See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/6117294

The Molecular Bases of Training Adaptation

ARTICLE in SPORTS MEDICINE · FEBRUARY 2007

Impact Factor: 5.04 · DOI: 10.2165/00007256-200737090-00001 · Source: PubMed

CITATIONS READS

227 294

2 AUTHORS:

Vernon G Coffey John A Hawley

Bond University RMIT University
40 PUBLICATIONS 1,333 CITATIONS 167 PUBLICATIONS 5,605 CITATIONS

SEE PROFILE SEE PROFILE

Available from: Vernon G Coffey

Retrieved on: 13 January 2016
 The Molecular Bases of Training Adaptation

A thesis submitted in fulfilment of the requirements for the Doctorate of Philosophy

Vernon G. Coffey

School of Medical Sciences

Science, Engineering and Technology Portfolio

RMIT University

August 2006
 Publications arising from this thesis

This thesis is based on the following publications:

1. Coffey, V.G., Reeder, D.W., Lancaster, G.I., Yeo, W.K., Febbraio, M.A., Yaspelkis

III, B.B., Hawley, J.A. (2006). High-frequency training stimulus attenuates AKT and

exacerbates TNFα signaling responses in skeletal muscle. Journal of Applied

Physiology (In Review).

2. Coffey V.G., Zhong Z., Shield A., Canny B.J., Chibalin A.V., Zierath J.R, Hawley

J.A. (2006). Early signaling responses to divergent exercise stimuli in skeletal muscle

from well-trained humans. The FASEB Journal 20(1): 190-2.

3. Coffey V.G., Shield A., Canny B.J., Carey K.A., Cameron-Smith D., Hawley J.A.

(2006). Interaction of contractile activity and training history on mRNA abundance in

skeletal muscle from trained humans. American Journal of Physiology Endocrinology

and Metabolism 290(5): E849-855.

Additional publications arising from work undertaken for this thesis:

4. Deshmukh A., Coffey V.G., Zhong Z., Chibalin A.V., Zierath J.R, Hawley J.A.

(2006). Exercise-induced phosphorylation of the novel Akt substrates AS160 and

filamin in human skeletal muscle. Diabetes 55(6): 1776-1782.

5. Coffey V.G. and Hawley, J.A. (2006). Training for performance: Insights from

molecular biology. Invited commentary. International Journal of Sports Physiology

and Performance 1: 347-355.

6. Coffey, V.G. & Hawley, J.A. (2005). The Specificity of Training: New Insights from

Molecular Biology. Invited Review for Inaugural Issue. Malaysian Journal of Sport

Science and Recreation 1 (1): 1-15.

ii
 Declaration

I certify that except where due acknowledgement has been made, the work is that of the

author alone; the work has not been submitted previously, in whole or in part, to qualify for

any other academic award; the content of the thesis is the result of work which has been

carried out since the official commencement date of the approved research programme; and,

any editorial work, paid or unpaid, carried out by a third party is acknowledged.

Signed:

Vernon G. Coffey
Date: ___________

iii
 Acknowledgements

First, and foremost, I would like to acknowledge and thank my principle supervisor John

Hawley for giving me the opportunity to study and learn from a world renowned exercise

physiologist, and for guidance and support throughout my candidature. It is rare for a student

to be allowed and equipped to express and develop research ideas and have such a substantial

input into doctoral study, for which I am particularly grateful. I would also like to thank

Anthony Shield for his help and input into this thesis, and for always being willing to provide

valuable insight with regard to the projects outlined in this work.

Numerous individuals contributed to the studies incorporated in this thesis:

- Thank you to Professor Juleen Zierath at the Karolinska Institute, Stockholm, Sweden

and her lab members Alexander Chibalin and Zhihui Zong for the protein analysis for

my second study.

- Thank you to Dr. Ben Canny M.D. for performing all the muscle biopsies during

human exercise trials.

- Thank you to Dr. David Cameron-Smith and lab members Dr. Kate Carey and Janelle

Mollica from Deakin University, Melbourne for technical assistance during mRNA

analysis.

- Thanks also to Dr. Ben Yaspelkis III and particularly Don Reeder from California

State University, Northridge, U.S.A. who spent countless hours to facilitate the

exercise model for the rodent resistance training study.

- I would also like to thank Dr. Graeme Lancaster for his help providing IKK analysis,

and Wee Kian Yeo and Emmanuel Churchley for muscle glycogen data.

iv
I would want to say thanks to all the past and present members of the Exercise Metabolism

Group who have been the principle reason for the enjoyment I have had during my 3 ½ years

at RMIT University. The value of this experience is found in the people I have shared it with.

I would especially like to thank Sarah Lessard, with whom I have shared my entire PhD

journey, for her friendship and help during this rollercoaster ride. Unfortunately, as time goes

by our professional lives will probably take us down different paths but I hope our friendship

will last a life time. Maybe we can, at the very least, catch up at EMG lab reunions when John

is old and grey!

Thank you to my parents, family and friends who never seem to doubt me and support me in

everything I do.

Special thanks to my wife Heather who believes in me more than I believe in myself, rest

assured my heart is all yours.

Finally, should this thesis represent achievement, bring recognition or commendation of any

kind, I would acknowledge my friend and Saviour Jesus Christ who makes me who I am and

with whose gifts I have done my best.

“Wisdom may satisfy the needs of the mind but it will never satisfy the needs of the soul.”

So… set your mind on things above, not earthly things… and whatever you do, whether in

word or deed, do it all in the name of the Lord Jesus, giving thanks to the Father through Him

Col 3:2, 17.

v
 Table of Contents

PUBLICATIONS ARISING FROM THIS THESIS .............................................................................. II

DECLARATION ........................................................................................................................ III

ACKNOWLEDGEMENTS ...........................................................................................................IV

TABLE OF CONTENTS ..............................................................................................................VI

LIST OF FIGURES .....................................................................................................................IX

LIST OF TABLES .................................................................................................................... XII

ABBREVIATIONS .................................................................................................................. XIII

ABSTRACT ..............................................................................................................................1

CHAPTER ONE .......................................................................................................................5

LITERATURE REVIEW ..............................................................................................................5

1.1 Overview: The Specificity of Exercise Responses ........................................................6

1.2 Skeletal Muscle Mechanotransduction.......................................................................11

1.2.1 Putative Primary Messengers...........................................................................11

Mechanical Stretch ...................................................................................................11

Calcium.....................................................................................................................13

Redox Potential ........................................................................................................14

Phosphorylation Potential.........................................................................................16

Summary...................................................................................................................17

1.2.2 Secondary Messengers ......................................................................................17

5’Adenosine Monophosphate Activated Protein Kinase (AMPK) Mediated

Signalling..................................................................................................................18

Ca2+ calmodulin-dependent kinase (CaMK) / Calcineurin Signalling .....................22

Insulin / Insulin-like Growth Factor (IGF) Signalling Pathway...............................25

AKT / Protein Kinase B ...........................................................................................26

 Mammalian target of rapamycin (mTOR)................................................................32

p70 S6K, 4E-BP1& eIF2B .......................................................................................35

Cytokine Signalling ..................................................................................................39

Tumor Necrosis Factor Alpha (TNFα) .....................................................................39

Inhibitor Kappa B Kinase (IKK) & Nuclear Factor Kappa B (NFκB).....................41

Mitogen Activated Protein Kinase (MAPK) Signalling Pathway ............................44

ERK1/2 .....................................................................................................................45

p38 ............................................................................................................................47

Summary...................................................................................................................49

1.3 Genetic and Molecular Responses to Exercise...........................................................49

1.3.1 Endurance Exercise...........................................................................................50

Mitochondrial Biogenesis.........................................................................................51

Metabolic Gene Expression......................................................................................55

1.3.2 Resistance Exercise............................................................................................56

Hypertrophy..............................................................................................................57

Atrophy.....................................................................................................................61

1.3.3 Concurrent Training .........................................................................................66

1.4 Summary & aims of this thesis ...................................................................................75

CHAPTER TWO....................................................................................................................76

HIGH-FREQUENCY TRAINING STIMULUS ATTENUATES AKT AND EXACERBATES TNFΑ

SIGNALLING RESPONSES IN SKELETAL MUSCLE ......................................................................76

2.1 Introduction ............................................................................................................77

2.2 Methods ..................................................................................................................78

2.3 Results ....................................................................................................................83

2.4 Discussion...............................................................................................................89

vii
CHAPTER THREE................................................................................................................96

EARLY SIGNALLING RESPONSES TO DIVERGENT EXERCISE STIMULI IN SKELETAL MUSCLE

FROM WELL-TRAINED HUMANS ..............................................................................................96

3.1 Introduction ............................................................................................................97

3.2 Methods ..................................................................................................................98

3.3 Results ..................................................................................................................104

3.4 Discussion.............................................................................................................110

CHAPTER FOUR ................................................................................................................117

INTERACTION OF CONTRACTILE ACTIVITY AND TRAINING HISTORY ON MRNA ABUNDANCE IN

SKELETAL MUSCLE FROM TRAINED ATHLETES .....................................................................117

4.1 Introduction ..........................................................................................................118

4.2 Methods ................................................................................................................119

4.3 Results ..................................................................................................................125

4.4 Discussion.............................................................................................................131

CHAPTER FIVE ..................................................................................................................137

SUMMARY AND CONCLUSIONS ............................................................................................137

CHAPTER EIGHT ..............................................................................................................143

REFERENCES ........................................................................................................................143

viii
 List of Figures

Figure 1.1 Putative steps through which contractile activity leads to alterations of skeletal

muscle.........................................................................................................................................6

Figure 1.2 Schematic of the putative (A) mRNA and (B) protein responses with adaptation to

repetitive exercise stress. ............................................................................................................8

Figure 1.3 Proposed effect of concurrent training on specific adaptation when compared to

single mode training. ..................................................................................................................9

Figure 1.4 Metabolic and mechanical signals believed to play key roles as primary

messengers in mechanotransduction. .......................................................................................14

Figure 1.5 Putative contraction-mediated adaptive events associated with 5’Adenosine

Monophosphate Activated Protein Kinase (AMPK) activation in skeletal muscle..................19

Figure 1.6 Proposed mechanisms for calcium-dependent increases in gene expression with

skeletal muscle contractile activity...........................................................................................23

Figure 1.7 Simplified IGF-1 signalling pathway from receptor binding to protein synthesis. 26

Figure 1.8 Proposed adaptive events associated with activation of AKT in skeletal muscle..27

Figure 1.9 Model of the regulation and functions of the mammalian target of rapamycin

(mTOR) complex......................................................................................................................33

Figure 1.10 Putative downstream targets and functions of ribosomal protein S6K. ...............36

Figure 1.11 Simplified TNFα pathway initiating nuclear transcription. .................................41

Figure 1.12 Proposed pathways of activation and molecular targets of MAPK signalling.....44

Figure 1.13 Five stages of gene expression and sites of regulation.........................................50

Figure 1.14 Peroxisome proliferator receptor delta (PPARδ) regulates exercise endurance. .54

Figure 1.15 Schematic representations of events regulating satellite cell activation. .............59

Figure 1.16 Putative pathways regulating signalling to MAFBx / MuRF ubiquitin ligases. ..63

ix
Figure 1.17 Schematic providing an example of the integration of hypertrophy (IGF-1) and

atrophy (TNFα) pathways in skeletal muscle...........................................................................66

Figure 1.18 Putative divergent regulation of eukaryotic elongation factor 2 ..........................71

Figure 1.19 Proposed effects of acute endurance and resistance training on forkhead box O1

(FoxO1) mediated transcription................................................................................................72

Figure 1.20 Putative adaptive pathways in response to endurance- and resistance-like stimuli.

..................................................................................................................................................73

Figure 2.1 Representative schematic of high-frequency “stacking” and conventional-

frequency resistance training protocols. ...................................................................................79

Figure 2.2 Muscle glycogen content (A, B) and 5’ adenosine monophosphate activated

protein kinasethr172 (AMPK) phosphorylation (C, D) ...............................................................84

Figure 2.3 Phosphorylated AKTser473 (A, B) and mammalian target of rapamycinser2448

(mTOR; C, D) relative to total, and FKHRser256 (FoxO1) phosphorylation (E, F)...................85

Figure 2.4 Eukaryotic initiation factor 4E-binding proteinthr70 (4E-BP1; A, B)

phosphorylation and ribosomal p70 S6 kinasethr389 (p70 S6K) phosphorylation relative to total

(C, D) ........................................................................................................................................87

Figure 2.5 Total tumor necrosis factor alpha (TNFα) content (A, B), phosphorylated p38thr180

mitogen activated protein kinase (MAPK) relative to total (C, D), and inhibitor kappa B

kinaseser180/181 (IKK) phosphorylation (E, F) ............................................................................88

Figure 3.1 ‘5 adenosine monophosphate kinase (AMPK) phosphorylation..........................105

Figure 3.2 AKT (A, B) and tuberous sclerosis complex-2 (TSC2; C, D) phosphorylation ..106

Figure 3.3 Eukaryotic initiation factor 2B (eIF2B; A, B) and ribosomal p70 S6 kinase (p70

S6K; C, D) phosphorylation ...................................................................................................107

Figure 3.4 Extracellular regulating kinase (ERK; A, B) and p38 (C, D) MAPK

phosphorylation ......................................................................................................................109

Figure 4.1 Changes in mRNA abundance for genes associated with endurance responses ..127

x
Figure 4.2 Changes in mRNA abundance for genes associated with myogenic responses...128

Figure 4.3 Changes in mRNA abundance for genes associated with endurance responses ..129

Figure 4.4 Changes in mRNA abundance for genes associated with myogenic responses...130

xi
 List of Tables

Table 1.1 Summary of research investigating AKT responses to contractile overload in

skeletal muscle..........................................................................................................................29

Table 1.2 Summary of research investigating AKT responses to exercise in skeletal muscle.

..................................................................................................................................................30

Table 1.3 Summary of research investigating MAPK responses to exercise in vivo human

skeletal muscle..........................................................................................................................46

Table 1.4 Summary of research investigating the effect of concurrent strength and endurance

training on skeletal muscle adaptation......................................................................................68

Table 3.1 Subject characteristics. ............................................................................................99

Table 4.2 Primer sequences and concentrations used for real-time PCR. .............................124

xii
Abbreviations

ACC acetyl-CoA carboxylase

AMP adenosine monophosphate

AMPK 5’ adenosine monophosphate kinase

AP1 activator protein 1

AS160 AKT substrate of 160 kDa

ATP adenosine triphosphate

BCAA branch chain amino acid

CaN calcineurin

CaMK calmodulin kinase

CAMKK calmodulin kinase kinase

CHO carbohydrate

COX cytochrome C oxidase

DNA deoxyribose nucleic acid

eEF eukaryotic elongation factor

Egr early growth response gene-1

eIF eukaryotic initiation factor

ERK extra-cellular regulating factor

ERR estrogen-related receptor alpha

FoxO Forkhead box O

FT fast twitch

GβL G beta L protein

Glut4 glucose transporter 4

GSK glycogen synthase kinase

HDAC histone deacteylase

HFES high-frequency electrical stimulation

xiii
IEG immediate early gene

IGF insulin-like growth factor

IGFR insulin-like growth factor receptor

IκB inhibitor of NFκB

IKK IκB kinase

IRS insulin receptor substrate

LFES low-frequency electrical stimulation

MAFBx muscle atrophy F box protein

MAPK mitogen activated protein kinase

MEF myocyte enhancer factor

MEK mitogen activated kinase

Mfn mitofusin

MK mitogen protein kinase

MNK MAPK-interacting kinase

MRF myogenic regulatory factor

mRNA messenger ribose nucleic acid

MSK mitogen and stress activated kinase

mTOR mammalian target of rapamycin

MuRF muscle ring finger protein

MyoG myogenin transcription factor

MyoD myogenic differentiation transcription factor

NAD/NADH nicotinamide adenine dinucleotide/hydroxide

NFκB nuclear factor kappa enhancer binding protein

NRF nuclear respiratory factor

PDK1 3’ phosphoinositide-dependent protein kinase 1

PDK4 pyruvate dehydrogenase kinase 4

xiv
PIP2 phosphatidylinositol-3-OH kinase phosphatidylinositol-4, 5 biphosphate

PIP3 phosphatidylinositol-3-OH kinase phosphatidylinositol-3, 4, 5 triphosphate

PI3K phosphatidylinositol-3-OH kinase

PPAR peroxisome proliferator activated receptor

PGC-1α peroxisome proliferator activated receptor gamma co-activator-1 alpha

PHLPP PH domain leucine-rich repeat protein phosphatase

PTEN lipid-binding phosphatase and tensin homologue

p70 S6K ribosomal protein p70 S6 kinase

PWC peak work capacity

Rheb Ras homologue enriched in brain

RM repetition maximum

ROS reactive oxygen species

rpS6 ribosomal protein S6

RSK ribosomal S6 kinase

SHP2 SH2-containing inositol 5’-phosphatase-2

S6K ribosomal protein S6 kinase

ST slow twitch

TAK transforming growth factor beta activated kinase

TBS tris-buffered saline

TBST tris-buffered saline with tween

TFAM mitochondrial transcription factor A

TG transgenic

TNFα tumor necrosis factor alpha

TNFR tumor necrosis factor receptor

TRAF TNF-receptor-associated factor

TSC tuberous sclerosis complex

xv
UCP uncoupling protein

VEGF vascular endothelial growth factor

VO2peak maximal oxygen uptake

VO2peak peak oxygen uptake

WT wild type

4E-BP1 eukaryotic initiation factor 4E-binding protein

xvi
 Abstract
The molecular events that promote or inhibit specific training adaptations (i.e. skeletal muscle

hypertrophy or mitochondrial biogenesis) are not completely understood. Accordingly, there

is a need to better define both the acute and chronic responses to divergent exercise stimuli in

order to elucidate the specific molecular mechanisms that ultimately determine skeletal

muscle phenotype. Therefore, the primary aims of the studies undertaken for this thesis were to

examine the acute molecular adaptation responses in skeletal muscle following resistance and

endurance training.

In order to determine the acute molecular events following repeated bouts of exercise,

the study described in Chapter Two compared a high-frequency “stacked” training regimen

designed to generate a summation of transient exercise-induced signalling responses with a

conventional-frequency resistance training protocol. Groups (n= 6) of Sprague-Dawley rats

performed either high-frequency training (four exercise bouts consisting of 3 × 10 repetitions

separated by 3 h) or conventional-frequency training (three exercise bouts consisting of 4 × 10

repetitions with 48 h between sessions). Protocols were matched for total work, and

repetitions were performed at 75% one-repetition maximum with 3 min recovery between

sets. White quadriceps muscle was extracted 3 h after every training bout, and 24 and 48 h

following the final exercise session of each protocol. AKT phosphorylation was significantly

decreased 3 h following the 2nd bout of high-frequency training, an effect that persisted until

48 h after the final exercise bout (P <0.05), while the phosphorylation state of this kinase was

unchanged with conventional training. These results suggest that high-frequency training

suppressed IGF-1 mediated signalling. Furthermore, high-frequency training generated

sustained and coordinated increases in TNFα and IKK phosphorylation (P <0.05), indicating

an extended response of inflammatory signalling pathways. Conversely, and irrespective of an

initial increase after the first bout of exercise, TNFα signalling ultimately returned to control

1
values by DAY 5 of conventional-frequency training, indicative of a rapid adaptation to the

exercise stimulus. Notably, despite differential AKT activation there were similar increases in

p70 S6K phosphorylation with both training protocols. These results indicate high-frequency

resistance training extends the transient activation of inflammatory cytokine-mediated

signalling and results in a persistent suppression of AKT phosphorylation, but these events do

not appear to inhibit kinase activity proximal to translation initiation.

The aim of the study described in Chapter Three was to determine the effect of prior

training history on selected signalling responses after an acute bout of resistance and

endurance exercise. Following 24 h diet / exercise control 13 male subjects (7 strength-trained

and 6 endurance-trained) performed a random order of either resistance (8 x 5 maximal leg

extensions) or endurance exercise (1 h cycling at 70% peak O2 uptake). Muscle biopsies were

taken from the vastus lateralis at rest, immediately and 3 h post-exercise. AMPK

phosphorylation increased after cycling in strength-trained, but not endurance-trained subjects

(P <0.05). Conversely, AMPK was elevated following resistance exercise in endurance-, but

not strength-trained subjects (P <0.05). Thus, AMPK was elevated only when subjects

undertook a bout of exercise in a mode of training to which they were unaccustomed.

Surprisingly, there was no change in AKT phosphorylation following resistance exercise

regardless of the training background of the subjects. In the absence of increased AKT

phosphorylation, resistance exercise induced an increase in p70 S6K and ribosomal S6 protein

phosphorylation in endurance-trained but not strength-trained subjects (P<0.05). AKT

phosphorylation was increased in endurance-trained, but not strength-trained subjects after

cycling (P <0.05). These results show that a degree of signalling “response plasticity” capable

of diverse adaptive compliance is conserved at opposite ends of the adaptation continuum.

Furthermore, the adaptive phenotype associated with a prolonged training history alters the

subsequent signalling responses with divergent exercise stimuli.

2
 The third study described in Chapter Four quantified the acute sub-cellular mRNA

responses in muscle to habitual and unfamiliar exercise modes. This study employed the same

subjects and protocols outlined in Chapter Three and analysis was performed on muscle

biopsies taken at rest and 3 h after an exercise bout. Gene expression was analysed using

Real-Time PCR with changes normalised relative to pre-exercise values. Following cycling

exercise peroxisome proliferator activated receptor gamma co-activator-1 alpha, pyruvate

dehydrogenase kinase 4 and vascular endothelial growth factor mRNA abundance was

significantly increased in both endurance and strength-trained subjects (P <0.05). This finding

indicates that the adaptive phenotype of these athletes did not produce a disparity in the

mRNA response of these ‘metabolic genes’. Similarly, muscle atrophy F box protein

(MAFBx) mRNA increased in both groups (P <0.05) suggesting that a prolonged endurance

training stimulus may increase the activity of pathways involved in the regulation of muscle

atrophy. Unexpectedly, MyoD and Myogenin mRNA increased in endurance-trained subjects

after cycling. Accordingly, it seems plausible to suggest that these regulators of satellite cell

activity may have additional roles in skeletal muscle metabolism. Finally, high-intensity

resistance exercise did not induce any change in mRNA abundance of selected ‘myogenic’

genes in either group of subjects, despite a decrease in MAFBx and Myostatin mRNA in

endurance-trained subjects. It may be that in highly-trained athletes a greater volume or

repeated bout effect is required to initiate anabolic gene expression. Taken collectively, these

results indicate that prior training history can modify the acute mRNA changes in skeletal

muscle in response to exercise. Indeed, the data indicate that independent of exercise mode,

the gene responses in skeletal muscle from endurance-trained athletes are more sensitive to

alterations in the cellular milieu than strength-trained subjects.

In summary, the work from the studies undertaken for this thesis provides novel

information regarding the effects of the frequency of the training stimulus on signalling

responses in skeletal muscle. Specifically, high-frequency resistance training does not

3
enhance anabolic signal transduction and may exacerbate inflammation and atrophy. In regard

to the effects of prior contractile history on early signalling and mRNA responses, divergent

exercise induces a mode specific molecular response that is altered by the training-induced

phenotype of the muscle, highlighting the need for extensive training overload in highly-

trained athletes.

4
 Chapter One

Literature Review

5
 1.1 Overview: The Specificity of Exercise Responses

Skeletal muscle is a malleable tissue capable of altering the type and amount of protein in

response to disruptions to cellular homeostasis. Contractile activity as a result of physical

activity (i.e. exercise) represents a potent stimulus that can generate significant disturbance

within the muscle milieu and elicit substantial changes and adjustment in the cellular

environment. Indeed, repeated contractile activity produces a cascade of events that ultimately

alters the adaptive machinery and tissue characteristics resulting in less interference to cell

homeostasis during subsequent contractions (Figure 1.1).

Nerve stimulation

Contractile activity

Primary messengers

Secondary messengers

Regulatory Genes

Functional genes (Proteins)

Fibre specific characteristics

Tissue characteristics
(Phenotype)
Figure 1.1 Putative steps through which contractile activity leads to alterations of skeletal

muscle (Williams and Neufer 1996).

Current understanding of the complex process of exercise-induced adaptation in

skeletal muscle was pioneered in the 1960’s. Notably, Holloszy (1967) was the first exercise

scientist to utilise conventional biochemistry techniques to investigate the effects of exercise

on skeletal muscle. Holloszy (1967) established that regular prolonged exercise significantly

increased skeletal muscle mitochondrial content and enzyme activity, thereby elucidating a

molecular mechanism for the increase in aerobic work capacity with endurance training.

6
Similarly, Goldberg (1968) pioneered work that identified the capacity of skeletal muscle to

increase in size in response to physiological overload. He showed that overload-induced

compensatory hypertrophy occurred via the incorporation of amino acid derived protein

synthesis, the principal molecular event to increase muscle mass with resistance training.

Since these early studies advances in biotechnology have enabled the elucidation of specific

signalling mechanisms that initiate replication of DNA sequences and translation of the

genetic message into a series of amino acids that create new protein (Bouchard et al. 1997).

The continuous turnover of cell proteins and alterations in the equilibrium between protein

synthesis and degradation permits muscle plasticity (Booth and Baldwin 1996). The

functional consequences of these exercise-induced adaptation processes are determined by the

volume, intensity and frequency of the stimulus and the half-life of the protein. Moreover,

many features of the resultant adaptation after repeated bouts of contractile activity are

specific to the type of stimulus, such as the mode of exercise (Williamson et al. 2001;

Izquierdo et al. 2004; Mahoney et al. 2005).

The early signalling responses elicited by a single bout of exercise generate increases

in transcription of nuclear / mitochondrial DNA resulting in greater mRNA abundance of

specific exercise-induced genes. While gene expression and subsequent protein synthesis in

response to exercise is regulated at multiple steps, the directional change in mRNA is

generally the same as the protein during early adaptation to a new steady-state level (Booth

and Baldwin 1996). Contraction generates transient increases in the quantity of mRNA for

specific exercise-induced genes commonly peaking between 3-12 h post-exercise and

returning to basal levels within 24 h (Figure 1.2a; Pilegaard et al. 2000; Psilander et al. 2003;

Bickel et al. 2005; Yang et al. 2005). Therefore, frequent repeated bouts of exercise will result

in increased transcriptional activity that subsequently amplifies protein synthesis.

Consequently, chronic adaptation to training is likely due to the cumulative effects of each

acute exercise bout leading to a change in the steady-state level of specific proteins and a new

7
 functional threshold (Figure 1.2b; Widegren et al. 2001; Mahoney et al. 2005; Pilegaard et al.

2005).

A B New Functional Threshold

70 100
90

Adaptation (% above basal)

60
mRNA (% above basal)

80
50 70
60
40
50
30 40
20 30
20
10
10
0 0
1 2 3 4 1 2 3 4 5 6 7
Days of Exercise Weeks of Exercise

Figure 1.2 Schematic of the putative (A) mRNA and (B) protein responses with adaptation to

repetitive exercise stress.

Diverse exercise stimuli induce specific early gene responses and protein synthesis in

skeletal muscle (Atherton et al. 2005). Individuals have different genetic capacity to perform

and adapt to aerobic or anaerobic exercise (Bouchard et al. 2000) and muscle fibre

composition is an important contributing factor to this process. Nevertheless, while the

mechanisms that transduce the fibre-type specific effect of contractile activity are

incompletely understood, numerous signalling proteins and genes have been implicated in

exercise-induced adaptation (Hawley 2002; Glass 2005; Koulmann and Bigard 2006).

Prolonged endurance training elicits a variety of metabolic and morphological gene

expression including those related to mitochondrial biogenesis (Holloszy 1967; Irrcher et al.

2003), fast-slow fibre-type transformation (Zierath and Hawley 2004) and substrate

metabolism (Holloszy et al. 1977). In contrast, heavy resistance exercise stimulates adaptive

machinery responsible for increasing muscle hypertrophy (Rennie et al. 2004) and maximal

contractile force output (Häkkinen 1989; Ahtiainen et al. 2003).

Concomitant with the vastly different functional outcomes induced via these diverse

exercise modes, the genetic and molecular mechanisms of adaptation are distinct and may be

8
regarded as incompatible. Each mode of exercise results in activation and / or repression of

specific pathways and subsets of genes. Performing multiple bouts of each training mode in

isolation will ultimately generate a developmental history in the muscle fibres, producing a

specific exercise-induced phenotype associated with chronic training (Ingalls 2004).

Therefore, aerobic endurance and heavy resistance training represent opposite ends of an

adaptation continuum. While the cellular and molecular events associated with endurance and

resistance exercise adaptations are becoming evident, our current understanding of the

adaptation process when performing concurrent endurance and resistance training is less

clear. Previous work (Leveritt et al. 2003) suggests that concurrent endurance and resistance

training reduces the adaptive response compared to when each exercise mode is undertaken

alone (Figure 1.3).

New Functional Threshold

100
Adaptation (% above basal)

90
80
Single Mode Training
70
60
50 Concurrent Training?
40
30
20
10
0
1 2 3 4 5 6 7
Weeks of Exercise

Figure 1.3 Proposed effect of concurrent training on specific adaptation when compared to

single mode training.

