EMBRYONIC STEM CELLS/INDUCED

PLURIPOTENT STEM CELLS

iPSC Transplantation Increases Regeneration and
Functional Recovery After Ischemic Stroke in
Neonatal Rats
MONICA J. CHAU,a TODD C. DEVEAU,a MINGKE SONG,a XIAOHUAN GU,a DONGDONG CHEN,a
LING WEIa,b
Key Words. iPSCs • Neuronal differentiation • Ischemic stroke • Trophic factors

a ABSTRACT
Department of
Anesthesiology; bDepartment
of Neurology, Emory
University School of
Medicine, Atlanta, Georgia,
USA.
Correspondence: Ling Wei, MD,
Department of Anesthesiology,
101 Woodruff Cir, Suite 617,
Emory University School of
Medicine, Atlanta, Georgia
30322, USA. Telephone: 404-
718-8661; Fax. 404-712-1351;
e-mail: lwei7@emory.edu
Received December 18, 2013;
accepted for publication July 23,
2014; first published online in
STEM CELLS EXPRESS August 5,
2014.
C AlphaMed Press
V
1066-5099/2014/$30.00/0
http://dx.doi.org/
10.1002/stem.1802
Limited treatments are available for perinatal/neonatal stroke. Induced pluripotent stem cells
(iPSCs) hold therapeutic promise for stroke treatment, but the benefits of iPSC transplantation
in neonates are relatively unknown. We hypothesized that transplanted iPSC-derived neural pro-
genitor cells (iPSC-NPCs) would increase regeneration after stroke. Mouse pluripotent iPSCs
were differentiated into neural progenitors using a retinoic acid protocol. Differentiated neural
cells were characterized by using multiple criteria and assessments. Ischemic stroke was induced
in postnatal day 7 (P7) rats by occluding the right middle cerebral artery and right common
carotid artery. iPSC-NPCs (400,000 in 4 ml) were transplanted into the penumbra via intracranial
injection 7 days after stroke. Trophic factor expression in the peri-infarct tissue was measured
using Western blot analysis. Animals received daily bromodeoxyuridine (BrdU) injections and
were sacrificed 21 days after stroke for immunohistochemistry. The vibrissae-elicited forelimb
placement test was used to evaluate functional recovery. Differentiated iPSCs expressed mature
neuronal markers, functional sodium and potassium channels, and fired action potentials. Sev-
eral angiogenic and neurogenic trophic factors were identified in iPSC-NPCs. Animals that
received iPSC-NPC transplantation had greater expression of stromal cell-derived factor 1-a
(SDF-1a) and vascular endothelial growth factor (VEGF) in the peri-infarct region. iPSC-NPCs
stained positive for neuronal nuclei (NeuN) or glial fibrillary acidic protein (GFAP) 14 days after
transplantation. iPSC-NPC-transplanted animals showed greater numbers of BrdU/NeuN and
BrdU/Collagen IV colabeled cells in the peri-infarct area compared with stroke controls and per-
formed better in a sensorimotor functional test after stroke. iPSC-NPC therapy may play multi-
ple therapeutic roles after stroke by providing trophic factors, increasing angiogenesis and
neurogenesis, and providing new cells for tissue repair. STEM CELLS 2014;32:3075–3087

INTRODUCTION such as cognitive impairment, spasticity, or

Ischemic neonatal/perinatal stroke is a devastat-
ing disease. In the United States, perinatal
stroke occurs at a rate of 1 of 3500 live births
each year [1, 2]. The most common cause of
arterial ischemic stroke in children ages 0–15
years is cerebral arteriopathy, which comprises
more than half of all cases [1, 3]. Among the
causes of neonatal ischemic stroke are angiopa-
thies and thromboembolism from an intracranial
or extracranial vessel. There are few treatments
available for ischemic stroke. Tissue plasminogen
activator (tPA), a thrombolytic agent, is the only
Food and Drug Administration-approved drug
for the treatment of ischemic stroke in adults
[4]. The efficacy and safety of tPA in children is
unknown. Currently, children with thrombosis
are treated with anticoagulation using unfractio-
nated or low-molecular-weight heparin [5]. Peri-
natal stroke can result in irreversible outcomes
death [4]. Children who suffer a perinatal stroke
also are at risk of delayed effects such as seiz-
ures. Over 25% of perinatal stroke survivors
develop a seizure within 3 years [6]. The medical
cost of perinatal stroke is a financial strain to
patients and society [7].
The postnatal brain exhibits endogenous
regeneration including neurogenesis and
angiogenesis after ischemic stroke [8–11]. Neu-
ral progenitors are generated in the subven-
tricular zone (SVZ) [12, 13]. As a physiological
process, SVZ cells migrate to the olfactory
bulb via the rostral migratory stream to differ-
entiate into granule interneurons [14]. After
ischemic stroke, chemoattractants such as SDF-
1a in the injury are upregulated and divert
neural progenitors from the rostral migratory
stream toward the ischemic infarct [13, 15,
16]. Cerebral ischemia dramatically increases
SVZ neural progenitor cell proliferation,

STEM CELLS 2014;32:3075–3087 www.StemCells.com C AlphaMed Press 2014

V
3076 Regeneration and Functional Recovery by iPSCs in Rats

Figure 1. Experimental timeline. This experimental timeline delineates the in vitro and in vivo studies. Induced pluripotent stem cells
(iPSCs) were differentiated in suspension culture with the retinoic acid protocol. Neural progenitors were harvested and were either
plated for terminal differentiation or transplanted into the neonatal stroke rats. Abbreviation: RA, retinoic acid.

migration to the infarct, and differentiation into neurons [9,
17–21]. However, a large proportion of these progenitors and
new neurons do not survive upon reaching the injury site due
to the inflammatory and cytotoxic microenvironment sur-
rounding the stroke [22]. Thus, the endogenous regenerative
activities and their abilities in tissue repair are limited.
In the field of regenerative medicine, transplanting exoge-
nous cells such as neural progenitors derived from iPSCs has
exhibited promise for enhanced tissue repair and functional
recovery after ischemic stroke [23–25]. iPSCs are pluripotent
stem cells generated from adult somatic cells [26, 27]. They
were first created via the upregulation of four transcription
factors, Oct3/4, Sox2, c-Myc, and Klf4 [27, 28]. The use of
iPSCs circumvents ethical issues surrounding the use of
human embryonic stem cells (ESCs). iPSCs also have great
potential for personalized medicine in which pluripotent stem
cells can be generated using one’s own somatic cells such as
skin fibroblasts. Autologous transplantation of these cells
would avoid immune rejection after transplantation.
In contrast to multipotent bone marrow mesenchymal stem
cells (BMSCs), iPSCs can be differentiated into cells of any of
the three primary germ layers [29] including neurons and glia
[30–32]. Although iPSCs have great therapeutic potential, a pro-
file of the major trophic factors expressed by iPSC-neural pro-
genitor cells (NPCs) has not been delineated. Furthermore, their
regenerative abilities after transplantation into a neonatal ische-
mic brain have not been investigated. This study is the first to
examine the regenerative properties of neural progenitors
derived from iPSCs in a neonatal ischemic stroke model.
MATERIALS AND METHODS
iPSC Culture and Differentiation
The experimental timeline is illustrated in Figure 1, showing
neural differentiation of iPSCs in vitro relative to the timing of
in vivo transplantation. Pluripotent mouse primary iPSCs (WP5
line, Stemgent Cambridge, MA, https://www.stemgent.com/)

