2176

Journal of Food Protection, Vol. 69, No. 9, 2006, Pages 2176–2182

Copyright 䊚, International Association for Food Protection

Occurrence of Pathogens in Raw and Ready-to-Eat Meat and

Poultry Products Collected from the Retail Marketplace in
Edmonton, Alberta, Canada
V. M. BOHAYCHUK,1 G. E. GENSLER,1 R. K. KING,1 K. I. MANNINEN,1 O. SORENSEN,1 J. T. WU,1 M. E. STILES,2
AND L. M. MCMULLEN2*

1Food Safety Division, Alberta Agriculture, Food and Rural Development, 6909 116 Street, Edmonton, Alberta, Canada T6H 4P2; and 2Department
of Agricultural, Food and Nutritional Science, University of Alberta, 4-10 Agriculture Forestry Centre, Edmonton, Alberta, Canada T6G 2P5

MS 05-600: Received 30 November 2005/Accepted 10 March 2006

ABSTRACT
A total of 800 meat and poultry products were purchased from the retail marketplace in Edmonton, Alberta, Canada. The
products consisted of raw ground beef, chicken legs, pork chops, and ready-to-eat fermented sausage, roast beef, processed
turkey breast, chicken wieners, and beef wieners. The samples were analyzed to determine the prevalence of Shiga toxin–
producing Escherichia coli, Salmonella, Campylobacter spp., and Listeria monocytogenes. Shiga toxin–producing E. coli O22:
H8 was found in one raw ground beef sample. Salmonella and Campylobacter were found in 30 and 62% of raw chicken
legs, respectively. L. monocytogenes was found in 52% of raw ground beef, 34% of raw chicken legs, 24% of raw pork chops,
4% of fermented sausages, 3% of processed turkey breast, 5% of beef wieners, and 3% of chicken wieners. The occurrence
of pathogens in this study is similar to that in retail products in many other international locales.

The microbiological safety of meat and poultry prod-
ucts has assumed paramount importance for industry, con-
sumers, and public health officials. Approximately 30,000
cases of foodborne illness are reported annually in Canada
(21), although an estimated 2.2 million cases of foodborne
disease occur each year (40). Meat and poultry products are
frequently associated with foodborne outbreaks.
Irrespective of the surveillance systems employed,
many cases of foodborne illness are not reported for various
reasons: (i) the infected person does not seek medical care,
(ii) the healthcare provider does not obtain a specimen for
laboratory analysis, (iii) the laboratory does not perform
the necessary analysis, or (iv) the illness or laboratory find-
ings are not reported to public health officials (29). Re-
cently, the Canadian Integrated Surveillance Report was re-
leased and provided information on enteric disease due to
Salmonella, Campylobacter, and pathogenic Escherichia
coli from 1996 to 1999 (4). Many of the cases of salmo-
nellosis were associated with meat and poultry products
such as sausage, roast beef, prepackaged lunch products,
turkey, ham, raw meat, or poultry (4). Outbreaks due to E.
coli O157:H7 were associated with salami and ground beef
(4). Seasonal trends were noted for incidence of enteric
disease, with peaks consistently observed in the months of
July through October for Salmonella infections and distinct
summer peaks for Campylobacter and E. coli infections (4).
In Alberta, there were approximately 25 to 35 reported cas-
es of salmonellosis, 25 to 45 cases of campylobacteriosis,
and 5 to 9 cases of pathogenic E. coli infection per 100,000
* Author for correspondence. Tel: 780-492-6015; Fax: 780-492-8914;
E-mail: lynn.mcmullen@ualberta.ca.
people per year (4). However, these numbers are likely an
underestimate of the actual number of cases for the reasons
cited above. Laboratory-based surveillance detected be-
tween 47 and 79 cases of human listeriosis in Canada each
year from 1995 through 2000 (33). Infections due to Lis-
teria monocytogenes are not nationally reportable (33), so
these reports may be an underestimate.
Even though it is well established that meat and poultry
products are associated with foodborne illness in Canada,
little is known about the occurrence of bacterial contami-
nants in meat products in the retail marketplace. A small
number of raw meat samples obtained from grocery stores
in Calgary were analyzed for E. coli O157:H7 in 1985 (14),
and the prevalence of Salmonella in raw ground beef sam-
ples obtained from grocery and retail meat outlets through-
out Alberta was determined in 1999 (38). However, the oc-
currence of other pathogens in retail raw and ready-to-eat
meat and poultry products has not been determined. The
objective of this study was to determine the occurrence of
Shiga toxin–producing E. coli (STEC), Salmonella, Cam-
pylobacter spp., and L. monocytogenes in raw and ready-
to-eat meat and poultry products available to consumers in
the retail marketplace in a large urban center.
MATERIALS AND METHODS
Sample collection. Samples (n ⫽ 800) of raw ground beef,
raw chicken legs, raw pork chops, processed turkey breast, roast
beef, fermented sausage, chicken wieners, and beef wieners from
refrigerated retail counters were purchased from stores of four
supermarket chains in Edmonton, Alberta, Canada. Stores of the
four supermarket chains were identified from telephone listings
and were assigned identification numbers to generate a random
collection schedule. Sampling visits to stores were made every
J. Food Prot., Vol. 69, No. 9 OCCURRENCE OF PATHOGENS IN RETAIL MEAT AND POULTRY PRODUCTS
Sunday and Monday from May to August 2001. Samples con-
sisted of a minimum of 500 g of lean raw ground beef that had
been ground and packaged in the retail store or 500-g chub pack-
ages prepared in the processing plant, 500 g of in-store wrapped
packages of raw chicken legs and raw pork chops, two 300-g
packages of vacuum-packaged chicken wieners, beef wieners, or
fermented sausage from the same batch or lot, and processor vac-
uum-packaged or deli-sliced turkey breast and roast beef. All
products that had a ‘‘best before’’ date on the package were pur-
chased prior to the date on the package.
On each of the two sampling days, selected meat products
were purchased from three to six stores and transported on ice to
the laboratory. Upon arrival at the laboratory, the temperature of
the samples was measured to ensure that temperature abuse had
not occurred. Samples were stored at 2 to 3⬚C and analyzed the
following day. One unopened 300-g package of each ready-to-eat
product was stored at 2⬚C in case retesting was necessary.
Pathogen detection. Culture methods were used for the de-
tection of STEC, Salmonella, Campylobacter spp., and L. mono-
cytogenes from all meat and poultry samples. Media used were
from Difco Laboratories (Becton Dickinson, Sparks, Md.) unless
otherwise indicated. Samples were initially screened for the pres-
ence of a particular pathogen using at least one rapid method
selected on the basis of results from a previous study (3). Com-
mercially available enzyme-linked immunosorbent assay (ELISA)
kits were used to detect the presence of Shiga toxins and Cam-
pylobacter spp., a PCR assay was used to detect the presence of
STEC and Salmonella, and a lateral flow immunoprecipitation as-
say was used to detect the presence of Listeria spp. All samples
with a positive result from the rapid assays were confirmed using
standard culture methods. For all analyses, positive and negative
controls were included with each set of samples. Positive controls
E. coli O157:H7 ATCC 35150, Salmonella Typhimurium ATCC
14028, Campylobacter jejuni ATCC 33250, and L. monocytogenes
ATCC 19115 were inoculated into the appropriate enrichment
broths. Negative controls were samples of uninoculated enrich-
ment broths.