Metabolic and mitochondrial adaptation to aerobic exercise is typically associated

with resistance to lifestyle related diseases, while increased muscular strength and power may

prevent musculo-skeletal injury and loss of function. Greater knowledge of the mechanisms

9
and interaction of exercise-induced adaptive pathways in skeletal muscle is important for our

understanding of the aetiology of disease, maintenance of metabolic and functional capacity

with aging, and training for athletic performance. This chapter will provide a detailed review

of adaptive pathways in skeletal muscle and highlight the effects of exercise on genetic and

molecular mechanisms of adaptation.

10
 1.2 Skeletal Muscle Mechanotransduction

The process of converting a mechanical signal to a biochemical event in a muscle cell has

been termed mechanotransduction (Hornberger and Esser 2004) and involves the up-

regulation of primary and secondary messengers that initiate a cascade of events that result in

activation and / or repression of specific signalling pathways regulating exercise-induced gene

expression and protein synthesis / degradation (Williams and Neufer 1996). One of the most

potent stimuli for skeletal muscle mechanotransduction is contraction.

1.2.1 Putative Primary Messengers

Elucidation of the precise mechanisms that enable skeletal muscle cells to interpret and

respond to contraction has proved elusive. Indeed, the complexity of this process is

complicated by 1) the proposed mechanoreceptors that connect the neuronal, mechanical and

biochemical events and 2) the numerous cellular candidates as potential primary messengers

that transduce the mechanical signal. In addition, it is unlikely that these primary signalling

messengers act in isolation and probably results in an intricate multifaceted signal with

redundancy and cross-talk. Nevertheless, a number of putative messengers is emerging

including, but not limited to, calcium, Na+ / K+, mechanical stretch, pH, hydrogen ions, redox

state, hypoxia, and phosphorylation state. This review will focus on several important primary

messengers that have been identified to be altered with exercise-induced contractile activity

(Williams and Neufer 1996; Sakamoto and Goodyear 2002; Hawley and Zierath 2004).

Mechanical Stretch

Mechanical stimuli modulate cell function via membrane distortion and mechanochemical

conversion, and directly affect tissue form and function (Alenghat and Ingber 2002). Putative

mechanoreceptors for signal transduction in skeletal muscle include the phospholipid bilayer

11
and surface adhesion receptors (Hornberger and Esser 2004). Movement of intra- and extra-

cellular components via disruption to the lipid membrane and activation of focal adhesion

kinases through integrin receptors as a result of muscle contraction represent likely candidates

that activate secondary events (Hornberger and Esser 2004; Rennie et al. 2004). Technical

limitations currently prevent accurate measurement of the effect of mechanical stimuli on

mechanotransduction in vivo. However, the use of passive stretch on muscle in vitro and in

situ demonstrates that mechanical stimuli induce numerous adaptive processes. Passive

stretch has been shown to alter myogenic regulatory factors (MRF), myosin heavy chain and

fast-to-slow phenotype gene expression in both innervated and denervated skeletal muscle

(Loughna et al. 1990; Loughna and Morgan 1999; Rauch and Loughna 2005). Furthermore,

stretch is capable of generating significant increases in skeletal muscle insulin-like growth

factor (IGF) mRNA and hypertrophy (Czerwinski et al. 1994).

Evidence is emerging that mechanical perturbation of skeletal muscle mediates

activation of the calcineurin, mitogen activated protein kinase (MAPK) and IGF signalling

cascades (Kumar et al. 2002; Hornberger et al. 2005a; Rauch and Loughna 2005). Moreover,

it has become apparent that muscle cells can distinguish between mechanical forces acting on

the cell. Work by Kumar and colleagues (2002) revealed that axial versus transverse stress

produced activation of distinct signalling intermediates despite the same magnitude of

mechanical stress applied to the muscle fibre. Similarly, Hornberger and co-workers (2005a)

observed unique activation of signalling proteins when comparing cyclic uni- and multi-axial

stretch. The rapid and differentiated mechanochemical conversion induced by distinct models

of mechanical stress strongly suggests the existence of mechanotransduction specificity.

Therefore, the signalling events initiated by mechanical load with exercise (i.e. frequency and

intensity of contraction) are likely to contribute to the specificity of exercise-induced

adaptation and implicates mechanical stress / tension as a significant primary messenger.

12
Calcium

Neural activation of skeletal muscle generates an action potential that results in Ca2+ release

from the sarcoplasmic reticulum (SR) via Ca2+ release channels triggering a rise in cellular

[Ca2+] for excitation-contraction coupling (Carroll et al. 1995). Cessation of the action

potential initiates the transport of Ca2+ out of the cytosol back to the sarcoplasmic reticulum.

The rate and capacity of Ca2+ release and uptake is altered by contractile activity (Figure 1.4).

Prolonged moderate intensity (~60-70% VO2max) exercise has been shown to increase

SR Ca2+ uptake and may increase the number of active pumps resequestering Ca2+ (Schertzer

et al. 2003; Schertzer et al. 2004). In contrast, a single bout of high-intensity (>100% VO2max)

or fatiguing exercise generates a 20-50% transient decrease in Ca2+ uptake and release,

returning to basal levels following 60 min recovery (Byrd et al. 1989; Matsunaga et al. 2002).

These acute alterations in cytosolic [Ca2+] may elicit secondary events following a return to

resting / basal values. Interestingly, repeated bouts of exercise have been shown to induce an

adaptive response resulting in less perturbation in Ca2+ release and uptake, and subsequently

improved Ca2+ cycling and resistance to fatigue (Holloway et al. 2005). Taken together, these

findings provide evidence to suggest the amplitude and duration of Ca2+ flux is regulated by

the duration and frequency of contractile stimulus. For example, endurance exercise likely

results in extended periods of moderately elevated [Ca2+], while resistance exercise would

generate short cycles of significantly higher intra-cellular [Ca2+] (Baar et al. 1999). Indeed, it

is plausible to suggest that the specific cytosolic Ca2+ transient will also determine subsequent

downstream events such as gene expression and protein synthesis (Chin 2005; Tidball 2005).

Ca2+ cycling has been implicated in the activation of multiple potential secondary

messenger complexes including calcineurin, nuclear factor of activated T-cells (NFAT),

calmodulin, MAPK and protein kinase C (Williams and Neufer 1996; Baar et al. 1999;

Sakamoto and Goodyear 2002). Elevation of intranuclear [Ca2+] may also result in activation

of histone deacetylase (HDAC) and myocyte enhancer factor 2 (MEF2) (Liu et al. 2005).

13
However, the precise relationship between alterations in [Ca2+] and initiation of the adaptive

processes culminating in gene expression and protein synthesis remains elusive. Nevertheless,

Ca2+ appears to be a compelling regulator in the specificity of exercise-induced adaptive

events and its effects are likely to be altered by the mode, intensity and volume of exercise.

st r st
et re
ch Sarcoplasmic Reticulum tc
h
1

Ca2+ 2
Ca2+ Ca2+ CHO + Fat
Ca2+
+
Ca2+
Ca2+
Ca2+
T-tubule

+ NAD
Ca2+ Ca2+
ADP + Pi
Ca2+
+ 3
Ca2+ 4
Ca2+ Ca2+ NADH
ATP
Ca2+
O2

Figure 1.4 Metabolic and mechanical signals believed to play key roles as primary

messengers in mechanotransduction. 1) Mechanical stretch 2) Ca2+ flux 3) redox potential and

4) phosphorylation potential. Ca2+, calcium; CHO, carbohydrate (Spriet 2002; Hawley and

Zierath 2004).

Redox Potential

The process of maintaining redox potential occurs when nicotinamide adenine dinucleotide

(NAD) is converted to NADH, and to maintain redox homeostasis NADH must be constantly

re-oxidised via several different pathways (Lin and Guarente 2003). This redox mechanism is

predominantly a result of the catabolic reactions occurring with glycolytic and lipolytic

metabolism (Figure 1.4). Therefore, the NAD/NADH ratio regulates intra-cellular redox state

14
and may be considered a marker of skeletal muscle metabolic state (Lin and Guarente 2003).

Indeed, contractile function in the absence of fatigue and during strenuous exercise to

exhaustion is modulated moment-to-moment by cellular redox state (Smith and Reid 2006).

The maintenance of redox potential produces volatile free oxygen molecules (e.g.

reactive oxygen species [ROS]) and this oxidant activity is buffered by multiple anti-oxidant

systems in skeletal muscle (Stofan et al. 2000; Arbogast and Reid 2004). Due to the increase

in demand for oxygen and activity of metabolic pathways, exercise represents a stimulus

capable of generating high levels of ROS. While a direct cause and effect relationship has not

been established, indirect evidence suggests that oxidative stress limits exercise capacity and

may modulate exercise-induced adaptive signalling. ROS-selective antioxidants have been

utilised to significantly increase sub-maximal exercise time to exhaustion but do not appear to

promote any delay in fatigue at high-intensity workloads in human skeletal muscle in vivo

(Medved et al. 2003; Medved et al. 2004; Matuszczak et al. 2005). Therefore, prolonged

endurance exercise appears to be a stimulus more likely to promote oxidative stress and ROS

activity than heavy resistance training. This may characterise a point of diversion in the

specificity of exercise-induced signalling.

Our present understanding indicates that redox potential and resultant free radical

synthesis with exercise and during recovery may regulate adaptive pathways in two ways. In

the first instance, redox state may act as a primary messenger through a direct affect on

transcriptional regulation and DNA binding specificity of immediate early genes (IEG’s) such

as Fos and Jun, and transcription factors nuclear factor kappa B (NFκB) and activator protein

1 (AP1; Xanthoudakis et al. 1992; Carrero et al. 2000; Jindra et al. 2004). In addition, due to

the apparent effect of ROS on numerous elements of cellular function redox state may act

indirectly on signalling machinery via its effect on intra-cellular Ca2+ regulation and

mitochondrial metabolism (Smith and Reid 2006).

15
Phosphorylation Potential

Muscle contraction is an energy consuming process that requires the continual hydrolysis of

adenosine triphosphate (ATP) to sustain force production. Resynthesis of ATP via restoration

of its high energy phosphate bonds is generated by oxidative phosphorylation and / or

glycolysis (Houston 2001). Subsequently, concentrations of metabolites related to the

maintenance of muscle phosphorylation potential (i.e. [ATP]/[ADP][Pi]) provide feedback

signals to balance ATP production with ATP consumption (Hawley and Zierath 2004).

Indeed, intra-cellular concentrations of free adenosine monophosphate (AMP) are an

important regulator of energy consuming and regenerating pathways (Sakamoto and

Goodyear 2002).

Contraction has been clearly shown to alter metabolite concentration in both type I and

type II muscle fibres (Hintz et al. 1982; Ivy et al. 1987). Strong evidence also exists for the

relationship between metabolite concentrations and contractile intensity and duration during

both continuous and intermittent models of electrical stimulation and in vivo exercise (Hintz

et al. 1982; Ivy et al. 1987; Bangsbo et al. 2001; Ferguson et al. 2001; Krustrup et al. 2003).

Moreover, the maintenance of phosphorylation potential appears to be inversely related to

exercise intensity. Work by Krustrup and colleagues (2003) revealed significant differences in

ATP and creatine phosphate (CP) degradation in response to either low (50% VO2peak) or high

(110% VO2peak) intensity exercise, in which the more intense exercise generated a 20%

greater degradation in muscle ATP concentration. Likewise, Ivy and co-workers (1987) have

shown a concomitant decrease in CP concentration as exercise intensity increases during a

graded exercise protocol to exhaustion. Exercise duration also results in modulation of

phosphorylation potential whereby exercise at a constant work rate has been shown to

increase the rate of ATP turnover, reducing mechanical efficiency with continued exercise

(Bangsbo et al. 2001).

16
 Any cellular stress that inhibits ATP synthesis or accelerates ATP consumption (e.g.

exercise-induced contraction) and subsequently increases the AMP:ATP ratio potentially

initiates numerous downstream molecular events in skeletal muscle (Hardie and Sakamoto

2006). As a primary messenger for adaptive signalling, phosphorylation state appears to

principally exert its effect via a potent secondary messenger, the 5’adenosine monophosphate

activated protein kinase (AMPK; Sakamoto and Goodyear 2002; Hawley and Zierath 2004;

Hardie and Sakamoto 2006). Therefore, phosphorylation potential and subsequent AMPK

activation may ultimately regulate multiple cell signalling cascades for such diverse processes

as glucose uptake, fatty acid oxidation, hypertrophy and gene expression (Aschenbach et al.

2004). This ubiquitous kinase is discussed at greater length in section 1.2.2.

Summary

All mechanotransduction events are important in coordinating and transmitting the

mechanochemical signals produced during exercise. Collectively, and in a coordinated

manner, these signals provide the mechanistic framework by which exercise initiates and

regulates intra-cellular signal transduction to the transcriptional machinery in the nucleus,

modulating gene expression and ultimately protein turnover, generating an exercise specific

signal.

1.2.2 Secondary Messengers

Following initiation of the primary signal additional kinases / phosphatases are activated to

mediate the exercise-induced signal. Numerous signalling cascades exist in mammalian cells

and these pathways are highly regulated at multiple levels with substantial cross-talk between

pathways producing a highly sensitive, complex transduction network. This review will

consider major pathways of contraction and growth factor signalling in skeletal muscle.

17
5’Adenosine Monophosphate Activated Protein Kinase (AMPK) Mediated Signalling

AMPK is a heterotrimeric protein consisting of three subunits (α, β, γ), and functions as a key

regulator of energy homeostasis in skeletal muscle (Winder 2001; Aschenbach et al. 2004;

Hardie and Sakamoto 2006; Witters et al. 2006). Each subunit of AMPK exists in multiple

isoforms and its presence in skeletal muscle may be unique, in that it appears to be the only

tissue containing all catalytic α-subunit (α1, α2) and regulatory β- (β1, β2) and γ-subunit (γ1,

γ2, γ3) isoforms (Hardie and Sakamoto 2006). AMPK is directly activated by 5’AMP and

consequently is sensitive to changes in cellular AMP:ATP ratios (Carling et al. 1987; Hardie

et al. 1999). In addition, upstream kinases LKB1 and calcium calmodulin-dependent kinase

kinase (CAMKK) also converge at threonine172 on the α-subunit to phosphorylate and activate

AMPK in response to altered cellular AMP and Ca2+, respectively (Hawley et al. 2005;

Hurley et al. 2005; Sakamoto et al. 2005; Woods et al. 2005; Witters et al. 2006).

Acute activation of AMPK in response to cellular energy depletion (e.g. skeletal

muscle contraction) initiates actions to both conserve and generate ATP (Witters et al. 2006).

AMPK is implicated in enhancing ATP production by stimulating insulin-independent

glucose uptake (Hayashi et al. 1998; Musi et al. 2001; Nakano et al. 2006) and increasing fat

oxidation, primarily via inhibition of the β isoform of acetyl-CoA carboxylase (ACC-β)

thereby reducing the synthesis and inhibitory effects of malonyl-CoA and subsequently

increasing fatty acyl-CoA translocation into the mitochondria (Merrill et al. 1997; Kaushik et

al. 2001; Aschenbach et al. 2004; Lee et al. 2006). Additional effects of contraction-mediated

AMPK activation are less clear but may result in multiple adaptive events including altered

protein synthesis and gene expression (Figure 1.5). AMPK has been linked to control of gene

expression by activating transcription factors associated with mitochondrial fatty acid

oxidation and the inhibition of protein synthesis by down-regulating components of the

insulin / insulin-like growth factor signalling pathway (Bolster et al. 2002; Zong et al. 2002;

18
Kimura et al. 2003; Terada and Tabata 2003; Jorgensen et al. 2005; Terada et al. 2005; Lee et

al. 2006).

Muscle Contraction

AMP/ATP Ca2+

AMPK
Glucose Uptake + Active ? Fibre Type
? v
CHO Metabolism Gene Expression
+ ?
–
Fatty Acid Oxidation Hypertrophy

Protein Synthesis

Figure 1.5 Putative contraction-mediated adaptive events associated with 5’Adenosine

Monophosphate Activated Protein Kinase (AMPK) activation in skeletal muscle. + positive

effect, – negative effect, V variable positive/negative effect, ? unknown effect; Ca2+, calcium;

CHO, carbohydrate (adapted from Aschenbach et al. 2004 and Witters et al. 2006).

Activation of AMPK in skeletal muscle has been shown in a variety of systems

including in vitro / in vivo contraction, pharmacological activators and transgenic animals

(Nielsen et al. 2003b; Sakamoto et al. 2004b; Atherton et al. 2005; Jorgensen et al. 2005;

Toyoda et al. 2006). Current evidence suggests that isoform specific AMPK activation occurs

in a time, intensity, fibre-type and mode-specific manner and exercise-induced contraction of

skeletal muscle in vivo has been clearly shown to up-regulate AMPK activity (Durante et al.

2002; Nielsen et al. 2003b; Yu et al. 2003; Frøsig et al. 2004; Atherton et al. 2005; Hurst et al.

19
2005; McConell et al. 2005; Sriwijitkamol et al. 2005; Taylor et al. 2005; Wojtaszewski et al.

2005; Toyoda et al. 2006).

In vitro activation of AMPK has revealed that while increased AMPK activity occurs

in both red and white muscle, α1 and α2 isoform activity is greatest in red fast-twitch muscle

(Ai et al. 2002). Findings in vivo following treadmill running support the contention that

AMPK activation is greater in red compared to white muscle (Rasmussen and Winder 1997;

Durante et al. 2002). Importantly, interpretation of the available literature with regard to fibre-

type specific AMPK activity is limited because most studies have incorporated exercise

protocols unlikely to significantly recruit white muscle (i.e. endurance running or swimming).

However, Taylor and colleagues (2005) recently compared the effects of moderate-intensity

endurance training and high-intensity interval training on AMPK signalling. They found that

high-intensity interval training induced a significant additive effect to endurance training on

LKB1 activity in white but not red quadriceps suggesting that white muscle may generate

substantial AMPK responses when sufficiently stimulated. Nevertheless, our current

understanding of fibre-type specific AMPK responses is incompletely resolved.

Commensurate with its proposed role as an ‘energy sensing’ kinase, AMPK activation

occurs in an intensity-dependent manner and has been shown to increase with increasing

contraction force, treadmill speed and cycling power (Rasmussen and Winder 1997; Ihlemann

et al. 1999; Musi et al. 2001; Chen et al. 2003; Wadley et al. 2006). While acute low intensity

in vitro contraction has been shown to activate AMPK α1 but not α2 isoforms (Toyoda et al.

2006), sub-maximal aerobic exercise in vivo appears to primarily increase AMPK α2 activity

(Fujii et al. 2000; Wojtaszewski et al. 2000; Durante et al. 2002; Stephens et al. 2002; Yu et

al. 2003). Indeed, endurance exercise-induced activation of AMPK is predictable given its

ability to increase ATP regeneration via fat oxidation to meet the demands of prolonged low-

intensity contraction. Interestingly, this exercise response seems to be dependent on the

adaptive state of the muscle as evidence exists to demonstrate that short-term and chronic

20
aerobic training reduces the acute AMPK response to prolonged and intermittent sub-maximal

exercise (Durante et al. 2002; Yu et al. 2003; Hurst et al. 2005; McConell et al. 2005).

However, the AMPK response in endurance trained athletes may be conserved with adequate

overload as high-intensity interval training (~90% VO2max) has been shown to increase AMPK

α1 and α2 in highly trained cyclists (Clark et al. 2004). Furthermore, AMPK α1/α2 isoform

activity and ACC phosphorylation is also significantly up-regulated following short duration

(~30 s) supra-maximal sprint cycling, likely due to the extensive and rapid reduction in

cellular ATP (Chen et al. 2000).

Few studies investigating AMPK signalling have incorporated resistance training as a

stimulus. Hence our knowledge of AMPK signalling following this mode of contractile

activity is limited. Work by Wojtaszewski and colleagues (2005) utilised six wk of

progressive overload resistance training at 50-80% of one repetition maximum (1-RM) in

healthy and diabetic subjects. Their data reveal a significant increase in the protein expression

of AMPK α1, β2 and γ1, but not α2 isoforms independent of the subject’s health status.

Interestingly, Dreyer et al. (2006) report an increase in AMPK activity after an acute bout of

resistance training in humans, yet they observed increased α2 but not α1 activity. Koopman

and co-workers (2006) also observed increased AMPK phosphorylation following an acute

bout of resistance training, although it should be noted that the training load in that study (16

sets x 10 reps, 2 min recovery) would likely induce a high metabolic stress typically

associated with endurance training. Resistance exercise-induced changes in AMPK

phosphorylation may reflect an increase in insulin-independent cellular glucose uptake and

transport. However, the physiological significance of increased AMPK following resistance

training has yet to be determined.

Information on differences in AMPK responses between endurance and resistance

training has not been extensively investigated. However, intricate work by Atherton and co-

workers (2005) indicates mode-specific AMPK activation with acute bouts of “endurance-

21
like” and “resistance-like” contraction. Using electrical stimulation to mimic endurance or

resistance loading, these workers show increased AMPK phosphorylation immediately and 3

h post-exercise following “endurance-like” but not “resistance-like” contraction in slow-

twitch soleus and fast-twitch extensor digitorum longus muscle. Therefore, given the

dissimilar functional adaptive outcomes with chronic endurance versus resistance training the

possibility exists that AMPK signalling is a key intermediate for the divergent adaptation with

these different exercise modes.

Ca2+ calmodulin-dependent kinase (CaMK) / Calcineurin Signalling

Contraction-stimulated alterations of intra-cellular [Ca2+] induce both direct and hierarchical

signalling responses in skeletal muscle (Chin 2005; Koulmann and Bigard 2006).

Specifically, calmodulin (CaM) is an intermediate binding protein sensitive to increases in

[Ca2+] and acts as a calcium sensing unit that transduces Ca2+ flux (>30 Hz) via

conformational changes in its protein motifs before subsequently activating downstream

kinases and phosphatases (Chin 2005). Calcineurin is a Ca2+ / calmodulin-dependent

phosphatase that acts as a molecular translator of Ca2+ flux activated by a sustained, low

amplitude signal (~10 Hz) (Olson and Williams 2000; Michel et al. 2004).

The Ca2+-calmodulin-dependent serine / threonine kinases (CaMK) detect and respond

to physiologically relevant [Ca2+] and incorporates a group of single and multi-functional

kinases (Chin 2005). The specific kinases from the CaMK family found in skeletal muscle are

not well defined but existing evidence indicates that CaMKII and IV are expressed in skeletal

muscle (Wu et al. 2002; Rose and Hargreaves 2003). CaMKII and IV have been linked with

activation of gene expression of contractile and mitochondrial proteins, respectively (Fluck et

al. 2000; Wu et al. 2002). CaMKII activity has been shown to increase with stretch overload

and wheel running animal models (Fluck et al. 2000) and with cycling exercise in humans

(Rose and Hargreaves 2003). Indeed, it appears CaMKII is the predominant multifunctional

22
CaMK in response to endurance exercise and is rapidly up-regulated after commencing

exercise in an intensity-dependent manner (Rose et al. 2006). While transgenic animals

selectively expressing CaMKIV appear to enhance mitochondrial biogenesis following

electrical stimulation (Wu et al. 2002), these findings are contentious as other investigators

have failed to detect CaMKIV protein in skeletal muscle (Rose and Hargreaves 2003;

Akimoto et al. 2004).

Ca2+
Ca2+
Ca2+ Ca2+
Ca2+ Cytoplasm

Ca2+

P NFAT

CaN CaMK

NFAT HDAC P

Nucleus
HDAC

NFAT MEF2 GATA mRNA Transcription

Figure 1.6 Proposed mechanisms for calcium-dependent increases in gene expression with

skeletal muscle contractile activity. Bars denote inhibition and arrows denote activation. Ca2+,

calcium; CaN, calcineurin; CaMK, calmodulin kinase; HDAC, histone deacetylase; MEF2,

myocyte enhancer factor 2; NFAT, nuclear factor of activated T-cells (adapted from Liu et al.

2005).

Conclusive mechanistic data linking the effect of CaMK activation to cellular

adaptation is currently lacking but downstream effects may be mediated, at least in part,

through histone deacetylase nuclear extrusion via calcium signalling (Figure 1.6; Chin 2005;

23
Liu et al. 2005). Prolonged, low-amplitude intra-cellular calcium transients increase

calcineurin activity that dephosphorylates and activates transcriptional promoters to up-

regulate gene expression (Michel et al. 2004; Koulmann and Bigard 2006). The principle

substrate targets of calcineurin include the nuclear factor of activated T cells (NFAT) and

myocyte enhancer factor 2 (MEF2) families of transcription factors (Liu et al. 2005).

Calcineurin has been implicated in several adaptive responses inducing muscle fibre growth /

regeneration and slow fibre-type gene expression (Dunn et al. 1999; Musaro et al. 1999; Naya

et al. 2000; Sakuma et al. 2003). Calcineurin appears to act as a co-regulator of muscle

hypertrophy with insulin-like growth factor and may also contribute to myogenic proliferation

and differentiation of satellite cells during skeletal muscle regeneration (Dunn et al. 1999;

Musaro et al. 1999; Dunn et al. 2000; Sakuma et al. 2003; Scicchitano et al. 2005). The use of

calcium / calmodulin inhibitors has been shown to suppress growth of overloaded muscle

fibres while calcineurin over expression reduces disuse atrophy (Dunn et al. 1999; Dunn et al.

2000). In addition, research suggests calcineurin is also involved in fibre-type plasticity and

fast-to-slow phenotype transformation (Naya et al. 2000; Michel et al. 2004; Parsons et al.

2004; Talmadge et al. 2004). Indeed, it has been proposed that calcineurin-induced gene

expression of slow fibre and oxidative genes may result in the acquisition of a more

metabolically efficient phenotype (Chin et al. 1998; Wu et al. 2000a; Michel et al. 2004).

Such diverse calcineurin regulated adaptive pathways appear paradoxical (i.e. hypertrophy

versus oxidative phenotype) but may represent alternating adaptation responses that are

specific to the intensity and duration of contractile activity.

While research investigating Ca2+-calmodulin-calcineurin-dependent signalling has

provided mechanistic insight into the role of this pathway in skeletal muscle, it should be

noted our current understanding appears to be limited to cell culture and transgenic animal

models. Importantly, few works have investigated the role of Ca2+-dependent signalling in

24
humans, and the effect of exercise on calmodulin-calcineurin pathways remains to be

established.

Insulin / Insulin-like Growth Factor (IGF) Signalling Pathway

The insulin / IGF signalling pathway incorporates many of the molecular components critical

to our current understanding of muscle proteolysis and regulation of hypertrophy and atrophy

processes (Glass 2003; Heszele and Price 2004; Sartorelli and Fulco 2004; Glass 2005;

Taniguchi et al. 2006). Moreover, many of these components have additional roles for the

regulation of glucose uptake, glycogen synthesis, and cell growth and differentiation

(Taniguchi et al. 2006). The expression and importance of IGF-1 in skeletal muscle has been

demonstrated in a variety of models from cell culture to human in vivo (DeVol et al. 1990;

Vandenburgh et al. 1991; Adams and McCue 1998; Musaro et al. 1999; Chakravarthy et al.

2000b; Rommel et al. 2001; Dehoux et al. 2004; Stitt et al. 2004; Latres et al. 2005).

Contractile activity in skeletal muscle stimulates the secretion of IGF-1 which acts as

an autocrine / paracrine growth factor, binding to its membrane receptor and initiating a

cascade of molecular events (Figure 1.7; Glass 2003). IGF-1 binding to the receptor tyrosine

kinase phosphorylates the insulin receptor substrate-1 (IRS-1) which subsequently activates

phosphatidylinositol-3-OH kinase (PI3K; Backer et al. 1992). PI3K catalyses phosphate

transfer (phosphatidylinositol-4, 5 biphosphate [PIP2] / -3, 4, 5 triphosphate [PIP3]) which

ultimately recruits additional kinases, protein kinase B / AKT and PDK1 (3’

phosphoinositide-dependent protein kinase 1) to the cell membrane (Stephens et al. 1998;

Wick et al. 2000). AKT may be negatively regulated via PIP3 dephosphorylation by lipid-

binding phosphatase and tensin homologue (PTEN) and SH2-containing inositol 5’-

phosphatase-2 (SHIP2; Sleeman et al. 2005; Tang et al. 2005). Nevertheless, when activated

AKT phosphorylates multiple substrates mediating important aspects of carbohydrate

metabolism as well as protein synthesis and degradation.

25
 IGFR IGFR

IGF-1

PIP2 PIP3
PI3K
IRS1
AKT PDK-1

Raptor
GSK3ß 4EBP1 mTOR FOXO

eIF2B eIF4E p70S6K

Protein Synthesis Protein Degradation

Figure 1.7 Simplified IGF-1 signalling pathway from receptor binding to protein synthesis.

Dashed arrows designate that phosphorylation activates the substrate and bars denote

inhibition, whereas grey arrows denote phosphorylation events that result in inactivation of

the substrate. IGFR, insulin-like growth factor receptor; IGF-1, insulin-like growth factor-1;

IRS1, insulin receptor substrate 1; PIP2/3, phosphatidylinositol-4, 5 biphosphate / -3, 4, 5

triphosphate; PI3K, phosphatidylinositol-3-OH kinase; PDK1, 3’ phosphoinositide-dependent

protein kinase 1; FoxO, forkhead box O; mTOR; mammalian target of rapamycin; GSK3β,

glycogen synthase kinase 3β; 4EBP1, eukaryotic initiation factor 4E-binding protein;

eIF2B/4E eukaryotic initiation factor 2B/4E; p70S6K, p70 ribosomal S6 kinase (adapted from

Sartorelli and Fulco 2004).