C AlphaMed Press 2014

V STEM CELLS
Chau, Deveau, Song et al.
were maintained in their pluripotent state in culture medium
consisting of 15% ESC fetal bovine serum (ESC FBS, Gibco Life
Technologies, Grand Island, NY, http://www.lifetechnologies.
com/us/en/home/brands/gibco.html) in Dulbecco’s modified
Eagle Medium (Corning Cellgro, Manassas, VA, http://www.
cellgro.com/). This media was supplemented with 1% nones-
sential amino acids, 1% penicillin–streptomycin, 0.1% beta-
mercaptoethanol, and 1:10,000 leukemia inhibitory factor
(LIF). Cells were either passaged daily with trypsin-EDTA when
cells were approximately 80% confluent or media was
changed if the cells were not confluent enough for passage.
Pluripotent cell cultures were maintained on mouse embry-
onic fibroblast (MEF) feeder layers (Millipore, Billerica, MA,
http://www.emdmillipore.com/US/en) for about six passages
after the initial thawing. The cultures were maintained at later
passages in 0.15% gelatin-coated flasks. iPSCs were differenti-
ated in suspension culture with a “42/41” (4 days without/4
days with) retinoic acid (RA) (all trans-RA, Sigma, St. Louis,
MO, http://www.sigmaaldrich.com/united-states.html) proto-
col in LIF-free media [33, 34]. Cells were dissociated from
flasks with trypsin without EDTA. iPSCs were plated in petri
dishes in growth media without LIF in suspension culture.
Within the first day, the cells formed embryoid bodies in sus-
pension culture. In the last 4 days, 5 3 1027 M of all-trans
RA was added to the media. Neural progenitors were har-
vested by dissociating cells with trypsin-EDTA for 10 minutes,
inactivated with serum media, and run through a cheesecloth
filter to separate the cells. Cells were centrifuged and resus-
pended to a concentration of 100,000 cells/ll and were either
transplanted immediately into the rats after stroke or plated
in modified SATO media [35] on Poly-D-Lysine (PDL)/Laminin-
coated dishes and allowed to terminally differentiate for at
least 5 days (Fig. 1). In vitro studies were performed in paral-
lel with transplantation to monitor the quality and differentia-
tion of the transplanted cells.
In studies visualizing iPSC-NPC transplantation and differen-
tiation in vivo, we used iPSCs that were genetically modified to
express the fluorescent protein, mCherry. Briefly, the mCherry
expression vector was created by subcloning the mCherry coding
sequence (Addgene Cambridge, MA http://www.addgene.org
plasmid #20943, kind gift of Dr. Karl Deisseroth) [35] in place of
the Nanog coding sequencing of a backbone used previously in
ESC studies (Addgene Cambridge, MA http://www.addgene.org
plasmid #13838, kind gift of Dr. Shinya Yamanaka) [36]. A stable
mCherry iPSC line was created by transfecting the mCherry
expression vector into pluripotent iPSCs using Lipofectamine
2000 (Life Technologies, Grand Island, NY, https://www.lifetech-
nologies.com/us/en/home.html). Forty-eight hours after trans-
fection, puromycin (0.5–1 mg/ml, Sigma) was used to select
stable clones expressing mCherry that were pooled and main-
tained on MEFs. We observed mCherry expression through at
least 30 passages as well as after cell freezing and recovery.
These cells underwent the same maintenance, differentiation,
and transplantation protocol as cells without the mCherry
marker.
Immunocytochemistry
Cells were fixed with 4% paraformaldehyde for 15 minutes
then washed three times for 5 minutes each with phosphate-
buffered saline (PBS) after each protocol step. Cells were
treated with 220 C ethanol/acetic acid solution, permeabil-
www.StemCells.com
3077
ized with a 0.2% Triton-X 100 solution, and blocked with 1%
cold fish gelatin (Sigma, St. Louis, MO, http://www.sigmaal-
drich.com/united-states.html). Cells were incubated overnight
at 4 C with primary antibodies for Oct3/4 (sc-5279, 1:200;
Santa Cruz Biotechnology, Santa Cruz, CA, http://www.scbt.
com/), Sox2 (sc-17320, 1:200; Santa Cruz Biotechnology), dou-
blecortin (DCX, sc-8066, 1:100; Santa Cruz Biotechnology,
http://www.scbt.com/), NeuN (MAB377 1:200; Millipore, Bill-
erica, MA http://www.emdmillipore.com/US/en), b-III Tubulin
(Tuj-1, MMS-435P, 1:200; Covance, http://www.covance.com/,
Princeton, NJ), synaptosomal-associated protein 25 (SNAP-25,
AB5871P, 1:100; Millipore, Billerica, MA http://www.emdmilli-
pore.com/US/en), synapsin 1 (51–5200, 1:200; Life Technolo-
gies, Grand Island, NY https://www.lifetechnologies.com/us/
en/home.html), neurofilament (AB9568, 1:100; Millipore Bill-
erica, MA http://www.emdmillipore.com/US/en), and mCherry
(AB167453, 1:100; Abcam, Cambridge, MA, http://www.
abcam.com/). To analyze trophic factors, iPSC-NPCs were incu-
bated overnight with primary antibodies at 1:100 for fibro-
blast growth factor (FGF) (sc-7375; Santa Cruz Biotechnology,
Dallas, TX http://www.scbt.com/), brain-derived neurotrophic
factor (BDNF) (sc-546; Santa Cruz Biotechnology, Dallas, TX
http://www.scbt.com/), erythropoietin (EPO) (sc-1310; Santa
Cruz Biotechnology, Dallas, TX http://www.scbt.com/), stromal
cell-derived factor 1-a (SDF-1a) (MAB350; R&D systems, Min-
neapolis, MN, http://www.rndsystems.com/), and glial cell-
dervied neurotrophic factor (GDNF) (sc-328; Santa Cruz Bio-
technology, Dallas, TX http://www.scbt.com/). After incuba-
tion, cells were washed with PBS three times for 5 minutes
each. Secondary antibodies were applied at 1:100 for 1 hour
at room temperature for Oct3/4 and SDF-1a, neuronal nuclei
(NeuN), Tuj-1 (donkey anti-mouse Cy3, Jackson ImmunoRe-
search, West Grove, PA, http://www.jacksonimmuno.com/),
doublecortin (DCX) (donkey anti-goat Cy3, Jackson ImmunoRe-
search, West Grove, PA, http://www.jacksonimmuno.com/),
GDNF (donkey anti-rabbit Cy5, Jackson ImmunoResearch, West
Grove, PA http://www.jacksonimmuno.com/), sex determining
region Y-box 2 (Sox2), FGF, EPO, synaptosomal-associated
protein 25 (SNAP-25) (AlexaFluor 488, donkey anti-goat; Invi-
trogen Life Technologies, Grand Island, NY, https://www.life-
technologies.com/us/en/home.html), and BDNF,
neurofilament, synapsin 1, and mCherry (donkey anti-rabbit
Cy3, Jackson ImmunoResearch, West Grove, PA http://www.
jacksonimmuno.com/). Dishes were washed with PBS and
stained with Hoechst 33342 (1:20,000), washed, and cover-
slipped with Vectashield mounting media (Vector Laboratories,
Burlingame, CA, https://www.vectorlabs.com/).
Electrophysiological Characterization
Whole-cell patch clamp recording was performed on mouse
iPSC-derived neurons 10 days after neural progenitor harvest
using an EPC9 amplifier (HEKA, Elektronik, Lambrecht, Germany,
http://www.heka.com/) at room temperature. The recording
external solution contained (mM) 135 NaCl, 5 KCl, 1 MgCl2, 2
CaCl2, 10 HEPES, and 10 Glucose at a pH of 7.4. Recording elec-
trodes were pulled from borosilicate glass pipettes (Sutter
Instrument, Novato, CA http://www.sutter.com/) and had a tip
resistance between 5 and 8 MX when filled with the internal
solution (mM): 140 KCl, 2 MgCl2, 1 CaCl2, 2 Na2ATP, 10 EGTA,
and 10 HEPES at a pH of 7.2. Series resistance was compensated
by 60–80%. Linear leak and residual capacitance currents were
C AlphaMed Press 2014
V
3078
subtracted on-line using a P/6 protocol. Action potentials (APs)
were recorded (HEKA, Elektronik, Lambrecht, Germany http://
www.heka.com/) under current-clamp mode using Pulse soft-
ware (HEKA Elektronik Lambrecht, Germany http://www.heka.
com/). Tetrodotoxin (TTX, 1lM) was used to block voltage-
gated inward sodium currents. Data were filtered at 3 KHz and
digitized at sampling rates of 20 KHz. AP amplitude was deter-
mined by measurement from the initial threshold to the peak
of AP upstroke.
Reverse Transcription PCR on iPSC-NPCs
On the final day of the differentiation protocol (day 8) when
iPSCs had differentiated into neural progenitors, total mRNA
was extracted from the cells with Trizol reagent (Invitrogen
Life Technologies Grand Island, NY https://www.lifetechnolo-
gies.com/us/en/home/brands/invitrogen.html). For each dish,
250 ll of Trizol was used to lyse the cells. Choloroform (50
ll) was added and samples were centrifuged. The RNA was
collected from the upper aqueous phase and precipitated
with 125 ll of isopropyl alcohol. RNA was centrifuged into a
pellet and washed two times with 75% ethanol. RNA pellets
were air-dried and resuspended in DEPC-treated water and
RNA concentration was measured. The high capacity RNA-to-
cDNA kit (Life Technologies, Grand Island, NY) was used to
create cDNA from RNA samples. Polymerase chain reaction
(PCR) analysis has a mixture of Taq buffer (New England Biol-
abs, Ipswich, MA, https://www.neb.com/), forward primer,
reverse primer, dNTP (10 mM), Taq polymerase, water, and
cDNA. Primer pairs for trophic factors (mouse) were designed
from the mRNA sequence found in the NCBI nucleotide bank.
The primer pairs are listed below. DNA samples were run out
in a 1.8% agarose gel and band intensity was quantified using
ImageJ software (NIH, Bethesda, MD, http://rsbweb.nih.gov/ij/
download.html).
Primer Pairs. 18S: GACTCAACACGGGAAACCTC (forward),
ATGCCAGAGTCTCGTTCGTT (reverse)
BDNF: CGACATCACTGGCTGACACT (forward), ATGTTTGCGGC
ATCCAGGTA (reverse) CXCR4: GCCATGGCTGACTGGTACTT (for-
ward), CACCCACATAGACGGCCTTT (reverse)
EPO: ACCACCCCACCTGCTCCACTC (forward), GTTCGTCGGTC
CACCACGGT (reverse)
FGF1: GTGGATGGGACAAGGGACAG (forward), GGTGTCTG
CGAGCCGTATAA (reverse)
GDNF: CGCTGACCAGTGACTCCAAT (forward), CTCTGCGACC
TTTCCCTCTG (reverse)
SDF-1a: GCTCTGCATCAGTGACGGTA (forward), CCAGGTACT
CTTGGATCCAC (reverse)
VEGF: CTCACCAAAGCCAGCACATA (forward), AAATGCTTTCT
CCGCTCTGA (reverse)
Focal Ischemia Surgery and Cell Transplantation
Wistar rat pups and dam were housed in a climate-controlled
room with a 12-hour light–dark cycle. Animals had free access
to water and food. Pups received experimental treatment
from ages P7 to P28 and were sacrificed by 4% chloral
hydrate (10 ml/kg) before decapitation. All animal procedures
were approved by the Emory University Institutional Animal
Care and Use Committee (IACUC).
To induce focal cerebral ischemia, P7 rat pups were anes-
thetized with hypothermia as described previously [36]. Sur-
C AlphaMed Press 2014
V STEM CELLS
Regeneration and Functional Recovery by iPSCs in Rats