STEC was detected using a modification of the U.S. Depart-
ment of Agriculture method (37). A 25-g sample of each meat or
of raw chicken skin was homogenized in a stomacher (Seward
Stomacher 400, Seward Laboratory, London, UK) for 2 min in
225 ml of modified EC broth supplemented with novobiocin (20
␮g ml⫺1; Sigma-Aldrich Canada Ltd., Oakville, Ontario) and in-
cubated at 35⬚C for 24 h. Aliquots (300 ␮l for PCR and 1 ml for
ELISA) of each modified EC broth were removed and analyzed
for the presence of Shiga toxin genes by PCR and for Shiga toxins
by ELISA. Aliquots of each positive modified EC broth sample
were stored at ⫺70⬚C in 20% sterile glycerol (vol/vol) for sub-
sequent analysis. The frozen aliquots that were positive by PCR
and/or ELISA were thawed and inoculated into fresh modified EC
broth, incubated at 35⬚C for 24 h, and analyzed by PCR to confirm
the presence of Shiga toxin genes. These samples were streaked
onto MacConkey agar, sorbitol MacConkey agar, sorbitol Mac-
Conkey agar with cefixime and tellurite (Dynal Inc., Lake Suc-
cess, N.Y.), and chromogenic E. coli agar (CHROMagar O157,
CHROMagar, Paris, France). After 24 h of incubation at 35⬚C,
colonies from each plate were streaked for purity onto blood agar
plates. Individual colonies were picked from the blood agar plates
and suspended in tubes containing 100 ␮l of 12 mM Tris buffer
(pH 8.0). The tubes were heated for 10 min in a waterbath con-
taining boiling water to release DNA and were then immediately
cooled on ice. Ten microliters was tested for the presence of both
stx1 and stx2 genes by PCR. A maximum of 40 colonies per sam-
2177
ple were tested. Colonies that tested positive by PCR were inoc-
ulated into modified EC broth, incubated at 35⬚C for 24 h, and
analyzed for Shiga toxins by ELISA. Colonies were also bio-
chemically identified (API 32E, bioMérieux Canada Inc., St. Lau-
rent, Quebec) and serologically analyzed using latex agglutination
(E. coli O157 agglutination test, Prolex, Pro-Lab Diagnostics,
Richmond Hill, Ontario, Canada). E. coli isolates that were neg-
ative for the O157 serotype by latex agglutination were sent for
serotyping to the Public Health Agency of Canada Laboratory for
Foodborne Zoonoses (Guelph, Ontario).
Salmonella was detected using a modification of the Health
Protection Branch method (12). A 25-g sample of each meat or
of raw chicken skin was homogenized in a stomacher for 2 min
in 225 ml of universal enrichment broth and incubated at 35⬚C
for 24 h. Aliquots (300 ␮l) of each broth culture were analyzed
by PCR. For cultures PCR-positive for Salmonella, 1 ml of the
culture broth was transferred to 10 ml of tetrathionate broth and
to 10 ml of selenite cystine broth. The tetrathionate broth was
incubated at 42⬚C for 24 h, and selenite cystine broth was incu-
bated at 35⬚C for 24 h. The tetrathionate and selenite cystine
broths were streaked onto xylose-lysine-tergitol 4 agar and bril-
liant green sulfa agar plates and incubated at 35⬚C for 24 h. Five
typical colonies were screened using triple sugar iron agar slants,
urea agar slants, and MacConkey agar plates incubated at 35⬚C
for 24 h. A representative isolate from each positive sample was
biochemically identified using the API 32E system and serologi-
cally confirmed using the poly O agglutination test (Difco, Becton
Dickinson). The isolates were stored at ⫺70⬚C in sheep blood and
subsequently sent for serotyping (Provincial Laboratory for Public
Health, Calgary, Alberta, Canada).
Campylobacter spp. were detected using a modification of
the U.S. Food and Drug Administration method (24). A 25-g sam-
ple of each meat or of raw chicken skin was added to 100 ml of
Bolton broth (Oxoid, Nepean, Ontario, Canada) in filter stomacher
bags and mixed on a platform shaker at 25 rpm for 5 min. The
samples and filters were removed, and the broth was adjusted to
pH 7.4 with 1 N NaOH or 1 N HCl. The enrichment broths were
incubated under microaerophilic conditions (5% O2, 10% CO2,
and 85% N2) for 4 h at 35⬚C and then for 42 h at 42⬚C. After
incubation, 5-ml aliquots from each sample were removed and
screened for Campylobacter spp. using the ELISA. Samples that
were positive for Campylobacter were streaked onto Karmali agar
(Oxoid) and charcoal-cefoperazone-deoxycholate agar (Oxoid)
plates, which were incubated in a microaerophilic atmosphere at
42⬚C for up to 48 h. Typical Campylobacter colonies were con-
firmed using Gram stain and oxidase and catalase tests. Species
identity was determined based on the results of hippurate tests and
sensitivity tests for nalidixic acid and cephalothin (24).
L. monocytogenes was detected using a modified Health Pro-
tection Branch method (34). A 25-g sample of each meat or of
raw chicken skin was homogenized in a stomacher for 2 min in
225 ml of University of Vermont modified Listeria enrichment
broth (UVM) and incubated at 30⬚C for 48 h. A 0.1-ml volume
of the UVM culture was then transferred to 10 ml of modified
Fraser broth and incubated at 35⬚C for 48 h. A 2-ml volume of
modified Fraser broth culture was then removed and screened for
the presence of Listeria spp. using lateral flow immunoprecipita-
tion test kits. Modified Fraser broth cultures from samples deter-
mined to be positive by the immunoprecipitation tests were
streaked onto lithium chloride phenylethanol moxalactam (LPM),
PALCAM, and Oxford agar plates. The LPM plates were incu-
bated at 30⬚C and the PALCAM and Oxford plates were incubated
at 35⬚C for up to 48 h. The presence of Listeria spp. was con-
firmed by Gram stain and oxidase and catalase tests. L. monocy-
2178 BOHAYCHUK ET AL. J. Food Prot., Vol. 69, No. 9

TABLE 1. Nucleotide sequences of the oligonucleotide primers used for PCR amplification of bacterial genes in enrichment broth
cultures
Gene Product size
Organism targeted 5⬘ to 3⬘ sequence (bp) Reference

STEC stx1 Forward: ACACTGGATGATCTCAGTGG 614 17

Reverse: CTGAATCCCCCTCCATTATG
stx2 Forward: CCATGACAACGGACAGCAGTT 779
Reverse: CCTGTCAACTGAGCACTTTG
Salmonella invA Forward: ACAGTGCTCGTTTACGACCTGAAT 244 10
Reverse: AGACGACTGGTACTGATCGATAAT

togenes was identified by ␤-hemolysis on horse blood agar, and
the species identity was confirmed by nucleic acid hybridization
probe tests (Accuprobe, Gen-Probe Inc., San Diego, Calif.) ac-
cording to the manufacturer’s instructions. One L. monocytogenes
isolate from each positive sample was stored at ⫺70⬚C in sheep
blood and subsequently serotyped using an agglutination assay
(Listeria antisera ‘‘Seiken,’’ Denka Seika Co. Ltd., Tokyo, Japan).