AKT / Protein Kinase B

There are three isoforms of the serine / threonine AKT family, two of which (AKT1 and 2)

are primarily expressed in skeletal muscle (Glass 2003; Nader 2005). Furthermore, the

26
different AKT isoforms appear to have distinct functions: AKT1 has been associated with

muscle hypertrophy whereas AKT2 has been implicated in signalling to glucose transport

(Taniguchi et al. 2006). Following translocation to the cell membrane AKT is phosphorylated

by PDK1 at threonine308 but requires secondary phosphorylation at serine473 for full

activation, a role for which the mammalian target of rapamycin-rictor (mTOR-rictor) complex

has recently been implicated (Sarbassov et al. 2005b; Taniguchi et al. 2006). Of late, a PH

domain leucine-rich repeat protein phosphatase (PHLPP) has been shown to dephosphorylate

AKTser473 and suppress growth in cancer cells but this down-regulation of AKT has yet to be

confirmed in skeletal muscle (Gao et al. 2005).

Contraction

Insulin
IGF-1

AKT
Protein Synthesis Protein Degradation

Cell Growth Glucose Transport

Figure 1.8 Proposed adaptive events associated with activation of AKT in skeletal muscle.

IGF-1, insulin-like growth factor-1.

AKT has numerous molecular targets commensurate with its varied physiological

functions including those involved in protein synthesis (mTOR, tuberous sclerosis complex 2

[TSC2], glycogen synthase kinase 3 [GSK3]), atrophy (forkhead box O1 [FoxO1]), and

glucose uptake (AKT substrate of 160 kDa [AS160]) (Figure 1.8; Bodine et al. 2001b;

Rommel et al. 2001; Inoki et al. 2002; Stitt et al. 2004; Bruss et al. 2005; Cai et al. 2006).

27
While mTOR is considered a down-stream target of AKT via phosphorylation at serine2448

(Nave et al. 1999; Bodine et al. 2001b), evidence is emerging that mTOR also phosphorylates

AKT when bound to its associated protein rictor suggesting mutual activation under certain

conditions (Hresko and Mueckler 2005; Sarbassov et al. 2005b; Sarbassov et al. 2006).

Regardless, there is strong evidence the PI3K-AKT-mTOR pathway mediates hypertrophy in

skeletal muscle via activation of translation initiation and increased ribosomal protein content

(Bodine et al. 2001b; Rommel et al. 2001; Lai et al. 2004; Nader et al. 2005). In addition,

AKT regulation of AMPK activity and direct phosphorylation of TSC2 and GSK3β may

suppress their role as inhibitors of protein synthesis (Rommel et al. 2001; Inoki et al. 2002;

Hahn-Windgassen et al. 2005; Cai et al. 2006). AMPK phosphorylates TSC2 which

subsequently inhibits the hypertrophic actions of mTOR, while GSK3β prevents activation of

eukaryotic initiation factor (eIF) 2B (Tee et al. 2002; Vyas et al. 2002; Garami et al. 2003;

Hahn-Windgassen et al. 2005). Thus, in addition to mTORser2448 phosphorylation, AKT may

also indirectly enhance translation initiation and protein synthesis through inhibition of

AMPK-TSC2 and GSKβ. Similarly, phosphorylation of the nuclear transcription factor FoxO

by PI3K-AKT has been shown to sequester FoxO from the nucleus to the cytosol preventing

transcription initiation of atrophy genes responsible for degradation of contractile protein,

thereby mediating a protective effect on skeletal muscle by down-regulating pathways of

protein degradation (Rena et al. 2002; Stitt et al. 2004; Latres et al. 2005).

There is conflicting data regarding AKT responses to contractile activity in skeletal

muscle (Table 1.1). A variety of electrical stimulation and surgical ablation protocols have

been shown to increase AKT phosphorylation in both red and white rodent skeletal muscle

(Turinsky and Damrau-Abney 1999; Nader and Esser 2001; Sakamoto et al. 2002; Atherton et

al. 2005; Bruss et al. 2005; Thomson and Gordon 2006).

28
Table 1.1 Summary of research investigating AKT responses to contractile overload in skeletal muscle.

Author Species Stimulus Results

Thomson & Gordon (2006)
Atherton et al. (2005)
Bruss et al. (2005)
Parkington et al. (2003)
Sakamoto et al. (2002)
Bodine et al. (2001)
Nader/Esser (2001)
Turinsky/Damrau-Abney (1999)
Sherwood et al (1999)
Lund et al. (1998)
Brozinick/Birnbaum (1998)
P, phosphorylation; A, activity; T, total protein; ES, electrical stimulation; HF, high-frequency; LF, low-frequency.
Rat One wk surgical ablation P + T - >100% increase
Rat 1) HFES – 10 x 6 @ 3 s contractions 2) LFES 3 h P – 1) HFES = 8-fold increase 2) LFES = no change
Rat In vitro epitrochlearis contractions (5 min) P – 150% increase
Rat HFES – 10 x 10, 3 s contractions P + T - no change
Rat In situ contractions (1, 2.5, 5, 15, 30 min) P – increased in all muscle types (range 1.6-13-fold)
Rat Surgical ablation (7, 14 & 30 d) T – increased 4-fold @ 14 d P – 9-fold @ 14 d
Rat 1) HFES – 10 x 6 @ 3 s contractions 2) LFES 30 min P – increase 1) HFES= 38% 2) LFES= 40%
3) Treadmill – 30 min @ 83% VO2max 3) Run = no change
Rat ES of the calf muscle (1 contraction/s 5, 15, 25 min) AKT 1-A – 3-fold increase, AKT 2 + 3-A – no effect
Rat ES of the sciatic nerve (2, 5, 10, 15, 30, 60 min) A – no change
Rat In vitro contractions of soleus (5 min) A – no change
Rat ES of epitrochlearis/soleus A – no significant increase

29
Table 1.2 Summary of research investigating AKT responses to exercise in skeletal muscle.

Author Species Stimulus Results

Dreyer et al. (2006) Human Resistance 10 x 10 leg extensions @ 70% 1RM P – 100% increase
Eliasson (2006) Human Resistance 1) 4 x 6 ECC 2) 4 x 6 CON P – no change
Wilson et al. (2006) Human Cycle 60 min @ ~70% VO2max P – 50% increase
Creer et al. (2005) Human Resistance – 3 x 10 @ 70% 1RM P – 1.5-fold increase
Sakamoto et al. (2004) Human Cycle 1) 30 min @ 75% VO2max 2) 6 x 60 s @ 125% A – increase 1) 75% VO2max = 40% 2) 125% VO2max
VO2max = 110%
Thorell et al. (1999) Human Cycle – 60 min @ 70% VO2max P – 180% increase
Widegren et al. (1998) Human Cycle – 60 min one-leg @ 70% VO2max A – no change
Williamson et al. (2006) Rat Treadmill – 10% grade 26/m/min for 10, 20, 30 min P – no change
Reynolds et al. (2004) Rat Voluntary wheel running (3 months) P + T – 45-50% increase
Krisan et al. (2004) Rat Resistance – 3 x 10 @ 75% 1RM 3/wk (12 wk) A + T – no change
Bolster et al. (2003) Rat Resistance – 1 x 50 each day for 4 d P –~200% increase
Sakamoto et al. (2003) Rat Treadmill 1) 60 min @ 20m/min+12% grade 2) A – increase 1) 60 min= 80% - 150%
16m/min, grade increased 1% every 2 min to fatigue 2) Fatigue= 150% - 150%
Markuns et al. (1999) Rat Treadmill – 5, 10, 30, 60 min @ 25m/min (10% gde) A + P = no change
Wojtaszewski et al (1999) Mice Treadmill – 60 min @ 22m/min (10%) P – no effect
(MIRKO)
P, phosphorylation; A, activity; T, total protein; RM, repetition maximum; VO2max, maximum oxygen consumption; ECC, eccentric; CON, concentric.

30
Equally, a number of studies have also observed no change in phosphorylation of AKT

following electrical stimulation (Brozinick Jr. and Birnbaum 1998; Lund et al. 1998;

Sherwood et al. 1999; Parkington et al. 2003). Moreover, in vivo contraction after running and

resistance training in rodents has also produced conflicting findings where AKT has been

reported to increase (Bolster et al. 2003b; Sakamoto et al. 2003; Reynolds et al. 2004) or

remain unchanged (Markuns et al. 1999; Nader and Esser 2001; Krisan et al. 2004; Eliasson et

al. 2006; Williamson et al. 2006b) in response to exercise (Table 1.2). Notably, Bolster et al.

(2003b) examined the time-course of AKT response to resistance exercise and observed peak

AKT phosphorylation 5-15 min following a bout of resistance training. Conversely, Dreyer

and colleagues (2006) observed an increase in AKT phosphorylation 60 min after an acute

bout of resistance training in humans. Differences in the contractile stimulus, timing of

muscle tissue collection and isoform specific response may have contributed to the diverse

and conflicting findings.

Work by Wilson et al. (2006), Sakamoto and colleagues (2004) and Thorell and co-

workers (1999) has shown that moderate duration (30- 60 min) low- (~70% VO2max) and high-

intensity (~125% VO2max) cycling exercise is sufficient to increase AKT phosphorylation in

humans. Similarly, Creer et al. (2005) observed a significant increase in AKT

phosphorylation 10 min after a bout of moderate-intensity resistance training. In contrast,

Widegren and co-workers (1998) found no change in AKT activity 15 min post-exercise after

60 min cycling at 70% VO2max. These conflicting results bring into question the specific role

and functions of AKT in contraction-mediated training responses. However, differences in

species, experimental design, fibre-type, substrate availability, and mode and intensity /

duration of contractile activity may partly explain some of these discordant findings.

While strong evidence exists for AKT as a critical regulator of adaptation in skeletal

muscle, defining and validating its role with in vivo exercise models remains elusive. Heavy

resistance training increases muscle tension and hypertrophy while endurance training

31
increases substrate turnover and utilisation. Therefore, the increase in AKT observed with

diverse exercise modes described previously may be expected considering AKT’s putative

regulation of protein synthesis and glucose transport, respectively. Indeed, AKT appears to be

a primary signalling mediator of training-specific adaptation to both endurance and resistance

training in skeletal muscle.

Mammalian target of rapamycin (mTOR)

Protein complexes involving mTOR (also known as FKBP12 rapamycin-associated protein,

FRAP) are capable of sensing diverse signals and produce a multitude of responses including

mRNA translation, ribosomal biogenesis and nutrient metabolism (Sarbassov et al. 2005a).

Two mTOR protein complexes exist where mTOR binds with a G-beta-L protein (GβL) and

either a rapamycin-sensitive raptor or a rictor protein (Figure 1.9; Kim et al. 2003; Sarbassov

et al. 2005b; Sarbassov et al. 2006). Work utilising rapamycin to manipulate mTOR activity

indicates the mTOR-GβL-raptor complex is a positive regulator of cell growth while mTOR-

GβL-rictor appears to have a key role in AKT activation and actin cytoskeleton regulation

(Takano et al. 2001; Sarbassov et al. 2004; Park et al. 2005; Wang et al. 2005; Sarbassov et al.

2006).

Due to mTOR-rictor mediated activation of AKT it appears mTOR bound with rictor

acts upstream and therefore is involved in regulating mTOR-raptor. In addition to AKT,

upstream regulators of mTOR-raptor include the Ras homologue enriched in brain (Rheb) G

protein (Manning and Cantley 2003). Rheb is in turn regulated upstream by the TSC1/2

complex and has been shown to regulate mTOR signalling and its subsequent downstream

targets by an unknown mechanism (Tee et al. 2002; Garami et al. 2003). Primary downstream

targets of mTOR-raptor include p70 ribosomal S6 kinase (p70 S6K), eukaryotic initiation

factor 4E-binding protein (4E-BP1) and eukaryotic initiation factor 4B (eIF4B) which links

mTOR with mRNA translation and increased protein synthesis and cell size (Bodine et al.

2001b; Raught et al. 2004; Ali and Sabatini 2005; Ohanna et al. 2005; Ruvinsky and Meyuhas

32
2006). However, the mechanisms of mTOR-raptor activity in adaptation processes are not

known and roles for additional kinases in this process cannot be ruled out (Sarbassov et al.

2005a). Nevertheless, altered mTOR activity has been observed in response to nutrients,

mechanical stimuli and contraction in skeletal muscle (Hornberger et al. 2004; Parkington et

al. 2004; Vary and Lynch 2006).

AMPK AKT

TSC2

Rheb

mTOR
Amino Acids
GßL

Rapamycin mTOR mTOR

GßL Raptor GßL Rictor

S6K, 4E-BP1

Figure 1.9 Model of the regulation and functions of the mammalian target of rapamycin

(mTOR) complex. Bars denote inhibition and arrows denote activation. AMPK, adenosine

monophosphate kinase; TSC2, tuberous sclerosis complex 2; Rheb, Ras homologue enriched

in brain; GβL, G beta L protein; 4E-BP1, eukaryotic initiation factor 4E-binding protein;

S6K, ribosomal S6 kinase; (adapted from Sabassov 2005).

Overloaded plantaris following surgical ablation has been shown to increase mTOR

phosphorylation and total protein in both young and aged rodent skeletal muscle (Reynolds et

33
al. 2002; Thomson and Gordon 2006). Work by Parkington and colleagues (Parkington et al.

2003; Parkington et al. 2004) and Atherton and co-workers (2005) has used intermittent high-

frequency electrical stimulation and induced significant increases in mTOR phosphorylation

in a number of different muscle groups. Conversely, no change in mTOR phosphorylation

was seen following sustained low-frequency electrical stimulation, suggesting a tension-

specific contractile response (Atherton et al. 2005). However, these contractile stimuli may

not represent physiological loading as voluntary wheel running and resistance training in

rodents have been shown to increase mTOR phosphorylation (Bolster et al. 2003b; Reynolds

et al. 2004).

It is difficult to reconcile an increase in mTOR activity following an endurance

exercise stimulus such as voluntary wheel running, although emerging evidence suggests that

mTOR may be involved in regulating mitochondrial function (Schieke et al. 2006). However,

the reported changes in aged rodents following chronic (3 months) wheel running were

increased total mTOR protein content but not mTOR activity (Reynolds et al. 2004).

Accordingly, the elevated total mTOR protein in aged rodent muscle relative to sedentary

control may be the result of exercise-induced maintenance of muscle mass with aging rather

than stimulating translation initiation and protein synthesis. In contrast, increased mTOR

activation following resistance training seems plausible given its proposed role in protein

synthesis in response to a hypertrophy stimulus (Bolster et al. 2003b). Few studies have

investigated the activation of mTOR in skeletal muscle of humans in vivo. Recently, Dreyer

and co-workers (2006) have shown an increase in mTOR phosphorylation up to 2 h after

resistance exercise in humans, providing strong evidence for the role of mTOR in anabolic

processes following resistance training. Indeed, mTOR appears to be a primary regulator of

protein synthesis in response to resistance training that may also be modulated by physical

activity with aging.

34
p70 S6K, 4E-BP1& eIF2B

The most well-defined effectors of the PI3K-AKT-mTOR signalling pathway are the proteins

implicated in translational control: ribosomal protein S6 kinase (S6K), eukaryotic initiation

factor 4E-binding protein (4E-BP1) and eukaryotic initiation factor 2B (eIF2B; Bolster et al.

2003a; Ruvinsky and Meyuhas 2006). Mammalian cells express two S6K isoforms (S6K1 and

2) and S6K1 subsequently has duel cytosolic (p70 S6K) and nuclear (p85 S6K) isoforms

(Ruvinsky & Meyuhas 2006). S6K appears to function downstream of mTOR-raptor and

rodent knockout models have revealed that of the two isoforms, S6K1 predominantly

regulates cell size in skeletal muscle (Shima et al. 1998; Ohanna et al. 2005). mTOR-raptor

also regulates and suppresses 4E-BP1 (also known as phosphorylated heat and acid soluble

protein stimulated by insulin, PHAS-1) via hyper-phosphorylation to derepress 4E-BP1

inhibition of translation initiation cap binding protein eIF4E (Richter and Sonenberg 2005;

Sarbassov et al. 2005a). Alternately, GSK3 regulates eIF2B and inhibits its actions which

initiate ribosomal translation (Pavitt 2005). GSK3 is a phosphorylation target of AKT, which

inhibits its negative effect on eIF2B thereby increasing translation and protein synthesis, and

is therefore controlled to a large extent via insulin / IGF signalling (Welsh et al. 1997;

Jefferson et al. 1999).

S6K exerts its effect through multiple substrate targets and has been implicated in

orchestrating the regulation of numerous cellular functions (Figure 1.10; Ruvinsky and

Meyuhas 2006). Numerous studies provide compelling support for the fundamental role of

p70 S6K in skeletal muscle hypertrophy (Baar and Esser 1999; Bodine et al. 2001b; Nader

and Esser 2001; Karlsson et al. 2004; Lai et al. 2004; Atherton et al. 2005). Early work by

Baar and Esser (1999) established a strong association between increased p70 S6K activity

and skeletal muscle hypertrophy following 6 wk of high-frequency electrical stimulation.

Subsequently, work from Bodine and co-workers (2001b) used surgical ablation and

pharmacological intervention to highlight the important role for p70 S6K in skeletal muscle

35
hypertrophy processes. Further studies reveal that the exercise-induced p70 S6K response

occurs with a resistance training-like stimulus and that endurance exercise does not up-

regulate p70 S6K activity (Nader and Esser 2001; Atherton et al. 2005; Kubica et al. 2005).

Indeed, recent work showing increased p70 S6K phosphorylation with stretch activated

mechanotransduction in skeletal muscle suggests that eccentric loading may be critical for

S6K1 activation and therefore hypertrophy (Hornberger et al. 2005a; Hornberger et al. 2005b;

Spangenburg and McBride 2006).

S6K

IRS-1 mTOR rpS6 eIF4B eEF2K

eEF2

Insulin Glucose Protein

Cell size
sensitivity homeostasis synthesis

Figure 1.10 Putative downstream targets and functions of ribosomal protein S6K. Bars denote

inhibition, arrows denote activation, and dashed lines indicate a putative effect. IRS-1, insulin

receptor substrate-1; mTOR; mammalian target of rapamycin; eIF4B, eukaryotic initiation

factor 4B; S6K, ribosomal protein S6 kinase; rpS6, ribosomal protein S6; eEF2, eukaryotic

elongation factor 2; eEF2K, eukaryotic elongation factor 2 kinase. (adapted from Ruvinsky

and Meyuhas 2006).

36
 Studies performed on humans support the results of investigations undertaken in

rodents in which up-regulation of S6K1 and p70 S6K has been observed following an acute

bout of resistance training (Karlsson et al. 2004; Eliasson et al. 2006; Koopman et al. 2006).

The chronic regulation of hypertrophy and other cell processes by S6K1 is less clear

considering its possible reciprocal effects on protein synthesis and negative feedback to PI3K-

AKT-mTOR signalling through IRS-1 phosphorylation (Ruvinsky and Meyuhas 2006).

Given the well-documented co-regulation by mTOR-raptor, it is not surprising that

4E-BP1 phosphorylation in skeletal muscle emulates that of S6K1 to a large extent. Studies

utilising surgical ablation and high-frequency electrical stimulation consistently show an

increase in 4E-BP1 phosphorylation in skeletal muscle in rodents (Bodine et al. 2001b;

Atherton et al. 2005; Funai et al. 2006; Thomson and Gordon 2006). Furthermore, as

translation initiation cap binding is prevented when dephosphorylated 4E-BP1 is bound to

eukaryotic initiation factor (eIF) 4E, skeletal muscle overload has also been shown to produce

a decrease in 4E-BP1-eIF4E binding and subsequent increases in eIF4E-eIF4G association

(Bodine et al. 2001b; Kubica et al. 2005). Significant increases in phosphorylation of 4E-BP1

have also been observed following several resistance exercise models (Bolster et al. 2003a;

Kubica et al. 2005). Conversely, an endurance-like stimulus has been shown to decrease 4E-

BP1 phosphorylation indicating a negative effect of endurance training on translational

machinery and protein synthesis (Atherton et al. 2005). Interestingly, Koopman and

colleagues (2006) recently observed reduced 4E-BP1 phosphorylation immediately and 2 h

after an acute bout of resistance training. However, these authors incorporated an atypical

resistance training protocol including a high number of contractions with short recovery

periods generating elevated metabolic stress and AMPK activity. This training stimulus could

reduce activation of pathways involved in protein synthesis in a manner similar to endurance

training.

37
 Contraction-induced eIF2B activity is predominantly controlled by AKT-GSK3β and

represents a rate limiting step for translation initiation (Welsh et al. 1997; Jefferson et al.

1999; Pavitt 2005). Moreover, evidence exists that eIF2B may also be regulated in an mTOR

dependent manner (Kubica et al. 2005). Nevertheless, of the multiple eIF2B subunits the

epsilon subunit may represent a principal site for activation with contraction (Kubica et al.

2005). Contractile activity has been shown to reduce GSK3β phosphorylation of eIF2B

thereby relieving inhibition and increasing translation (Farrell et al. 2000; Kostyak et al. 2001;

Vary et al. 2002). In response to resistance exercise significant dephosphorylation of eIF2B

enhancing its availability for translation initiation and increases in eIF2B total protein and

mRNA levels have been shown (Farrell et al. 2000; Kostyak et al. 2001; Kubica et al. 2004;

Kubica et al. 2005). The effect of endurance training on eIF2B is unclear although in view of

its regulation of glycogen metabolism, GSK3 activity would be expected to increase with

endurance exercise but may be repressed during recovery with carbohydrate feeding. Indeed,

Atherton and colleagues (Atherton et al. 2005) employed endurance–like contractile activity

in rodent skeletal muscle and observed a significant increase in GSK3β and eIF2B

(deactivation) phosphorylation immediately and following 3 h recovery, respectively.

However, eIF2B responses to resistance or endurance exercise have not been investigated in

human skeletal muscle.

Taken together, these findings provide strong evidence for the resistance training-

induced increase in protein synthesis via IGF signalling, but may also include other currently

unknown kinases acting directly on mTOR-raptor or its downstream kinases. In addition,

endurance training appears to have a significant negative effect on the translational

machinery.

38
Cytokine Signalling

Cytokines function as inter-cellular signalling molecules and act as facilitators of receptor

subunit assembly to induce an intra-cellular signal (Cannon and St. Pierre 1998). Cytokines

are small polypeptides released at the site of inflammation in response to numerous factors

including cachexia, sepsis, and exercise-induced muscle damage (Cannon and St. Pierre 1998;

Jackman and Kandarian 2004; Glass 2005; Petersen and Pedersen 2005). Several cytokines

have been implicated in initiating protein degradation and suppression of protein synthesis

following injury in skeletal muscle, most notably tumor necrosis factor alpha (Garcia-

Martinez et al. 1993; Glass 2005; Williamson et al. 2005).

Tumor Necrosis Factor Alpha (TNFα)

Elevated TNFα concentration generates an increase in the activity of ubiquitin-conjugated

protein degradation and inhibition of insulin / IGF mediated protein synthesis (Garcia-

Martinez et al. 1993; Garcia-Martinez et al. 1994; Fernandez-Celemin et al. 2002; Plomgaard

et al. 2005; Williamson et al. 2005; Lang et al. 2006). Furthermore, TNFα has also been

shown to negatively affect anabolic processes by destabilising myogenic differentiation and

altering transcriptional activity (Langen et al. 2004; Vashisht Gopal et al. 2006). Suppression

of the insulin / IGF signalling pathway by TNFα has been shown to induce insulin resistance

via impaired phosphorylation of IRS-1 and the AKT substrate AS160 kDa (del Aguila et al.

1999; de Alvaro et al. 2004; Plomgaard et al. 2005), and suppress protein synthesis through a

decrease in IGF-1 and IGF-binding protein gene expression, subsequently inhibiting

elongation initiation and mRNA translational efficiency in skeletal muscle (Lang et al. 2002;

Williamson et al. 2005; Lang et al. 2006). Early studies using intravenous administration of

TNFα revealed a significant time-dependent increase in free ubiquitin and ubiquitin gene

expression highlighting the role of TNFα with regard to elevated muscle proteolysis (Garcia-

Martinez et al. 1993; Garcia-Martinez et al. 1994). This effect has subsequently been linked to

downstream intermediates stimulating ubiquitin ligase gene expression and therefore muscle
39
atrophy (Fernandez-Celemin et al. 2002; Li et al. 2003; Cai et al. 2004; Li et al. 2005; Lang et

al. 2006).

Work by Sriwijitkamol and colleagues (2006) revealed a 40% decrease in TNFα

protein content in subjects following eight wk of cycling, indicating a positive effect of low-

intensity aerobic exercise on low-grade inflammation and metabolic status in skeletal muscle.

Conversely, strenuous exercise, particularly heavy eccentric contractions associated with

resistance training, would be expected to generate an acute increase in local inflammation and

rise in TNFα concentration. Indeed, there is a significant increase in circulating systemic

TNFα after muscle damaging eccentric resistance training and marathon running (Ostrowski

et al. 1999; Del Aguila et al. 2000). Similarly, Hamada and colleagues (2004) observed an

increase in TNFα mRNA abundance 3 d after a 45 min bout of downhill running in muscle

samples of healthy subjects, indicative of an acute inflammatory response associated with

exercise-induced muscle damage. Thus, it appears that exercise is capable of generating pro-

and anti-inflammatory effects on skeletal muscle in an intensity- and mode-dependent

manner, mediated at least in part via TNFα activation. However, the chronic effects of

repeated bouts of high-intensity exercise and the specific adaptive response with altered

intensity, duration and frequency of contraction and mode of exercise on TNFα activity

remain to be established.

Previous studies have predominantly utilised cell culture, pathological states or

intravenous administration to identify the effect of TNFα. Hence, our knowledge of

contraction-induced changes in TNFα and subsequent alterations within skeletal muscle is

limited. Moreover, most investigations have focused on regulators and effectors of TNFα

signalling, namely inhibitor of NFκB kinase (IKK), nuclear factor kappa enhancer binding

protein (NFκB) and p38 mitogen activated protein kinase.

40
Inhibitor Kappa B Kinase (IKK) & Nuclear Factor Kappa B (NFκB)

The binding of TNFα to its receptor at the cell membrane initiates a cascade of intra-cellular

events. An important component of this cytokine mediated pathway is the activation of a

kinase that inhibits IκB (Chen 2005; Chen et al. 2006). When IκB is bound to the nuclear

transcription factor NFκB, IκB suppresses its role as a promoter of gene expression (Chen

2005; Natoli et al. 2005; Tergaonkar et al. 2005; Bosisio et al. 2006). TNFα signals through

the TNF-receptor-associated factor (TRAF) and transforming growth factor beta activated

kinase 1 (TAK1) proteins to phosphorylate and activate IKK (Chen et al. 2006).

TNFR

TRAF 2/5 TAK1 IKKa IKKß

P
I kB
p50 p65

p50 p65 Cytoplasm

Nucleus

p50 p65 mRNA Transcription

Figure 1.11 Simplified TNFα pathway initiating nuclear transcription. TNFR, tumor necrosis

factor receptor; TRAF2/5, TNF-receptor-associated factor 2/5; TAK1, transforming growth

factor beta activated kinase 1; IκB, inhibitor of nuclear factor kappa enhancer binding protein;

IKKα/β, inhibitor kappa B kinase; P, phosphorylation; p50/65, nuclear factor kappa enhancer

binding protein complex (adapted from Chen 2005 & Chen et al. 2006).

41
 Phosphorylation of IκB by IKK targets it for ubiquitination and subsequent

degradation, releasing the NFκB dimeric complex (p50/p65) to initiate the expression of

genes involved in multiple cell processes including ubiquitin-mediated protein degradation

(Figure 1.11; Alkalay et al. 1995; Chen et al. 1995; Scherer et al. 1995; Tergaonkar et al.

2005). Moreover, while this orthodox regulation of NFκB activity is well-accepted there are

numerous additional putative mechanisms of activation and transcriptional and post-

translational control (Bae et al. 2003; Duran et al. 2003; Schwabe and Sakurai 2005;

Steinbrecher et al. 2005; Kearns et al. 2006). Indeed, NFκB exists as multiple complexes

resulting in altered function and is induced by a diverse array of stimuli with immense

diversity in the effects and consequence of its activation that can both promote and suppress

cell growth and metabolic status (Perkins and Gilmore 2006).

Recently, work by Cai and colleagues (2004) established a mechanistic link between

IKKβ / NFκB and expression of atrophy genes in skeletal muscle confirming the findings of

previous investigations that identified a relationship between NFκB activation and muscle

atrophy in models of disuse and muscular dystrophy (Hunter et al. 2002; Kumar and Boriek

2003). Cai and co-workers (2004) utilised muscle-specific transgenic expression of IKKβ or

an IκB repressor to selectively activate or repress NFκB and skeletal muscle wasting, and the

subsequent gene expression of the atrophy promoting ubiquitin ligase muscle ring finger

protein (MuRF). Additional work in cell culture provides support for the proposed initiation

of ubiquitin-proteasome transcriptional machinery in a NFκB-dependent manner (Wyke and

Tisdale 2005). Collectively, these results indicate that up-regulation of the IKK / NFκB /

MuRF pathway exacerbates atrophy in skeletal muscle.