gery commenced when the rat showed no response to
noxious stimuli. The right common carotid artery and the dis-
tal branches of right middle cerebral artery were permanently
occluded via cauterization to induce ischemia in the right
whisker barrel cortex. Sham animals received skin incisions,
without arterial occlusion. Starting 3 days after stroke, animals
received daily intraperitoneal (i.p.) injection of bromodeoxyur-
idine (BrdU; Sigma St. Louis, MO http://www.sigmaaldrich.
com/united-states.html) to label any proliferating cells in the
brain. Pups were given 1/3 the adult BrdU dosage (16.7 mg/
kg) until their body weight reached 30 g (usually P15) when
they received the adult dose of 50 mg/kg.
Seven days after stroke induction, animals received iPSC-
NPC transplantation. Under 4% chloral hydrate anesthesia, the
skull over the penumbra was thinned by a dental drill. Ische-
mic tissue was visually identified through the skull. 400,000
iPSC-NPCs were delivered through 4 3 1 ll injections at four
sites in the peri-infarct region using a Hamilton syringe (Reno,
NV http://www.hamiltoncompany.com/Syringes/). Control ani-
mals received 4 3 1 ll injections of SATO media at four sites
as a vehicle control. The incision was closed with surgical
adhesive. To kill the animals, they were anesthetized and
decapitated. The brain was dissected from the cranium, a 5-
mm coronal section that included the injury or a flattened
cortex of the injured side was flash frozen on dry ice in OCT
mounting media.
Western Blot on iPSC-NPCs and Peri-Infarct Brain
Tissue
To examine trophic factors and receptors expressed by neural
progenitors in culture, neural progenitors were collected after
RA differentiation. To analyze trophic factors in the peri-infarct
tissue after cell transplantation, tissue was dissected from the
peri-infarct area immediately after killing and total protein was
extracted using lysis buffer. Cells or tissues were homogenized
with lysis buffer containing protease inhibitor (1:100). The bicin-
choninic acid assay was used to measure and normalize total
protein concentrations for each sample. Protein samples for gel
electrophoresis were created by combining the original protein
solution with water and 5X loading buffer. Samples were boiled
for 10 minutes at 95 C. The samples were run on a 7.5–20%
gradient acrylamide gel. For culture dishes, we used antibodies
for vascular endothelial growth factor (VEGF) (05–443; Millipore,
Billerica, MA, www.emdmillipore.com/US/en), VEGFR-2 (SC315;
Santa Cruz, Dallas, Texas, http://www.scbt.com/), VEGFR-3
(AB1875; Millipore, Billerica, MA, http://www.emdmillipore.com/
US/en), BDNF (SC546; Santa Cruz, Dallas, Texas, http://www.
scbt.com/), Angiopoietin-3 (Ang3, PC671; Oncogene Research
Products, Cambridge, MA, http://www.oncogene.com/), and
SDF-1a (MAB350; R&D Systems, Minneapolis, MN, http://www.
rndsystems.com/). For tissue samples, antibodies probed for
VEGF (05–443, 1:1000; Millipore, Billerica, MA, http://www.emd-
millipore.com/US/en), SDF-1a (MAB350, 1:500; R&D Systems,
Minneapolis, MN, http://www.rndsystems.com/), b-actin (A5441
1:5000; Sigma, St. Louis, MO, http://www.sigmaaldrich.com/
united-states.html), and tubulin (Cell signaling, Boston, MA,
http://www.cellsignal.com/). For cultures, blots were incubated
in AP-conjugated secondary antibody anti-mouse, anti-rabbit, or
anti-goat (1:1000; Promega, Madison, WI, http://www.promega.
com/). Tissue SDF-1a and VEGF blots were incubated in AP-
conjugated secondary antibody anti-mouse (1:1000; Promega,
Chau, Deveau, Song et al.
Madison, WI http://www.promega.com/) at room temperature,
washed and developed with NBT/BCIP solution, and then
washed with water to stop the reaction. All blots were quanti-
fied with Image J (NIH). Values for each band were normalized
against a b-actin or tubulin loading control.
Immunohistochemistry
In our in vivo analyses, fresh frozen brains were sectioned at
20 lm on a cryostat microtome at 220 C using design-based
stereology in which every 10th section was collected such
that two adjacent tissues were more than 200 lm apart. This
method avoided double-counting a cell in adjacent sections.
Sectioned tissues were fixed with 10% buffered formalin and
treated with a 220 C ethanol/acetic acid solution. Tissue was
permeabilized with a 0.2% Triton-X 100 solution, and blocked
for nonspecific binding with 1% fish gel. Tissues and cells
were washed three times with PBS between each step. Tis-
sues were incubated overnight at 4 C with primary antibodies
for BrdU (OBT0030G, 1:400; AbD Serotec, Hercules, CA http://
www.abdserotec.com/), NeuN (MAB377 1:200; Millipore, Bill-
erica, MA http://www.emdmillipore.com/US/en), Collagen IV
(AB769, 1:200; Millipore, Billerica, MA http://www.emdmilli-
pore.com/US/en), and glial fibrillary acidic protein (GFAP)
(MAB360, 1:200; Millipore Billerica, MA http://www.emdmilli-
pore.com/US/en). After washing with PBS, secondary antibod-
ies conjugated to fluorophores were used to visualize 5-
bromo-20 -deoxyuridine (BrdU) (donkey anti-rat Cy3, 1:300;
Jackson ImmunoResearch, West Grove, PA http://www.jackso-
nimmuno.com/), NeuN (donkey anti-mouse Cy5, 1:200), Colla-
gen IV (donkey anti-goat AlexaFluor 488, 1:200; Invitrogen Life
Technologies Grand Island, NY http://www.lifetechnologies.
com/us/en/home.html), and GFAP (donkey anti-mouse Cy3,
1:200; Jackson ImmunoResearch, West Grove, PA http://www.
jacksonimmuno.com/home/contact.asp). The secondary anti-
bodies were applied and incubated on the tissue for 1 hour
at room temperature and washed three times with PBS.
Stained tissues and cells were analyzed under fluorescent
microscopy. Pictures from six areas in the peri-infarct area
(based on the border between live and dead NeuN-positive
cells adjacent to the ischemic core) were taken at 40X. Six tis-
sue sections from each animal were quantified. NeuN/BrdU
colabeled and Collagen IV/BrdU colabeled cells were counted
per animal.
Vibrissae-Elicited Forelimb Placement Behavior Test
The vibrissae-elicited forelimb placement test is a test to
directly assay whisker somatosensation and forepaw motor
function [37, 38]. It assesses the ability for the whiskers of
the animal to sense the tactile stimulus of the table edge. If
the tactile stimulus is felt, animals will stereotypically place
their forelimb on the table. Without impeding the forelimb
movement, the rats were scruffed loosely to brush either
right or left whiskers on a table edge. Animals were held in a
horizontal position and passed from above the table edge to
below the table edge once. Upon stimulation of the whiskers,
normal animals with no brain injury will stereotypically reach
out to the ledge with their forepaw. Animals with no deficit
will reach out approximately equally for both sides of whisker
stimulation. Animals with post-stroke deficits will reach out a
fewer number of times when the whiskers contralateral to
www.StemCells.com
3079
the injury have been stimulated. Animals were trained two
times on each side before testing. Each animal was tested for
6–10 times on each side and the percentage of successful
reaches was calculated.
Statistical Analysis
Statistical analyses were performed using Prism Graphpad
(GraphPad Software, Inc., La Jolla, CA, http://www.graphpad.
com/scientific-software/prism/). Single comparisons were per-
formed using Student’s t-test. One- and two-way analysis of var-
iance (ANOVA) followed by Bonferroni’s post hoc analysis was
used for multiple comparisons. Significance was identified by a
p < .05. SEM was reported with the means.
RESULTS
iPSCs Differentiation into Functional Neurons In Vitro
iPSCs in the expansion stage stained positive for pluripotent
markers, Sox2 and Oct3/4 (Fig. 2A–2F). iPSCs were maintained
on MEF feeder layers (Fig. 2G), expanded in feeder free condi-
tions on 0.2% gelatin-coated flasks (diluted from 2% gelatin
solution, Sigma-Aldrich, St. Louis MO, http://www.sigmaal-
drich.com), and were differentiated in suspension culture into
neural progenitors by a 42/41 RA differentiation protocol
[33]. The pluripotent cells in suspension formed embryoid
bodies 1 day after differentiation and remained in aggregates
throughout the differentiation process until harvest at day 8
(Fig. 2H). After harvesting aggregates, cells were plated on
poly-D-lysine PDL/laminin-coated dishes. Cell counts at 1 day
after harvest indicated that 96.9% of cells expressed the neu-
ral progenitor marker, DCX (DCX-positive cells/total Hoechst
cells) (Fig. 2I, 2J). Five days after harvest, cells exhibited neu-
ronal morphology including processes projecting from the cell
body (Fig. 2K, 2L).
To verify the formation of mature neurons and neuronal
activity, we performed electrophysiological recordings on
these cells (Fig. 3A). Whole-cell patch clamp recordings were
performed 10 days after harvest. Differentiated cells exhibited
neuronal functionality with action potentials triggered by a
30-lA current injection (average amplitude 5 53.31612.77
mV, n 5 7 cells; Fig. 3A-1). Inward Na1 current and outward
K1 current were elicited by step voltage changes from a hold-
ing potential of 270 mV to depolarized levels (240 to 150
mV in 10 mV decrement; Fig. 3A). The inward Na1 current
was highly sensitive to the specific channel blocker, tetrodo-
toxin (TTX, 1 lM; Fig. 3A). To confirm differentiation into neu-
ronal cells, we stained the cells for the mature neuronal
markers, Tuj-1, NeuN, and neurofilament (Fig. 3B–3D). At 5
days after harvest, 87.5% of the cells expressed NeuN (NeuN-
positive cells/total Hoechst-labeled cells) (Fig. 3C). The cells
also expressed synapsin 1 and SNAP-25 (Fig. 3E, 3F).
To confirm that the genetically labeled mCherry iPSCs
were able to differentiate into functional neurons in vitro, we
recorded action potentials from the differentiated mCherry
iPSCs (Fig. 3G). Differentiated mCherry iPSCs also stained posi-
tive for NeuN and Tuj-1 (Fig. 3H, 3I).
Trophic Factor Expression Profile of iPSC-NPCs In Vitro
Using immunocytochemistry, we detected expression of (SDF-
1a), fibroblast growth factor (FGF), glial cell-derived neutrophic
C AlphaMed Press 2014
V
3080 Regeneration and Functional Recovery by iPSCs in Rats

