in pcDNA3.1 group, followed by gD and gD-GS, while the lowest
was seen in gD-TpD group. Of note, undetectable virus shedding in the
vagina was observed in gD-TpD group 9 days after challenge (Fig. 7D).
Taken together, these data indicate that gD-TpD could offer long-term
protective immune response against lethal HSV-2 challenge.
4. Discussion
Over the past few decades, multiple vaccine candidates against
HSV-2 with diverse platforms have been investigated. Among them,
X. Li et al. International Immunopharmacology 61 (2018) 100–108

Fig. 4. gD-TpD induces balanced Th1/2 cellular responses. One week after the final immunization, mice were sacrificed and splenocytes were isolated and stimulated
with purified gD. Antigen-specific Th1/2-associated cytokines (A) IL-2, (B) IL-4, (C) IL-5, (D) IFN-γ and (E) TNF were quantified by CBA assay. Data shown are
mean ± SD of three independent experiments (n = 5). ns, not statistically significant; *, p < 0.05; **, p < 0.01; ***, p < 0.001.

subunit vaccine formulations with gD as the antigen are most widely
studied [7]. It is not a surprise that gD has been given such attention in
the vaccine development research, given that it is a surface protein and
is responsible for receptor binding. It has been evidenced that most
neutralization antibodies target gD. In addition, anti-gD antibody level
is correlated with protection in immunized animals [30]. These data
indicate that gD is a rationale antigen that can be used in an HSV-2
subunit vaccine. However, optimizations still remain to be researched
in order for gD-based vaccines to generate long-term, fully protective
immune responses against HSV-2 infection. In the current study, we
have shown that a simple inclusion of a universal CD4 T cell helper
peptide TpD significantly enhanced gD-induced immune responses.
Such enhancement offered long-term complete protection against va-
ginal lethal viral challenge on a mouse model. Of note, since the effect
of CD4 T cell helper peptide is to promote CD4 T cell activation, it in
return evidences that the ability of gD alone to activate T cell response
is poor. Therefore, this strategy by inclusion of universal CD4 T cell
helper peptides in vaccines may be also applicable for other antigens
with poor T cell responses. In addition, it is equally possible that other
means like cytokines involving in CD4 T cell activation and maturation,
although further investigations required, may have similar modulation
effect on gD-induced immunity [25,31,32].
HSV-2 is large double-strand DNA virus, with more than 10 glyco-
proteins on the viral surface. Among them, four glycoproteins, gB, gD,
gH and gL, are essential for viral entry. gD has been in the spotlight in
vaccine research due to its important role in receptor binding during
viral entry, and in our study, it has also shown its potential to induce
long-term protection against lethal viral challenge. Of the other three
proteins, gB is the fusion protein which fuses viral membrane with cell
membrane, creating a pore for viral contents entry of the host cell,
while gH and gL form heterodimers to stabilize gB conformation. Given
the indispensable roles in viral entry, gB, gH and gL as antigen may also

105
X. Li et al. International Immunopharmacology 61 (2018) 100–108

Fig. 5. gD-TpD enhances gD-specific CTL response. One week after the final
immunization, mice were sacrificed and splenocytes were isolated and stimu-
lated with purified gD. Antigen-specific CTL activity was determined by a 3 h
Europium (Eu3+)-release assay. Data shown are mean ± SD of three in-
dependent experiments (n = 5). ns, not statistically significant; *, p < 0.05; **,
p < 0.01; ***, p < 0.001.

be worthy to be investigated. In fact, there are a few studies that in-

vestigated the potential of these glycoproteins as subunit vaccine an-
tigens. Yan et al. has constructed a DNA vaccine expressing an HSV-2
gB-CCL19 fusion protein, which induced short-term protective im-
munity against vaginal challenge on a mouse model [23]. Moreover,
when we compared the adjuvant effect of CCL19 to our TpD, TpD
showed better efficacy in antigen-specific antibody induction both in
serum and vaginal lavage, indicating TpD is an adjuvant over CCL19
(Fig. S1). In addition, another study reported that a lentiviral vector-
based HSV-1 gB vaccine afforded cross protection against HSV-1 and
HSV-2 genital infections [33]. Therefore, glycoproteins other than gD
may also be suitable for vaccine and whether the inclusion of a uni-
versal CD4 T cell helper epitope could also have similar immune en-
hancement to other HSV-2 glycoproteins worth further investigation.