Given the capacity of contractile activity to induce local and systemic stress /

inflammation and disturb cell homeostasis, exercise represents a stimulus capable of

increasing NFκB activity in skeletal muscle. Yet, contractile activity is also of critical

importance for maintaining cell functions including enhanced protein synthesis and

42
preserving muscle mass. Ex vivo mechanical stretch of diaphragm muscle activates IKK /

NFκB and promotes IκB degradation with an ensuing increase in NFκB / DNA binding

(Kumar and Boriek 2003). Likewise, an acute bout of endurance exercise (60 min, ~75%

VO2max) has been shown to decrease IκB content, and increase IKK and NFκB

phosphorylation in rodent skeletal muscle (Ji et al. 2004; Ho et al. 2005). In contrast, Durham

and colleagues (2004) observed a decrease in NFκB activity following a severe bout of

resistance training in humans and with electrical stimulation in rodents. While the low sample

numbers (four human, five rodent) necessitate that these results are interpreted cautiously, an

explanation for these discordant findings is unclear. Indeed, a vigorous resistance training

session with repeated eccentric contractions would typically be expected to result in muscle

damage, inflammation and muscle remodelling. To date, only one training study has

investigated the effects of exercise on TNFα signalling. In that investigation, 14 subjects

performed 8 wk of sub-maximal cycling (4 x wk, 45 min, 70% VO2peak) and had increased

IκB and reduced TNFα protein content in skeletal muscle, indicating a decrease in IKK /

NFκB signalling (Sriwijitkamol et al. 2006). These findings may be interpreted as a protective

effect of sub-maximal intensity aerobic activity on the inflammatory response, decreasing

local inflammation and cellular disturbance.

Altered transcriptional responses through signal transduction to NFκB with exercise-

induced contraction may be an important process in skeletal muscle adaptation. Acute training

bouts may increase NFκB activity for transient adaptive events such as immune or anti-

apoptotic responses, while chronic training may reduce total NFκB activity and subsequent

protein degradation enabling net protein synthesis. Regardless, due to the innumerable

functional outcomes of NFκB transcriptional control much work remains to fully elucidate the

cause and effect relationship between exercise and NFκB activity.

43
Mitogen Activated Protein Kinase (MAPK) Signalling Pathway

Of all the secondary messenger systems, the mitogen activated protein kinase pathway may be

the most complex, induced by a variety of stimuli and regulating numerous diverse functions

in mammalian cells. The MAPK family is conserved in eukaryotic cells and co-ordinately

regulates activities including gene expression, mitosis, metabolism, survival and apoptosis

(Figure 1.12; Roux and Blenis 2004). Of the five distinct MAPK groups, two have been most

Mitogens Stress/Cytokines

MEK1/2 MEK3/6

ERK1/2 p38

RSK MSK MNK MK

1/2/3/4 1/2 1/2 2/3

Transcription Nuclear Response Transcription Transcription

Proliferation Transcription Translation Translation Stability
LKB1, GSK3ß, Akt, 4E-BP1, eIF4E, eIF4G TNFa, eEF2 kinase
IkBa, NFkB NFkB

Figure 1.12 Proposed pathways of activation and molecular targets of MAPK signalling.

MAPK, mitogen activated protein kinase; MEK, mitogen activated kinase; ERK, extracellular

regulated kinase; RSK, ribosomal S6 kinase; MSK, mitogen and stress activated kinase;

MNK, MAPK-interacting kinase; MK, mitogen protein kinase; GSK, glycogen synthase

kinase; IκB, inhibitor kappa B; NFκB, nuclear factor kappa B; TNFα, tumor necrosis factor

alpha; eEF, eukaryotic elongation factor; eIF, eukaryotic initiation factor; 4E-BP1, eukaryotic

initiation factor 4E-binding protein (adapted from Roux and Blenis 2004).

44
characterised with regard to exercise responses, the extracellular signal-regulated kinases 1

and 2 (ERK1/2) and p38 isoforms α, β, γ, and δ (Sakamoto & Goodyear 2002). ERK1/2

appear to be preferentially activated in response to growth factors while p38 is more

responsive to an assortment of stress stimuli (Roux and Blenis 2004).

Upon activation ERK1/2 and p38 can modulate gene expression and protein synthesis

via phosphorylation of multiple targets including cytosolic proteins and transcription factors,

or translocate directly to the nucleus where they can also regulate transcription factor activity

(Figure 1.12; Sakamoto & Goodyear 2002). Moreover, the capacity of exercise-induced

contractile activity to induce MAPK activation is undeniable yet determining the specificity

of response and the resultant physiological outcome remains elusive (Nielsen et al. 2003a;

Thong et al. 2003; Williamson et al. 2003).

ERK1/2

A relatively large number of studies have investigated the effect of exercise on MAPK

activity in vivo human skeletal muscle (Table 1.3) and increased ERK1/2 activity has been

consistently observed following exercise regardless of intensity, duration, mode of exercise or

subject training status. Interestingly, this response may be attenuated with aging (Williamson

et al. 2003). It has been postulated that ERK1/2 is involved in a “general” response to exercise

that could include up-regulation of non-specific immediate early response genes or signalling

pathways important for increasing global rates of transcription and / or translation (Assoian

2002; Galetic et al. 2003; Atherton et al. 2005; Shahbazian et al. 2006; Williamson et al.

2006b). Despite the common response of ERK1/2 with diverse exercise stimuli it is

reasonable to suggest that ERK1/2 mediates divergent adaptation processes. Moreover, the

role of ERK1/2 in regulating immediate early gene (IEG) responses and the cell cycle

programme has been shown to be dependent on the strength and duration of the signal (Wu et

al. 2000b; Assoian 2002; Murphy et al. 2002; Murphy et al. 2004). Signal duration of ERK1/2

45
Table 1.3 Summary of research investigating MAPK responses to exercise in vivo human skeletal muscle.

Author Stimulus Results

Creer et al. (2005) Resistance 3 x 10 @ 70% 1-RM 1) H-CHO 2) L-CHO ERK-P 1) 120% 2) 120% p90 RSK-P 1) 290% 2) 550%

Richter et al. (2004) Cycle 1) 10 min @ 35, 60, 85% VO2max ERK-A 1) ~100% @ 35% no further increase @ 60/85% 2) ~100%

2) 30 min @ 35% VO2max ERK-P 1) 35%VO2 = ~100%; 60%VO2 = ~220%; 85%VO2 = ~500% 2) ~100%

McGee & Hargreaves (2004) Cycle 60 min @ 70% VO2peak Total p38-P 380% Nuclear p38-P 80%

Chan et al. (2004) Cycle 60 min @ 70% VO2peak 1) Normal 2) L-CHO Nuclear p38-P 1) ~80% 2) ~110%

Karlsson et al. (2004) Resistance 4 x 10 @ 80% 1-RM 1) BCAA 2) water ERK-P – 700% p38-P – 400% (no effect with BCAA)

Nielsen et al. (2003) Cycle 20 min @ 80% VO2peak 1) Sed 2) Trained ERK-A 1) 40% 2) 38% p38-P 1) 1000% 2) 950%

Thompson et al. (2003) 1) 50 eccentric contractions 2) 30 min -10% downhill treadmill ERK-P 1) 200% 2) –53% ERK-T 1) 424% 2) no change

Thong et al. (2003) 60 min 1-leg kicks (alt 5 min @ 75 & 100% PWC) p38-P up 40% compared with rest leg

Williamson et al. (2003) Resistance 3 x 10 (KE) @ 70% 1-RM 1) old 2) young ERK-P 1) –48% 2) 75% p90-P 1) –60% 2) 100% p38-P 1) –17% 2) 18%

Yu et al. (2003) Cycle 8 x 5 min @85% VO2peak 1) Untrained 2) Trained ERK-P 1) 171% 2) 42% p38-P 1) 120% 2) 50%

Yu et al. (2001) Marathon ERK-P 400% p38 400%

Boppart et al. (2000) Marathon p38γ-P 300% p38γ-A 50%

Krook et al. (2000) Cycle 1-leg @ 70% VO2max MSK ½-A 400% & 200% p90 RSK-A 2500% MapKap2-A 330% vs. rest

Widegren et al. (1998) Cycle 1-leg @ 70% VO2max ERK-P 31 fold @ 30 min (75% 30 min response @ 60 min) p38-P 2.2 fold

Aronson et al. (1997) Cycle 60 min @ 70% VO2max ERK-P 4-24 fold

P ,phosphorylation; A, activity; T, total protein; RM, repetition maximum; PWC, peak work capacity; BCAA, branch chain amino acids; H-CHO, high carbohydrate, L-CHO, low

carbohydrate; KE, knee extension.

46
alters the functional activity of gene product and ultimately controls the biological outcome

(Murphy et al. 2002). Indeed, in regulating progression of the myogenic programme ERK1/2

appears to initially interfere with differentiation but later enhances myotube formation (Wu et

al. 2000b). In addition, a high degree of crosstalk may also contribute to regulation of ERK1/2

activity. Notably, AKT has been shown to regulate components of ERK1/2 signalling, fine-

tuning differentiation and proliferation in the cell cycle (Rommel et al. 1999; Moelling et al.

2002; Galetic et al. 2003).

Distinguishing between sustained and transient signal duration and alterations in

signal strength may significantly alter the role of ERK1/2 in subsequent adaptation processes,

particularly in satellite cell activation. Collectively, these factors may represent a mechanism

for the specificity of response with diverse modes of exercise considering the extended

duration of contraction with endurance training versus the greater contraction intensity during

heavy resistance training. Evidence exists for a specific role of ERK1/2 in response to

resistance training, in which ERK1/2 has been implicated as a regulator of hypertrophy in

skeletal muscle. Phosphorylation of TSC2 by ERK1/2 suppresses TSC2 inhibition of mTOR

and downstream mediators of translation initiation (Ma et al. 2005). ERK1/2 also directly

regulates eIF4B phosphorylation via its downstream effector p90 ribosomal protein S6 kinase

(RSK) increasing translation efficiency (Shahbazian et al. 2006). Regardless, due to the

common response of ERK1/2 following endurance and resistance exercise the precise

functions of ERK1/2 have yet to be determined and more work is needed to clearly define the

role of ERK1/2 in specific exercise-induced adaptation.

p38

Activation of p38 MAPK has been observed following both endurance and resistance exercise

in humans (Yu et al. 2001; Karlsson et al. 2004; McGee and Hargreaves 2004). It seems that

p38 is responsible for the regulation of multiple cell processes including myogenic and

mitochondrial gene expression and ubiquitin ligase activity making it difficult to establish a

47
clear role for p38 in the adaptation response to exercise (Akimoto et al. 2005; Li et al. 2005;

Lluis et al. 2006). Previous findings have established an unequivocal role for p38 MAPK in

controlling muscle gene expression in the myogenic process (Wu et al. 2000b; Lluis et al.

2006). This multi-step process that is primarily orchestrated by myogenic regulatory factors is

in large part regulated by p38 which may also act as a molecular switch for the activation of

satellite cells (Suelves et al. 2004; Jones et al. 2005; Lluis et al. 2005). In addition, a study by

Li and colleagues (2005) revealed that p38 was also involved in the regulation of muscle

atrophy, mediating the TNFα-induced gene expression of muscle atrophy F-box protein.

Therefore, p38 may be involved in the regulation of both hypertrophy and atrophy processes

suggesting an important role for p38 in adaptation responses to resistance training. The

complexity of MAPK-mediated signalling in skeletal muscle is highlighted by the notion that

p38 has recently been implicated in mitochondrial biogenesis (Akimoto et al. 2005). Akimoto

and co-workers (2005) initially observed a correlation between the peroxisome proliferator

activated receptor γ co-activator 1α (PGC-1α), a transcription factor that promotes

mitochondrial biogenesis, and p38 MAPK activation. In addition, work in cells and transgenic

mice by these workers revealed PGC-1α and cytochrome oxidase IV (COX IV) protein

expression occurred in response to p38 activation. Furthermore, p38 activity has also been

shown to regulate myocyte enhancer factor 2 (MEF2) dependent genes, including PGC-1α

(Zhao et al. 1999; McGee and Hargreaves 2004). Thus, p38 may promote mitochondrial

biogenesis and therefore may also have a significant role in adaptation following endurance

training. The conundrum of MAPK responses to exercise limits our current understanding of

the potential functions and physiological outcomes that contribute to the specificity of training

adaptation. Indeed, much of our knowledge regarding MAPK responses with exercise rests on

correlation data with little information currently available regarding the mechanisms of

regulation.

48
Summary

It is apparent that multiple secondary messengers and signalling pathways are activated or

repressed in response to an exercise stimulus and that these pathways induce a multi-faceted

adaptation process. While our current understanding of intra-cellular signalling is

incompletely resolved, it is clear that exercise-induced contractile activity generates activation

of common and distinct signalling intermediaries in response to the intensity, duration and

mode of contraction. Ultimately, this complex transduction network produces an increase in

the transcription of particular genes and subsequent gene product to promote phenotypic

adaptation in an exercise specific manner.

1.3 Genetic and Molecular Responses to Exercise

Adaptive events distal to primary and secondary signalling culminate in the synthesis of new

protein containing genetically determined information to carry out specific functions

(Bouchard et al. 1997; Flück and Hoppeler 2003). This molecular process is highly regulated

at numerous sites from DNA copying to the assembly of gene product (Figure 1.13). While

there is a paucity of evidence showing detailed continuity between specific signalling

pathways, gene expression and subsequent protein synthesis, signalling proteins have been

shown to activate numerous immediate early genes, transcription factors and molecular

machinery responsible for promoting the rate of transcription of target gene messenger RNA

(Zhao et al. 1999; Cai et al. 2004; Murphy et al. 2004; Sandri et al. 2004; Simone et al. 2004).

Generally, the directional change of mRNA transcription is the same as the directional change

of the protein generating a new steady state adaptation in the muscle milieu (Booth and

Baldwin 1996). Increased mRNA quantity should translate into greater functional protein

abundance although multiple control mechanisms may alter the end state adaptation.

49
 Gene
DNA
Stage 1

Transcription A

Primary RNA Transcript

Stage 2
RNA Splicing B

mRNA
Stage 3 Nucleus
Cytoplasm
Transport C D
Ribosome
mRNA
Stage 4
E
Polypeptide
Translation
Stage 5

Post-translation Modification F

Functional Protein

Figure 1.13 Five stages of gene expression and sites of regulation (A-F; adapted from

Bouchard, Melina and Perusse 1997).

Moreover, the balance of mRNA synthesis versus degradation, the baseline abundance of

each specific protein, and additional translational control mechanisms all contribute to net

protein synthesis (Flück and Hoppeler 2003). The following sections will highlight important

genetic and molecular adaptation responses with endurance and resistance exercise, and

examine the effect of concurrent endurance and resistance training on the specificity of

adaptation in skeletal muscle.

1.3.1 Endurance Exercise

Endurance training elicits both central and peripheral adaptations, alters neural recruitment

patterns, and causes profound changes in muscle bioenergetics and enhanced morphological,

metabolic substrate and acid-base status in skeletal muscle (Hawley 2002). Briefly, endurance

50
adaptation results in increased muscle glycogen stores and glycogen sparing at submaximal

workloads via increased fat oxidation, enhanced lactate kinetics and morphological alterations

including greater type I fibre proportions per muscle area, and increased capillary and

mitochondrial density. Moreover, repeated bouts of endurance exercise results in altered

expression of a multiplicity of gene products, resulting in an altered muscle phenotype with

improved resistance to fatigue (Adhihetty et al. 2003). Mitochondria are the main subcellular

structures that determine the oxidative capacity and fatigue resistance to prolonged contractile

activity in skeletal muscle (Hoppeler and Flück 2003). Endurance training can increase steady

state mitochondrial protein content 50-100% within ~6 wk, but a protein turnover half-life of

~1 wk means a continuous training stimulus is required to maintain elevated mitochondrial

content (Hood 2001). While enhanced oxygen kinetics, substrate transport, and buffering

capacity all contribute to enhanced endurance capability in skeletal muscle, improved

endurance is most associated with the increase in mitochondrial density and enzyme activity,

termed mitochondrial biogenesis (Adhihetty et al. 2003; Irrcher et al. 2003).

Mitochondrial Biogenesis

The expansion of the mitochondrial reticulum in skeletal muscle is a highly regulated and

complex process that appears to require the co-ordinated expression of a large number of

genes (Goffart and Wiesner 2003; Irrcher et al. 2003). Mitochondrial biogenesis requires the

co-expression of both the nuclear and mitochondrial genomes for assembly and expansion of

the reticulum and 95% of the genes necessary for biogenesis are encoded in the nucleus

(Hood 2001; Goffart and Wiesner 2003). Thus, an important aspect of mitochondrial

biogenesis is the import machinery regulating the transport of nuclear encoded precursor

proteins into the organelle (Irrcher et al. 2003). However, expression of genes promoting

mitochondrial biogenesis is predominantly controlled by the global principles of gene

regulation, that is, transcription initiation and interaction at the gene promoter (Goffart and

51
Wiesner 2003). Therefore, transcription factors and transcriptional co-activators represent

critical regulators of mitochondrial biogenesis.

Numerous transcription factors have been implicated in regulating expression of genes

involved in mitochondrial biogenesis (Adhihetty et al. 2003). While no single transcription

factor has been found to be responsible for the co-ordination of mitochondrial gene

expression, several candidates appear to be important for mitochondrial biogenesis. These

include the immediate early genes (c-fos, c-jun), early growth response gene-1 (Egr-1) and

nuclear respiratory factors-1 and -2 (NRF-1/2; Hood et al. 2006). Egr-1 is associated with

promoting transcription of the electron transport chain protein cytochrome C oxidase (COX;

(Freyssenet et al. 2004) while NRF-1 and NRF-2 are implicated in the transcriptional control

of multiple mitochondrial genes including mitochondrial transcription factor A (Tfam) and

recently identified mitochondrial transcription specificity factors TFB1M and TFB2M

(Scarpulla 2002; Gleyzer et al. 2005). The Egr and NRF transcription factors increase in

response to serum stimulation or contractile activity (Connor et al. 2001; Irrcher and Hood

2004; Gleyzer et al. 2005) and NRF-1 and -2 mRNA have been shown to increase in response

to both acute and chronic endurance exercise (Baar et al. 2002; Short et al. 2003).

The peroxisome proliferator receptor gamma co-activator-1 alpha (PGC-1α) has been

established as an important regulator of mitochondria content in skeletal muscle due to its

apparent co-activation of multiple mitochondrial transcription factors (Finck and Kelly 2006;

Hood et al. 2006). Indeed, PGC-1α is the founding member of a family of transcriptional co-

activators that has been proposed as a potential “master regulator” of mitochondrial

biogenesis (Adhihetty et al. 2003; Scarpulla 2006). In support of this contention, Lin and co-

workers (2002) over expressed PGC-1α in mice skeletal muscle and observed increased

proportions of type I fibres and increased resistance to fatigue. In addition, the biogenesis and

maintenance of mitochondrial architecture is controlled by altered rates of mitochondrial

protein fusion and fission (Santel and Fuller 2001), a role for which mitofusin (Mfn) 1/2

52
proteins have been strongly implicated (Bach et al. 2003; Santel et al. 2003). Recent evidence

indicates that PGC-1α mediates a regulatory pathway involving estrogen-related receptor

alpha (ERRα) and Mfn1/2, and this pathway has been shown to be up-regulated following a

10-km cycling time trial (Cartoni et al. 2005; Soriano et al. 2006). This suggests that a PGC-

1α activated pathway promotes an increase in mitochondrial content in response to endurance

exercise through enhanced mitochondrial protein fusion.

Similarly, PGC-1α also mediates Tfam activation, a key component in mitochondrial

DNA replication and transcription (Kanki et al. 2004; Maniura-Weber et al. 2004). The NRF-

1 transcription factor has been shown to activate Tfam which enhances the capacity for

assembly of protein complexes within the mitochondria (Scarpulla 2006). Therefore, as a co-

activator of NRF-1 transcription PGC-1α is involved in regulating Tfam function (Wu et al.

1999). Importantly, Tfam activity appears to increase in response to contractile activity and

exercise suggesting enhanced mitochondrial protein assembly with endurance training

(Bengtsson et al. 2001; Gordon et al. 2001).

Most notably, PGC-1α is the co-activator of the peroxisome proliferator activated

receptor (PPAR) family (Vega et al. 2000; Oberkofler et al. 2002). The three PPAR sub-types

α, γ and δ have distinct functions but all appear to regulate lipid homeostasis via expression of

genes involved in mitochondrial fatty acid oxidation (Lee et al. 2003; Finck and Kelly 2006).

The physiological significance of increased PGC-1α-PPAR activated gene expression with

endurance training is an enhanced capacity for fat utilisation during prolonged exercise, and

may also be related to fast-to-slow fibre type conversion (Luquet et al. 2003; Wang et al.

2004). Indeed, this was highlighted by Wang and colleagues (2004) who generated transgenic

mice over expressing PPARδ that resulted in a 2.3-fold increase in mitochondrial DNA

content, significant type I fibre transformation and a 90% increase in running performance

(Figure 1.14). The small numbers of studies investigating PPAR activation following exercise

support these findings where both acute (Jorgensen et al. 2005; Russell et al. 2005) and

53
chronic (Luquet et al. 2003; Mahoney et al. 2005; Fritz et al. 2006) endurance exercise

induces PPAR transcription.

Figure 1.14 Peroxisome proliferator receptor delta (PPARδ) regulates exercise endurance. A)

Enhanced exercise performance in the transgenic PPARδ-over expression mice (TG) versus

wild type (WT) mice. B) Compromised exercise performance in transgenic PPARδ-null mice

(Null) compared with wild type (WT) mice. C) Putative functions of PPARδ in skeletal

muscle (reproduced from Wang et al. 2004).

The available evidence suggests that increased PGC-1α-PPAR mediated transcription

is an important endurance adaptation and imperative for establishing an endurance phenotype.

54
Taken collectively, the results from the studies reviewed here not only implicate PGC-1α in

the regulation of aerobic metabolism but also mitochondrial architecture and fast-to-slow fibre

type transformation. The upstream signalling events that activate PGC-1α gene expression are

not well defined and various pathways have been implicated including AMPK, calcineurin,

p38 MAPK and FoxO1 (Zong et al. 2002; Akimoto et al. 2005; Southgate et al. 2005; Finck

and Kelly 2006). Intriguingly, PGC-1α activation may be complicated by the fact that some

transcription factors that are co-activated by PGC-1α may also be responsible for its up-

regulation (Hood et al. 2006).

Endurance exercise has been routinely shown as a potent stimulator of PGC-1α gene

and protein expression (Pilegaard et al. 2000; Baar et al. 2002; Norrbom et al. 2003; Psilander

et al. 2003; Terada and Tabata 2003; Cluberton et al. 2005; Jorgensen et al. 2005; Terada et

al. 2005). In contrast, due to its specific role in mitochondrial biogenesis, no studies have

investigated the role of PGC-1α following resistance training. However, as might be expected,

a significant decrease in PGC-1α protein was observed after high-frequency electrical

stimulation to mimic the effects of resistance training (Atherton et al. 2005). Accordingly,

exercise-induced up-regulation of PGC-1α represents an essential molecular response in our

current understanding of mitochondrial biogenesis and exercise specific adaptation to

endurance but not resistance training in skeletal muscle.

Metabolic Gene Expression

In addition to mitochondrial biogenesis, increased gene expression of metabolic proteins

following endurance exercise contributes to promoting an enhanced endurance phenotype

(Mahoney et al. 2005). These include genes encoding enzymes and transporters involved in

carbohydrate and fat metabolism such as hexokinase, lipoprotein lipase and carnitine

palmitoyltransferase (Pilegaard et al. 2000; Tunstall et al. 2002). Endurance exercise has been

shown to increase the mRNA abundance and transcription of a variety of metabolic genes in

the post-exercise recovery period (Pilegaard et al. 2000; Tunstall et al. 2002; Hildebrandt et

55
al. 2003; Pilegaard et al. 2005; Yang et al. 2005). This up-regulation of metabolic genes

following exercise appears to peak in the initial hours of recovery and generally returns to

resting levels within 24 h (Pilegaard et al. 2005; Yang et al. 2005). It has been postulated that

the cumulative effect of this transient up-regulation with repeated bouts of exercise may be an

underlying mechanism for exercise-induced adaptation with endurance training (Pilegaard et

al. 2000). However, in contrast to PGC-1α activity resistance training may also alter the

expression of a number of metabolic genes (e.g. PDK4), but this moderate effect may be

restricted to those proteins involved in carbohydrate metabolism (Yang et al. 2005). In

addition, evidence suggests that nutrient availability has a significant effect on the exercise

response of a variety of metabolic genes. Therefore, nutrient-gene interactions represent a

variable that may promote or suppress metabolic exercise-induced adaptation in skeletal

muscle (Vissing et al. 2004; Pilegaard et al. 2005; Hawley et al. 2006).

1.3.2 Resistance Exercise

Increased muscle cross-sectional area and altered neural recruitment patterns represent the

principal adaptations to repeated bouts of heavy resistance exercise (Häkkinen 1989).

Increased cross-sectional area (i.e. hypertrophy) following resistance training is a result of an

increase in protein mass per cross-sectional area of tissue which occurs when the rate of

protein synthesis is greater than protein degradation (Chesley et al. 1992; Phillips et al. 1997).

Fundamentally, the hypertrophy response to overload is qualitatively and quantitatively

controlled via the production of cellular proteins and new muscle cells. Adaptation to

resistance training includes increased protein synthesis via regulatory changes in

transcriptional and translational mechanisms, and in the production of muscle cells that are

added to existing myofibres or combine and form new contractile filaments, each providing

additional contractile machinery with which to generate force (Bolster et al. 2003a; Rennie et

al. 2004; Sartorelli and Fulco 2004). In addition, while a degree of protein degradation is

56
required for muscle remodelling resistance training may also decrease chronic activation of

atrophy pathways resulting in supplementary net protein synthesis (Jones et al. 2004).

Hypertrophy

Compensatory hypertrophy in skeletal muscle following resistance training involves an

increase in ribosomal protein synthesis (Bolster et al. 2003a). Regulation of ribosomal protein

synthesis is controlled by phosphorylation events altering mRNA translation initiation,

elongation and termination, and the cellular ribosome content which determines the synthesis

of protein per mRNA (Farrell et al. 2000; Wang et al. 2001; Hannan et al. 2003; Richter and

Sonenberg 2005). Modulation of translation initiation is a particularly important regulatory

site for global protein synthesis in response to a resistance exercise stimulus and is the rate

limiting step and most frequent target for translational control (Baar et al. 1999; Richter and

Sonenberg 2005). The initiation step in translation is regulated by phosphorylation of

eukaryotic initiation factors (eIFs) that mediate 40S ribosomal subunit binding to mRNA

(Bolster et al. 2003a). The binding of 40S ribosome-mRNA is mediated by the interaction of

multiple eIFs and ribosomal S6 protein that are the most distal components of the insulin /

IGF-1 and MAPK signalling cascades (Glass 2005; Kubica et al. 2005; Shahbazian et al.

2006). Given its ability to ultimately enhance protein synthesis through translation initiation

IGF-1 and IGF-binding protein gene expression following an exercise stimulus has been the

focus of extensive investigation.

Over expression and localised infusion of IGF-1 have both been shown to induce

significant skeletal muscle hypertrophy (Adams and McCue 1998; Musaro et al. 2001; Song

et al. 2005). While a number of IGF isoforms and splice variants exist there is growing

evidence elucidating the potential mechanisms that directly promote IGF-1 induced

hypertrophy. Musaro and co-workers (1999) have demonstrated that IGF-1 mediated protein

synthesis and hypertrophy involves IGF-1 induced calcineurin activation of GATA-2 and

nuclear factor of activated T-cell (NFAT) transcription factors generating an increase in gene

57
expression. Moreover, there is compelling mechanistic data showing IGF-1 regulates

increases in PI3K-AKT-mTOR signalling (Shen et al. 2005; Vary 2006). Importantly, these

studies show p70 S6K and 4E-BP1 phosphorylation and eIF4E-eIF4G association, indicating

IGF-1 activation of kinases proximal to the translational machinery. IGF-1 has also been

shown to enhance satellite cell recruitment, proliferative potential and life span (Chakravarthy

et al. 2000a; Chakravarthy et al. 2000b; Jacquemin et al. 2004). Thus, IGF-1 appears capable

of inducing hypertrophy via an enhanced programme of gene expression, increased

ribosomal-mediated translation, and satellite cell activation. Collectively, this strongly

implicates IGF-1 as a potent multi-factorial regulator of hypertrophy. The co-ordination of the

alternate adaptive machinery responsible for IGF-1 mediated hypertrophy responses is unclear

but is likely to be specific to the intensity and duration of the overload stimulus.