Figure 2. Induced pluripotent stem cells (iPSCs) differentiated down the neural lineage. (A–F): iPSCs expressed Sox2 and Oct3/4. (G):
iPSCs were maintained on a feeder layer. (H): Cells in suspension formed embryoid bodies during differentiation. (I, J): The cells
expressed doublecortin (DCX) 1 day after harvest. (K, L): Cells exhibited neuronal morphology including projected processes 5 days after
harvest. Abbreviation: DCX, doublecortin.
factor (GDNF), brain-derived neurotrophic factor (BDNF), and SDF-1a and VEGF in the peri-infarct tissue after ischemic
erythropoitin (EPO) in iPSC-NPCs (Fig. 4A–4G). We verified stroke. Tissue from the peri-infarct area was collected 2 days
trophic factor expression and expression of vascular endothelial after iPSC-NPCs were transplanted. Western blot analysis dem-
growth factor (VEGF) and C-X-C motif receptor 4 (CXCR4) with onstrated that SDF-1a expression in the peri-infarct area
PCR analysis of neural progenitors (Fig. 4H). In addition, the pro- increased after ischemic stroke. Animals with cell transplanta-
tein expression of several angiogenic trophic factors including tion showed a significant increase in SDF-1a expression com-
vascular endothelial growth factor (VEGF), brain-derived neuro- pared with the sham group (Fig. 5A, n 5 4; one-way ANOVA,
trophic factor (BDNF), angiopoietin-3 (Ang3), SDF-1a, and the F(2,9) 5 10.69, p 5 .0042; pairwise comparisons with Bonfer-
receptors for VEGF including vascular endothelial growth factor roni post hoc test showed a significant difference between
receptor-2 (VEGFR-2) and vascular endothelial growth factor sham and stroke1 iPSC, p < .005). Similarly, VEGF expression
receptor-3 (VEGFR-3) were detected using Western blot (Fig. 4I). in the iPSC-NPC transplantation group was significantly greater
than stroke and sham groups (Fig. 5B, n 5 3–4, one-way
Increased Trophic Factor Expression in the Ischemic ANOVA, F(2,8) 5 13.34, p 5 .0028; pairwise comparisons with
Brain After Transplantation Bonferroni post hoc test showed a significant difference
We tested if transplanting iPSC-NPCs into the peri-infarct area between sham and stroke1 iPSC, p < .005, stroke and stro-
would increase the levels of two important trophic factors, ke 1 iPSC, p < .05).