L. monocytogenes isolates were streaked on brain heart infusion
(BHI) agar and motility test medium (MTM) agar plates and in-
cubated overnight at 35 and 30⬚C, respectively. For determination
of O antigens, a dense cell suspension was prepared by removing
cells from the surface of the BHI agar plate with a 10-␮l loop
and placing them in 1 ml of 0.2% saline in a sterile microcentri-
fuge tube. The cell suspension was autoclaved at 121⬚C for 30
min, cooled to room temperature, and centrifuged at 1,000 ⫻ g
for 20 min. The supernatant was discarded, and the cell pellet was
resuspended in 1 ml of 0.2% saline. With a sterile loop, 10 ␮l of
the cell suspension was added to 20 ␮l each of OI/II and OV/VI
polyvalent antisera on a glass slide, mixed well, and observed for
agglutination. Isolates were typed using individual antisera de-
pending on the reactions observed using the polyvalent antisera.
With a sterile loop, 10 ␮l of the cell suspension was added to 20
␮l each of OI and OIV or OVI, OVII, OVIII, and OIX antisera
on a glass slide, mixed well, and observed for agglutination.
For determination of H antigens, bacteria from the outer edge
of colonies growing on MTM agar plates were transferred to the
surface of another MTM agar plate and incubated overnight at
30⬚C. This procedure was then repeated to enhance motility. After
the second overnight incubation, bacteria from the outer edge of
colonies growing on the MTM agar plate was transferred to 1 ml
of BHI broth and incubated overnight at 30⬚C, and then 1 ml of
1% formalin was added to the broth culture and mixed. Twenty
microliters of each H antiserum (A, AB, C, and D) was added to
wells of a 96-well microtiter plate, and 200 ␮l of the cell suspen-
sion was added to each of the antiserum wells. The microtiter
plate was agitated for 2 min on an Aliquot Mixer (Ames Com-
pany, Division Miles Laboratories, Inc., Elkhart, Ind.) and then
incubated for 1 h in a waterbath at 50 to 52⬚C, and samples were
observed for agglutination. Determination of serotype for each L.
monocytogenes isolate was made using the antigen structure table
provided by the manufacturer of the antisera.
DNA extraction. DNA was extracted from modified EC en-
richment broth for STEC and from tetrathionate and selenite cys-
tine enrichment broths for Salmonella using a lysis reagent (Ultra
PrepMan, Applied Biosystems, Foster City, Calif.). A 300-␮l vol-
ume of modified EC broth culture or 150 ␮l each of tetrathionate
and selenite cystine broths were added to 700 ␮l of sterile purified
water and mixed. After centrifugation at 18,000 ⫻ g for 5 min,
the supernatant was discarded, and 200 ␮l of well-mixed lysis
reagent was added to the pellet, which was resuspended and held
for 10 min in a boiling waterbath. After cooling to room temper-
ature, the suspension was centrifuged at 18,000 ⫻ g for 3 min,
and 75 ␮l of the supernatant was mixed with 75 ␮l of 12 mM
Tris buffer (pH 8.0) and stored at 4⬚C for use in PCRs. DNA
extractions of positive and negative control cultures were included
with each batch of samples.
STEC isolates were suspended in 100 ␮l of 12 mM Tris
buffer (pH 8.0) and heated for 10 min in a boiling waterbath to
extract DNA. The heated samples were chilled on ice prior to use
in PCRs. Colonies of E. coli O157:H7 (ATCC 35150) and non-
STEC (ATCC 25922) were included in every extraction as posi-
tive and negative controls, respectively.
PCR. Target genes and oligonucleotide sequences used for
PCRs are listed in Table 1. Multiplex PCRs for STEC consisted
of Tris buffer (20 mM Tris-HCl, pH 8.0, 50 mM KCl), 2.5 mM
MgCl2, 200 ␮M each dNTP, 1 ␮M stx1 primers, 0.5 ␮M stx2
primers, 0.02 U/␮l platinum Taq polymerase (all reagents from
Invitrogen Canada Inc., Burlington, Ontario), and 10 ␮l of tem-
plate DNA in a 50-␮l reaction volume. The multiplex reaction
was amplified in a Peltier thermocycler (DNA Engine PTC-200,
MJ Research Inc., Waltham, Mass.) at 94⬚C for 5 min followed
by 35 cycles of 94⬚C for 1 min, 60⬚C for 1 min, and 72⬚C for 2
min and a final extension step of 72⬚C for 5 min. A positive
control to monitor DNA extraction, strong and weak PCR-positive
controls (10 and 1 pg of purified genomic E. coli O157:H7 AP-
0087-10, a laboratory isolate from raw ground beef), and a neg-
ative control (water) were included in each run. Samples with
positive stx1 or stx2 signals were rerun in separate reactions with
the individual primer sets to confirm PCR product size. PCR prod-
ucts were separated and visualized on agarose gels stained with
ethidium bromide.
Reaction mixtures for Salmonella consisted of Tris buffer (20
mM Tris-HCl, pH 8.0, 50 mM KCl), 1.5 mM MgCl2, 100 ␮M
each dNTP, 1.0 ␮M invA primers, 0.02 U/␮l platinum Taq poly-
merase, and 10 ␮l of template DNA in a final volume of 50 ␮l.
To detect the presence of PCR inhibitors, 100 fg of an internal
control was added to each reaction. Reactions were amplified by
heating at 94⬚C for 5 min followed by 35 cycles of 94⬚C for 30
s, 56⬚C for 30 s, and 72⬚C for 2 min and then a final extension
step of 72⬚C for 10 min. A DNA extraction positive control,
strong and weak PCR positive controls (10 and 2 pg of purified
genomic DNA from Salmonella Typhimurium ATCC 14028), and
a negative control (water) were included in each run. PCR prod-
ucts were separated and visualized on agarose gels stained with
ethidium bromide.