Skeletal muscle IGF-1 and IGF-binding protein mRNA and protein content increases

in response to contractile activity in a variety of overload models (Adams et al. 1999;

Spangenburg et al. 2002; Hameed et al. 2003; Adams et al. 2004; Bickel et al. 2005).

However, the effect of resistance exercise on IGF-1 in vivo in humans is equivocal, as IGF-1

mRNA has been reported to increase (Bamman et al. 2001; Kim et al. 2005; Petrella et al.

2006), decrease (Psilander et al. 2003; Bickel et al. 2005) and remain unchanged (Bickel et al.

2003; Hameed et al. 2003). Differences in exercise stimuli, individual variability and the

unknown time course of expression for the IGF-1 response may provide some explanation for

these discordant findings. Nonetheless, the IGF-1 genotype appears to enhance the strength

response to resistance exercise in humans as the IGF-1 promoter polymorphism has been

associated with greater strength gains following 10 wk of resistance training (Kostek et al.

2005). Therefore, despite only partial clarity of in vivo human data the available evidence

implicates IGF-1 gene expression in exercise-induced muscle hypertrophy in response to

resistance training.

58
Activation and differentiation of non-specialised satellite cells into new muscle cells is an

additional mechanism that contributes to compensatory hypertrophy (Sartorelli and Fulco

2004). Eccentric contraction during resistance exercise is capable of inducing substantial

damage to contractile and structural components of skeletal muscle (McCully and Faulkner

1985; MacPherson et al. 1997). Satellite cells located at the basal lamina that surrounds a

myofibre are activated for the repair and maintenance of the muscle milieu and addition of

myonuclei, both important components for muscle regeneration and hypertrophy (Zammit et

al. 2004; Petrella et al. 2006). During the course of regeneration satellite cells first exit their

quiescent state and proliferate until secondary molecular signals arrest the mitotic activity and

initiate the differentiation of non-specialised cells to muscle precursor cells that migrate to the

site of regeneration (Figure 1.15; Charge and Rudnicki 2004).

Figure 1.15 Schematic representations of events regulating satellite cell activation. Following

muscle damage (A) quiescent satellite cells are activated to enter the cell cycle and proliferate

and (B) is followed by terminal differentiation. (C-E) Cells then combine with damaged

myofibres for repair or each other for new myofibre formation. (F) A subset of cells return to

quiescent state to replenish the satellite cell pool. (G) Repaired or new fibres resemble

original myofibres (adapted from Charge and Rudnicki 2004).

59
 Primary regulators of satellite cell activation include the myogenic regulatory factor

(MRF) family of transcription factors and cell cycle kinases, which provide molecular

landmarks for the transition from satellite cell quiescence to activation, proliferation and

differentiation (Zammit et al. 2004). The best characterised of the MRF’s are the myogenic

differentiation (MyoD) and myogenin (MyoG) transcription factors. Activation of satellite

cells in skeletal muscle is associated with rapid up-regulation of MyoD prior to cell

proliferation and continues through differentiation, while MyoG up-regulation occurs in cells

initiating the terminal differentiation programme (Cornelison and Wold 1997; Cornelison et

al. 2000).

Expression patterns from functionally overloaded skeletal muscle reveal that satellite

cells express both MyoD and MyoG during the hypertrophy process and activated satellite

cells can significantly contribute to activity-dependent muscle growth (Ishido et al. 2004b; Li

et al. 2006; Petrella et al. 2006). A single bout of contractile activity is sufficient to increase

cell cycle kinases and MyoD and MyoG mRNA abundance in skeletal muscle of both rodents

and humans (Adams et al. 1999; Haddad and Adams 2002; Willoughby and Nelson 2002;

Psilander et al. 2003; Bickel et al. 2005; Vissing et al. 2005; Yang et al. 2005). Moreover, this

response does not appear to be attenuated with chronic resistance training (3 d/wk for 16 wk)

which induced MyoD and MyoG mRNA responses equal to a single resistance training bout

(Kosek et al. 2006). This implicates the MRF’s in contributing to the myogenic programme

and resultant compensatory hypertrophy response with resistance training. However,

increased MyoD and MyoG expression has also been observed following low-frequency

electrical stimulation and endurance exercise (Kadi et al. 2004; Siu et al. 2004; Vissing et al.

2005; Yang et al. 2005). Endurance cycling / swimming is unlikely to induce muscle damage

and subsequent satellite cell activation; hence the MyoD / MyoG response to an endurance

exercise stimulus has been postulated to regulate a pathway for exercise-induced changes in

mitochondrial enzymes and / or muscle fibre type transformation (Kadi et al. 2004; Siu et al.

60
2004; Vissing et al. 2005). While there is an established role for MRF’s in satellite cell

activation and subsequent increases in myonuclei number and myofibre size, it appears these

transcription factors have additional and as yet undefined roles in skeletal muscle adaptation

to exercise.

Atrophy

Skeletal muscle atrophy is characterised by a decrease in structural and contractile protein

content and fibre diameter (Jackman and Kandarian 2004; Bassel-Duby and Olson 2006).

Moreover, while hypertrophy pathways may suppress the activity of some mediators of

protein breakdown, atrophy is not simply the reversal of hypertrophy but comprises unique

mechanisms in a series of pathways regulating proteolysis (Sacheck et al. 2004; Glass 2005).

Atrophy occurs when protein degradation exceeds protein resynthesis and is often prevalent in

conditions such as inactivity, aging and disease (Jackman and Kandarian 2004; Reid 2005).

The variety of conditions that generate a common outcome suggests that both reciprocal and

distinct molecular signalling pathways contribute to the skeletal muscle atrophy programme

(Jackman and Kandarian 2004).

Current understanding of skeletal muscle atrophy implicates at least three systems in

the regulation of proteolysis. The calcium-dependent protease calpain family and proteolytic

caspase class of proteins have been proposed to mediate skeletal muscle myofibrillar

disassembly and cleavage of actomyosin protein, respectively (Tischler et al. 1990; Du et al.

2004). Similarly, cathepsin, a proteolytic enzyme involved in lysosomal proteolysis has been

implicated in the degradation of membrane proteins such as receptors, channels and

transporters (Jackman and Kandarian 2004). While the initial fragmentation of structural and

contractile protein via calpain, caspase or lysosomal pathways is required to enable

degradation, the destruction of the protein fragments appears to be co-ordinated by a common

system (Bodine et al. 2001a; Lecker et al. 2004).

61
 The destruction of myofibrillar protein is primarily carried out by the ATP-dependent

ubiquitin proteasome pathway (Kandarian and Jackman 2006). This pathway labels proteins

by conjugation with ubiquitin and this composite protein is subsequently recognised and

degraded via zinc-finger domain protein ZNF216 association with the 26S proteasome

enzyme complex (Reid 2005; Hishiya et al. 2006). In addition, ubiquitin ligases may also

degrade MyoD and inhibit subsequent satellite cell activation (Abu Hatoum et al. 1998;

Mitchell and Pavlath 2004; Tintignac et al. 2005). Work by Bodine and colleagues (2001) and

Gomes and co-workers (2001) has identified important ubiquitin ligase proteins that are up-

regulated during skeletal muscle atrophy; the muscle-specific atrophy F box (MAFBx, also

known as atrogin-1) and muscle ring finger (MuRF) proteins. The evidence supporting their

proposed role in muscle atrophy is compelling as the increase in gene expression of these

ubiquitin proteins has been systematically induced with fasting, cachexia, diabetes, uremia,

denervation, glucocorticoid release and disuse atrophy models (Bodine et al. 2001a; Jones et

al. 2004; Lecker et al. 2004; Sacheck et al. 2004). The results from these studies suggest that

the MAFBx and MuRF proteins are valid and reliable markers of skeletal muscle atrophy.

However, the molecular proteins that initiate MAFBx and MuRF gene expression are still

largely unknown (Figure 1.16).

Principle candidates implicated in MAFBx and MuRF activation include the forkhead

(FoxO) transcription factors and TNFα via p38 MAPK and NFκB (Glass 2005). FoxO has

numerous regulatory sites mediated by AKT phosphorylation which stimulates the nuclear

exclusion and inactivation of this transcription factor (Rena et al. 2002). Constitutively active

FoxO acts on the MAFBx promoter to initiate MAFBx transcription and results in dramatic

atrophy of myotubes and myofibres (Sandri et al. 2004). Moreover, in the absence of IGF-1

signalling MAFBx and MuRF gene expression and muscle atrophy is increased, implicating

AKT-FoxO interactions in mediating regulation of ubiquitin ligases (Sacheck et al. 2004; Stitt

et al. 2004). Similarly, activation of NFκB through transgenic expression of IKKβ, and

62
 Growth factors Disuse, Cachexia factors

Akt TNFα

p38 IKK
Foxo
NFKB

MAFbx MuRF

Protein Degradation

Muscle Atrophy

Figure 1.16 Putative pathways regulating signalling to MAFBx / MuRF ubiquitin ligases.

MAFBx, muscle atrophy F box protein; MuRF, muscle ring finger protein; IKK, inhibitor

kappa B kinase; NFκB, nuclear factor kappa B; TNFα, tumor necrosis factor alpha; FoxO,

forkhead box O; p38, p38 mitogen activated protein kinase (adapted from Cai et al. 2004).

reactive oxygen species stimulated p38 MAPK activity, have been shown to increase MuRF

and MAFBx gene expression, respectively (Cai et al. 2004; Li et al. 2005). Pharmalogical

inhibition of IKKβ / NFκB and p38 results in inhibition of MuRF and MAFBx up-regulation

and reverses muscle atrophy, providing further evidence for NFκB and p38 regulation of

MuRF and MAFBx activation in the atrophy programme, respectively (Cai et al. 2004; Li et

al. 2005).

63
 Myostatin (or growth and differentiation factor 8) is a transforming growth factor-β

family member that may not be classified as an atrophy-inducing factor per se but functions

as an inhibitor of muscle hypertrophy (McNally 2004; Wagner et al. 2005). The role of

myostatin as a negative regulator of hypertrophy is highlighted by the extraordinary increase

in muscle mass of myostatin-deficient animals and humans (McPherron and Lee 1997; Lee

and McPherron 2001; Schuelke et al. 2004). Furthermore, transgenic over expression of

myostatin has been shown to reduce muscle mass, fibre size and myonuclei number,

suggesting that increased myostatin expression may have the capacity to exacerbate atrophy

(Reisz-Porszasz et al. 2003). Myostatin appears to exert its regulatory effect on muscle mass

via inhibition of satellite cell proliferation, differentiation and self-renewal (Thomas et al.

2000; Langley et al. 2002; McCroskery et al. 2003). Therefore, down-regulation of myostatin

gene expression can result in hypertrophy and hyperplasia following skeletal muscle

regeneration (Lee and McPherron 2001).

The capacity of muscle contraction to repress, reverse or exacerbate various atrophy

signalling pathways and catabolic states is still unclear. Early work by Sandri et al. (1997)

showed that ubiquitin protein and associated apoptosis in mice increased following one night

of voluntary wheel running. Their findings were later corroborated by other studies

incorporating repeated bouts of resistance training that also induced a post-exercise increase

in skeletal muscle ubiquitin protein content (Stupka et al. 2001; Willoughby et al. 2003).

Indeed, Yang and colleagues (2006) observed an increase in MAFBx and MuRF mRNA

abundance following a single bout of resistance exercise. Conversely, resistance training has

also been shown to reduce MuRF and MAFBx gene expression and restore muscle mass and

strength following 2-6 wk disuse atrophy, decreasing ubiquitin ligase mRNA abundance by a

minimum ~40% (Jones et al. 2004; Dupont-Versteegden et al. 2006). Myostatin gene

expression also appears to be reduced following resistance exercise in humans (Roth et al.

2003; Kim et al. 2005; Raue et al. 2006), although a single study has reported an increase in

64
myostatin mRNA abundance after 12 wk resistance training (Willoughby 2004). Moreover,

Matsakas and co-workers (2005) observed a decrease in myostatin mRNA in rodents

following one and three days (2 x 60 min/d) of swimming training. The authors attributed this

somewhat unexpected finding to the need for skeletal muscle remodelling with repeated

concentric contractile activity (Matsakas et al. 2005).

Interestingly, Haddad and colleagues (2006) provide evidence that an isometric

training programme previously shown to induce hypertrophy (Adams et al. 2004) failed to

maintain myofibril protein content during hind limb suspension, despite completely abating

the increase in MAFBx, MuRF and myostatin mRNA. These workers suggest that to prevent

muscle atrophy, maintaining optimal activity of hypertrophy pathways is required in addition

to inhibiting the catabolic stimulus. Furthermore, training history is likely to alter the response

of atrophic gene expression where acute bouts of resistance exercise in untrained muscle may

induce an atrophy programme due to muscle damage, but may also be required for

regeneration remodelling. Indeed, chronic resistance training may ultimately produce a

decrease in atrophy gene expression thereby enhancing the capacity for compensatory

hypertrophy.

Collectively, these findings suggest that exercise-induced skeletal muscle contraction

is capable of altering regulators of skeletal muscle atrophy including pathways regulating

ubiquitin ligase and satellite cell activation. However, the interaction of mode of contraction,

duration and intensity of exercise likely modifies the specific response of atrophy and / or

hypertrophy pathways. In addition, exercise interventions in models of disease or disuse may

induce molecular responses that do not accurately reflect changes in atrophy / hypertrophy

pathways that occur with resistance training in healthy or athletic populations. Regardless, the

proteolytic status in skeletal muscle is the result of the interactions between integrated atrophy

and hypertrophy pathways generating a specific time-course of events determining net protein

balance that may promote or inhibit protein synthesis (Figure 1.17).

65
 IGF-1 TNFa

PDK1

IRS1 PI3K AKT IKK

p38 NFkB
GSK3 TSC1/2 mTOR Foxo

EIF2B p70 S6K 4EBP1 MAFbx MuRF

Figure 1.17 Schematic providing an example of the integration of hypertrophy (IGF-1) and

atrophy (TNFα) pathways in skeletal muscle. Bars denote inhibition and arrows denote

activation. IRS1, insulin receptor substrate 1; PI3K, phosphatidylinositol-3-OH kinase;

PDK1, 3’ phosphoinositide-dependent protein kinase 1; FoxO, forkhead box O; mTOR;

mammalian target of rapamycin; GSK3, glycogen synthase kinase 3; TSC1/2, tuberous

sclerosis complex 1/2; 4EBP1, eukaryotic initiation factor 4E-binding protein; eIF2B

eukaryotic initiation factor 2B; p70 S6K, p70 ribosomal S6 kinase; MAFBx, muscle atrophy

F box protein; MuRF, muscle ring finger protein; IKK, inhibitor kappa B kinase; NFκB,

nuclear factor kappa B; TNFα, tumor necrosis factor alpha; p38, p38 mitogen activated

protein kinase (adapted from Glass 2005).

1.3.3 Concurrent Training

The concomitant integration of endurance and resistance training in a periodised training plan is

termed concurrent training. To date, few animal studies have attempted to elucidate mechanisms

of adaptation in skeletal muscle with concomitant aerobic and hypertrophic stimuli. Furthermore,

the results of studies investigating adaptation and performance changes in humans undertaking

concurrent strength and endurance training have been equivocal (Millet et al. 2002; Balabinis et

al. 2003; Häkkinen et al. 2003; Glowacki et al. 2004). There are several possible reasons for this

66
discrepancy, including differences in the design of the concurrent training interventions, the

training status of the subjects, the influence of dependent variable selection, small sample sizes

and inadequate statistical power (Leveritt et al. 2003). Most concurrent training studies have

involved cycling, with only a few studies using running or swimming protocols, and have

typically employed untrained or moderately trained male volunteers, who undergo short-term (8

to 16 wk) training interventions in which the training volume and intensity is low. Nevertheless,

since the classic investigative work of Hickson (1980) numerous studies have reported a

variety of adaptive consequences when combining resistance and endurance training (Table

1.4; Leveritt et al. 1999).

The conundrum of variable results arising from concurrent training research is not

surprising given the complexity of signalling and gene expression with endurance and

resistance training described previously. Indeed, it is reasonable to suggest that the specific

adaptations to the divergent exercise modes appear to be incompatible, at least at the cellular /

molecular level. Heavy resistance training does not lead to mitochondrial biogenesis, and the

larger myofibril cross sectional area increases diffusion distances for oxygen and substrates

(Hood 2001). Therefore, with respect to alterations in the muscle milieu, this does not induce

a favourable adaptation for endurance capacity. Likewise, chronic endurance training does not

have a marked effect on myofibril size and the muscles altered [AMP/Ca2+] and subsequent

residual fatigue may have a negative effect on muscle protein synthesis and the ability to

generate force. Accordingly, this does not produce an adaptation conducive for increased

muscular size and strength.

67
Table 1.4 Summary of research investigating the effect of concurrent strength and endurance training on skeletal muscle adaptation.

Author WK Training Concurrent Training Interference?

Izquierdo et al. (2005) 16 (S) 2 d/wk (E) 2 d/wk (C) 1 x S + 1 x E once weekly Yes – lower leg strength development

Glowacki et al. (2004) 12 (S) 2-3 x wk (E) 2-3 x wk (C) 5 x wk Yes – reduced increase of maximum oxygen consumption in C vs. E

Häkkinen et al. (2003) 21 (S) 2 d/wk (C) 2 x S + 2 x E Yes – impaired explosive strength development

Balabinis et al. (2003) 7 (S) 4 d/wk (E) 4 d/wk (C) S + E regimens / same day No

Millet et al. (2002) 14 (E) triathlon precondition phase (C) E + S-2 x wk No

McCarthy et al. (2002) 10 (S) 3 d/wk (E) 3 d/wk (C) combined S + E in same session No

Bell et al. (2000) 12 (S) 3 d/wk (E) 3 d/wk (C) S + E regimens / alternate day Yes - impaired strength gains in C compared with S

Horne et al. (1997) 12 (S) 3 d/wk (E) 3 d/wk (C) S + E regimens / alternate day Yes - impaired strength gains in C compared with S

Kraemer et al. (1995) 12 (S) 4 d/wk (E) 4 d/wk (C) S + E regimens / same day Yes - impaired strength gains in C compared with S

McCarthy et al. (1995) 10 (S) 3 d/wk (E) 3 d/wk (C) combined S + E in same session No

Hennessy & Watson (1994) 8 (S) 3 d/wk (E) 4 d/wk(C) random S+E combined & separate 5 d/wk Yes – impaired strength gains in C compared with S

Nelson et al. (1990) 20 (S) 4 d/wk (E) 4 d/wk (C) S + E regimens / same day Yes – reduced increase of maximum oxygen consumption in C vs. E

Hunter et al. (1987) 12 (S) 4 d/wk (E) 4 d/wk (C) S + E regimens / same day Yes – reduced vertical jump in C compared with S

Dudley & Djamil (1985) 7 (S) 3 x wk (E) 3 x wk (C) S + E regimens / alternate day Yes – reduced maximum torque at high velocities in C vs. S

Hickson (1980) 10 (S) 5 d/wk (E) 6 d/wk (C) S + E regimens / same day Yes – impaired strength gains in C compared with S group

S, strength training; E endurance training; C, concurrent strength and endurance training

68
 The majority of research aimed at elucidating the adaptive responses to concurrent

training has been confined to “end state” measures such as maximum strength / power or

maximal aerobic capacity. Consequently, it is not possible to deduce the timing and identity of

the regulatory events that orchestrated the observed “end-point” adaptations. As a result there

has been little or no elucidation of the mechanisms underlying the specificity of training

adaptation or interference to these pathways during concurrent training. Early work by Riedy

and colleagues (1985) examined whether enlarged rodent skeletal muscle following 30 d

surgical ablation responded to endurance training similar to control muscle. They observed

comparable increases in succinate dehydrogenase activity in enlarged versus normal muscle

and concluded that the response to endurance training was unaltered in hypertrophied muscle.

Conversely, Stone and co-workers (1996) assessed the effect of 6 wk concurrent surgical

overload and endurance training on citrate synthase and observed compromised oxidative

enzyme content with concomitant hypertrophy. Finally, Putman and colleagues (2004;

Putman et al. 2004) employed 12 wk concurrent training to determine changes in myosin

heavy chain isoform content. These workers reported reduced strength development with

concurrent compared to strength training alone and greater fast-to-slow fibre-type transition

and attenuated hypertrophy of type I fibres following concurrent training. Accordingly, these

inconclusive findings provide little mechanistic insight regarding the possible interference and

/ or incompatibility of adaptation with concurrent strength and endurance training. However,

emerging evidence provides a number of possible mechanisms that may, in part, offer a

rationale for adaptation specificity and an “interference” phenomenon with concurrent

training.

The elongation phase of translation is mediated by eukaryotic elongation factors which

represent a rate limiting step in protein synthesis (Bouchard et al. 1997). A key component of

this translational machinery is eukaryotic elongation factor 2 (eEF2) which mediates

translocation of the ribosome along the mRNA. eEF2 is phosphorylated and inactivated by

69
eEF2K in response to stimuli that increase energy demand or reduce energy supply (Browne

and Proud 2002). Moreover, the activation of eEF2K appears to be regulated upstream via

calmodulin and AMPK mediated signalling, kinases activated in response to endurance

exercise (Nairn and Palfrey 1987; Ryazanov 1987; Horman et al. 2002). Indeed, Rose and

colleagues (2005) provide strong evidence for the phosphorylation and inactivation of eEF2 in

a calcium-calmodulin dependent manner in response to 90 min submaximal cycling (~67%

VO2peak). Atherton and co-workers (2005) likewise observed an increase in eEF2

phosphorylation immediately after, and 3 h following an endurance-like stimulus. This

suggests that inhibition of eEF2 activity by endurance exercise results in a decrease in

translation elongation and protein synthesis (Figure 1.18). Conversely, IGF-1 signalling has

been implicated in the phosphorylation and inhibition of eEF2K and subsequent activation of

eEF2 (Browne and Proud 2002). Data exists showing phosphorylation at serine366 by p70 S6K

inactivates eEF2K, while mTOR has also been shown to phosphorylate serine78 on eEF2K

decreasing kinase activity (Wang et al. 2001; Browne and Proud 2004). Therefore, in addition

to its established role in translation initiation these findings also implicate mTOR-p70 S6K in

the regulation of eEF2 and translation elongation. Increased mTOR and p70 S6K activity

following resistance training would be expected to promote hypertrophy in part via increased

eEF2 activity (Figure 1.18). In support of this contention a resistance-like stimulus has been

demonstrated to decrease eEF2 phosphorylation likely enhancing elongation and protein

synthesis (Atherton et al. 2005), but this effect has yet to be investigated in humans.

Nonetheless, contrasting regulation of eEF2 mediated elongation by endurance and resistance

training may represent a point of divergence for control of protein synthesis.

70
 1 Ca2+

Ca2+
Ca2+ Cytoplasm
Ca2+ Ca2+ 2
Ca2+

Ca2+ S6K
Ca2+
Ca2+ Ca2+
eEF2K
Ca2+
eEF2
CaMK
Ribosome
Translation
mRNA
eEF2
P
Ribosome
Translation
mRNA

Figure 1.18 Putative divergent regulation of eukaryotic elongation factor 2 (eEF2) by (1)

endurance and (2) resistance exercise. Bars denote inhibition and arrows denote activation.

CaMK, calmodulin-dependent kinase; S6K, ribosomal protein S6 kinase; eEF2K, eukaryotic

elongation factor 2 kinase (based on findings of Atherton et al. 2005; Rose et al. 2005; and

Wang et al. 2001).

The FoxO transcription factor has been implicated in promoting mRNA abundance of

genes involved in processes as varied as mitochondrial biogenesis and myofibrillar protein

degradation (Glass 2005; Hood et al. 2006). FoxO functions on the promoter regions and

initiates transcription of a number of genes including PGC-1α and MAFBx, and the activity

and nuclear abundance of FoxO is regulated by AKT (Daitoku et al. 2003; Sandri et al. 2004;

Nader 2005). When AKT phosphorylates FoxO it translocates from the nucleus to the cytosol

and is prevented from promoting transcription and may also be subject to cytosolic

proteasomal degradation (Matsuzaki et al. 2003). AKT activation following resistance

exercise would likely result in phosphorylation of FoxO and subsequent inhibition of

71
ubiquitin ligase gene expression (Figure 1.19). While these events would be expected to

promote hypertrophy, work by Southgate and co-workers (2005) suggests that this results in

the concomitant down-regulation of PGC-1α gene expression (Figure 1.19). Equally,

endurance exercise is associated with increased PGC-1α gene expression and mitochondrial

biogenesis promoting an oxidative phenotype (Irrcher et al. 2003). However, the nuclear

location of FoxO with endurance exercise may suppress net protein synthesis due to increased

activity of ubiquitin gene expression and subsequent protein degradation. Therefore, altered

regulation of FoxO activity with contrasting modes of exercise may generate contradictory

gene expression profiles ultimately reducing the specificity of adaptation.

Cytoplasm

AKT

Nucleus
P P
FoxO1 mRNA Transcription FoxO1 mRNA Transcription

PGC-1a MAFbx

Mitochondrial Biogenesis Protein Degradation

Figure 1.19 Proposed effects of acute endurance and resistance training on forkhead box O1

(FoxO1) mediated transcription. PGC-1α, peroxisome proliferator activated receptor gamma

co-activator-1 alpha; MAFBx, muscle atrophy F box protein (based on findings of Hoffman

& Nader 2004 and Southgate et al. 2005).

72
Figure 1.20 Putative adaptive pathways in response to endurance- and resistance-like stimuli.

Bars denote inhibition and arrows denote activation. AMPK, adenosine monophosphate

kinase; PGC-1α, peroxisome proliferator activated receptor gamma co-activator-1 alpha; IGF,

insulin-like growth factor; PI3K, phosphatidylinositol-3-OH kinase; mTOR, mammalian

target of rapamycin; GSK3, glycogen synthase kinase 3; TSC1/2, tuberous sclerosis complex

1/2; 4E-BP1, eukaryotic initiation factor 4E-binding protein; eIF2B eukaryotic initiation

factor 2B; p70S6K, p70 ribosomal S6 kinase; eEF2, eukaryotic elongation factor (adapted

from Atherton et al. 2005).

The most compelling mechanism proposed to mediate the specificity of training and

subsequent interference effect with concurrent training may be the AMPK-AKT “master-

switch” hypothesis of Atherton and colleagues (Figure 1.20). In a rodent model in which

muscle fibres were electrically stimulated for prolonged periods at low frequency (to mimic

endurance training) or for short periods with high-frequency (to mimic resistance training)

73
they observed a reciprocal relationship in the activation of AMPK and AKT pathways in

response to these extreme divergent stimuli. Specifically, after low-frequency stimulation they

observed increased AMPK-TSC2 activity, PGC-1α gene expression and an inhibition of

mTOR mediated translation initiation. Conversely, after high-frequency stimulation there was

increased AKT-mediated hypertrophy signalling concomitant with a decrease in AMPK and

suppression of TSC2 activity. Based on these findings in a single muscle electrical stimulation

model to mimic exercise, these workers proposed that the AMPK and AKT signalling may

represent divergent pathways that when activated direct skeletal muscle adaptation to either

an aerobic or hypertrophic phenotype (Figure 1.20).

Collectively, the current literature provides a number of possible mechanisms to

explain the specificity of training adaptation in response to strength and endurance exercise.

However, as it appears that divergent adaptive phenotypes are induced via the complex

manipulation of numerous common signalling and gene expression pathways this highlights

the intricacy of adaptation to exercise stimuli. Regardless, alternating exercise modes during

concurrent training may reduce the capacity for the simultaneous acquisition of hypertrophy

and / or mitochondrial training-induced adaptation responses compared with single mode

training.

74
 1.4 Summary & aims of this thesis

The specificity of training adaptation is highlighted by comparing the distinct adaptive

responses in skeletal muscle to endurance versus heavy resistance training. Heavy resistance

training increases muscle size and strength while regular endurance training results in

enhanced oxygen kinetics and improved resistance to fatigue. It would appear that skeletal

muscle adaptive responses are reduced when incorporating concurrent endurance and

resistance exercise stimuli, producing moderate alterations in muscle phenotype when

compared to single mode training. However, the molecular events that promote or inhibit the

specificity of training adaptation are incompletely resolved and determining the interaction of

adaptive pathways when undertaking concurrent strength and endurance training remains

elusive. Moreover, the current understanding of intracellular signalling and gene expression

with various modes of training is limited due to the specific transient and time-dependent

molecular responses to exercise. Accordingly, there is a need to better define the acute and

chronic responses to exercise by manipulating the mode, volume, intensity and frequency of

training thereby elucidating the specific molecular and genetic mechanisms that ultimately

determine the specificity of training adaptation.

The aims of this thesis were to 1) systematically evaluate the time-course of a spectrum

of cellular and molecular markers specific to the regulation of muscle contractile protein and

subsequent hypertrophy, after the imposition of different resistance training protocols and 2) to

quantify the early response to divergent training stimuli in competitive athletes who are

highly specialised / adapted to a single discipline, and to establish the degree of “signalling

specificity” in these athletes.

75
 Chapter Two

High-frequency training stimulus attenuates AKT and

exacerbates TNFα signalling responses in skeletal muscle

Adapted from: Coffey, V.G., Reeder, D.W., Lancaster, G.I., Yeo, W.K., Febbraio, M.A.,

Yaspelkis III, B.B., Hawley, J.A. American Journal of Physiology Endocrinology and

Metabolism (In Review).