C AlphaMed Press 2014

V STEM CELLS
Chau, Deveau, Song et al. 3081

Figure 3. Induced pluripotent stem cells (iPSCs) differentiated into functional neurons. (A): iPSC-derived neurons exhibited (1) action
potentials, (2) Na1 and K1 currents, and (3) when tetrodotoxin was applied, INa was completely blocked. (B–D): Cells expressed imma-
ture and mature neuronal markers, Tuj-1, NeuN, and neurofilament (E, F) and neuronal synaptic markers and synaptosomal-associated
protein 25 (SNAP-25) (G–I). Differentiated mCherry iPSCs exhibited action potentials and neuronal markers, NeuN and Tuj-1. Abbrevia-
tions: NeuN, Neuronal Nuclei; SNAP-25, synaptosomal-associated protein 25; Tuj, tubulin.

Transplanted iPSC-NPCs Differentiate into Neural Line-
age Cells
Animals received mCherry iPSC-NPC transplantation 7 days
after stroke. We chose a delayed 7-day time point to avoid
the cytotoxic milieu found in acute and subacute phases of
ischemia [25, 39]. Much of the inflammatory response and
edema subsides by 7 days after stroke [40, 41], which pre-
sumably allows for a more hospitable environment for exoge-
nous cell transplants [41, 42]. We observed that transplanted
mCherry iPSCs differentiated into neural lineage cells at 7
days after transplantation as indicated by the positive costain-
ing of mCherry with the mature neuronal markers, NeuN and
neurofilament (Fig. 6A–6C). Also, a portion of transplanted
mCherry iPSCs differentiated into GFAP-positive cells as indi-
cated by the GFAP staining colabeled with mCherry (Fig. 6D).
Transplantation of iPSC-NPCs Increased Endogenous
Neurogenesis and Angiogenesis
Dissected brain tissues were analyzed for neurogenesis and
angiogenesis 21 days after stroke when active endogenous neu-
ral progenitor proliferation and migration activity peaks post-
ischemia [13, 42]. Animals were injected with BrdU (i.p.) start-
ing 3 days after stroke to label newly formed neuronal cells
(NeuN-positive) and proliferating vessels (Collagen IV-positive
cells labeling the vessel basement membrane). In stroke only
controls (Fig. 7A–7D) and stroke 1 iPSC-NPC transplanted brains
(Fig. 7E–7H), we compared the number of colabeled NeuN/
BrdU cells (Fig. 7I–7K) and colabeled Collagen IV/BrdU cells in
the peri-infarct area (Fig. 7L–7N). There were significantly more
NeuN/BrdU (Fig. 7K, n 5 7–9; Student’s t-test t(14) 5 2.799,
p 5 .0142) and Collagen IV/BrdU (Fig. 7N, n 5 7–9; Student’s t-
test t(14) 5 2.258, p 5 .0404) colabeled cells in the iPSC-NPC
transplantation group compared with the stroke only group.
Transplantation of iPSCs Increases Functional Recovery
Our stroke model produced a consistent injury in the sensorimotor
cortex that included the whisker barrel cortex in the neonatal rats
[43]. We analyzed the somatosensory function of sham, stroke,
and stroke with iPSC-NPC transplantation animals using the
vibrissae-elicited forelimb placement test 14 days after treatment
(21 days after the onset of stroke) [38]. Sham animals had a simi-
lar (and not significantly different) percentage of successful reaches
with their left and right paws. Animals with stroke exhibited a sig-
nificantly lower percentage of successful reaches on the left/
impaired side compared with shams (Fig. 7O, n 5 7–9; repeated

www.StemCells.com C AlphaMed Press 2014

V
3082 Regeneration and Functional Recovery by iPSCs in Rats

Figure 4. Induced pluripotent stem cells (iPSC)–neural progenitor cells (NPCs) express trophic factors in vitro. (A–G): iPSC-NPCs
expressed SDF-1a, fibroblast growth factor (FGF), GDNF, EPO, and BDNF with immunohistochemistry. (H): Expression of CXCR4, SDF-1a,
vascular endothelial growth factor (VEGF), EPO, BDNF, FGF, and GDNF with polymerase chain reaction analysis of iPSC-NPCs. (I): Western
blot of iPSC-NPCs for VEGF, VEGFR-2, VEGFR-3, BDNF, Ang3, and SDF-1a. Abbreviations: BDNF, Brain-derived Neurotrophic Factor; EPO,
Erythropoietin; FGF, fibroblast growth factor; GDNF, Glial Cell Line-derived Neurotrophic Factor; SDF, Stromal Cell-Derived Factor 1-a;
VEGF, vascular endothelial growth factor.

measures two-way ANOVA shows a significant interaction
F(2,22) 5 3.60, p 5 .0444 and a significant effect of paw side
F(1,22) 5 14.54, p 5 .001; pairwise comparisons with the Bonfer-
roni post hoc test showed a significant difference in the left paw
when comparing sham and stroke group, p < .05). Animals that
had received iPSC-NPC transplantation showed no significant differ-
ence from sham animals (pairwise comparisons with the Bonfer-
roni post hoc test showed no significant difference in the left paw
when comparing sham and stroke1 iPSC-NPC groups, p > .05).
DISCUSSION
Previous studies have shown that iPSC transplantation into an
adult ischemic stroke model increased regeneration and func-
tional recovery [24, 25, 39, 44], however the trophic factor
expression of iPSCs and their regenerative capabilities have
not been evaluated in neonatal stroke. In the current investi-
gation, we characterized the stages of neuronal differentiation
of iPSCs, profiled major regenerative trophic factors expressed
by iPSC-NPCs, evaluated the trophic factor levels in the brain
tissue after transplantation, demonstrated the ability of trans-
planted iPSC-NPCs to differentiate into neurons in vitro and in
vivo, and demonstrated increased levels of angiogenesis, neu-
rogenesis and functional recovery in neonatal rats with stroke
and iPSC-NPC transplantation. The benefits of stem cell trans-
plantation are multifold, involving generation of new neuronal
cells and trophic factor delivery to the injury region.
To support our hypothesis that iPSCs can differentiate into
neurons to replace lost cells, we demonstrated that Oct3/4 and
Sox2-positive pluripotent iPSCs could be differentiated into
DCX-positive neural progenitors with a 96.9% differentiation
rate. Furthermore, harvested iPSC-NPCs could differentiate into
neurons expressing several neuronal markers including Tuj-1,
neurofilament, and NeuN. We confirmed that these neurons
had functional electrophysiological activity. At 10 days after
harvest, the cells exhibited action potentials, and inward Na1
and outward K1 currents. The SNAP-25 and synapsin 1 expres-
sion of the differentiated cells suggested that they also have
the machinery to build synapses and potentially regulate syn-
aptic activity within the host tissue. Furthermore, transplanted
iPSC-NPCs were able to differentiate into mature neurons and

C AlphaMed Press 2014

V STEM CELLS
Chau, Deveau, Song et al. 3083

Figure 5. Increased trophic factor expression after transplantation. (A): Tissues were dissected from the peri-infarct area 2 days after
induced pluripotent stem cells (iPSC)–neural progenitor cell (NPC) transplantation. Animals with transplantation showed a significant
increase in SDF-1a expression compared with sham animals (n 5 4, F(2,9) 5 10.69, p 5 .0042). (B): VEGF expression in the iPSC-NPC
transplantation group was significantly greater than stroke only and sham groups (n 5 3–4, F(2,8) 5 13.34, p 5 .0028). Abbreviations:
iPSC, induced pluripotent stem cell; SDF, stromal cell-derived factor 1-a; VEGF, vascular endothelial growth factor.

glial cells in vivo suggesting that these cells can provide iPSC-NPCs. Trophic factors found in several types of stem cells
rebuilding materials for tissue repair in the ischemic brain. have pleiotropic effects in that transplanting them after stroke
To support our hypothesis that trophic factors from iPSCs enhances endogenous neurogenesis and angiogenesis [13, 45,
increase regeneration, we analyzed major trophic factors in 46]. For example, mesenchymal stem cells (MSCs) have been

Figure 6. Transplanted induced pluripotent stem cell (iPSC)–neural progenitor cells (NPCs) differentiate into neural lineage cells. (A, B):
Transplanted mCherry iPSC-NPCs differentiated into NeuN-positive cells, (C) neurofilament-positive cells, and (D) glial fibrillary acidic
protein-positive cells. Abbreviations: GFAP, glial fibrillary acidic protein; NeuN, neuronal nuclei.