ELISA. ELISAs for Campylobacter spp. and the presence of
Shiga toxins were carried out using commercial kits that were
adapted for automation (BioMek 2000 workstation, Beckman
Coulter, Fullerton, Calif.). Kits were used according to the man-
J. Food Prot., Vol. 69, No. 9 OCCURRENCE OF PATHOGENS IN RETAIL MEAT AND POULTRY PRODUCTS 2179

TABLE 2. Prevalence of pathogens confirmed by standard cul- TABLE 3. L. monocytogenes serotypes isolated from the meat
ture methods in meat and poultry products and poultry products and numbers of samples with each serotype
Prevalence (%) Serotype
Product (no. of samples)
No. of Salmo- Campylo- L. mono-
Sample type samples STEC nella bacter cytogenes Raw ground beef 1/2a (15), 1/2b (32), 1/2c (5)
Raw chicken legs 1/2a (19), 1/2b (11), 1/2c (4)
Raw ground beef 100 1.0 0 0 52.0 Raw pork chops 1/2a (11), 1/2b (5), 1/2c (3),
Raw chicken legs 100 0 30.0 62.0 34.0 3a (1), 3b (1), 3c (1), 4b (1)
Raw pork chops 98 0 0 0 23.5 Fermented sausage 1/2a (4)
Fermented sausage 100 0 0 0 4.0 Turkey breast 1/2a (1), 1/2b (2)
Roast beef 101 0 0 0 0 Beef wieners 1/2b (5)
Turkey breast 100 0 0 0 3.0 Chicken wieners 1/2b (3)
Beef wieners 100 0 0 0 5.0
Chicken wieners 101 0 0 0 3.0
identified as Salmonella Heidelberg and 11% (3 of 27) were
Salmonella Braenderup. Two isolates each (7%) were Sal-
ufacturer’s instructions with modifications. Kits from a single lot monella Enteritidis and Salmonella Kentucky. Salmonella
number were purchased to minimize variability. Optical density Schwarzengrund, Salmonella Thompson, Salmonella
values were read with a Vmax ELISA reader (Molecular Devices,
Mbandaka, and Salmonella Typhimurium were each rep-
Sunnyvale, Calif.). Controls consisting of a positive and negative
resented by one isolate (4%).
kit control and a known positive sample were run in each assay.
Campylobacter spp. were detected using kits (TECRA Cam-
Campylobacter spp. were isolated from 62% of raw
pylobacter Visual Immunoassay, TECRA International Pty Ltd., chicken leg samples. Of these, Campylobacter jejuni was
Willoughby, New South Wales, Australia) according to the man- isolated from 49 samples, Campylobacter coli was isolated
ufacturer’s instructions. The assay was modified by using samples from 3 samples, Campylobacter lari was isolated from 2
enriched for 48 h in Bolton broth instead of TECRA Campylo- samples, and 2 samples contained Campylobacter isolates
bacter enrichment broth. that could not be identified to species using these methods
Shiga toxins were detected using ELISA kits (Ridascreen and were therefore identified only as thermophilic Cam-
Verotoxin, R-Biopharm, GmbH, Darmstadt, Germany). The pro- pylobacter spp. Six of the samples contained two species
tocol was modified using samples enriched for 24 h in modified of Campylobacter: C. jejuni and C. coli were isolated from
EC broth instead of tryptic soy broth with novobiocin. five samples, and C. jejuni and thermophilic Campylobacter
Lateral flow immunoprecipitation. Listeria spp. were de- spp. were isolated from one sample. Campylobacter was
tected using lateral flow immunoprecipitation kits (REVEAL Lis- not isolated from any of the other meat or poultry products.
teria Test System, Neogen Corporation, Lansing, Mich.). The L. monocytogenes was isolated from all meat and poul-
manufacturer’s protocol was modified so that samples were en- try product types except for roast beef. L. monocytogenes
riched in UVM broth instead of half-Fraser broth and then trans- serotypes and the number of samples with each serotype
ferred into modified Fraser broth instead of buffered Listeria en- are listed in Table 3. The majority of samples contained L.
richment broth. A 2.0-ml volume of modified Fraser broth incu- monocytogenes that belonged to serotypes 1/2a and 1/2b.
bated for 48 h was heated in a waterbath at 80⬚C for 20 min and Raw pork chops had the highest diversity of serotypes and
then cooled to room temperature, and six drops were added to the were the only product type that contained a sample with L.
test strip. The results were interpreted within 15 to 20 min ac-
monocytogenes serotype 4b. L. monocytogenes isolated
cording to the manufacturer’s instructions.
from fermented sausage were all of serotype 1/2a, and iso-
RESULTS lates from beef wieners and chicken wieners were all of
serotype 1/2b. Two of the L. monocytogenes isolates, se-
During this study, 100 samples each of raw ground
rotypes 1/2a and 1/2b, were isolated from processor vacu-
beef, raw chicken legs, processed turkey breast, beef wie-
um-packaged turkey breast, and one serotype 1/2b L. mono-
ners, and fermented sausage, 101 samples each of roast beef cytogenes isolate was isolated from deli-sliced turkey
and chicken wieners, and 98 samples of raw pork chops breast.
were analyzed. The prevalences of STEC, Salmonella, More than one pathogen was isolated from 39 of the
Campylobacter spp., and L. monocytogenes in the meat and raw chicken leg samples. Of these, 17 samples were posi-
poultry products are given in Table 2. tive for both L. monocytogenes and Campylobacter spp.
STEC was isolated from only one sample of raw Salmonella and Campylobacter spp. were both isolated
ground beef. A positive PCR result was obtained for both from another 16 samples. One sample contained both Sal-
the stx1 and stx2 genes, and the E. coli isolate was deter- monella and L. monocytogenes, and five samples were pos-
mined to be serotype O22:H8. itive for Salmonella, L. monocytogenes, and Campylobacter
Salmonella was isolated from 30.0% of raw chicken spp. Only one pathogen type was isolated in all other meat
legs. No Salmonella was detected in any other meat or and poultry products.
poultry products. Of the 30 Salmonella isolates recovered
from raw chicken legs, one isolate could not be resuscitated DISCUSSION
after storage at ⫺70⬚C and two isolates could not be se- The microbiological safety of food products is of ex-
rotyped. Fifty-nine percent (16 of 27) of the isolates were treme importance to industry, public health officials, regu-
2180 BOHAYCHUK ET AL.
latory agencies, and the public. Little information is avail-
able regarding the occurrence of pathogens in meat and
poultry products in the retail marketplace in Alberta. This
survey provided important information on the occurrence
of STEC, Salmonella, Campylobacter spp., and L. mono-
cytogenes in raw and ready-to-eat meat and poultry prod-
ucts offered for sale to consumers.
Culture methods have traditionally been regarded as
the ‘‘gold standard’’; however, they are labor intensive, and
results can take several days to obtain. The use of rapid
methods such as PCR, ELISA, and lateral flow immuno-
precipitation greatly reduces the manpower and time re-
quired to obtain presumptive results. In this study, rapid
methods previously determined to be effective for meat and
poultry products (3) were used to screen the products for
the presence of pathogens. This screening approach elimi-
nated the need for culturing a large number of negative
samples and allowed resources to be focused on the culture
of presumptive positive samples.
STEC was not detected in raw chicken legs, raw pork
chops, fermented sausage, roast beef, processed turkey
breast, beef wieners, or chicken wieners tested in this study.
STEC was isolated from only one sample of raw ground
beef, and serotyping of this isolate indicated that the or-
ganism was not E. coli O157:H7, the serotype most com-
monly associated with large outbreaks in Canada, the Unit-
ed States, and the United Kingdom (35). However, the E.
coli serotype detected, O22:H8, is known to be associated
with severe disease (2, 35). This low occurrence of STEC
is similar to those reported for minced beef in Switzerland
(16) and The Netherlands (23) (2.3 and 1.1%, respectively).
A recent survey of ground beef produced at federally in-
spected establishments in Canada also revealed a low prev-
alence (0.25 to 2.1%) of E. coli O157 (19). The prevalence
of STEC reported here is much lower than that reported for
ground beef from retail stores in the United States (36) and
France (35) (16.8 and 11%, respectively).