76
2.1 Introduction

Skeletal muscle is the most abundant tissue in the human body and its normal physiology

plays a fundamental role in health and disease. During many disease states, a dramatic loss of

skeletal muscle mass (atrophy) is observed. In contrast, chronic resistance training results in

increased skeletal muscle size (hypertrophy) and changes in muscle contractile properties that

ultimately lead to gains in strength and power (Fry et al. 2003). While such adaptations

involve multiple factors including nutrient availability, genetic predisposition and

environmental factors etc, they are likely to be the result of the cumulative effect of repeated

training bouts, with the cellular responses leading to these long-term adaptations occurring

during and after each training session (Widegren et al. 1998; Atherton et al. 2005; Yang et al.

2005). Indeed, many contraction-induced signalling events in muscle appear to be maximally

activated in the initial (0-4 h) period post-exercise, returning to basal levels within 24 h

(Widegren et al. 1998; Nader and Esser 2001). This short-term, transient increase in signalling

activation following contraction represents a stimulus capable of initiating downstream events

co-ordinating an increase in gene expression and subsequent protein synthesis (Atherton et al.

2005; Cuthbertson et al. 2005).

The signalling pathways that initiate adaptive processes in skeletal muscle constitute a

complex network of kinases and phosphatases that are often subject to a high degree of

feedback regulation, cross-talk, and transient activation (Glass 2005). While our current

understanding of the signal transduction pathways controlling skeletal muscle hypertrophy

and atrophy are incompletely resolved, a growing body of evidence identifies several key

signalling cascades that are pivotal to these adaptation processes (Glass 2005). For example,

activation of insulin-like growth factor-1 (IGF-1) and AKT / mammalian target of rapamycin /

p70 S6 kinase is sufficient to induce skeletal muscle hypertrophy (Adams and McCue 1998;

Bodine et al. 2001b), while this signalling cascade can also block the transcriptional up-

regulation of key mediators of skeletal muscle atrophy (Latres et al. 2005), the ubiquitin-

77
ligases MuRF1 and MAFBx (also called Atrogin-1). Activation of the NFκB transcription

pathway, by cachectic factors such as TNFα and inhibitor NFκB kinase, is sufficient to induce

skeletal muscle atrophy, in part via NFκB-mediated up-regulation of MuRF1 (Cai et al. 2004).

Much of the work that has attempted to elucidate the signalling pathways regulating

hypertrophy / atrophy in skeletal muscle has utilised transgenic manipulation, chronic

unloading or electrical stimulation. Such models may not be typical of the loading patterns

encountered with daily physical activity. To date, few studies have incorporated in vivo

exercise-induced contractile activity as a stimulus to examine changes in growth factor and

inflammatory signalling cascades. The present study compared a conventional-frequency

resistance training regimen with a novel high-frequency “stacking” protocol designed to

generate a summation of transient exercise-induced signalling responses in order to identify

the discrete cellular and molecular responses that take place following repetitive overload.

The hypothesis was that when high-frequency resistance training sessions were performed

with short (i.e. 3 h) recovery periods, the transient response of key signalling pathways

initiating hypertrophy may be extended and additive compared to when the same work was

undertaken with longer (i.e. 48 h) recovery.

2.2 Methods

Experimental Design

Seventy-two male Sprague-Dawley rats ~6 wk of age (mass 351 ± 17 g) were obtained from

Harlan (San Diego, CA) and housed four per cage in an environment maintained at ~21 °C

with an artificial 12:12 h light-dark cycle. All animals received a standard chow diet (63%

carbohydrate, 17% fat and 20% protein, no. 112386, Dyets, Bethlehem, PA) for the duration

of the study and had ad libitum access to food and water. Animals were assigned to one of

three treatment groups: control (Con, n = 6); high-frequency “stacked” training protocol (HF;

n = 36) or conventional-frequency training protocol (CF; n = 30). Exercise-trained groups (HF

78
and CF) were further subdivided into “stacked” training that completed either one, two, three

or four exercise sessions on the same day (1×, 2×, 3× or 4×, n = 6 per group) or conventional

training, that completed up to three exercise sessions over 5 d (DAY 1, DAY 3 or DAY 5 n =

6 per group). Following the completion of both HF and CF, two groups of animals were

sacrificed 24 h and 48 h after their last training bout (n = 6 per group). CF and HF training

protocols were matched for total work. HF “stacked” training comprised four bouts of 3 sets ×

10 repetitions separated by 3 h recovery while CF training consisted of three bouts of 4 sets ×

10 repetitions with 48 h recovery between resistance training bouts (Figure 2.1). All

experimental and training procedures were approved by the Institutional Animal Care and Use

Committee at California State University, Northridge and conformed to the guidelines for the

use of laboratory animals published by the US Department of Health and Human Resources.

Figure 2.1 Representative schematic of high-frequency “stacking” and conventional-

frequency resistance training protocols. The stacked protocol was comprised of four bouts of

3 × 10 repetitions separated by 3 h recovery and completed within 10 h on a single day.

Conventional training consisted of three bouts of 4 × 10 repetitions with 48 h between

resistance training bouts completed over 5 d. Protocols were matched for total work and

repetitions were performed at 75% one-repetition maximum with 3 min recovery between

sets. Animal groups (n = 6) were sacrificed and white quadriceps muscle extracted 3 h after

every training bout (arrows), and 24 and 48 h following the final exercise session of each

protocol.

79
Resistance Training Protocols and Animal Sacrifice

One repetition maximum (1-RM) was determined for all animals a minimum of 5 d prior to

commencement of a training period. The 1-RM established the physical load that could be

lifted once but not a second time with the same squat-training equipment that was utilised

during all training sessions. Mean 1-RM for all animals was 998 ± 215 g. All subsequent

resistance-training protocols were performed at 75% of 1-RM. The core components of the

training protocol and apparatus utilised in the present study have been described in detail

previously (Krisan et al. 2004). Briefly, the apparatus consisted of two 45 cm vertical metal

rods 0.5 cm in diameter set 31 cm apart on a 15 cm × 20 cm stainless steel metal base securely

inserted into a 2.54 cm thick wood platform. A 33 cm × 2.54 cm wood crossbeam was

outfitted with two brass sleeves and placed on the two vertical rods, allowing for uninhibited

vertical movement. An aluminium holder, moulded to accommodate the rats, was attached to

the centre of the crossbeam at a 90° angle relative to the base. Animals were strapped into a

nylon vest and attached to the aluminium holder with Velcro straps before being placed in a

squat position using safety stoppers on each rod to support the load. Two 5 cm metal pegs

attached vertically on opposite ends of the crossbeam were used to mount calibrated miniature

weight plates. A brief low-voltage electrical stimulus (10 V, 0.3-s duration) was delivered by

manually depressing a switch that allowed current to flow through an electrode attached to the

tail of the animals to initiate each repetition. After each repetition, the animals were

repositioned on the apparatus such that their legs were beneath the torso. A repetition was

initiated as soon as practicable following each prior repetition (i.e. cessation of movement and

re-positioning – mean interval approximately 2 s) and repeated until 10 repetitions were

completed. The animals were allowed to rest for 3 min between each set and were removed

from the apparatus and returned to their cage during the recovery period. Group sacrifice (n =

6) was conducted 3 h after every resistance training session for both CF and HF training

80
protocols, and 24 and 48 h following the final exercise session of each protocol, respectively.

Animals were sacrificed via cervical dislocation and prepared for hind limb muscle collection.

Portions of the white quadriceps (WQ) were surgically removed from the left and right hind

limbs in sequence and freeze clamped in liquid N2. Muscle samples were stored at –80 oC

until subsequent analysis.

Analytical Procedures

Muscle Glycogen Concentration

Muscle samples (~40-50 mg) were freeze-dried with visible connective tissue removed during

powdering. Aliquots (~3 mg) of freeze-dried muscle were extracted with 250 µL of 2 M

hydrochloric acid, incubated at 100 ºC for 2 h and then neutralised with 750 µL of 0.67 M

sodium hydroxide for subsequent determination of glycogen concentration via enzymatic

analyses (50mM Tris, 25mM HCL, 1mM MgCl2, 0.5 mM DTT, 0.3mM ATP, 0.05mM

NADP and 1U/ml HK, 0.1 U/ml G-6-PDH) with NADH and glucose standards by

fluorometric detection. Glycogen concentration was expressed as millimoles of glycogen⋅kg-1

d.w.

Western Blotting

Materials

Monoclonal anti-phospho-AKTSer473 (#4058), polyclonal anti-phospho-mTORSer2448 (#2971), -

p70 S6 kinaseThr389 (#9205), -4EBP1Thr70 (#9455), -p38 MAP kinaseThr180/Tyr182 (#9211), -

FKHRSer256 (#9461) -IKKα/βser176/180 (#2681) and polyclonal anti-AKT (#9272), -p70 S6

kinase (#9202), -p38 MAP kinase (#9212), and -TNFα (#3707) were from Cell Signalling

Technology, Inc. (Beverly, MA, U.S.A.). Polyclonal anti-mTOR (#07-231) was from Upstate

Signalling Solutions (Charlottesville, Va, U.S.A.). Anti-phospho-AMPKthr172 was raised

against AMPK alpha peptide (KDGEFLRpTSCGAPNY) as described previously (Clark et al.

81
2004). Anti-rabbit secondary antibody and enhanced chemiluminescence reagents were from

Amersham Biosciences (Buckinghamshire, U.K.) and Pierce Biotechnology (Rockford, IL,

U.S.A.).

Procedure

Samples were homogenised in ice cold homogenisation buffer containing 50 mM Tris-HCL,

pH 7.5, 1 mM EDTA, 1 mM EGTA, 10% glycerol, 1% triton-X, 50 mM NaF, 5 mM Na

pyrophosphate, 1 mM DTT, 10 µg/mL trypsin inhibitor, 2 µg/mL aprotinin, 1 mM

benzamidine and 1 mM phenylmethylsulfonyl fluoride. The lysate was kept on ice at all times

then centrifuged at 12 000 g for 20 min at 4 oC. The supernatant was transferred to a sterile

tube and subsequently aliquoted to determine protein concentration (Pierce, Rockford, IL,

U.S.A.). Aliquots were stored at –80 oC until analysis. Aliquots of lysate (60-80 µg of protein)

were re-suspended in Laemmli sample buffer. Proteins were then separated by SDS/PAGE,

transferred to polyvinylidenedifluoride membranes (Bio-Rad, Hercules, CA, U.S.A.), blocked

with 5% non-fat milk for 90 min, washed with TBST (10 mM Tris HCl, 100 mM NaCl,

0.02% Tween) and incubated with appropriate primary antibodies overnight at 4 oC.

Membranes were washed with TBST and incubated with an appropriate secondary antibody

for 60 min. Proteins were visualised by chemiluminescence and quantified by densitometry.

Samples from each training group were run on the same gel and the amount of protein from

the densitometric quantification is expressed as arbitrary units.

Statistical Analysis

Immunoblot phosphorylation and total protein data are expressed in arbitrary units relative to

non-exercise controls. Differences between means were determined by a one-way analysis of

variance (ANOVA) with Newman-Keuls post-hoc test (SigmaStat for windows version 3.11).

82
All values are expressed as means and standard error (SE) with the critical level of

significance established at P <0.05.

2.3 Results

Muscle Glycogen

Muscle glycogen content in HF was decreased ~30-35% 3 h after the initial training session

and remained below non-exercise control values for each subsequent bout (P<0.05, Figure

2.2A). Muscle glycogen levels were restored to control values after 24 and 48 h of recovery.

CF resulted in a decline in muscle glycogen 3 h after training on DAY 1 (NS, Figure 2.2B).

After DAY 3 there was an increase in glycogen content compared to control and all time

points (P<0.05), but thereafter muscle glycogen levels were not different to non-exercise

control values.

Signalling Responses

5’ Adenosine Monophosphate Activated Protein Kinase (AMPK)

As might be expected with the decline in muscle glycogen after the initial training bout,

phosphorylation of AMPKthr172 increased gradually after the HF training bouts (~25-40%)

reaching significance 3 h after bout 4 compared to 48 h post-exercise (~55%, P<0.05, Figure

2.2C). In contrast, there were no differences in phosphorylated AMPK thr172 over time with the

CF training protocol (Figure 2.2D).

AKT / Mammalian Target of Rapamycin (mTOR) / Forkhead Box O1 (FoxO1)

Phosphorylation of AKTser473 was significantly decreased following the second bout of HF

training (P <0.05) and remained suppressed for the remainder of this regimen. This

suppression of AKT persisted for up to 48 h after completion of the HF training protocol

(Figure 2.3A). In contrast, CF training had little effect on AKT phosphorylation (Figure

2.3B). mTOR was not significantly altered following either training protocol (Figure 2.3C and

83
2.3D). FoxO1ser256 phosphorylation was decreased by ~24% (2× and 3×, NS) and ~26% (24 h,

NS) with HF and CF resistance training, respectively, but these changes were not significant

(Figure 2.3E and 2.3F).

Figure 2.2 Muscle glycogen content (A, B) and 5’ adenosine monophosphate activated

protein kinasethr172 (AMPK) phosphorylation (C, D) following either high-frequency

“stacked” resistance training comprising four bouts of 3 × 10 repetitions separated by 3 h

recovery (A, C; n = 6 per group) or conventional-frequency training consisting of three bouts

of 4 × 10 repetitions with 48 h between resistance training bouts (B, D; n = 6 per group).

Protocols were matched for total work and repetitions were performed at 75% one-repetition

maximum with 3 min recovery between sets. White quadriceps muscle was extracted 3 h after

every training bout, and 24 and 48 h following the final exercise session of each protocol,

respectively. Results are group means (± SE) and p-AMPK arbitrary values are expressed

relative to control. Significant difference (One-way ANOVA, P<0.05) vs. *control; § 48 h; ╫

all.

84
Figure 2.3 Phosphorylated AKTser473 (A, B) and mammalian target of rapamycinser2448

(mTOR; C, D) relative to total, and FKHRser256 (FoxO1) phosphorylation (E, F) following

either high-frequency “stacked” resistance training comprising four bouts of 3 × 10 repetitions

separated by 3 h recovery (A, C, E; n = 6 per group) or conventional-frequency training

consisting of three bouts of 4 × 10 repetitions with 48 h between resistance training bouts (B,

D, F; n = 6 per group). Protocols were matched for total work and repetitions were performed

at 75% one-repetition maximum with 3 min recovery between sets. White quadriceps muscle

85
was extracted 3 h after every training bout, and 24 and 48 h following the final exercise

session of each protocol, respectively. Results are group means (± SE) and data are arbitrary

values expressed relative to control. Significant difference (One-way ANOVA, P<0.05) vs.

*control; † 1×.

p70 S6 Kinase (p70 S6K) / Eukaryotic Initiation Factor 4E-binding Protein (4E-BP1)

No difference in 4E-BP1thr70 phosphorylation was observed following HF and CF resistance

training (~15-25%, NS, Figure 2.4A and 2.4B). In contrast, p70 S6K phosphorylation was

increased significantly after both HF and CF resistance training. Phosphorylation of p70

S6Kthr389 was increased 3 h post-exercise with HF compared with control values, reaching

significance after 3× and 4× bouts of training (~500%, P<0.05, Figure 2.4C). Likewise, p70

S6K increased 3 h after CF training, an increase that was significantly different from control

on DAY 1 and DAY 5 (~500-700%, P<0.05, Figure 2.4D). Phosphorylation of p70 S6K had

returned to control levels 24 and 48 h after the final training bout for both training protocols.

Cytokines and Mitogen Activated Protein Kinase (MAPK)

HF resistance training resulted in increased expression of tumor necrosis factor alpha (TNFα)

at all post-exercise time points (~13-54%) but was only significantly different from control 3

h after the fourth training bout (P<0.05, Figure 2.5A). TNFα content significantly increased

after DAY 1 of CF (~38%, P<0.05) but had returned to control values by DAY 5 (Figure

2.5B). Significant increases in p38thr180 MAPK phosphorylation were consistently observed

after each bout with HF training and 24 h after the last exercise bout (~67-100%, P<0.05,

Figure 2.5C), while CF training increased p38 compared to control on DAY 1 and DAY 3

(~65-118%, P<0.05, Figure 2.5D). Inhibitor kappa B kinase alpha/beta (IKKα/βser180/181)

phosphorylation was significantly higher than control following 3 h recovery after all HF

86
training bouts (~65-75%, P<0.05, Figure 2.5E) but was only increased following exercise on

DAY 1 with CF resistance training (~63%, P<0.05, Figure 2.5F).

Figure 2.4 Eukaryotic initiation factor 4E-binding proteinthr70 (4E-BP1; A, B)

phosphorylation and ribosomal p70 S6 kinasethr389 (p70 S6K) phosphorylation relative to total

(C, D) following either high-frequency “stacked” resistance training comprising four bouts of

3 × 10 repetitions separated by 3 h recovery (A, C; n = 6 per group) or conventional-

frequency training consisting of three bouts of 4 × 10 repetitions with 48 h between resistance

training bouts (B, D; n = 6 per group). Protocols were matched for total work and repetitions

were performed at 75% one-repetition maximum with 3 min recovery between sets. White

quadriceps muscle was extracted 3 h after every training bout, and 24 and 48 h following the

final exercise session of each protocol, respectively. Results are group means (± SE) and data

are arbitrary values expressed relative to control. Significant difference (One-way ANOVA,

P<0.05) vs. *control, ‡ 2×, # 24 h, § 48 h, ╫ all.

87
Figure 2.5 Total tumor necrosis factor alpha (TNFα) content (A, B), phosphorylated p38thr180

mitogen activated protein kinase (MAPK) relative to total (C, D), and inhibitor kappa B

kinaseser180/181 (IKK) phosphorylation (E, F) following either high-frequency “stacked”

resistance training comprising four bouts of 3 × 10 repetitions separated by 3 h recovery (A,

C, E; n = 6 per group) or conventional-frequency training consisting of three bouts of 4 × 10

repetitions with 48 h between resistance training bouts (B, D, F; n = 6 per group). Protocols

88
were matched for total work and repetitions were performed at 75% one-repetition maximum

with 3 min recovery between sets. White quadriceps muscle was extracted 3 h after every

training bout, and 24 and 48 h following the final exercise session of each protocol,

respectively. Results are group means (± SE) and data are arbitrary values expressed relative

to control. Significant difference (One-way ANOVA, P<0.05) vs. *control, # 24 h, § 48 h, ╫

all.

2.4 Discussion

The key components of any training programme are the volume, intensity and frequency of

exercise sessions (Hawley 2002). The sum of these inputs can be termed the training stimulus

that either enhances or impairs adaptation. Initially, training adaptations are directly related to

the volume of work performed. However, the control mechanisms signalling adaptive

responses are eventually titrated by exercise duration (Booth and Watson 1985) indicating

that a maximal duration exists beyond which additional stimulus will not induce significant

adaptation. If continually increasing exercise volume is insufficient for driving the adaptive

response this suggests that the intensity and frequency of the overload stimulus are important

for disruption to homeostasis and subsequent adaptation in skeletal muscle. The present study

compared a conventional resistance training regimen with a novel “stacking” protocol in an

attempt to identify the effects of training frequency on discrete cellular and molecular events

following repetitive overload. It was hypothesised that compared to a conventional resistance

training protocol, high-frequency training sessions would extend the transient response of key

signalling pathways leading to an additive or “stacked” effect and a concomitant up-

regulation of signalling pathways involved in hypertrophy. In contrast to the original

hypothesis, this study provides novel evidence to demonstrate that high-frequency overload

suppressed AKT phosphorylation and exacerbated expression of TNFα, IKK activity and p38

MAPK phosphorylation compared to a conventional training regimen. Nevertheless, both

89
training protocols resulted in increases in p70 S6K phosphorylation independent of the

activation states of AKT and mTOR.

High-frequency training bouts resulted in a persistent suppression of muscle glycogen

content, whereas the longer recovery time (and greater nutrient intake) between conventional

training sessions was sufficient to replenish glycogen levels (Figure 2.2). Indeed, with the

conventional training regimen there was moderate ‘supercompensation’ on DAY 3 whereby

glycogen levels were increased above resting basal values. It has been proposed that AMPK

acts as a “fuel gauge” in muscle cells, switching off ATP-consuming pathways when cellular

energy is low, while concomitantly turning on alternative pathways for ATP regeneration.

Accordingly, the suppressed glycogen content in the working muscles throughout the high-

frequency training protocol was associated with a gradual increase in AMPK phosphorylation

with each successive bout (Figure 2.2). In contrast, with longer recovery between training

bouts and fuel status restored, AMPKthr172 responses were blunted throughout the

conventional-frequency training protocol.

AKT is a critical mediator of insulin / IGF signalling that when activated

phosphorylates multiple substrates mediating important aspects of carbohydrate metabolism,

and protein synthesis and degradation (Taniguchi et al. 2006). This study shows a systematic

down-regulation in the phosphorylation state of AKT following repeated bouts of exercise, an

effect that persisted for up to 48 h following multiple bouts undertaken in a single day (Figure

2.3). Given the proposed role for AKT in compensatory hypertrophy (Bodine et al. 2001b; Lai

et al. 2004) the original hypothesis was that a cumulative increase in the phosphorylation of

AKTser473 would occur following high-frequency resistance training. Nevertheless, AKT

activity has previously been shown to both increase (Nader and Esser 2001; Bolster et al.

2003b; Sakamoto et al. 2004a; Creer et al. 2005) or remain unchanged (Widegren et al. 1998;

Krisan et al. 2004) in response to a variety of contractile stimuli. There are a number of

possible explanations for the dephosphorylation of AKT in response to stacked resistance

90
training bouts. The most likely relates to the suppression and / or activation of kinases and

phosphatases involved in the direct regulation of AKT activity. In this regard, Gao and

colleagues (Gao et al. 2005) have shown that the pH domain leucine-rich repeat protein

phosphatase (PHLPP) specifically controls the phosphorylation state of serine473 and catalyses

its dephosphorylation in vivo significantly reducing AKT activity. Importantly, this

dephosphorylation can lead to an increase in apoptosis and suppression of cell growth, effects

that have yet to be confirmed in skeletal muscle (Gao et al. 2005). Nevertheless, the

possibility exists that the demanding stimulus provided by stacked resistance training bouts

resulted in PHLPP mediated down-regulation of AKT and increased apoptosis.

In addition, phosphorylation of the activation loops on threonine308 and the

hydrophobic motif on serine473 is required for full activation of AKT (Alessi et al. 1997;

Sarbassov et al. 2005b). Insulin receptor substrate-1 (IRS-1) phosphorylation and insulin

signalling has been shown to be impaired by increases in TNFα (del Aguila et al. 1999;

Plomgaard et al. 2005). In the current study a sustained and consistent increase in TNFα

following high-frequency overload was observed. TNFα appears to exert its effect on IRS-1

by activation of IKK in a p38 MAPK-dependent manner (Del Aguila et al. 2000; Gao et al.

2002; de Alvaro et al. 2004). In support of this contention, the present findings show

corresponding IKK and p38 phosphorylation concomitant with AKT dephosphorylation,

indicating a possible TNFα-mediated effect on AKT activity. Del Aguila and colleagues (Del

Aguila et al. 2000) have previously reported that IRS-1 signalling and AKT kinase activation

is impaired by muscle damage-induced TNFα production. Taken together, these findings

indicate the muscle damage following high-frequency resistance training and subsequent

increases in TNFα signalling may have exacerbated the persistent decrease in phosphorylation

of AKT.

AKT is involved in the regulation of numerous cellular processes including protein

synthesis and degradation (Nader 2005). AKT has been shown to mediate protein synthesis

91
and degradation via the AKT-mTOR and AKT-FoxO1 pathways respectively (Nave et al.

1999; Sandri et al. 2004; Stitt et al. 2004; Latres et al. 2005), yet mTORser2448 and FoxO1ser256

phosphorylation was largely unaffected by either resistance training regimen or changes in

AKT phosphorylation (Figure 2.3). Two mTOR protein complexes exist where mTOR binds

with a G-beta-L protein (GβL) and either a rapamycin-sensitive raptor or a rictor protein

(Sarbassov et al. 2005b; Sarbassov et al. 2006). The mTOR-raptor complex appears to

regulate cell growth through p70 S6K and 4E-BP1 while mTOR-rictor phosphorylates and

activates AKTser473 (Sarbassov et al. 2005a). While the mechanism(s) responsible for the

regulation of the mTOR-rictor complex is currently unknown, a decrease in mTOR-rictor with

high-frequency training may have contributed to the down-regulation of AKT

phosphorylation. Furthermore, mTOR-raptor has been shown to be negatively regulated by

the tuberous sclerosis complex 1/2 (TSC1/2)-Ras homologue enriched in brain (Rheb)

pathway and AMPK appears to promote TSC2-Rheb mediated inhibition of mTOR-raptor

activity (Garami et al. 2003; Williamson et al. 2006a). The increase in AMPK

phosphorylation with the high-frequency training stimulus may have contributed to the lack of

response in mTOR activity following this protocol. Indeed, Williamson and colleagues

(Williamson et al. 2006a) have shown AMPK activation suppresses protein synthesis through

repression of mTOR signalling. In the present study a modest decrease in phosphorylation of

the FoxO1 transcription factor following resistance training was also observed (Figure 2.3).

This suggests that increased transcriptional activity of atrophy proteins may occur after

strenuous exercise-induced contraction. However, further work is required to establish the

effect of in vivo contractile activity on FoxO1 activation as previous investigations have

shown AKT regulation of FoxO1 and subsequent ubiquitin ligase activity in cell culture and

transgenic animals (Sandri et al. 2004; Stitt et al. 2004).

Several p70 S6K substrates exist but essentially phosphorylated p70 S6K activates

processes increasing translation efficiency and protein synthesis while 4E-BP1 is deactivated

92
with phosphorylation inhibiting its role as a repressor of the translational machinery (Bodine

et al. 2001b; Ruvinsky and Meyuhas 2006). A novel finding of the present study was the

pronounced summation in p70 S6K phosphorylation with both “stacked” and conventional

resistance training protocols that occurred independent of AKT or mTOR phosphorylation

(Figure 2.4). Phosphorylation of p70 S6K and 4E-BP1 has been shown to be regulated by

AKT (Bodine et al. 2001b; Lai et al. 2004) and mTOR (Burnett et al. 1998; Ali and Sabatini

2005) and evidence suggests these kinases may be fundamental for the control of cell size

(Ohanna et al. 2005). It is difficult to reconcile the increased p70 S6K phosphorylation in the

absence of the activation of its upstream kinases. However, these findings support those of

others showing the activation of p70 S6K with a resistance training-like stimulus in rodents

and humans (Bodine et al. 2001b; Atherton et al. 2005; Cuthbertson et al. 2005). The decrease

in 4E-BP1 phosphorylation in the present study suggests a lack of mTOR mediated

downstream effects that would abolish its role in p70 S6K activation supporting the

contention that p70 S6K phosphorylation may occur independent of AKT / mTOR under

certain conditions (Hornberger et al. 2004; Song et al. 2005). PDK1 has been implicated as

having a role in regulating p70 S6K activation, but it does not appear to phosphorylate p70

S6Kthr389 (Alessi et al. 1998; Pullen et al. 1998). Although evidence suggests that p70 S6K

and 4E-BP1 are direct substrates of mTOR-raptor it cannot be ruled out that other unique

kinases regulate p70 S6K / 4E-BP1 phosphorylation.

TNFα is an inflammatory cytokine shown to negatively affect anabolic processes by

increasing activity of protein degradation pathways, destabilising myogenic differentiation

and altering transcriptional activity (Garcia-Martinez et al. 1994; Lang et al. 2002; Langen et

al. 2004). Primary targets of TNFα signalling include the inhibitor kappa B kinase (IKK) and

p38 MAPK (Li et al. 2005; Chen et al. 2006). A fundamental role of IKK is phosphorylation

of the nuclear factor kappa B (NFκB) inhibitor (IκB) which designates IκB for ubiquitination

and subsequent degradation, releasing the transcription factor NFκB to translocate to the

93
nucleus and initiate the expression of a number of genes, including those involved in

regulation of skeletal muscle protein degradation such as muscle ring finger 1 protein

(MuRF1; Cai et al. 2004). Similarly, TNFα stimulated p38 phosphorylation also appears to

induce gene expression of the E3 ubiquitin ligase muscle atrophy F box (MAFBx) protein

promoting protein degradation in skeletal muscle (Li et al. 2005). The in vivo data from this

study show that changes in IKK and p38 phosphorylation were highly coordinated with the

responses of TNFα (Figure 2.5). Specifically, the repeated stimulus during the stacked

training protocol induced a significant increase in IKK and p38 phosphorylation following

each discrete exercise bout. In contrast, a single exercise bout increased phosphorylation of

IKK and p38 after 3 h recovery on DAY 1 of conventional training, but this response was

diminished with subsequent training bouts. The present findings are in agreement with recent

work by Sriwijitkamol and colleagues (Sriwijitkamol et al. 2006) that showed reduced TNFα

and increased IκB content in human skeletal muscle following an 8 wk exercise programme.

Taken together, these results suggest that chronic exercise is capable of promoting anti-

inflammatory effects that may be protective against stress-induced damage in skeletal muscle.