www.StemCells.com C AlphaMed Press 2014

V
3084 Regeneration and Functional Recovery by iPSCs in Rats

Figure 7. Transplantation of induced pluripotent stem cell (iPSC)–neural progenitor cells (NPCs) increased endogenous regeneration
and functional recovery. (A–D): Stroke only control. (E–H): Stroke 1 iPSC-NPC transplantation. White arrows show colabeling. (I–K):
Increased colabeled NeuN/bromodeoxyuridine (BrdU) cells in transplanted animals (n 5 7–9; t(14) 5 2.799, p 5 .0142). (L–N): Collagen
IV/BrdU cells in the peri-infarct area (n 5 7–9; t(14) 5 2.258, p 5 .0404). (O): Vibrissae-elicited forelimb placement test showed a signifi-
cantly lowered percentage of successful reaches on the left side of stroke animals compared with shams (n 5 7–9; F(2,22) 5 3.60,
p 5 .0444). No significant difference between sham and stroke 1 iPSC-NPC animals. Abbreviations: BrdU, bromodeoxyuridine; iPSC,
induced pluripotent stem cells; NeuN, Neuronal nuclei; NPC, neural progenitor cells.

shown to release a wide range of adaptive factors such as [47]. To illustrate their paracrine effects, MSC-conditioned
factors that are cytoprotective (endothelin), angiogenic media increased neurite outgrowth and branch number when
(VEGF), and play a role in cell migration (LRP-1 and LRP-6) applied to neurons [48]. Similarly, iPSCs have recently been