Moreover, some other HSV-2 proteins, albeit they cannot induce pro-
tective immunity on their own, could enhance immune responses when
combined with immunodominant antigens like gD. gC and gE are two
proteins that can assist virus immune evasion by inhibiting comple-
ment. One study has reported that a trivalent subunit vaccine con-
taining HSV-2 gC/D/E offered better protection than gD alone due to
enhanced blocking on HSV-2 immune evasion [34]. Consequently, it
would be interesting to investigate, albeit beyond the scope of our
current study, whether the inclusion of gC and gE to gD-TpD could
generate even better protection.
Due to the interlinkage between humoral and cellular responses, Fig. 6. gD-TpD generates robust memory humoral and cellular responses. Mice
antibody response requires help from CD4 T cells. Some antigens lack were immunized 3 times with pcDNA3.1, gD, gD-GS or gD-TpD and challenged
effective MHC II epitopes and cannot efficiently induce T cell activa- at Day 150 with lethal doses of HSV-2. One week after the final immunization,
tion, leading to poor humoral immunity. The inclusion of universal CD4 one week before virus challenge as well as 3, 7 and 15 days after virus chal-
T cell helper peptides could amend this disadvantage by providing ac- lenge, sera and splenocytes were collected and (A) gD-specific IgG, (B) serum
tivation epitopes to CD4 T cells. Up to now, a big variety of universal neutralization and (C) gD-specific IFN-γ production were measured. Data
CD4 T cell helper peptides are designed or discovered. The TpD used in shown are mean ± SD of three independent experiments (n = 5).
our current study contains two epitopes, originating from tetanus and
diphtheria toxoid, respectively. Tetanus and diphtheria toxoid are rich time of viral invasion. Long-term immunity is immunological memory
in MHC II epitopes and therefore a broad range of potential universal established by long-lived antigen-specific lymphocytes. These cells
epitopes have been identified from them [35]. However, since the CD4 were induced by the original exposure to antigen and persist in a resting
T cell help effect of these peptides are MHC II-, species- and antigen- state in the system. When encountering with the pathogen again, the
dependent, their immune modulative capabilities also have to be de- cells can be activated and propagate rapidly and generate strong an-
termined on a case by case basis. TpD is previously designed by soft- tigen-specific immune responses [36,37]. TpD, as investigated by a
ware and investigated by others to be effective in mice, non-human previous study, can promote T cell memory responses and not sur-
primates and human [22]. Our study has shown that TpD is a very prisingly in our current study the inclusion of TpD significantly en-
effective peptide to enhance gD-induced immune responses to achieve a hanced strength of the immune responses upon lethal virus challenge at
long-term protection against HSV-2. It would be warranted to further Day 150 [22]. Noticeably, gD alone has also induced a moderate level
investigate whether these findings could be transferred to non-human of long-term immune responses, indication of its ability to generate
primate model, or eventually even on human. antigen-specific memory cells. Also, a little elevation of anti-HSV-2
Long-term protective immunity is the ultimate goal of every vac- antibody and cellular responses could be observed in pcDNA3.1 nega-
cine, which requires a rapid and robust immune response recall at the tive group one week post-challenge, indicating that primary immune

106
X. Li et al.
Fig. 7. gD-TpD offers long-term protective immunity against lethal virus challenge. Mice were immunized 3 times with pcDNA3.1, gD, gD-GS or gD-TpD and
challenged at Day 150 with lethal doses of HSV-2. (A) Animal survival, (B) weight loss, (C) disease score and (D) vaginal virus shedding were monitored daily. Data
shown are mean ± SD of three independent experiments (n = 10).
responses are generated at this time.
Taken together, our study herein has shown that the inclusion of the
CD4 T cell helper peptide TpD in HSV-2 gD subunit vaccine could in-
duce long-term protective immunity, providing information for a ra-
tional design of vaccines against HSV-2 or even other viruses.
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.intimp.2018.05.024.
Acknowledgments
This study was supported by grants from the National Natural
Science Foundation of China (81760115 and 81460118) and the
Education Department Scientific Research Foundation of Jiangxi
Province (GJJ160039).
Author contributions
X.L., J.X. and T.X. conceived and designed the experiments; X.L.,
S.Z. and J.L. performed the experiments; X.L. and Y.Z. analyzed the
data; X.Z. contributed reagents/materials/analysis tools; X.L., J.X. and
T.X. wrote the paper.
Conflicts of interest
The authors declare no conflict of interest.