The initial and sustained increase in IKK / TNFα pathway signalling with high-

frequency overload suggests that resistance exercise generates significant alterations in

cellular homeostasis and a substantial pro-inflammatory response in skeletal muscle.

Moreover, it is likely that the increases in IKK and TNFα in the present study were the result

of muscle damage per se, as a subgroup of animals subjected to an acute bout of prolonged

swimming showed no alterations in IKK phosphorylation or IκBα degradation (data not

shown).

In conclusion, this study compared a high-frequency resistance training protocol

(matched for total work) with a conventional-frequency training regimen in order to elucidate

the discrete signalling events following divergent overload stimuli. The data show that the

frequency of overload is an important factor determining subsequent signalling events that

94
underlie the adaptation processes. Specifically, this work provides novel evidence to

demonstrate that high-frequency overload suppressed AKT phosphorylation and exacerbated

the expression of TNFα, IKKα/β activity and p38 MAPK phosphorylation. In contrast,

conventional-frequency resistance training attenuated these pro-inflammatory signalling

events. Both training protocols resulted in increases in p70 S6K phosphorylation independent

of the activation states of AKT and mTOR. These data provide the first information on the

time-course of events regarding the effects of exercise frequency on signal transduction

pathways governing hypertrophy / atrophy regulatory responses in skeletal muscle in vivo.

95
 Chapter Three

Early signalling responses to divergent exercise stimuli in

skeletal muscle from well-trained humans

Adapted from: Coffey V.G., Zhong Z., Shield A., Canny B.J., Chibalin A.V., Zierath J.R,

Hawley J.A. The FASEB Journal 20(1): 190-2, 2006.

96
3.1 Introduction

Conventional endurance and strength training exercise induce diverse adaptive responses.

Endurance training elicits a variety of metabolic and morphological responses that function to

minimise cellular disturbances during subsequent training sessions (Hawley 2002), including

mitochondrial biogenesis (Holloszy 1967), a fast-to-slow twitch fibre phenotype

transformation (Zierath and Hawley 2004), a decreased reliance on carbohydrate-based fuels

during sub-maximal exercise (Holloszy et al. 1977) and improved whole-body aerobic

capacity (VO2max; Saltin 1969). In contrast, strength / resistance training has minimal effect on

the muscle fibre phenotype (Williamson et al. 2001), VO2max (Allen et al. 1976), or patterns of

substrate utilisation during sub-maximal exercise. Strength / resistance training and some

forms of high-intensity intermittent stimulation are associated with an increase in protein

synthesis (Nader and Esser 2001; Rennie et al. 2004) and substantial muscle hypertrophy

(Rennie and Tipton 2000) that promotes gains in maximal force output, whereas endurance

training does not promote muscle hypertrophy or increase the force-output ability of muscle

(Hickson 1980).

Although the molecular signalling mechanisms that transduce the effects of contractile

activity to modify the skeletal muscle phenotype and function are incompletely understood, a

number of pathways have been implicated. For example, activation of the 5’ AMP-activated

protein kinase (AMPK)- peroxisome proliferator activated receptor gamma co-activator-1α

(PGC-1α) signalling pathway may partly explain some of the adaptations to endurance

training, while selective up-regulation of the AKT-tuberous sclerosis complex 2 (TSC2)-

mammalian target of rapamycin (mTOR) cascade may underlie the increase in skeletal muscle

protein synthesis and growth observed after resistance training (Atherton et al. 2005). While

the chronic, training-induced adaptations in skeletal muscle are the result of the cumulative

effect of repeated bouts of exercise, the initial signalling responses that promote long-term

adaptations are likely to occur after each training session (Widegren et al. 2001). Accordingly,

97
this study investigated the early signalling events in skeletal muscle that are elicited in

response to different types of contractile stimuli (e.g. endurance and strength training).

Utilising a unique design in which athletes from different training backgrounds (i.e.

chronically endurance- or strength-trained) undertook exercise in their habitual training mode,

and “crossed over” to perform an acute bout in a non-familiar exercise discipline, the results

are expected to characterise the acute signalling events underlying the specific adaptations to

diverse modes of contractile activity associated with endurance and strength training.

3.2 Methods

Materials

Monoclonal anti-phospho-extracellular regulating kinase 1/2 (ERK1/2Thr202/Tyr204), polyclonal

anti-AKTSer473/Thr308, were from New England BioLabs (Beverly, MA, U.S.A.). Polyclonal

anti-p-Tuberin/TSC2Thr1462, Phospho-AMPKThr172, polyclonal anti-ribosomal protein S6

kinase 70 kDa (p70 S6KThr389) kinase, polyclonal anti-phospho- eukaryotic translation

initiation factor 2 beta (eIF2BSer540) and polyclonal anti-phospho-p38Tyr188/182 were from Cell

Signaling Technology, Inc. (Beverly, MA, U.S.A.). Enhanced chemiluminescence reagents

were from Amersham Biosciences (Buckinghamshire, U.K.). Other reagents are from Sigma

Chemicals (St. Louis, MO, U.S.A.).

Subjects

Thirteen trained male volunteers participated in this investigation. Six subjects were cyclists

who had been participating in regular endurance training (ET) for 8 yr. These subjects did not

undertake any form of resistance training. The other 7 subjects were power-lifters who had

been participating in regular strength / resistance training (ST) for 9 yr and did not participate

in any kind of endurance training. Characteristics of subjects from the two diverse training

backgrounds are displayed in Table 3.1. The experimental procedures and possible risks

98
associated with the study were explained to each subject, who gave written informed consent

prior to participation. The study was approved by the Human Research Ethics Committee of

RMIT University.

Table 3.1 Subject characteristics.

Endurance Trained Strength Trained

(n= 6) (n= 7)

Mass (kg) 74.7 ± 7.6 96.9 ± 15.5*

Age (yr) 28.7 ± 6.1 30.7 ± 8.4

Training History (yr) 8.5 ± 2.7 9.0 ± 7.3

VO2peak (ml·kg-1·min-1) 65.2 ± 6.4 36.9 ± 7.4*

Maximum Strength (N·m)

Concentric 214 ± 40 309 ± 45*

Eccentric 243 ± 53 389 ± 60*

All values are means ± standard deviation. * Significant difference between endurance-trained

and strength-trained groups (Students t-test, P <0.05).

Overview of Study Design

The study consisted of a crossover design. All subjects performed two different exercise-

testing protocols in randomised order: one experimental trial was undertaken in the subject’s

habitual training discipline, while the other trial was performed in a non-familiar exercise

mode.

99
Preliminary Tests

Peak Oxygen Uptake (VO2peak)

Peak oxygen uptake (VO2peak) was determined during an incremental maximal cycling test to

volitional fatigue on an isokinetic Lode bicycle ergometer (Groningen, The Netherlands).

Briefly, the test protocol commenced at an intensity equivalent to 3.33 W·kg-1 or 2.5 W·kg-1

of body mass (BM) for endurance- and strength-trained subjects, respectively. This workload

was maintained for 150 s then increased by 50 W for the second workload and 25 W every

150 s thereafter until subjects reached volitional fatigue, defined as the inability to maintain a

cadence >70 rev·min-1. Throughout the maximal test breath-by-breath expired gas was passed

through a flowmeter, an O2 analyser, and a CO2 analyser (Med Graphics, Minnesota) that was

calibrated before testing using a 3-L Hans-Rudolph syringe and gases of known concentration

(4.00% CO2 and 16.00% O2). The flowmeter and gas analysers were connected to a computer

that calculated minute ventilation, oxygen uptake (VO2), CO2 production (VCO2), and

respiratory exchange ratio (RER) from conventional equations.

Maximal Strength

Maximal concentric and eccentric strength was determined using seated leg extensions,

performed on a Kin-Com isokinetic dynamometer (Chattanooga, Tennessee, U.S.A.). The

subject’s right leg was strapped to the actuator arm immediately superior to the lateral

malleolus of the lower leg with the lateral condyle of the femur visually aligned to the

fulcrum of the actuator arm. Contractions were performed at 30°·s-1 and subjects were

instructed to extend their leg and resist the actuator arm with maximal effort during

repetitions. Exercise range of motion was 85°, with leg extension endpoint set at -5° from full

extension. Real time visual feedback was provided for all repetitions. Quadriceps strength was

determined during a series of 3-repetition maximal leg extension sets with each set separated

100
by 120 s. Each individual 1-RM was defined as the peak torque (N·m) recorded during the

concentric and eccentric contraction phases of the test protocol.

Diet/Exercise Control

Twenty-four hours before each exercise testing session (described subsequently), subjects

refrained from vigorous physical activity and were provided with standardised pre-packed

meals that consisted of 3 g CHO·kg-1 body mass (BM), 0.5 g protein·kg-1 BM, and 0.3 g

fat·kg-1 BM, to be consumed as the final intake the evening prior to reporting for an exercise

testing session.

Exercise Testing Session

On the morning of a testing session subjects reported to the laboratory in a 10-12 h overnight

fasted state. After resting quietly in a supine position for 10 min local anaesthesia (2-3 ml of

1% Xylocaine (lignocaine)) was administered to the skin, subcutaneous tissue and fascia of

the vastus lateralis in preparation for muscle sampling. A resting biopsy was taken by using a

6 mm Bergstrom needle with suction applied (Evans et al. 1982). Approximately 100 mg of

skeletal muscle was removed and immediately frozen in liquid N2. At this time, separate sites

on the same leg (~5 cm distal) were prepared for subsequent sampling. Biopsies were taken

from the left leg when subjects performed the cycling exercise session and the right leg for the

resistance training session. Immediately upon completion of each exercise testing session, a

second biopsy was taken and then subjects rested in a supine position for 3 h. At the end of

the 3 h recovery period, during which time the subjects were only allowed access to water, a

third biopsy was taken. Every attempt was made to extract tissue from approximately the

same depth in the muscle and to freeze the sample in liquid N2 within 10 s. Samples were

stored at –80 oC until subsequent analysis.

101
Cycling Exercise Session

Subjects performed 60 min of continuous cycling at a power output that elicited ∼70% of

individual VO2peak.

Resistance Exercise Session

Maximal voluntary isokinetic single leg extensions were performed on a Kin-Com

dynamometer (as described previously). Subjects performed 8 sets of 5 repetitions at maximal

intensity, separated by a 3 min recovery period. Peak and mean torque were recorded for each

leg extension set.

Analytical Procedures

Total RNA Isolation and Reverse Transcription

Total RNA from ~20 mg of wet muscle was isolated using the ToTALLY RNA Kit (Ambion

Inc., Austin, TX, U.S.A.) protocol and reagents. Total RNA concentration was determined

spectrophotometrically at 260 and 280 nm. RNA was reverse transcribed to synthesise first-

strand cDNA using AMV reverse transcriptase (Promega, Madison, WI, U.S.A.) as described

previously (Wadley et al. 2001). The cDNA was stored at -20 οC for subsequent analysis.

Primer Design and mRNA Quantification

Peroxisome proliferator activated receptor gamma co-activator-1α (PGC-1α) primers were

designed using Primer Express software version 2.0 (Applied Biosystems, Foster City, CA.)

from GenBank sequence accession no. NM_013261. Primer specificity was confirmed using

BLAST (Altschul et al. 1990). Primers were purchased from GeneWorks (Adelaide, SA,

Australia). Primer efficiency (E) of each target amplification for a series of dilutions was

calculated using E = (10-1/slope)-1. Primers demonstrated efficient amplification.

102
Real-time PCR was performed using the GeneAmp® 5700 Sequence Detection System

(Applied Biosystems). Reaction volumes (20 µl) contained 2 × SYBR Green PCR Master Mix

(Applied Biosystems), forward and reverse primers and cDNA template (diluted 1:40).

Samples were run in duplicate for 1 cycle (50 °C 2 min, 95 °C 10 min) followed by 40 cycles

(95 °C 15 s, 60 °C 60 s) and fluorescence emissions were measured after each cycle. A

melting point dissociation curve was generated to confirm single product amplification.

Expression of the gene of interest was calculated by subtracting the CT of the target gene for a

given sample from the CT of the appropriate control sample. Expression of the gene of interest

relative to control was calculated using the expression 2-∆CT.

Western Blot Analysis

Skeletal muscle biopsies were freeze-dried overnight and dissected under a microscope to

remove visible blood, fat and connective tissue. Skeletal muscles were homogenised in ice-

cold homogenisation buffer containing 50 mM HEPES, pH 7.5, 150 mM NaCl, 5 mM EDTA,

10 mM sodium pyrophosphate, 2 mM sodium vanadate, and a protease inhibitor cocktail (1

mM phenylmethylsulfonyl fluoride, and 10 µg/mL each of aprotinin, leupeptin, and

pepstatin). The lysate was kept on ice for 30 min and subjected to centrifugation at 12,000 g

for 10 min at 4 ºC. Protein concentration was determined with a BCA Protein Assay (Pierce,

Rockford, IL, U.S.A.). Aliquots of lysate (20 µg of protein) were re-suspended in Laemmli

sample buffer. Proteins were then separated by SDS/PAGE, transferred to

polyvinylidenedifluoride membranes (Millipore, MA), blocked with 7.5% non-fat milk,

washed with TBST (10 mM Tris HCl, 100 mM NaCl, 0.02% Tween 20) and incubated with

appropriate primary antibodies overnight at 4 ºC. Membranes were washed with TBST and

incubated with an appropriate secondary antibody. Both training groups were run on the same

gel. Proteins were visualised by chemiluminescence and quantified by densitometry. The

103
amount of phosphorylated proteins of the densitometric quantification is expressed as

arbitrary units.

Statistical Analysis

Differences in subject characteristics and exercise performance were determined using two-

tailed t-test assuming unequal variances. Real-time PCR mRNA, and immunoblot

phosphorylation and protein data are expressed in arbitrary units. Differences between means

were determined by a one-way analysis of variance (ANOVA) with Newman-Keuls post-hoc

test (GraphPad Prism version 3.0). All values are expressed as means and standard error (SE)

with the critical level of significance established at P <0.05.

3.3 Results

Exercise Performance

The average power output corresponding to ~70% of VO2peak for the 60 min cycling exercise

session was 242 ± 11 vs. 168 ± 10 W for endurance- and strength-trained subjects,

respectively (P <0.001). Four strength-trained subjects were unable to complete the prescribed

workload during the cycling bout. In these cases, power output was reduced to 60% of VO2peak

after 30 min for the remainder of the prescribed exercise time. Peak force during the

isokinetic resistance exercise session was 263 ± 10 vs. 190 ± 4 N for strength- and endurance-

trained subjects, respectively (P <0.001).

Signalling Responses

AMPK

Phosphorylation of AMPK increased immediately following cycling exercise in strength-

trained (54%; P <0.05, Figure 3.1A), but not endurance-trained subjects. Conversely, AMPK

phosphorylation was increased immediately post-exercise in endurance- (114%; P <0.05,

104
Figure 3.1B), but not strength-trained subjects after resistance exercise. Effects on AMPK

phosphorylation were lost within 3 h recovery following both exercise modes.

Figure 3.1 ‘5 adenosine monophosphate kinase (AMPK) phosphorylation in vastus lateralis

muscle of strength-trained (ST; n = 7) and endurance-trained (ET; n = 6) subjects in response

to 60 min cycling at ~70% VO2peak (A) and 8 × 5 maximal isokinetic leg extensions (B).

Values are group means (± SE) at rest, immediately post-exercise (Post) and 3 h post-exercise

(3 h). *Significant difference (One-way ANOVA) rest vs. post (*P <0.05); †Significant

difference post vs. 3 h (†P <0.05).

AKT-TSC2

Following cycling exercise, AKTSer473 phosphorylation was increased in endurance- (50%; P

<0.05), but not strength-trained subjects (Figure 3.2A). The level of AKTThr308

phosphorylation was unchanged (data not shown). After 3 h of recovery, AKT

phosphorylation decreased below resting values in endurance-trained subjects (67%; P <0.01).

AKT phosphorylation was similar between strength- and endurance-trained subjects following

resistance exercise (Figure 3.2B). TSC2 phosphorylation was unaltered after cycle exercise in

either strength- or endurance-trained subjects (Figure 3.2C). However, following resistance

exercise, TSC2 phosphorylation was decreased in endurance-trained subjects immediately

post-exercise (47%; P <0.05), an effect that persisted for 3 h recovery (40%; P <0.05, Figure

3.2D).

105
Figure 3.2 AKT (A, B) and tuberous sclerosis complex-2 (TSC2; C, D) phosphorylation in

vastus lateralis muscle of strength-trained (ST; n = 7) and endurance-trained (ET; n = 6)

subjects in response to 60 min cycling at ~70% VO2peak (A, C) and 8 × 5 maximal isokinetic

leg extensions (B, D). Values are group means (± SE) at rest, immediately post-exercise

(Post) and 3 h post-exercise (3 h). *Significant difference (One-way ANOVA) rest vs. post

(*P <0.05); ‡Significant difference rest vs. 3 h (‡P <0.05, ‡‡P <0.01); †Significant difference

post vs. 3 h (†††P <0.001).

106
Figure 3.3 Eukaryotic initiation factor 2B (eIF2B; A, B) and ribosomal p70 S6 kinase (p70

S6K; C, D) phosphorylation, and ribosomal S6 protein abundance (S6; E, F) in vastus lateralis

muscle of strength-trained (ST; n = 7) and endurance-trained (ET; n = 6) subjects in response

to 60 min cycling at ~70% VO2peak (A, C, E) and 8 × 5 maximal isokinetic leg extensions (B,

D, F). Values are group means (± SE) at rest, immediately post-exercise (Post) and 3 h post-

exercise (3 h). *Significant difference (One-way ANOVA) rest vs. post (*P <0.05, **P

<0.01); ‡Significant difference rest vs. 3 h (‡P <0.05, ‡‡P <0.01); †Significant difference post

vs. 3 h (†P <0.05).

107
eIF2B-p70 S6K

Cycling exercise induced a significant decrease in eIF2B phosphorylation in strength-trained

(P <0.01, Figure 3.3A), but not endurance-trained subjects. eIF2B phosphorylation in

strength-trained subjects was decreased immediately post-exercise (78% P <0.01) and this

effect was maintained after 3 h recovery (63%; P <0.01, Figure 3.3A). eIF2B phosphorylation

was similar after resistance exercise in strength- and endurance-trained subjects following 3 h

recovery (Figure 3.3B). Likewise, p70 S6K phosphorylation was similar between strength-

and endurance-trained subjects after 60 min cycling exercise (Figure 3.3C). However,

resistance exercise elicited a significant increase in p70 S6K phosphorylation in endurance-

trained subjects after 3 h of recovery (118%; P<0.05, Figure 3.3D). Phosphorylation of S6

protein, a substrate for p70 S6K, was increased immediately following resistance exercise in

endurance-trained (129%; P <0.05; Figure 3.3F), but not strength-trained subjects.

ERK1/2-p38

ERK phosphorylation after cycling or resistance exercise was similar between strength- and

endurance-trained subjects (Figure 3.4A and 3.4B). p38 phosphorylation was increased in

strength- (74%; P <0.001), but not endurance-trained subjects immediately after cycling

exercise (Figure 3.4C). In contrast, p38 phosphorylation was significantly increased in

endurance-, but not strength-trained subjects after resistance exercise (28%; P <0.05, Figure

3.4D). All exercise-induced phosphorylation effects were lost after 3 h recovery following

both exercise modes.

108
Figure 3.4 Extracellular regulating kinase (ERK; A, B) and p38 (C, D) MAPK

phosphorylation in vastus lateralis muscle of strength-trained (ST; n = 7) and endurance-

trained (ET; n = 6) subjects in response to 60 min cycling at ~70% VO2peak (A, C) and 8 × 5

maximal isokinetic leg extensions (B, D). Values are group means (± SE) at rest, immediately

post-exercise (Post) and 3 h post-exercise (3 h). *Significant difference (One-way ANOVA)

rest vs. post (*P <0.05, ***P <0.001); †Significant difference post vs. 3 h (†P < 0.05, ††P

<0.01).

PGC-1α mRNA and Protein Expression Responses to Exercise

PGC-1α mRNA was increased to a similar extent after cycling in both endurance-trained

(~8.5-fold, P <0.001) and strength-trained subjects (~10-fold increase, P <0.001). However,

there was little effect of resistance exercise on the mRNA expression of PGC-1α. PGC-1α

protein content after 3 h recovery from cycling or resistance exercise was unchanged in

strength- and endurance-trained subjects (data not shown).

109
3.4 Discussion

Contractile activity associated with physical exercise stimulates multiple signalling events and

induces transient changes in gene transcription (Widegren et al. 2001; Sakamoto and

Goodyear 2002). These acute alterations in cellular homeostasis may be responsible for the

chronic adaptations that occur in skeletal muscle in response to repeated bouts of exercise (i.e.

training). The disparity between the adaptations observed after chronic resistance or

endurance training suggests these two types of contractile stimuli induce differential

signalling and gene regulatory responses (Booth and Thomason 1991). To test this hypothesis,

the current study utilised a unique design in which habitually strength-trained and endurance-

trained athletes undertook an acute bout of exercise in each of these training modes in order to

characterise the specific signalling events associated with diverse modes of contraction. The

results provide evidence for the highly specialised nature of training adaptation and

demonstrate that a degree of “response plasticity” capable of diverse adaptive compliance is

conserved at opposite ends of the endurance-hypertrophy adaptation continuum.

AMPK is involved in the regulation of numerous adaptive responses including

mitochondrial biogenesis, muscle hypertrophy and protein synthesis (Aschenbach et al. 2004).

In response to exercise, isoform-specific and intensity-dependent changes in AMPK activity

have been observed in human skeletal muscle (Yu et al. 2003). AMPK has been implicated as

part of a metabolic ‘switch’ that, in concert with PGC-1α (Terada et al. 2002; Jorgensen et al.

2005), promotes mitochondrial biogenesis and an ‘endurance-training like’ profile (Atherton

et al. 2005). AMPK phosphorylation was increased in skeletal muscle from strength-trained

subjects when non-habitual cycling exercise was performed and from endurance-trained

subjects who undertook non-habitual resistance exercise (Figure 3.1). These changes in

AMPK phosphorylation in human skeletal muscle in vivo contrast with the recent results in

rodent skeletal muscle (Atherton et al. 2005), whereby signalling responses were determined

in response to in vitro electrical stimulation. Compared to rest, low-frequency electrical

110
stimulation to mimic endurance training increased AMPKThr172 phosphorylation (relative to

total AMPK), while high-frequency electrical stimulation (to mimic resistance training)

decreased AMPK phosphorylation (Atherton et al. 2005).

There are a number of possible explanations for the discordant findings between these

studies. The most obvious relates to the use of different loads and stimulation patterns to

induce muscle contraction. In vitro electrical stimulation represents an extreme stimulus,

likely to exceed any stress that would be encountered by human skeletal muscle in vivo.

However, an alternative explanation might be that [AMP] only increased sufficiently to

activate AMPK when subjects performed exercise in their unfamiliar discipline (i.e. when

endurance-trained subjects undertook resistance exercise, or when strength-trained individuals

undertook sub-maximal cycling). In support of this contention, all strength-trained subjects

reported experiencing extreme difficulty completing 60 min of continuous cycling at the

prescribed power output, whereas all endurance-trained individuals coped with the demands

of this exercise task effortlessly. If, in the case of the strength-trained subjects, part of the

cycling exercise bout was undertaken at an intensity above the individual lactate threshold,

then aerobic and glycolytic ATP resynthesis rates would be insufficient to maintain steady-

state [phosphocreatine] and the concentrations of AMP would rise. Indeed, Yu and co-

workers (2003) and Neilsen and colleagues (2003a) have previously shown that during

cycling exercise performed at the same relative intensity, activation of several signalling

intermediates (including AMPK) was greater in skeletal muscle from untrained subjects than

from highly-trained cyclists with a prolonged history of endurance training, probably due to a

better maintenance of the energy charge and a less pronounced exercise-induced acidification

in exercise-trained muscle.

With regard to the increase in AMPK phosphorylation in endurance-trained subjects

following resistance exercise, the recovery between maximal work-bouts was possibly too

short to allow for complete resynthesis of [phosphocreatine]. This would lead to an increase in

111
[AMP] to a level that is sufficient for AMPK activation. Finally, as AMPK has a glycogen

binding domain (Hudson et al. 2003) and activity of AMPK is greater when skeletal muscle

[glycogen] is low (Wojtaszewski et al. 2003), the possibility exists that greater net glycogen

depletion occurred when subjects performed the unfamiliar exercise bout, compared to the

habitual discipline. Unfortunately, adequate muscle sample was unavailable for analyses of

glycogen and metabolite concentrations.

Along with AMPK, activation of PGC-1α has recently been proposed to partially

mediate specific adaptations to endurance training (Atherton et al. 2005). Indeed, evidence for

increased expression of PGC-1α in rodent skeletal muscle 12-18 h after a single bout of

prolonged swimming exercise (Baar et al. 2002) and within 3 h of low frequency electrical

stimulation in vitro (Atherton et al. 2005) has been provided, suggesting that increases in

PGC-1α protein expression represents a key regulatory component of the stimulation of

mitochondrial biogenesis by exercise. In the present study, cycling resulted in marked

increases in PGC-1α mRNA in endurance- and strength-trained subjects, whereas resistance

exercise had little effect on the mRNA expression. While endurance exercise undoubtedly

enhances PGC-1α mRNA expression, possibly through an AMPK-related mechanism (Terada

et al. 2002), further work is required to directly link AMPK-PGC-1α signalling with chronic

adaptations to exercise.

AKT is a critical signalling mediator of cellular growth and metabolism in skeletal

muscle (Glass 2003). AKT directly phosphorylates TSC2, activating mTOR, in part by

deactivating TSC2 (Inoki et al. 2002). AKT can also directly phosphorylate (Nave et al. 1999)

and activate mTOR (Scott et al. 1998) and phosphorylation of both AKT and mTOR are

increased during skeletal muscle hypertrophy (Reynolds et al. 2002). Inhibition of mTOR

activity blocks compensatory skeletal muscle hypertrophy in vivo (Bodine et al. 2001b), while

ablation or inhibition of p70 S6K results in decreases in cell size (Montagne et al. 1999).

Eukaryotic initiation factor eIF2 and its “exchange factor” eIF2B also play key roles in the

112
regulation of protein synthesis and cell growth: phosphorylation of eIF2 inhibits eIF2B and

thus translation initiation. While phosphorylation of eIF2 serves to impair protein synthesis, it

causes up-regulation of the translation of specific mRNAs that encode transcription factors,

therefore exerting effects on gene expression at multiple levels.

In agreement with others (Thorell et al. 1999; Sakamoto et al. 2004a), an increase in

AKTSer473 phosphorylation was observed following cycling exercise in endurance-trained

subjects. However, AKTThr308 phosphorylation was unchanged. At present, there is little data

on the response of AKT after an acute bout of resistance exercise undertaken by strength-

trained subjects, although a recent report provides evidence for increased AKT

phosphorylation in endurance-trained cyclists after moderate-intensity resistance exercise

(Creer et al. 2005). Interestingly, the increase in AKT phosphorylation in that study was

observed only when subjects commenced exercise with high (~600 mmol/kg dry mass)

skeletal muscle glycogen content and not when pre-exercise glycogen levels were low (~200

mmol/kg dry mass). Phosphorylation of AKT deactivates GSK3, which under basal

conditions is thought to promote activation of glycogen synthase (Cross et al. 1995) and

inhibit eIF2B activity (Vyas et al. 2002). The current results show a moderate increase in

eIF2B phosphorylation in skeletal muscle 3 h after strength-trained subjects performed

resistance exercise, and a concomitant decrease in phosphorylation after these subjects

undertook endurance exercise. These findings are perplexing and suggest that strength trained

subjects activated a prolonged translation initiation following endurance exercise, although

the mechanism underlying this effect remains unknown.

The involvement of p70 S6K in skeletal muscle hypertrophy has been implicated from

a variety of work / force overload models(Baar et al. 1999; Bodine et al. 2001b; Nader and

Esser 2001; Rommel et al. 2001). Phosphorylation of p70 S6K and subsequent activation of

ribosomal protein S6 enhances translation of mRNAs encoding elongation factors and

ribosomal proteins, thereby increasing translational capacity (Kubica et al. 2005). Resistance

113
exercise in endurance- but not strength-trained subjects elicited a significant increase in p70

S6K phosphorylation after 3 h recovery (Figure 3.3D) and in ribosomal S6 protein

phosphorylation immediately post-exercise (Figure 3.3F). This finding is in agreement with

previous work in humans (Karlsson et al. 2004), which showed that p70 S6K phosphorylation

was increased following resistance training in healthy untrained men 2 h post-exercise when

branch chain amino acids were administered. p70 S6K phosphorylation is also increased with

high-frequency electrical stimulation and resistance training to induce cell growth and

hypertrophy in rodents (Baar et al. 1999; Nader and Esser 2001; Kubica et al. 2005). An

explanation for the lack of change in p70 S6K and S6 protein in the strength-trained subjects

following resistance exercise is that these proteins are already sufficiently up-regulated to

accommodate any further strength gains that may occur after subsequent bouts of resistance

exercise (i.e. negative feedback). This theory may also explain why phosphorylation of p70

S6K, a translational regulator, was only increased in endurance-trained subjects 3 h following

resistance exercise. The increase in p70 S6K phosphorylation is consistent with the

observation that phosphorylation of this protein and subsequent protein synthesis in skeletal

muscle are only elevated in the long-term recovery period after an acute bout of resistance

exercise undertaken by untrained subjects (Karlsson et al. 2004) and after in vitro electrical

stimulation (Baar et al. 1999; Nader and Esser 2001). These models are representative of

skeletal muscle with large potential for plasticity to adapt (i.e. the malleability of structure and

function has yet to be determined).