Salmonella was not detected in any of the meat or
poultry products tested in this study other than raw chicken
legs. In other studies, Salmonella has been found in retail
raw beef and pork products (5, 15, 20, 38, 46, 47); however,
the prevalences were low (1.0 to 9.6%). In the present
study, 30% of the raw chicken legs sampled contained Sal-
monella. This percentage is similar to that reported for retail
chicken legs (35.8%) in Spain (13) and retail poultry car-
casses (36.5%) in Belgium (42). The prevalence of Sal-
monella in the present study was higher than those reported
for retail chicken from Washington, D.C. (4.2%) (46),
Wales (4.4%) (31), Italy (9.9%) (5), and Northern Ireland
(11%) (45), but lower than those in the state of Maryland
(44%) (11), in Portugal (60%) (1), and in Spain (55%) (6).
It is not clear why these rates vary so greatly, but the dif-
ferences in the prevalence of Salmonella in raw poultry
may be due to country of origin, type and size of sample
analyzed, and methodology used. The predominant Sal-
monella serotype identified in this study was Salmonella
Heidelberg, followed by Salmonella Braenderup, Salmo-
nella Enteritidis, and Salmonella Kentucky. In Canada from
1995 to 1999, the predominant serovars from human cases
J. Food Prot., Vol. 69, No. 9
of salmonellosis were Salmonella Typhimurium and Sal-
monella Enteritidis followed by Salmonella Heidelberg (4).
Salmonella Braenderup did not place in the top 10 serovars
during this time period. Unfortunately, data from 2000 on-
ward are not currently available. Other researchers who
have isolated Salmonella from raw chicken purchased in
the retail marketplace in Portugal, Spain, and Ireland have
identified Salmonella Enteritidis as the predominant sero-
type in raw poultry, and this serotype is the one most often
associated with human illness in Europe (1, 6, 13, 45). Sal-
monella Enteritidis is commonly associated with poultry,
and it is unclear why Salmonella Heidelberg was such a
predominant serotype in raw chicken during the period of
this study. It would be of interest to know whether isolates
from human cases of salmonellosis were also of serotype
Salmonella Heidelberg during this same time period.
Campylobacter spp. were not detected in any of the
meat or poultry products tested other than raw chicken legs.
In other studies, Campylobacter has been detected in raw
beef and pork products; however, the prevalences were low
(0.5 to 5.1%) (15, 44, 46). Campylobacter spp. were iso-
lated from 62% of the raw chicken legs sampled in the
present study. The predominant species isolated was C. je-
juni, which comprised 79.0% of the isolates. C. coli was
the second most common species, comprising 4.8% of the
isolates. In Canada, the majority of human Campylobacter
isolates associated with enteric disease are C. jejuni and C.
coli, at a ratio of approximately 12:1 (4), which is close to
the ratio of 16:1 for C. jejuni and C. coli isolated from raw
chicken legs in this study. The prevalence of C. jejuni and
C. coli in this study was similar to that reported in Ireland
(44), where C. jejuni and C. coli were isolated from 84.7
and 15.3% of retail chicken samples, respectively. This
finding contrasts with that for Campylobacter isolates from
retail chicken in Maryland, where similar percentages of C.
jejuni and C. coli (62 and 40% of Campylobacter isolates,
respectively) were detected (11). The overall prevalence of
Campylobacter reported here is similar to that reported for
raw retail chicken in the United States (11, 46), Spain (13),
Ireland (44, 45), and Wales (30, 31).
Roast beef was the only sample item in this study in
which L. monocytogenes was not detected. There was a
relatively high prevalence of L. monocytogenes (52, 34, and
23.5%) in raw ground beef, raw chicken legs, and raw pork
chops, respectively. However, these rates are comparable to
the 34.9% for raw beef and pork in Spain (43), 20.6% for
pork in Japan (25), 19.8% for pork in the United States
(15), and 36 to 38% for poultry in Japan, Spain, and Bel-
gium (25, 42, 43). Other researchers have found L. mono-
cytogenes prevalences of 1.9 to 18% in raw beef, pork, and
poultry in Denmark, Switzerland, Japan, Mexico, Ireland,
and Italy (5, 16, 22, 25, 32, 39). The prevalence of L. mono-
cytogenes in raw meat products in the present study was
not unexpected because of the ubiquitous and environmen-
tally tolerant nature of this organism.
L. monocytogenes is not typically a pathogen of con-
cern in raw meat products; however, the presence of L.
monocytogenes in several of the ready-to-eat products test-
ed is suggestive of postprocessing contamination and is of
J. Food Prot., Vol. 69, No. 9 OCCURRENCE OF PATHOGENS IN RETAIL MEAT AND POULTRY PRODUCTS
concern for food safety. Three to 5% of turkey breast, beef
wiener, and chicken wiener samples tested contained L.
monocytogenes. These detection rates are similar to those
reported for cooked and cured meat products in Denmark
(5%) (32), Spain (6.7%) (43), Belgium (4.9%) (41), Swit-
zerland (6.0%) (26), and the United States (3.6%) (28). L.
monocytogenes was detected in 4% of the fermented sau-
sage samples, a rate similar to that reported for fermented
sausage in the United States (3.25%) (28). The prevalence
reported here for L. monocytogenes in fermented sausage
is considerably lower than the 11.7 and 15% reported in
Belgium and Switzerland, respectively (26, 41).
Forty percent (50 of 124) of the L. monocytogenes iso-
lates were serotype 1/2a, 47% (58 of 124) were serotype 1/
2b, and 10% (12 of 124) were serotype 1/2c, and there was
one isolate each of serotypes 3a, 3b, 3c, and 4b. The se-
rotypes most often associated with foodborne illness are 1/
2a, 1/2b, and 4b (18). Of the strains isolated from raw
ground beef and raw pork chops, 35% (26 of 75), 49% (37
of 75), and 1% (1 of 75) were serotypes 1/2a, 1/2b, and
4b, respectively. Others have reported that 20, 16, and 27%
(43) and 44, 5, and 23% (16) of L. monocytogenes strains
isolated from raw meats were serotypes 1/2a, 1/2b, and 4b,
respectively. Of the L. monocytogenes isolated from raw
chicken legs, 56% (19 of 34) were serotype 1/2a and 32%
(11 of 34) were serotype 1/2b. Serotype 4b was not detected
in raw chicken legs tested in this study. Vitas and Garcia-
Jalon (43) found that 26.3, 36.8, and 21.1% of the strains
from poultry were serotypes 1/2a, 1/2b, and 4b, respective-
ly. The prevalence of serotype 4b in raw products tested in
this study was also considerably lower than the rates re-
ported for raw products in Spain and Switzerland (16, 43).
Of the 15 L. monocytogenes isolates from ready-to-eat
products, 33% (5 of 15) and 67% (10 of 15) were serotypes
1/2a and 1/2b, respectively. This contrasts with results from
a study from Spain, where 4b was the predominant L.
monocytogenes serotype isolated from cured meats (43).