C AlphaMed Press 2014

V STEM CELLS
Chau, Deveau, Song et al.
shown to express trophic factors including VEGF in
neuroepithelial-like stem cells derived from human iPSCs [44].
We profiled the proregenerative trophic factors expressed by
iPSC-NPCs via reverse-transcriptase polymerase chain reaction
(RT-PCR) and found that the iPSC-NPCs express SDF-1a, FGF,
GDNF, EPO, and BDNF, VEGF, Ang3, and CXCR4, a receptor of
SDF-1a. These are all major angiogenic and neurotrophic fac-
tors that contribute to regeneration after stroke [49–54].
Western blot analysis of the iPSC-NPCs further confirmed
expression of VEGF, BDNF, Ang3, SDF-1a, VEGFR-2, and
VEGFR-3. Since SDF-1a and VEGF are highly upregulated at
the stroke site [50, 55], SDF-1a and VEGF receptors expressed
by iPSC-NPCs may help to localize the transplanted cells to
the injury area after transplantation to encourage local
regeneration.
After confirming the trophic factor expression of iPSC-NPCs
in vitro, we transplanted these iPSC-NPCs into the peri-infarct
area and found that animals with transplantation had elevated
levels SDF-1a and VEGF in the peri-infarct tissue suggesting
that iPSC-NPCs-derived trophic factors may contribute to the
regenerative microenvironment. iPSC-NPCs were transplanted
during the delayed phase of stroke and supplemented the ris-
ing levels of SDF-1a and VEGF in the infarct encouraging repair
after stroke [13, 50]. Certain trophic factors also enhance neu-
rogenesis and progenitor migration. Chemoattractive trophic
factors like SDF-1a play an important role in directing endoge-
nous neural progenitors to the stroke lesion via the receptor,
CXCR4 [13, 50, 56]. By blocking the SDF-1a signaling with a
neutralizing antibody against CXCR4, migration was attenuated
[50]. SDF-1a is pleiotropic and also contributes to angiogenesis
after stroke by attracting endothelial cells for revascularization
[57, 58]. SDF-1a and VEGF both play roles in endogenous neu-
ral progenitor migration as well as endothelial progenitor cell
recruitment [50, 51] since endogenous neural and endothelial
cell progenitors express CXCR4 [59, 60].
Trophic factors such as VEGF enhance angiogenesis. Previ-
ous studies in vitro have shown that VEGF stimulates the
tubule formation of endothelial cells (human umbilical vein
endothelial cells [HUVEC]) resulting in angiogenesis [61]. With
the addition of VEGF antibody, this effect was attenuated
[61]. Similarly, transplanted neural stem cells that secreted
VEGF showed an increase in neovascularization in the peri-
infarct area demonstrating a greater blood vessel density in
animals with transplantation compared with controls [62]. We
tested the endogenous regeneration after iPSC-NPC transplan-
tation and observed significant increases in neurogenesis and
angiogenesis in the peri-infarct area of animals with iPSC-NPC
transplantation. An increase in the migration of neural pro-
genitors and angiogenesis could be an effect of trophic factors
from transplanted iPCS-NPCs. The NeuN/BrdU cells originated
as endogenous neural progenitors that had migrated and dif-
ferentiated into NeuN-positive cells before or after arriving at
the peri-infarct area. The source of the NeuN/BrdU cells is
likely endogenous and not exogenous since iPSC-NPCs show
low levels of proliferation after engraftment into the brain tis-
sue and in culture after harvest [39].
The endogenous angiogenesis and neurogenesis observed
in this study reflect a remodeling of the damaged neurovascu-
lar unit [11]. The neurovascular unit is a functional entity in
the brain parenchyma where the CNS, comprising of neuronal
cells, astrocytes, and pericytes interfaces with the vasculature
www.StemCells.com
3085
of the circulatory system to maintain metabolic homeostasis
such as ionic concentrations. This functional unit is severely
compromised after an ischemic event [63]. Previous work
demonstrated that angiogenesis and neurogenesis are causally
linked to regenerate the neurovascular unit [11]. For example,
when angiogenesis was blocked with Endostatin after stroke,
there was a correlating 10-fold drop of new neurons in the
peri-infarct cortex [11]. When endothelial progenitor cells
were transplanted, there was an increase of angiogenesis and
neurogenesis improving overall stroke recovery and behavioral
deficits [45]. These findings support our observations in the
present investigation that increased neurogenesis and angio-
genesis after transplantation could be synergistically contribut-
ing to the rebuilding of the neurovascular unit.
Pluripotent stem cell transplantation has the potential to
be tumorigenic, a major concern in the field [64]. To evaluate
whether or not these cells will lead to tumorigenesis, further
studies staining for markers such as Ki-67, proliferating cell
nuclear antigen (PCNA), prominin-1 (CD133), and p53 are
needed [65–67]. We transplanted progenitors, but not pluripo-
tent cells to avoid tumorigenesis. This agrees with the current
view that transplantation of undifferentiated stem cells includ-
ing pluripotent iPSCs may lead to tumorigenesis [68, 69]. Thus
lineage-restricted stem cells or progenitors are less tumori-
genic and better candidates for transplantation [70, 71].
To assess the functional recovery after iPSC-NPC transplan-
tation, whisker somatosensation was tested with the vibrissae-
elicited forelimb placement test. Animals with iPSC-NPC trans-
plantation showed an increase in the percentage of reaches
not significantly different than shams. Previous studies have
shown that stem cell transplantation increases functional
recovery when transplanted into adult [41, 72] and neonatal
stroke animals [73], however we are the first to explore iPSCs
in neonatal stroke. It has been suggested that transplanted
cells may provide several benefits: a favorable trophic factor
environment that attenuates cell death, increasing neurogene-
sis and angiogenesis after stroke, and the integration of trans-
planted cells into the existing circuitry to improve functional
recovery. Thus, both exogenously transplanted iPSC-NPCs and
endogenous neural and endothelial progenitors contribute to
tissue repair after neonatal ischemic stroke. This study is the
first to profile the many trophic factors expressed by iPSC-
NPCs and show that transplantation of iPSC-NPCs increases
angiogenesis and neurogenesis in neonatal stroke.
CONCLUSION
Our results indicate iPS-NPC transplantation increases trophic
support (through increased trophic factor expression) which can
lead to increased endogenous regeneration in the peri-infarct
area and functional recovery following focal ischemic stroke.
AUTHOR CONTRIBUTIONS
M.C.: conception and experimental design, data collection
and analysis, manuscript writing; T.D.: created mCherry stem
cell line and data collection; M.S.: performed patch clamp
experiments and data analysis; X.G.: performed stroke sur-
gery and animal care; D.C.: stem cell cultures, data collection
and analysis; L.W.: conception and experimental design, data
C AlphaMed Press 2014
V
3086
analysis, manuscript revision, financial and administrative
support.
ACKNOWLEDGMENTS
We thank Dr. Oskar Laur of the Custom Cloning Core Facility,
Emory University School of Medicine, Atlanta, GA, for his sub-
REFERENCES
1 Go AS, Mozaffarian D, Roger VL et al.
Heart disease and stroke statistics—2013
update: A report from the American Heart
Association. Circulation 2013;127:e6–e245.
2 Agrawal N, Johnston SC, Wu YW et al.
Imaging data reveal a higher pediatric stroke
incidence than prior US estimates. Stroke
2009;40:3415–3421.
3 Ganesan V, Prengler M, McShane MA
et al. Investigation of risk factors in children
with arterial ischemic stroke. Ann Neurol
2003;53:167–173.
4 Lynch JK, Hirtz DG, DeVeber G et al.
Report of the National Institute of Neurologi-
cal Disorders and Stroke workshop on perina-
tal and childhood stroke. Pediatrics 2002;
109:116–123.
5 Monagle P, Adams M, Mahoney M et al.
Outcome of pediatric thromboembolic dis-
ease: A report from the Canadian Childhood
Thrombophilia Registry. Pediatr Res 2000;47:
763–766.
6 Wusthoff CJ, Kessler SK, Vossough A
et al. Risk of later seizure after perinatal
arterial ischemic stroke: A prospective cohort
study. Pediatrics 2011;127:e1550–1557.
7 Gardner MA, Hills NK, Sidney S et al.
The 5-year direct medical cost of neonatal
and childhood stroke in a population-based
cohort. Neurology 2010;74:372–378.
8 Greenberg DA. Angiogenesis and stroke.
Drug News Perspect 1998;11:265–270.
9 Arvidsson A, Collin T, Kirik D et al. Neu-
ronal replacement from endogenous precur-
sors in the adult brain after stroke. Nat Med
2002;8:963–970.
10 Ohab JJ, Carmichael ST. Poststroke neu-
rogenesis: Emerging principles of migration
and localization of immature neurons. Neuro-
scientist 2008;14:369–380.
11 Ohab JJ, Fleming S, Blesch A et al. A
neurovascular niche for neurogenesis after
stroke. J Neurosci 2006;26:13007–13016.
12 Li Y, Yu S, Mohamad O et al. Sublethal
transient global ischemia stimulates migra-
tion of neuroblasts and neurogenesis in
mice. Trans Stroke Res 2010;1:184–196.
13 Li WL, Yu SP, Ogle ME et al. Enhanced
neurogenesis and cell migration following
focal ischemia and peripheral stimulation in
mice. Dev Neurobiol 2008;68:1474–1486.
14 Kornack DR, Rakic P. The generation,
migration, and differentiation of olfactory
neurons in the adult primate brain. Proc Natl
Acad Sci U S A 2001;98:4752–4757.
15 Menezes JR, Smith CM, Nelson KC et al.
The division of neuronal progenitor cells dur-
ing migration in the neonatal mammalian
forebrain. Mol Cell Neurosci 1995;6:496–508.
16 Smith CM, Luskin MB. Cell cycle length
of olfactory bulb neuronal progenitors in the
C AlphaMed Press 2014
V STEM CELLS
Regeneration and Functional Recovery by iPSCs in Rats
cloning help and expertise. This work was supported by NIH
grants NS075338, NS0458710, AHA EIA Award, and AHA Pre-
doctoral Fellowship.
DISCLOSURE OF POTENTIAL CONFLICTS
The authors indicate no potential conflicts of interest.
rostral migratory stream. Dev Dyn 1998;213:
220–227.
17 Zhang RL, Zhang ZG, Zhang L et al. Pro-
liferation and differentiation of progenitor
cells in the cortex and the subventricular