References
[1] K.J. Mertz, D. Trees, W.C. Levine, J.S. Lewis, B. Litchfield, K.S. Pettus, S.A. Morse,
107
International Immunopharmacology 61 (2018) 100–108
M.E. St. Louis, J.B. Weiss, J. Schwebke, J. Dickes, R. Kee, J. Reynolds, D. Hutcheson,
D. Green, I. Dyer, G.A. Richwald, J. Novotny, I. Weisfuse, M. Goldberg,
J.A. O'Donnell, R. Knaup, Etiology of genital ulcers and prevalence of human im-
munodeficiency virus coinfection in 10 US cities, J. Infect. Dis. 178 (6) (1998)
1795–1798.
[2] D.A. Lewis, E. Müller, L. Steele, M. Sternberg, F. Radebe, M. Lyall, R.C. Ballard,
G. Paz-Bailey, Prevalence and associations of genital ulcer and urethral pathogens
in men presenting with genital ulcer syndrome to primary health care clinics in
South Africa, Sex. Transm. Dis. 39 (11) (2012) 880–885.
[3] C. Johnston, L. Corey, Current concepts for genital herpes simplex virus infection:
diagnostics and pathogenesis of genital tract shedding, Clin. Microbiol. Rev. 29 (1)
(2016) 149–161.
[4] M.d.M.P. Rodríguez, A. Obasi, F. Mosha, J. Todd, D. Brown, J. Changalucha,
D. Mabey, D. Ross, H. Grosskurth, R. Hayes, Herpes simplex virus type 2 infection
increases HIV incidence: a prospective study in rural Tanzania, AIDS 16 (3) (2002)
451–462.
[5] K.J. Looker, A.S. Magaret, K.M.E. Turner, P. Vickerman, S.L. Gottlieb,
L.M. Newman, Global estimates of prevalent and incident herpes simplex virus type
2 infections in 2012, PLoS One 10 (1) (2015) e114989.
[6] J.I. Cohen, Vaccination to reduce reactivation of herpes simplex virus type 2, J.
Infect. Dis. 215 (6) (2017) 844–846.
[7] C. Johnston, S.L. Gottlieb, A. Wald, Status of vaccine research and development of
vaccines for herpes simplex virus, Vaccine 34 (26) (2016) 2948–2952.
[8] L.K. Dropulic, J.I. Cohen, The challenge of developing a herpes simplex virus 2
vaccine, Expert Review of Vaccines 11 (12) (2012) 1429–1440.
[9] T.M. Cairns, Z.-Y. Huang, J.C. Whitbeck, M. Ponce De Leon, H. Lou, A. Wald,
C. Krummenacher, R.J. Eisenberg, G.H. Cohen, Dissection of the antibody response
against herpes simplex virus glycoproteins in naturally infected humans, J. Virol. 88
(21) (2014) 12612–12622.
[10] A. Wald, D. Bernstein, K. Fife, P. Lee, S. Tyring, N. Van Wagoner, Novel therapeutic
vaccine for genital herpes reduces genital HSV-2 shedding, 53rd Interscience
Conference on Antimicrobial Agents and Chemotherapy, 2013.
[11] D. Long, M. Skoberne, T.M. Gierahn, S. Larson, J.A. Price, V. Clemens, A.E. Baccari,
K.P. Cohane, D. Garvie, G.R. Siber, J.B. Flechtner, Identification of novel virus-
specific antigens by CD4+ and CD8+ T cells from asymptomatic HSV-2 seropositive
and seronegative donors, Virology 464–465 (2014) 296–311.
[12] M. Skoberne, R. Cardin, A. Lee, A. Kazimirova, V. Zielinski, D. Garvie, A. Lundberg,
X. Li et al.
S. Larson, F.J. Bravo, D.I. Bernstein, J.B. Flechtner, D. Long, An adjuvanted herpes
simplex virus 2 subunit vaccine elicits a T cell response in mice and is an effective
therapeutic vaccine in guinea pigs, J. Virol. 87 (7) (2013) 3930–3942.
[13] J.L. Dutton, B. Li, W.-P. Woo, J.O. Marshak, Y. Xu, M.-l. Huang, L. Dong, I.H. Frazer,
D.M. Koelle, A novel DNA vaccine technology conveying protection against a lethal
herpes simplex viral challenge in mice, PLoS One 8 (10) (2013) e76407.