The presence of L. monocytogenes serotypes associated
with foodborne illness in ready-to-eat products emphasizes
the need for enhanced safe food handling practices to en-
sure that postprocessing contamination does not occur.
Contaminated food is reported to be the major vehicle
for cases of enteric disease in Canada, with poultry and
other meat items constituting the largest percentage of food
items associated with illness (27). Campylobacter followed
by Salmonella cause the highest number of cases of enteric
illness (4, 27). The relatively high prevalence of Salmonel-
la, Campylobacter, and L. monocytogenes in raw poultry
and meat products in this study emphasizes the need for
consumers to continue to be vigilant when handling these
products. It is important to prevent cross-contamination and
properly cook meat and poultry products to reduce the like-
lihood of foodborne illness. Of concern is the relatively
high prevalence of L. monocytogenes in several ready-to-
eat products. In recent years, there have been several large
outbreaks associated with consumption of ready-to-eat
meats such as wieners, chicken and turkey products (fresh
and frozen), and deli turkey meat contaminated with L.
monocytogenes (7–9).
2181
Although relatively few samples of each of the meat
or poultry products were tested, this study provides an in-
dication of the prevalence of pathogens in products avail-
able to consumers in the retail marketplace. Future surveys
conducted over a longer period and with larger numbers of
samples should be conducted to determine whether the
prevalences of these pathogens are changing and to avoid
bias due to possible seasonal effects.
ACKNOWLEDGMENTS
The authors are grateful for the technical assistance of Evelyn Bowl-
by, Eva Chow, Barbara Dakin, Susan Gibson, Kyla Kennedy, Sava Kne-
zic, Patricia Layton, Wayne Lazaroff, Blair Rogers, Marshall Smith, Deana
Wischlinski, and Lester Wong. This study was funded in part by the Al-
berta Agricultural Research Institute Strategic Emerging Issues Program.
REFERENCES
1. Antunes, P., C. Reu, J. C. Sousa, L. Peixe, and N. Pestana. 2003.
Incidence of Salmonella from poultry products and their suscepti-
bility to antimicrobial agents. Int. J. Food Microbiol. 82:97–103.
2. Blanco, J., M. Blanco, J. E. Blanco, A. Mora, E. A. Gonzalez, M.
I. Bernardez, M. P. Alonso, A. Coira, A. Rodriguez, J. Rey, J. M.
Alonso, and M. A. Usera. 2003. Verotoxin-producing Escherichia
coli in Spain: prevalence, serotypes, and virulence genes of O157:
H7 and non-O157 VTEC in ruminants, raw beef products, and hu-
mans. Exp. Biol. Med. 228:345–351.
3. Bohaychuk, V. M., G. E. Gensler, R. K. King, J. T. Wu, and L. M.
McMullen. 2005. Evaluation of detection methods for screening
meat and poultry products for the presence of foodborne pathogens.
J. Food Prot. 68:2637–2647.
4. Bowman, C., J. Flint, and F. Pollari. 2003. Canadian integrated sur-
veillance report: Salmonella, Campylobacter, pathogenic E. coli and
Shigella, from 1996 to 1999. Can. Commun. Dis. Rep. 29 (Suppl.
1):1–32.
5. Busani, L., A. Cigliano, E. Taioli, V. Caligiuri, L. Chiavacci, C. Di
Bella, A. Battisti, A. Duranti, M. Gianfranceschi, M. C. Nardella,
A. Ricci, S. Rolesu, M. Tamba, R. Marabelli, and A. Caprioli. 2005.
Prevalence of Salmonella enterica and Listeria monocytogenes con-
tamination in foods of animal origin in Italy. J. Food Prot. 68:1729–
1733.
6. Capita, R., M. Alvarez-Astorga, C. Alonso-Calleja, B. Moreno, and
M. del Camino Garcia-Fernandez. 2003. Occurrence of salmonellae
in retail chicken carcasses and their products in Spain. Int. J. Food
Microbiol. 81:169–173.
7. Centers for Disease Control and Prevention. 1998. Multistate out-
break of listeriosis—United States, 1998. Morb. Mortal. Wkly. Rep.
47:1085–1086.
8. Centers for Disease Control and Prevention. 2000. Multistate out-
break of listeriosis—United States, 2000. Morb. Mortal. Wkly. Rep.
49:1129–1130.
9. Centers for Disease Control and Prevention. 2002. Public health dis-
patch: outbreak of listeriosis—northeastern United States, 2002.
Morb. Mortal. Wkly. Rep. 51:950–951.
10. Chiu, C. H., and J. T. Ou. 1996. Rapid identification of Salmonella
serovars in feces by specific detection of virulence genes, invA and
spvC, by an enrichment broth culture–multiplex PCR combination
assay. J. Clin. Microbiol. 34:2619–2622.
11. Cui, S., B. Ge, J. Zheng, and J. Meng. 2005. Prevalence and anti-
microbial resistance of Campylobacter spp. and Salmonella serovars
in organic chickens from Maryland retail stores. Appl. Environ. Mi-
crobiol. 71:4108–4111.
12. D’Aoust, J. Y., and U. Purvis. 1998. Isolation and identification of
Salmonella from foods. MFHPB-20, p. 1–19. In D. Warburton (ed.),
Compendium of analytical methods. Health Protection Branch meth-
ods of microbiological analysis of foods, vol. 2. Polyscience Publi-
cations Inc., Montreal.
13. Dominguez, C., I. Gomez, and J. Zumalacarregui. 2002. Prevalence
2182 BOHAYCHUK ET AL.
of Salmonella and Campylobacter in retail chicken meat in Spain.
Int. J. Food Microbiol. 72:165–168.
14. Doyle, M. P., and J. L. Schoeni. 1987. Isolation of Escherichia coli
O157:H7 from retail fresh meats and poultry. Appl. Environ. Micro-
biol. 53:2394–2396.
15. Duffy, E. A., K. E. Belk, J. N. Sofos, G. R. Bellinger, A. Pape, and
G. C. Smith. 2001. Extent of microbial contamination in United
States pork retail products. J. Food Prot. 64:172–178.
16. Fantelli, K., and R. Stephan. 2001. Prevalence and characteristics of
Shiga toxin–producing Escherichia coli and Listeria monocytogenes
strains isolated from minced meat in Switzerland. Int. J. Food Mi-
crobiol. 70:63–69.
17. Gannon, V. P., R. K. King, J. Y. Kim, and E. J. Thomas. 1992. Rapid
and sensitive method for detection of Shiga-like toxin–producing
Escherichia coli in ground beef using the polymerase chain reaction.
Appl. Environ. Microbiol. 58:3809–3815.
18. Gellin, B. G., and C. V. Broome. 1989. Listeriosis. JAMA 261:1313–
1320.
19. Gleeson, T., L. Duncan, J. Kamanzi, R. Charlebois, and J. Farber.
2005. Prevalence studies on Escherichia coli O157:H7, Salmonella
spp. and indicator bacteria in raw ground beef produced at federally
registered establishments in Canada. Food Prot. Trends 25:242–249.
20. Harris, N. V., D. Thompson, D. C. Martin, and C. M. Nolan. 1986.
A survey of Campylobacter and other bacterial contaminants of pre-
market chicken and retail poultry and meats, King County, Wash-
ington. Am. J. Public Health 76:401–406.