zone in the adult rat after focal cerebral
ischemia. Neuroscience 2001;105:33–41.
18 Jin K, Sun Y, Xie L et al. Directed migra-
tion of neuronal precursors into the ischemic
cerebral cortex and striatum. Mol Cell Neuro-
sci 2003;24:171–189.
19 Tonchev AB, Yamashima T, Sawamoto K
et al. Enhanced proliferation of progenitor
cells in the subventricular zone and limited
neuronal production in the striatum and neo-
cortex of adult macaque monkeys after
global cerebral ischemia. J Neurosci Res
2005;81:776–788.
20 Thored P, Arvidsson A, Cacci E et al. Per-
sistent production of neurons from adult
brain stem cells during recovery after stroke.
STEM CELLS 2006;24:739–747.
21 Parent JM, Vexler ZS, Gong C et al. Rat
forebrain neurogenesis and striatal neuron
replacement after focal stroke. Ann Neurol
2002;52:802–813.
22 Kokaia Z, Thored P, Arvidsson A et al.
Regulation of stroke-induced neurogenesis in
adult brain—Recent scientific progress. Cere-
bral Cortex 2006;16:I162–I167.
23 Yuan T, Liao W, Feng NH et al. Human
induced pluripotent stem cell-derived neural
stem cells survive, migrate, differentiate, and
improve neurological function in a rat model
of middle cerebral artery occlusion. Stem Cell
Res Ther 2013;4:73.
24 Chen SJ, Chang CM, Tsai SK et al. Func-
tional improvement of focal cerebral ische-
mia injury by subdural transplantation of
induced pluripotent stem cells with fibrin
glue. Stem Cells Dev 2010;19:1757–I767.
25 Mohamad O, Drury-Stewart D, Song M
et al. Vector-free and transgene-free human
iPS cells differentiate into functional neurons
and enhance functional recovery after ische-
mic stroke in mice. PLoS One 2013;8:e64160.
26 Takahashi K, Tanabe K, Ohnuki M et al.
Induction of pluripotent stem cells from
adult human fibroblasts by defined factors.
Cell 2007;131:861–872.
27 Takahashi K, Yamanaka S. Induction of
pluripotent stem cells from mouse embryonic
and adult fibroblast cultures by defined fac-
tors. Cell 2006;126:663–676.
28 Takahashi K, Okita K, Nakagawa M et al.
Induction of pluripotent stem cells from
fibroblast cultures. Nat Protoc 2007;2:3081–
3089.
29 Yu J, Vodyanik MA, Smuga-Otto K et al.
Induced pluripotent stem cell lines derived
from human somatic cells. Science 2007;318:
1917–1920.
OF INTEREST
30 Dimos JT, Rodolfa KT, Niakan KK et al.
Induced pluripotent stem cells generated
from patients with ALS can be differentiated
into motor neurons. Science 2008;321:1218–
1221.
31 Chambers SM, Fasano CA, Papapetrou
EP et al. Highly efficient neural conversion of
human ES and iPS cells by dual inhibition of
SMAD signaling. Nat Biotechnol 2009;27:
275–280.
32 Karumbayaram S, Novitch BG, Patterson
M et al. Directed differentiation of human-
induced pluripotent stem cells generates
active motor neurons. STEM CELLS 2009;27:
806–811.
33 Bain G, Kitchens D, Yao M et al. Embry-
onic stem cells express neuronal properties
in vitro. Dev Biol 1995;168:342–357.
34 Bain G, Ray WJ, Yao M et al. Retinoic
acid promotes neural and represses mesoder-
mal gene expression in mouse embryonic
stem cells in culture. Biochem Biophys Res
Commun 1996;223:691–694.
35 Bottenstein JE, Sato GH. Growth of a rat
neuroblastoma cell line in serum-free supple-
mented medium. Proc Natl Acad Sci USA
1979;76:514–517.
36 Wei L, Han BH, Li Y et al. Cell death
mechanism and protective effect of erythro-
poietin after focal ischemia in the whisker-
barrel cortex of neonatal rats. J Pharmacol
Exp Ther 2006;317:109–116.
37 Schaar KL, Brenneman MM, Savitz SI.
Functional assessments in the rodent stroke
model. Exp TransStroke Med 2010;2:13.
38 Hua Y, Schallert T, Keep RF et al. Behav-
ioral tests after intracerebral hemorrhage in
the rat. Stroke 2002;33:2478–2484.
39 Drury-Stewart D, Song M, Mohamad O
et al. Highly efficient differentiation of neural
precursors from human embryonic stem cells
and benefits of transplantation after ischemic
stroke in mice. Stem Cell Res Ther 2013;4:93.
40 Li Y, Lu ZY, Ogle M et al. Erythropoietin
prevents blood brain barrier damage induced
by focal cerebral ischemia in mice. Neuro-
chem Res 2007;32:2132–2141.
41 Wei L, Cui L, Snider BJ et al. Transplanta-
tion of embryonic stem cells overexpressing
Bcl-2 promotes functional recovery after
transient cerebral ischemia. Neurobiol Dis
2005;19:183–193.
42 Kuge A, Takemura S, Kokubo Y et al.
Temporal profile of neurogenesis in the sub-
ventricular zone, dentate gyrus and cerebral
cortex following transient focal cerebral
ischemia. Neurol Res 2009;31:969–976.
43 Wei L, Rovainen CM, Woolsey TA. Minis-
trokes in rat barrel cortex. Stroke 1995;26:
1459–1462.
44 Oki K, Tatarishvili J, Wood J et al.
Human-induced pluripotent stem cells form
functional neurons and improve recovery
Chau, Deveau, Song et al.
after grafting in stroke-damaged brain. STEM
CELLS 2012;30:1120–1133.
45 Ishikawa H, Tajiri N, Shinozuka K et al.
Vasculogenesis in experimental stroke after
human cerebral endothelial cell transplanta-
tion. Stroke 2013;44:3473–3481.
46 Chau M, McCullough I, Yu SP et al. Neu-
rogenesis and neural progenitor migration
after stroke. In: Girard A, Moreau L, eds.
Neuronal Migration: Disorders, Genetic Fac-
tors, and Treatment Options. New York, NY:
Nova Science Publishers, Inc.; 2012;115–143.
47 Nguyen BK, Maltais S, Perrault LP et al.
Improved function and myocardial repair of
infarcted heart by intracoronary injection of
mesenchymal stem cell-derived growth
factors. J Cardiovasc Trans Res 2010;3:547–
558.
48 Oh JS, Liu ML, Jin HL et al. Effect of
bone marrow derived mesenchymal stem cell
conditioned media for neurite outgrowth in
human Ntera-2 neurons. Tissue Eng Regen-
erat Med 2009;6:562–567.
49 Frank J, Carroll CM, Aaranson K et al.
Ischemia increases the angiogenic potency of
basic fibroblast growth factor (FGF-2). Micro-
surgery 1996;17:452–456.
50 Robin AM, Zhang ZG, Wang L et al. Stro-
mal cell-derived factor 1alpha mediates neu-
ral progenitor cell motility after focal
cerebral ischemia. J Cereb Blood Flow Metab
2006;26:125–134.
51 Yamaguchi J, Kusano KF, Masuo O et al.
Stromal cell-derived factor-1 effects on ex
vivo expanded endothelial progenitor cell
recruitment for ischemic neovascularization.
Circulation 2003;107:1322–1328.
52 Chen J, Zhang C, Jiang H et al. Atorvas-
tatin induction of VEGF and BDNF promotes
brain plasticity after stroke in mice. J Cereb
Blood Flow Metab 2005;25:281–290.
53 Wang L, Chopp M, Gregg SR et al. Neu-
ral progenitor cells treated with EPO induce
angiogenesis through the production of
VEGF. J Cereb Blood Flow Metab 2008;28:
1361–1368.
www.StemCells.com
54 Kobayashi T, Ahlenius H, Thored P et al.
Intracerebral infusion of glial cell line-derived
neurotrophic factor promotes striatal neuro-
genesis after stroke in adult rats. Stroke
2006;37:2361–2367.
55 Jin K, Zhu Y, Sun Y et al. Vascular endo-
thelial growth factor (VEGF) stimulates neu-
rogenesis in vitro and in vivo. Proc Natl Acad
Sci U S A 2002;99:11946–11950.
56 Imitola J, Raddassi K, Park KI et al.
Directed migration of neural stem cells to
sites of CNS injury by the stromal cell-
derived factor 1alpha/CXC chemokine recep-
tor 4 pathway. Proc Natl Acad Sci U S A
2004;101:18117–18122.
57 Gupta SK, Lysko PG, Pillarisetti K et al.
Chemokine receptors in human endothelial
cells. Functional expression of CXCR4 and its
transcriptional regulation by inflammatory
cytokines. J Biol Chem 1998;273:4282–4287.
58 Volin MV, Joseph L, Shockley MS et al.
Chemokine receptor CXCR4 expression in
endothelium. Biochem Biophys Res Commun
1998;242:46–53.
59 Salcedo R, Wasserman K, Young HA
et al. Vascular endothelial growth factor and
basic fibroblast growth factor induce expres-
sion of CXCR4 on human endothelial cells: In
vivo neovascularization induced by stromal-
derived factor-1alpha. Am J Pathol 1999;154:
1125–1135.
60 Ji JF, He BP, Dheen ST et al. Expression
of chemokine receptors CXCR4, CCR2, CCR5
and CX3CR1 in neural progenitor cells iso-
lated from the subventricular zone of the
adult rat brain. Neurosci Lett 2004;355:236–
240.
61 Bishop ET, Bell GT, Bloor S et al. An in
vitro model of angiogenesis: Basic features.
Angiogenesis 1999;3:335–344.
62 Horie N, Pereira MP, Niizuma K et al.
Transplanted stem cell-secreted VEGF effects
post-stroke recovery, inflammation, and vas-
cular repair. STEM CELLS 2011; 29:274–85.
63 Madri JA. Modeling the neurovascular
niche: Implications for recovery from CNS
3087
injury. J Physiol Pharmacol 2009;60 Suppl 4:
95–104.
64 Dressel R, Schindehutte J, Kuhlmann T
et al. The tumorigenicity of mouse embryonic
stem cells and in vitro differentiated neuro-
nal cells is controlled by the recipients’
immune response. PLoS One 2008;3:e2622.
65 Moore N, Lyle S. Quiescent, slow-cycling
stem cell populations in cancer: A review of
the evidence and discussion of significance.
J Oncol 2011;2011, pii: 396076.
66 Sathi GA, Tamamura R, Tsujigiwa H et al.
Analysis of immunoexpression of common
cancer stem cell markers in ameloblastoma.
Exp Ther Med 2012;3:397–402.
67 Zhang M, Song T, Yang L et al. Nestin and
CD133: Valuable stem cell-specific markers for
determining clinical outcome of glioma
patients. J Exp Clin Cancer Res 2008;27:85.
68 Kawai H, Yamashita T, Ohta Y et al. Trider-
mal tumorigenesis of induced pluripotent stem
cells transplanted in ischemic brain. J Cereb
Blood Flow Metab 2010; 30:1487–1493.
69 Nishimori M, Yakushiji H, Mori M et al.
Tumorigenesis in cells derived from induced
pluripotent stem cells. Human Cell 2014;27:
29–35.
70 Xu T, Zhang M, Laurent T et al. Concise
review: Chemical approaches for modulating
lineage-specific stem cells and progenitors.
Stem Cells Trans Med 2013;2:355–361.
71 Liao MC, Diaconu M, Monecke S et al.
Embryonic stem cell-derived neural progeni-
tors as non-tumorigenic source for dopami-
nergic neurons. World J Stem Cells 2014;6:
248–255.
72 Theus MH, Wei L, Cui L et al. In vitro
hypoxic preconditioning of embryonic stem
cells as a strategy of promoting cell survival
and functional benefits after transplantation
into the ischemic rat brain. Exp Neurol 2008;
210:656–670.
73 van Velthoven CT, Sheldon RA, Kavelaars
A et al. Mesenchymal stem cell transplanta-
tion attenuates brain injury after neonatal
stroke. Stroke 2013;44:1426–1432.
C AlphaMed Press 2014
V