[14] R.L. Veselenak, M. Shlapobersky, R.B. Pyles, Q. Wei, S.M. Sullivan, N. Bourne, A
Vaxfectin®-adjuvanted HSV-2 plasmid DNA vaccine is effective for prophylactic and
therapeutic use in the guinea pig model of genital herpes, Vaccine 30 (49) (2012)
7046–7051.
[15] M.-C. Bernard, V. Barban, F. Pradezynski, A. de Montfort, R. Ryall, C. Caillet,
P. Londono-Hayes, Immunogenicity, protective efficacy, and non-replicative status
of the HSV-2 vaccine candidate HSV529 in mice and guinea pigs, PLoS One 10 (4)
(2015) e0121518.
[16] T. Matsusaki, S. Takeda, M. Takeshita, Y. Arima, C. Tsend-Ayush, T. Oyunsuren,
C. Sugita, H. Yoshida, W. Watanabe, M. Kurokawa, Augmentation of T helper type 1
immune response through intestinal immunity in murine cutaneous herpes simplex
virus type 1 infection by probiotic Lactobacillus plantarum strain 06CC2, Int.
Immunopharmacol. 39 (2016) 320–327.
[17] K. Roth, V.H. Ferreira, C. Kaushic, HSV-2 vaccine: current state and insights into
development of a vaccine that targets genital mucosal protection, Microb. Pathog.
58 (2013) 45–54.
[18] C. Parra-Lopez, J.M. Calvo-Calle, T.O. Cameron, L.E. Vargas, L.M. Salazar,
M.E. Patarroyo, E. Nardin, L.J. Stern, Major histocompatibility complex and T cell
interactions of a universal T cell epitope from Plasmodium falciparum circumspor-
ozoite protein, J. Biol. Chem. 281 (21) (2006) 14907–14917.
[19] J. Alexander, J. Sidney, S. Southwood, J. Ruppert, C. Oseroff, A. Maewal, K. Snoke,
H.M. Serra, R.T. Kubo, A. Sette, et al., Development of high potency universal DR-
restricted helper epitopes by modification of high affinity DR-blocking peptides,
Immunity 1 (9) (1994) 751–761.
[20] J.A. Junco, P. Peschke, I. Zuna, V. Ehemann, F. Fuentes, E. Bover, E. Pimentel,
R. Basulto, O. Reyes, L. Calzada, M.D. Castro, N. Arteaga, Y. Lopez, H. Garay,
H. Hernandez, R. Bringas, G.E. Guillen, Immunotherapy of prostate cancer in a
murine model using a novel GnRH based vaccine candidate, Vaccine 25 (50) (2007)
8460–8468.
[21] Y. Godet, E. Fabre, M. Dosset, M. Lamuraglia, E. Levionnois, P. Ravel,
N. Benhamouda, A. Cazes, F. Le Pimpec-Barthes, B. Gaugler, P. Langlade-Demoyen,
X. Pivot, P. Saas, B. Maillere, E. Tartour, C. Borg, O. Adotevi, Analysis of sponta-
neous tumor-specific CD4 T-cell immunity in lung cancer using promiscuous HLA-
DR telomerase-derived epitopes: potential synergistic effect with chemotherapy
response, Clinical Cancer Research: An Official Journal of the American Association
for Cancer Research 18 (10) (2012) 2943–2953.
[22] C.C. Fraser, D.H. Altreuter, P. Ilyinskii, L. Pittet, R.A. Lamothe, M. Keegan,
L. Johnston, T.K. Kishimoto, Generation of a universal CD4 memory T cell recall
peptide effective in humans, mice and non-human primates, Vaccine 32 (24) (2014)
2896–2903.
[23] Y. Yan, K. Hu, X. Deng, X. Guan, S. Luo, L. Tong, T. Du, M. Fu, M. Zhang, Y. Liu,
Immunization with HSV-2 gB-CCL19 fusion constructs protects mice against lethal
vaginal challenge, J. Immunol. 195 (1) (2015) 329–338.
108
International Immunopharmacology 61 (2018) 100–108
[24] F.N. Toka, M. Gierynska, B.T. Rouse, Codelivery of CCR7 ligands as molecular
adjuvants enhances the protective immune response against herpes simplex virus
type 1, J. Virol. 77 (23) (2003) 12742–12752.