21. Health Canada, Food Program. 2003. Policy development for raw
foods of animal origin. Available at: http://www.hc-sc.gc/food-aliment/
mh-dm/mhe-dme/rfao-aoca/e㛮rfao.html. Accessed 5 August 2004.
22. Heredia, N., S. Garcia, G. Rojas, and L. Salazar. 2001. Microbio-
logical condition of ground meat retailed in Monterrey, Mexico. J.
Food Prot. 64:1249–1251.
23. Heuvelink, A. E., J. T. Zwartkruis-Nahuis, R. R. Beumer, and E. de
Boer. 1999. Occurrence and survival of verocytotoxin-producing
Escherichia coli O157 in meats obtained from retail outlets in The
Netherlands. J. Food Prot. 62:1115–1122.
24. Hunt, J. M., C. Abeyta, and T. Tran. 1998. Isolation of Campylo-
bacter species from food and water, p. 7.01–7.24. In Bacteriological
analytical manual, 8th ed. AOAC International, Gaithersburg, Md.
25. Inoue, S., A. Nakama, Y. Arai, Y. Kokubo, T. Maruyama, A. Saito,
T. Yoshida, M. Terao, S. Yamamoto, and S. Kumagai. 2000. Prev-
alence and contamination levels of Listeria monocytogenes in retail
foods in Japan. Int. J. Food Microbiol. 59:73–77.
26. Jemmi, T., S. I. Pak, and M. D. Salman. 2002. Prevalence and risk
factors for contamination with Listeria monocytogenes of imported
and exported meat and fish products in Switzerland, 1992–2000.
Prev. Vet. Med. 54:25–36.
27. Lee, M. B., and D. Middleton. 2003. Enteric illness in Ontario, Can-
ada, from 1997 to 2001. J. Food Prot. 66:953–961.
28. Levine, P., B. Rose, S. Green, G. Ransom, and W. Hill. 2001. Path-
ogen testing of ready-to-eat meat and poultry products collected at
federally inspected establishments in the United States, 1990 to
1999. J. Food Prot. 64:1188–1193.
29. Mead, P. S., L. Slutsker, V. Dietz, L. F. McCaig, J. S. Bresee, C.
Shapiro, P. M. Griffin, and R. V. Tauxe. 1999. Food-related illness
and death in the United States. Emerg. Infect. Dis. 5:607–625.
30. Meldrum, R. J., D. Tucker, and C. Edwards. 2004. Baseline rates of
Campylobacter and Salmonella in raw chicken in Wales, United
Kingdom, in 2002. J. Food Prot. 67:1226–1228.
31. Meldrum, R. J., I. D. Tucker, R. M. Smith, and C. Edwards. 2005.
Survey of Salmonella and Campylobacter contamination of whole,
raw poultry on retail sale in Wales in 2003. J. Food Prot. 68:1447–
1449.
J. Food Prot., Vol. 69, No. 9
32. Norrung, B., J. K. Andersen, and J. Schlundt. 1999. Incidence and
control of Listeria monocytogenes in foods in Denmark. Int. J. Food
Microbiol. 53:195–203.
33. Pagotto, F., C. Clark, J. Farber, N. Corneau, J. Ismail, M. Lorange,
and D. Woodward. 2003. Human infections in Canada caused by
Listeria monocytogenes, p. 74, P046. In Proceedings of the Inter-
national Association for Food Protection Annual Meeting, New Or-
leans, La.
34. Pagotto, F., E. Daley, J. Farber, and D. Warburton. 2001. Isolation
of Listeria monocytogenes from all food and environmental samples.
MFHPB-30, p. 1–15. In D. Warburton (ed.), Compendium of ana-
lytical methods. Health Protection Branch methods of microbiolog-
ical analysis of foods, vol. 2. Polyscience Publications Inc., Montre-
al.
35. Pradel, N., V. Livrelli, C. De Champs, J.-B. Palcoux, A. Reynaud,
F. Scheutz, J. Sirot, B. Joly, and C. Forestier. 2000. Prevalence and
characterization of Shiga toxin–producing Escherichia coli isolated
from cattle, food, and children during a one-year prospective study
in France. J. Clin. Microbiol. 38:1023–1031.
36. Samadpour, M., M. Kubler, F. C. Buck, G. A. Depavia, E. Mazengia,
J. Stewart, P. Yang, and D. Alfi. 2002. Prevalence of Shiga toxin–
producing Escherichia coli in ground beef and cattle feces from King
County, Washington. J. Food Prot. 65:1322–1325.
37. Sharar, A. K., and B. E. Rose. 1998. Detection, isolation and iden-
tification of Escherichia coli O157:H7 and O157:NM (nonmotile)
from meat and poultry products, p. 5.1–5.10. In B. P. Dey and C. P.
Lattuada (ed.), Microbiology laboratory guidebook, 3rd ed., vol. 1.
U.S. Department of Agriculture, Washington, D.C.
38. Sorensen, O., J. Van Donkersgoed, M. McFall, K. Manninen, G.
Gensler, and G. Ollis. 2002. Salmonella spp. shedding by Alberta
beef cattle and the detection of Salmonella spp. in ground beef. J.
Food Prot. 65:484–491.
39. Soultos, N., P. Koidis, and R. H. Madden. 2003. Presence of Listeria
and Salmonella spp. in retail chicken in Northern Ireland. Lett. Appl.
Microbiol. 37:421–423.
40. Todd, E. C. 1989. Costs of acute bacterial foodborne disease in Can-
ada and the United States. Int. J. Food Microbiol. 9:313–326.
41. Uyttendaele, M., P. De Troy, and J. Debevere. 1999. Incidence of
Listeria monocytogenes in different types of meat products on the
Belgian retail market. Int. J. Food Microbiol. 53:75–80.
42. Uyttendaele, M., P. De Troy, and J. Debevere. 1999. Incidence of
Salmonella, Campylobacter jejuni, Campylobacter coli, and Listeria
monocytogenes in poultry carcasses and different types of poultry
products for sale on the Belgian retail market. J. Food Prot. 62:735–
40.
43. Vitas, A. I., and V. A. Garcia-Jalon. 2004. Occurrence of Listeria
monocytogenes in fresh and processed foods in Navarra (Spain). Int.
J. Food Microbiol. 90:349–356.
44. Whyte, P., K. McGill, D. Cowley, R. H. Madden, L. Moran, P.
Scates, C. Carroll, A. O’Leary, S. Fanning, J. D. Collins, E. Mc-
Namara, J. E. Moore, and M. Cormican. 2004. Occurrence of Cam-
pylobacter in retail foods in Ireland. Int. J. Food Microbiol. 95:111–
118.
45. Wilson, I. G. 2002. Salmonella and Campylobacter contamination
of raw retail chickens from different producers: a six year survey.
Epidemiol. Infect. 129:635–645.
46. Zhao, C., B. Ge, J. De Villena, R. Sudler, E. Yeh, S. Zhao, D. G.
White, D. Wagner, and J. Meng. 2001. Prevalence of Campylobacter
spp., Escherichia coli, and Salmonella serovars in retail chicken,
turkey, pork, and beef from the greater Washington, D.C. area. Appl.
Environ. Microbiol. 67:5431–5436.
47. Zhao, T., M. P. Doyle, P. J. Fedorka-Cray, P. Zhao, and S. Ladely.
2002. Occurrence of Salmonella enterica serotype Typhimurium
DT104A in retail ground beef. J. Food Prot. 65:403–407.
This article has been cited by:

1. KE LUO, SUNG-SAM HONG, JUN WANG, MI-JA CHUNG,3, DEOG-HWAN OH. 2015. Development of Predictive Models
for the Growth Kinetics of Listeria monocytogenes on Fresh Pork under Different Storage Temperatures. Journal of Food Protection
78:5, 921-926. [Abstract] [PDF] [PDF Plus]
2. AYSE HANDAN BAYSAL. 2014. Comparison of Conventional Culture Method and Fluorescent In Situ Hybridization
Technique for Detection of Listeria spp. in Ground Beef, Turkey, and Chicken Breast Fillets in İzmir, Turkey. Journal of Food
Protection 77:12, 2021-2030. [Abstract] [PDF] [PDF Plus]
3. ANATOLIY TROKHYMCHUK, CHERYL WALDNER, SHERYL GOW, BONNIE CHABAN, JANET E. HILL. 2014.
Comparison of Baseline Bacterial Levels in Retail Ground Beef Originating from Different Regulatory, Processing, and Packaging
Environments. Journal of Food Protection 77:3, 404-411. [Abstract] [PDF] [PDF Plus]
4. K. M. VAIL, L. M. McMULLEN, T. H. JONES. 2012. Growth and Filamentation of Cold-Adapted, Log-Phase Listeria
monocytogenes Exposed to Salt, Acid, or Alkali Stress at 3°C. Journal of Food Protection 75:12, 2142-2150. [Abstract] [PDF]
[PDF Plus]
5. JESSIE L. VIPHAM, MINDY M. BRASHEARS, GUY H. LONERAGAN, ALEJANDRO ECHEVERRY, J. CHANCE
BROOKS, W. EVAN CHANEY, MARK F. MILLER. 2012. Salmonella and Campylobacter Baseline in Retail Ground Beef
and Whole-Muscle Cuts Purchased during 2010 in the United States. Journal of Food Protection 75:12, 2110-2115. [Abstract]
[PDF] [PDF Plus]
6. JOVANA KOVAČEVIĆ, LORRAINE F. McINTYRE, SARAH B. HENDERSON, TOM KOSATSKY. 2012. Occurrence and
Distribution of Listeria Species in Facilities Producing Ready-to-Eat Foods in British Columbia, Canada. Journal of Food Protection
75:2, 216-224. [Abstract] [PDF] [PDF Plus]
7. ANGELA COOK, JOSEPH ODUMERU, SUSAN LEE, FRANK POLLARI. 2012. Campylobacter, Salmonella, Listeria
monocytogenes, Verotoxigenic Escherichia coli, and Escherichia coli Prevalence, Enumeration, and Subtypes on Retail Chicken
Breasts with and without Skin. Journal of Food Protection 75:1, 34-40. [Abstract] [PDF] [PDF Plus]
8. M. J. ABLEY, T. E. WITTUM, S. J. MOELLER, H. N. ZERBY, J. A. FUNK. 2012. Quantification of Campylobacter in Swine
before, during, and after the Slaughter Process. Journal of Food Protection 75:1, 139-143. [Abstract] [PDF] [PDF Plus]
9. ANGELA COOK, RICHARD J. REID-SMITH, REBECCA J. IRWIN, SCOTT A. McEWEN, VIRGINIA YOUNG, CARL
RIBBLE. 2011. Antimicrobial Resistance in Campylobacter, Salmonella, and Escherichia coli Isolated from Retail Grain-Fed Veal
Meat from Southern Ontario, Canada. Journal of Food Protection 74:8, 1245-1251. [Abstract] [PDF] [PDF Plus]
10. AMBROOS STALS, LEEN BAERT, VICKY JASSON, ELS VAN COILLIE, MIEKE UYTTENDAELE. 2011. Screening of
Fruit Products for Norovirus and the Difficulty of Interpreting Positive PCR Results. Journal of Food Protection 74:3, 425-431.
[Abstract] [PDF] [PDF Plus]
11. ANNE DECKERT, ALFONSO VALDIVIESO-GARCIA, RICHARD REID-SMITH, SUSAN TAMBLYN, PATRICK
SELISKE, REBECCA IRWIN, CATE DEWEY, PATRICK BOERLIN, SCOTT A. MCEWEN. 2010. Prevalence and
Antimicrobial Resistance in Campylobacter spp. Isolated from Retail Chicken in Two Health Units in Ontario. Journal of Food
Protection 73:7, 1317-1324. [Abstract] [PDF] [PDF Plus]
12. LYNN MORAN, PAM SCATES, ROBERT H. MADDEN. 2009. Prevalence of Campylobacter spp. in Raw Retail Poultry on
Sale in Northern Ireland. Journal of Food Protection 72:9, 1830-1835. [Abstract] [PDF] [PDF Plus]
13. JOSEPH M. BOSILEVAC, MICHAEL N. GUERINI, MOHAMMAD KOOHMARAIE. 2009. Increased Detection of Listeria
Species and Listeria monocytogenes in Raw Beef, Using the Assurance GDS Molecular Detection System with Culture Isolation.
Journal of Food Protection 72:3, 674-679. [Abstract] [PDF] [PDF Plus]
14. DIANE T. MEDEIROS, SYED A. SATTAR, JEFFREY M. FARBER, CATHERINE D. CARRILLO. 2008. Occurrence of
Campylobacter spp. in Raw and Ready-to-Eat Foods and in a Canadian Food Service Operation. Journal of Food Protection 71:10,
2087-2093. [Abstract] [PDF] [PDF Plus]
15. SOFRONI EGLEZOS, GARY A. DYKES, BIXING HUANG, NARELLE FEGAN, ED STUTTARD. 2008. Bacteriological
Profile of Raw, Frozen Chicken Nuggets. Journal of Food Protection 71:3, 613-615. [Abstract] [PDF] [PDF Plus]
16. MICHAEL N. GUERINI, DAYNA M. BRICHTA-HARHAY, STEVEN D. SHACKELFORD, TERRANCE M. ARTHUR,
JOSEPH M. BOSILEVAC, NORASAK KALCHAYANAND, TOMMY L. WHEELER, MOHAMMAD KOOHMARAIE.
2007. Listeria Prevalence and Listeria monocytogenes Serovar Diversity at Cull Cow and Bull Processing Plants in the United
States. Journal of Food Protection 70:11, 2578-2582. [Abstract] [PDF] [PDF Plus]
17. ALEXANDRA LIANOU, JOHN N. SOFOS. 2007. A Review of the Incidence and Transmission of Listeria monocytogenes in
Ready-to-Eat Products in Retail and Food Service Environments. Journal of Food Protection 70:9, 2172-2198. [Abstract] [PDF]
[PDF Plus]