[25] K. Hu, S. Luo, L. Tong, X. Huang, W. Jin, W. Huang, T. Du, Y. Yan, S. He,
G.E. Griffin, R.J. Shattock, Q. Hu, CCL19 and CCL28 augment mucosal and systemic
immune responses to HIV-1 gp140 by mobilizing responsive immunocytes into
secondary lymph nodes and mucosal tissue, J. Immunol. 191 (4) (2013)
1935–1947.
[26] T.M. Cairns, J. Fontana, Z.-Y. Huang, J.C. Whitbeck, D. Atanasiu, S. Rao, S.S. Shelly,
H. Lou, M. Ponce De Leon, A.C. Steven, R.J. Eisenberg, G.H. Cohen, Mechanism of
neutralization of herpes simplex virus by antibodies directed at the fusion domain
of glycoprotein B, J. Virol. 88 (5) (2014) 2677–2689.
[27] D. Cooper, M.W. Pride, M. Guo, M. Cutler, J.C. Mester, F. Nasar, J. She, V. Souza,
L. York, E. Mishkin, J. Eldridge, R.J. Natuk, Interleukin-12 redirects murine im-
mune responses to soluble or aluminum phosphate adsorbed HSV-2 glycoprotein D
towards Th1 and CD4+ CTL responses, Vaccine 23 (2) (2004) 236–246.
[28] M.A. Tigges, S. Leng, D.C. Johnson, R.L. Burke, Human herpes simplex virus (HSV)-
specific CD8+ CTL clones recognize HSV-2-infected fibroblasts after treatment with
IFN-gamma or when virion host shutoff functions are disabled, J. Immunol. 156
(10) (1996) 3901–3910.
[29] P.E. Cruz, P. Khalil, T. Dryden, H. Chiou, P. Fink, S.J. Berberich, N.J. Bigley, A novel
immunization method to induce cytotoxic T-lymphocyte responses (CTL) against
plasmid-encoded herpes simplex virus type-1 glycoprotein D1, Vaccine 17 (9–10)
(1999) 1091–1099.
[30] R.B. Belshe, T.C. Heineman, D.I. Bernstein, A.R. Bellamy, M. Ewell, R. van der Most,
C.D. Deal, Correlate of immune protection against HSV-1 genital disease in vacci-
nated women, J. Infect. Dis. 209 (6) (2014) 828–836.
[31] E. Okada, S. Sasaki, N. Ishii, I. Aoki, T. Yasuda, K. Nishioka, J. Fukushima,
J. Miyazaki, B. Wahren, K. Okuda, Intranasal immunization of a DNA vaccine with
IL-12-and granulocyte-macrophage colony-stimulating factor (GM-CSF)-expressing
plasmids in liposomes induces strong mucosal and cell-mediated immune responses
against HIV-1 antigens, J. Immunol. 159 (7) (1997) 3638–3647.
[32] W. Min, H.S. Lillehoj, J. Burnside, K.C. Weining, P. Staeheli, J.J. Zhu, Adjuvant
effects of IL-1β, IL-2, IL-8, IL-15, IFN-α, IFN-γTGF-β4 and lymphotactin on DNA
vaccination against Eimeria acervulina, Vaccine 20 (1) (2001) 267–274.
[33] F. Chiuppesi, L. Vannucci, A. De Luca, M. Lai, B. Matteoli, G. Freer, R. Manservigi,
L. Ceccherini-Nelli, F. Maggi, M. Bendinelli, M. Pistello, A lentiviral vector-based,
herpes simplex virus 1 (HSV-1) glycoprotein B vaccine affords cross-protection
against HSV-1 and HSV-2 genital infections, J. Virol. 86 (12) (2012) 6563–6574.
[34] S. Awasthi, J. Huang, C. Shaw, H.M. Friedman, Blocking herpes simplex virus 2
glycoprotein E immune evasion as an approach to enhance efficacy of a trivalent
subunit antigen vaccine for genital herpes, J. Virol. 88 (15) (2014) 8421–8432.
[35] B.M. Diethelm-Okita, D.K. Okita, L. Banaszak, B.M. Conti-Fine, Universal epitopes
for human CD4+ cells on tetanus and diphtheria toxins, J. Infect. Dis. 181 (3)
(2000) 1001–1009.
[36] K. Smyth, K. Garcia, Z. Sun, W. Tuo, Z. Xiao, TLR agonists are highly effective at
eliciting functional memory CTLs of effector memory phenotype in peptide im-
munization, Int. Immunopharmacol. 15 (1) (2013) 67–72.
[37] K. Murphy, C. Weaver, Janeway's Immunobiology, Garland Science, 2016.