The specific responses of mitogen activated protein kinases (MAPK) to different

forms of exercise / contraction are incompletely understood. Indeed, previous investigations

have established variable MAPK signalling responses with altered metabolic and mechanical

stress, contraction modes, and training status following a variety of exercise stimuli

(Widegren et al. 1998; Wretman et al. 2001; Nielsen et al. 2003a; Thompson et al. 2003; Yu

et al. 2003). In accordance with some (Nader and Esser 2001), but in contrast with other

114
studies (Wretman et al. 2001), findings from the current study provide no evidence for

exercise-specific or training-specific effects on either ERK1/2 and p38 phosphorylation

(Figure 3.4). The ERK1/2 pathway has been proposed to play a role in the formation of slow

muscle fibres and to inhibit the formation of fast muscle fibres (Murgia et al. 2000; Higginson

et al. 2002). While both forms of contraction were associated with a transient increase in ERK

phosphorylation immediately post-exercise and a return to resting values after 3 h of recovery,

these changes failed to reach statistical significance. Both low- and high-frequency electrical

stimulation of rodent skeletal muscle leads to increased ERK1/2 phosphorylation (Atherton et

al. 2005), suggesting that this pathway is involved in a general response to contractile activity.

With regard to the responses of the p38 MAPK pathway to different exercise modalities,

when subjects undertook exercise in their non-familiar activity, p38 MAPK phosphorylation

was increased. Contraction-induced phosphorylation of p38 MAPK is induced by high

mechanical stress, which might partly explain the increase in phosphorylation after

endurance-trained subjects performed heavy resistance exercise (i.e. mechanical loading to

which the muscle was unaccustomed or poorly adapted) (Wretman et al. 2001). However, in

rodent skeletal muscle, p38 MAPK phosphorylation was unaltered in response to either low-

or high-frequency electrical stimulation (Atherton et al. 2005). Data from this study supports

the contention that p38 MAPK is not always phosphorylated in response to contractile activity

(Wretman et al. 2001; Atherton et al. 2005).

In conclusion, linking specific signalling cascades to specialised metabolic and gene

regulatory responses that occur in response to different modes of exercise is complicated by

the fact that signalling pathways are non-linear and often constitute a complex and

incompletely resolved network with a high degree of cross-talk, feedback regulation, transient

activation and redundancy (Zierath and Hawley 2004). While information pertaining to the

subsets of genes and putative signalling pathways activated in response to different modes of

contraction in humans is emerging (Yu et al. 2003; Yang et al. 2005), the mechanism for

115
adaptive changes in skeletal muscle in response to training is incompletely resolved.

Moreover, whether prior contractile activity (i.e. training history) affects the acute responses

to divergent exercise stimuli is unknown. The results from the current study provide evidence

that chronic endurance or strength training attenuates some of the exercise specific signalling

responses involved in single mode adaptations to training. Although there is a possibility that

pre-existing (genetic) differences between the two groups may also contribute to the acute

exercise responses, this study demonstrates that human skeletal muscle retains the capacity to

respond to divergent contractile stimuli and that a degree of “response plasticity” is conserved

at opposite ends of the endurance-hypertrophy adaptation continuum. Although selective

activation of the AMPK-PGC-1α or AKT-TSC2-mTOR signalling pathways has been

proposed to explain many of the specific adaptive responses to endurance or resistance

training during in vitro electrically stimulated muscle contractions (Atherton et al. 2005), the

in vivo findings from this study provide little evidence for the putative AMPK-AKT switch.

116
 Chapter Four

Interaction of contractile activity and training history on

mRNA abundance in skeletal muscle from trained athletes

Adapted from: Coffey V.G., Shield A., Canny B.J., Carey K.A., Cameron-Smith D., Hawley

J.A. American Journal of Physiology Endocrinology and Metabolism 290(5): E849-855,

2006.

117
4.1 Introduction

Skeletal muscle displays an enormous plasticity to respond to contractile activity and loading

conditions, with muscle from strength- and endurance-trained athletes representing diverse

states of the “adaptation continuum.” Endurance training of sufficient volume and intensity

results in an increased whole-body maximal oxygen uptake and shifts in substrate utilisation

from carbohydrate- to lipid-based fuels, largely as a result of an expanded mitochondrial

density and volume (Irrcher et al. 2003). Such changes are brought about by the coordinated

co-expression of both the nuclear and mitochondrial genomes that, together, ensure proper

assembly and expansion of the mitochondrial reticulum (Adhihetty et al. 2003). Thus,

endurance training-induced adaptations culminate in mitochondrial biogenesis and an

organelle capable of improved ATP provision (Irrcher et al. 2003) and a concomitant

enhancement of endurance capacity (Holloszy and Coyle 1984). In contrast, resistance

exercise, comprising high-intensity, low volume loading, results in increased cross-sectional

area of the trained musculature, mainly due to an increase in muscle contractile protein (Flück

and Hoppeler 2003). Modulation of transcription and translation events contribute to changes

in gene expression and subsequent protein synthesis in response to this mode of training

(Bolster et al. 2003a). Accordingly, resistance training-induced adaptations that culminate in

muscle hypertrophy are the result of integrated gene responses and coordinated molecular

events that support the enlargement of pre-existing muscle cells via the incorporation of

additional myonuclei (Flück and Hoppeler 2003).

Training adaptation can merely be viewed as the accumulation of specific proteins

(Hansen et al. 2005). Hence, the altered gene expression that allows for these changes in

protein concentration is of major importance for any subsequent training adaptation. The

chronic adaptations to any training regimen are likely to be the result of the cumulative effects

of repeated bouts of exercise (Sanders Williams and Neufer 1996; Pilegaard et al. 2000), with

the initial cellular responses that lead to these long-term adaptations occurring after each

118
(acute) training session (Widegren et al. 2001). Previous works have demonstrated the

importance of a wide range of gene expression consistent with their central role in defining

the adaptive phenotype with differing modes of training (Teran-Garcia et al. 2005; Vissing et

al. 2005). However, for many genes the transcriptional activation and translational responses

occur during the first few hours of recovery, returning to basal levels within 24 h of the

exercise stimulus (Neufer and Dohm 1993; Pilegaard et al. 2000). Although much data is

available describing the cellular and molecular mechanisms underlying the transcriptional

regulation of gene expression after exercise the effects of prior training on the acute response

to different types of contraction has not been investigated. Accordingly, the present study was

undertaken to determine the early gene responses after an acute bout of endurance and

resistance training. Utilising a design in which chronically endurance- or strength-trained

athletes undertook exercise in their customary training mode and “crossed over” to perform an

acute bout of exercise in their non-familiar discipline, this study should provide novel data on

subsets of metabolic and myogenic genes that are likely to be fundamental to the specific

exercise-induced adaptation in skeletal muscle.

4.2 Methods

Subjects

Thirteen trained male volunteers participated in this investigation. Six subjects were cyclists

who had been participating in regular endurance training (ET) for an average of 8 ±3 yr.

These subjects were not undertaking any form of resistance training, nor had they performed

such training during the past 2 yr. The other 7 subjects were power-lifters who had been

participating in regular strength / resistance training (ST) for 9 ±7 yr and had not participated

in any kind of endurance training for the past 2 yr. The characteristics of the two training

populations are the same as those described in Chapter Two (page 98). The experimental

procedures and possible risks associated with the study were explained to each subject who
119
gave written informed consent prior to participation. The study was approved by the Human

Research Ethics Committees of RMIT University.

Overview of Study Design

The study consisted of a crossover design. All subjects performed two different exercise-

training protocols to enable within subject comparisons. One experimental trial was

undertaken in the subject’s habitual training discipline, while the other trial was performed in

their non-familiar exercise mode. Exercise testing sessions were separated by a minimum of

10 d.

Preliminary Tests

Peak Oxygen Uptake (VO2peak)

Peak oxygen uptake (VO2peak) was determined during an incremental maximal cycling test to

volitional fatigue on an isokinetic Lode bicycle ergometer (Groningen, Netherlands) as

described in detail previously (Hawley and Noakes 1992).

Maximal Strength

Maximal concentric and eccentric strength was determined using seated leg extensions

performed on a Kin-Com isokinetic dynamometer (Chattanooga, Tennessee). The subject’s

right leg was strapped to the actuator arm immediately superior to the lateral malleolus of the

lower leg with the lateral condyle of the femur visually aligned to the fulcrum of the actuator

arm. Contractions were performed at 30°·s-1 and subjects were instructed to extend their leg

and resist the actuator arm with maximal effort during concentric and eccentric leg extension

repetitions, respectively. Exercise range of motion was 85° with leg extension endpoint set at

-5° from full extension. Quadriceps strength was determined during a series of 3 x 3-

repetition leg extensions with each set separated by 120 s. Each individual 1-RM was defined

120
as the peak torque (N·m) recorded during the concentric and eccentric contraction phases of

the test protocol.

Diet/Exercise Control

Before each exercise testing session subjects were required to refrain from vigorous physical

activity for a minimum of 24 h and were provided with standardised pre-packed meals that

consisted of 3 g CHO·kg-1 body mass (BM), 0.5 g protein·kg-1 BM, and 0.3 g fat·kg-1 BM to

be consumed as the final caloric intake the evening prior to reporting to the laboratory.

Exercise Testing Session

On the morning of a testing session subjects reported to the laboratory in a 10-12 h overnight

fasted state. After resting for 10 min local anaesthesia (2-3 ml of 1% Xylocaine (lignocaine))

was administered to the skin, subcutaneous tissue and fascia of the vastus lateralis in

preparation for muscle biopsies. A resting biopsy (~100 mg) was taken by using a 6 mm

Bergstrom needle with suction applied (Evans et al. 1982), removed and immediately frozen

in liquid N2. At this time a separate site on the same leg (~5 cm distal) was prepared for a

second biopsy. Biopsies were taken from the left leg when performing the cycling exercise

session and the right leg for the resistance training session. Upon completion of each exercise

testing session subjects rested in a supine position for 3 h and during this time water was

consumed ad libitum. At the end of the recovery period a second muscle biopsy was taken.

Every attempt was made to extract tissue from approximately the same depth in the muscle

and to immediately freeze the sample in liquid N2. Samples were stored at –80 ºC until

subsequent analysis.

121
Cycling Exercise Session

Subjects performed 60 min of continuous cycling at a power output that elicited ∼70% of

individual VO2peak.

Resistance Exercise Session

Subjects performed maximal concentric and eccentric leg extensor contractions with their

right leg on a Kin-Com dynamometer (as described previously). Subjects performed 8 sets of

5 maximal effort repetitions with 3 min recovery between sets. Peak and mean torque were

recorded for each set.

Analytical Procedures

Total RNA Isolation and Reverse Transcription

Total RNA from ~20 mg of wet muscle was isolated using the ToTALLY RNA Kit (Ambion

Inc., Austin, TX) protocol and reagents. Total RNA concentration was determined

spectrophotometrically at 260 and 280 nm. RNA was reverse transcribed to synthesize first-

strand cDNA using AMV reverse transcriptase (Promega, Madison, WI). Extracted RNA (1

µg) was heated at 65 °C for 10 min immediately prior to first strand cDNA being generated

using AMV reverse transcriptase (kit A3500; Promega, Madison, WI) with Oligo(dT)15

primer, in the presence of 1mM of each dNTP and 20 U of recombinant RNasin ribonuclease

inhibitor. The reaction was incubated at 42 °C for 60 min and then terminated at 99 °C for 10

min and 4 °C for 5 min. The cDNA was stored at -20 ºC for subsequent analysis. Reverse

transcription was performed for all samples simultaneously. Previous work from this

laboratory has demonstrated minimal variation in efficiency when performed under these

conditions (Murphy et al. 2003).

122
Primer Design and mRNA Quantification

PCR primers were designed using Primer Express software version 2.0 (Applied Biosystems,

Foster City, CA.) from gene sequences obtained from GenBank (Table 4.2). Primer

specificity was confirmed using BLAST (Altschul et al. 1990). Primers were purchased from

GeneWorks (Adelaide, SA, Australia). Efficiency of PCR primers was confirmed by

examining the dynamic range of responses for a series of dilutions of cDNA. Using the slopes

of the lines, the efficiency (E) of each target amplification was calculated using the equation E

= (10-1/slope)-1. All primers used in this study demonstrated efficient amplification.

Real-time PCR was performed using the GeneAmp® 5700 Sequence Detection

System (Applied Biosystems). For the PCR step, reaction volumes of 20 µl contained 2 ×

SYBR Green PCR Master Mix (Applied Biosystems), forward and reverse primers and cDNA

template (diluted 1:40). All samples were run in duplicate. The real-time PCR reaction was

run for 1 cycle (50 °C 2 min, 95 °C 10 min) followed by 40 cycles (95 °C 15 s, 60 °C 60 s)

and fluorescence emissions was measured after each of the repetitive cycles. Because SYBR

green indiscriminately binds to double-stranded DNA, a melting point dissociation curve was

generated to confirm that only a single product was amplified. Heat dissociation of

oligonucleotides detects differences in melting temperature and produces a single dissociation

peak for each nucleotide within a 2 ºC difference in melting temperature (Ririe et al. 1997).

The selection of endogenous control to normalise for input RNA (housekeeping gene) was

confounded by training history (strength or endurance trained) and / or exercise mode (cycling

or resistance training) which generated significant variance in all of the commonly used

exercise housekeeping genes (β-actin, β 2-microglobulin, GAPDH; Jemiolo and Trappe 2004;

Mahoney et al. 2004). The expression of the gene of interest in a given sample was calculated

by subtracting the CT of the target gene for a given sample from the CT of the same gene

from the appropriate control sample, for that individual. The relative expression of the gene of

interest relative to control was then calculated using the expression 2-∆CT.

123
Table 4.2 Primer sequences and concentrations used for real-time PCR.

Gene GenBank Forward Primer (5’ Æ 3’) Reverse Primer (5’ Æ 3’)

Number

MAFBx NM_058229 CATCCTTATGTACACTGGTCCAAAGA TCCGATACACCCACATGTTAATG

MyoD NM_002478 CCGCCTGAGCAAAGTAAATGA GCAACCGCTGGTTTGGAT

Myogenin NM_002479 GGTGCCCAGCGAATGC TGATGCTGTCCACGATGGA

Myostatin NM_005259 CCAGGAGAAGATGGGCTGAA CAAGACCAAAATCCCTTCTGGAT

PGC-1α NM_013261 CAAGCCAAACCAACAACTTTATCTCT CACACTTAAGGTGCGTTCAATAGTC

PDK4 NM_002612 ATGGATAATTCCCGGAATGCT ACTTGGCATACAGACGAGAAATTG

VEGF NM_003376.3 GCGCAAGAAATCCCGGTATA GCTTTCTCCGCTGAGCAA

PGC-1α, peroxisome proliferator activated receptor gamma co-activator 1α; PDK4, pyruvate

dehydrogenase kinase 4; VEGF, vascular endothelial growth factor; MAFBx, muscle atrophy

F-box protein.

Statistical Analysis

Differences in subject characteristics and exercise performance were determined using two-

tailed t-test assuming unequal variances. Data for mRNA abundance with each exercise

session are expressed in relative units after individual samples were normalised relative to

mean values at rest. Data were subjected to repeated measures ANOVA and log-

transformation was performed when significant deviations from homogeneity occurred (SPSS

for Windows Version 12.0.1). Differences between individual means were compared using

Fisher’s LSD test. All values are expressed as means and standard deviation (SD) with the

critical level of significance established at P <0.05.

124
4.3 Results

Exercise Performance

The power output corresponding to ~70% VO2peak for the 60 min cycling bout was 242 ± 11

vs. 168 ± 10 W for ET and ST subjects, respectively (P <0.001). The mean peak force during

the isokinetic resistance exercise session was 263 ± 10 vs. 190 ± 4 N for ST and ET subjects,

respectively (P <0.001).

Changes in mRNA Abundance after Cycling Exercise

Relative changes in mRNA abundance of metabolic genes in muscle sampled 3 h following

60 min of cycling exercise were observed for both ST and ET subjects (Figure 4.1A, 1B).

Peroxisome proliferator activated receptor gamma co-activator 1α (PGC-1α) mRNA was

increased to a similar extent after cycling in both ET (~8.5-fold, P <0.001) and ST subjects

(~10-fold increase, P <0.001). There were also large increases in pyruvate dehydrogenase

kinase 4 (PDK4) mRNA in both groups of subjects after cycling (ET ~26-fold, P <0.05; ST

~39-fold, P <0.05). Likewise, the increase in vascular endothelial growth factor (VEGF)

mRNA was similar in ET (~4.5-fold, P <0.01) and ST subjects (~4-fold, P <0.01) in response

to cycling exercise.

Cycling exercise produced diverse responses between ET and ST subjects for the

myogenic regulatory factors (MRF’s) MyoD and Myogenin (Figure 4.2A, 2B). There was an

increase in both MyoD (~3-fold, P <0.05) and Myogenin mRNA (~0.9-fold, P <0.05) in ET

subjects after cycling. In contrast, cycling decreased MyoD (~0.4-fold: NS) and Myogenin

(~0.4-fold: NS) in ST subjects. Muscle atrophy F-box protein (MAFBx) mRNA abundance

was increased in both subject groups following cycling (ET ~2-fold, P <0.01; ST ~0.4-fold, P

<0.01) while Myostatin mRNA was significantly increased by cycling exercise in ET (~2-

fold, P <0.05) but not ST subjects.

125
Changes in mRNA Abundance after Resistance Exercise

There was little effect of resistance exercise on the mRNA abundance of PGC-1α or VEGF

(Figure 4.3A, 3B). In contrast, PDK4 was significantly increased in ET (~7-fold, P <0.01) but

not ST subjects after resistance exercise. There were divergent responses of genes associated

with myogenic regulation in ET subjects in response to resistance exercise (Figure 4.4A). In

ET subjects, MyoD increased (~0.7-fold: NS) but MAFBx (~0.7-fold: NS) and myostatin

(~0.6-fold: NS) both decreased after resistance exercise. In ST subjects, the mRNA

abundance of the myogenic genes under investigation was not significantly altered by a single

bout of resistance exercise (Figure 4.4B).

126
Figure 4.1 Changes in mRNA abundance for genes associated with endurance responses in

(A) endurance-trained (ET; n = 6) and (B) strength-trained (ST; n = 7) subject vastus lateralis

muscle sampled 3 h after 60 min cycling at ~70% VO2peak. All values are mean ±SD. PGC-1α,

peroxisome proliferator activated receptor gamma co-activator 1α; PDK4, pyruvate

dehydrogenase kinase 4; VEGF, vascular endothelial growth factor. * Significant difference

from rest (Repeated measures ANOVA, *P <0.05, **P <0.01, ***P <0.001).

127
Figure 4.2 Changes in mRNA abundance for genes associated with myogenic responses in

(A) endurance-trained (ET; n = 6) and (B) strength-trained (ST; n = 7) subject vastus lateralis

muscle sampled 3 h after 60 min cycling at ~70% VO2peak. All values are mean ±SD. MAFBx,

muscle atrophy F-box protein. * Significant difference from rest (Repeated measures

ANOVA, *P <0.05, **P <0.01).

128
Figure 4.3 Changes in mRNA abundance for genes associated with endurance responses in

(A) endurance-trained (ET; n = 6) and (B) strength-trained (ST; n = 7) subject vastus lateralis

muscle sampled 3 h after 8 × 5 maximal effort leg extensions. All values are mean ±SD. PGC-

1α, peroxisome proliferator activated receptor gamma co-activator 1α; PDK4, pyruvate

dehydrogenase kinase 4; VEGF, vascular endothelial growth factor. * Significant difference

from rest (Repeated measures ANOVA, P <0.05).

129
Figure 4.4 Changes in mRNA abundance for genes associated with myogenic responses in

(A) endurance-trained (ET; n = 6) and (B) strength-trained (ST; n = 7) subject vastus lateralis

muscle sampled 3 h after 8 × 5 maximal effort leg extensions. All values are mean ±SD.

MAFBx, muscle atrophy F-box protein.

130
4.4 Discussion

Differences in muscle phenotype and subsequent function occur by activating and / or

repressing different subsets of genes. A rate-limiting step for protein synthesis in response to

exercise is the level of transcription and the quantity of mRNA abundance (Booth and

Baldwin 1996; Sanders Williams and Neufer 1996), with the level of mRNA determined by

the rates of mRNA synthesis and decay. New steady state protein synthesis via chronic and

load-specific stimuli can optimise muscle tissue for such diverse physiological function as

strength or endurance capabilities (Goldspink 2003; Grifone et al. 2004).

Previous studies have shown that diverse exercise stimuli induce specific early gene

responses in skeletal muscle (Altschul et al. 1990; Pilegaard et al. 2000; Adams et al. 2004;

Mahoney et al. 2005). However, the degree of specificity in gene responses to divergent

modes of exercise when undertaken by athletes with an extensive history of single mode

training has not been investigated. The methods of the present study employed exercise of the

same relative rather than absolute exercise intensity in an attempt to mimic the habitual

training practices of the two groups of athletes. For the first time, these data provide evidence

demonstrating that divergent forms of exercise undertaken in habitually trained athletes

results in the selective up-regulation / repression of specific gene sets that are likely to

mediate some of the chronic exercise-induced adaptations to training.

The first novel finding of the present study was that a single bout of endurance

exercise undertaken by both strength- and endurance-trained athletes elicited similar changes

in the mRNA abundance of a subset of metabolic genes, namely PGC-1α, PDK4 and VEGF

(Figure 4.1A, 1B). The results showing an up-regulation of these genes in endurance-trained

subjects are in agreement with previous findings (Pilegaard et al. 2000; Gavin et al. 2004;

Cartoni et al. 2005; Mahoney et al. 2005) and provide further support for their proposed roles

in exercise-induced regulation of mitochondrial biogenesis, carbohydrate metabolism and

angiogenesis, respectively (Pilegaard et al. 2000; Baar et al. 2002; Psilander et al. 2003;

131
Gavin et al. 2004; LeBlanc et al. 2004). It has been proposed that adaptation to chronic

resistance training does not create a favourable cellular environment with respect to oxidative

potential (Tseng et al. 1994; Tseng et al. 1995; Hood 2001). The chronic training history of

strength-trained athletes results in an increased cross-sectional area and fibre diameter of the

trained musculature (MacDougall et al. 1982) and it has been suggested that this adaptation

may limit nuclear and mitochondrial transcriptional capacity due to an increase in the

cytoplasm to myonucleus ratio of the cell (Tseng et al. 1994). Furthermore, the mitochondrial

density of enlarged fibres may be diluted, thus increasing diffusion distances for oxygen and

substrates (Hood 2001). Notwithstanding these observations, such conditions did not preclude

an endurance exercise-induced increase in “metabolic genes” in this subject population.

With regard to the acute mRNA responses of “myogenic genes” after a bout of cycling

exercise, the present results demonstrate that MyoD and Myogenin increased in ET but not

ST subjects (Figure 4.2A, 2B). MyoD and Myogenin are expressed in muscle satellite cells

and mature myofibres and have been implicated in mediating the processes of cell

proliferation and differentiation, and in defining muscle phenotype (Willoughby and Nelson

2002; Charge and Rudnicki 2004; Ishido et al. 2004b). Cycling involves minimal eccentric

work for force production suggesting that the divergent responses of MyoD in the present

study were not the result of disparity in the activation of satellite cell populations. The

expression of MyoD is highly induced following resistance exercise, surgical ablation,

denervation and muscle damage (Willoughby and Nelson 2002; Psilander et al. 2003; Ishido

et al. 2004a; Ishido et al. 2004b; Bickel et al. 2005), but an increase in MyoD expression has

not previously been reported after cycling exercise in humans. MyoD expression is increased

after endurance treadmill running in rodents and humans (Armand et al. 2003; Yang et al.

2005). Yang and co workers (2005) observed increased MyoD mRNA abundance in

physically active human subjects following 30 min of treadmill running, and attributed this to

the eccentric component with foot strike and suggested that increased MyoD expression may

132
indicate transcriptional regulation of fibre-specific alterations in myosin heavy chain

expression. Previously, Kadi et al. (2004) have shown Myogenin accumulation following

endurance cycling and this may represent an early signal mediating the control of myofibre

oxidative metabolic properties. In support of this contention a significant increase in the

mRNA abundance of myogenin following cycling exercise in ET subjects was observed.

However, it is unclear why a decrease in Myogenin was observed in strength-trained subjects

following cycling exercise.

If expression of myogenic regulatory factors occurs in mature myofibres as a result of

endurance adaptation the decrease in MyoD and Myogenin mRNA in ST subjects following

cycling may suggest a repressed response due to the adaptive phenotype of the muscle.

However, although fibre-type specific responses are likely to contribute to the discrepancy in

MyoD and Myogenin mRNA abundance following cycling exercise, the precise mechanism

for such unique divergent responses in diversely trained athletic populations remains elusive.

A novel finding of the present study was the significant increase in mRNA abundance

of several ‘negative regulators’ of muscle mass in both ET and ST subjects following cycling

exercise. Increases in MAFBx and Myostatin after cycling exercise has not previously been

reported (Figure 4.2A, 2B). MAFBx (also known as Atrogin-1) is an ubiquitin E3 ligase

involved in the regulation of proteolysis (Lecker et al. 1999). The induction of MAFBx

expression prior to muscle loss and its high expression during accelerated protein degradation

strongly suggest that this plays an important role in initiating and maintaining proteolysis

(Lecker et al. 1999; Gomes et al. 2001). Important regulators of MAFBx expression have

been identified downstream of insulin and insulin-like growth factor signalling including

AKT and the Forkhead box O (FoxO) class of transcription factors, and mammalian target of

rapamycin (mTOR; Sandri et al. 2004; Glass 2005). Stimuli that have been shown to generate

proteolysis in skeletal muscle include fasting and diabetes (Gomes et al. 2001; Dehoux et al.

2004). In the current study, it seems reasonable to conclude that the metabolic stress produced

133
during 60 min endurance exercise performed in a fasted state contributed to the increase in

MAFBx mRNA abundance. Moreover, the increase in MAFBx mRNA in both ET and ST

subjects following cycling indicates a response that is independent of training history.

Myostatin is a transforming growth factor defined as a negative regulator of muscle mass.

Deletion of Myostatin is associated with gross muscle hypertrophy while over-expression

results in lower muscle mass and decreased fibre size (McPherron and Lee 1997; Reisz-

Porszasz et al. 2003). In this study an increase in Myostatin mRNA after cycling in ET but not

ST subjects was observed. These findings are in contrast to recent work in rodents after

swimming exercise (Matsakas et al. 2005). Differences in muscle sampling time course and

exercise mode and duration make comparisons difficult to rationalise these discordant

findings. Previous work involving resistance exercise in humans has shown both decreased

(Kim et al. 2005) and increased (Willoughby 2004) Myostatin mRNA expression. The

specific mechanism through which Myostatin gene expression is controlled and how it exerts

its effect on skeletal muscle is unclear. Nevertheless, the possibility exists that the skeletal

muscle adaptive state in ST subjects as a result of chronic resistance training inhibits any

acute up-regulation in Myostatin gene expression regardless of the exercise mode and that its

regulation following endurance exercise occurs in a phenotype or genotype specific manner.

The patterns of induction of the two subsets of metabolic and myogenic genes after

resistance exercise were variable. Considerable changes from rest were observed for PDK4,

MyoD, MAFBx and Myostatin mRNA abundance in ET but not ST subjects following 3 h

recovery after resistance exercise. PDK4 phosphorylates and inactivates the pyruvate

dehydrogenase complex and facilitates movement of glycolytically derived pyruvate toward

lactate output rather than oxidation (Sugden and Holness 2003). The increase in PDK4 in ET

subjects following resistance exercise probably corresponds to a requirement for increased

glycolytic metabolism to supply energy to sustain the repeated high-intensity contractile

activity, and may also have enhanced muscle glycogen resynthesis during recovery. The

134
present data are in agreement with those of Yang et al. (2005) showing increased PDK4

mRNA expression following resistance exercise.

Compatible with its role in muscle hypertrophy and supporting the work of others

(Willoughby and Nelson 2002; Psilander et al. 2003; Bickel et al. 2005), MyoD mRNA

increased in ET subjects following resistance exercise. The role of MyoD in satellite cell

proliferation and differentiation for subsequent muscle regeneration and hypertrophy has been

previously noted. Resistance training induces muscle overload resulting in local myotrauma

that stimulates a number of processes including satellite cell activation (Hawke and Garry

2001). Therefore, unfamiliar resistance exercise in ET subjects might have been expected to

induce an increase in MyoD expression due to the activation of satellite cells for muscle repair

/ regeneration and as an adaptation response for greater force production and reduced cellular

disturbance with subsequent repeated exercise bouts. MAFBx is a mediator of atrophy

involved in the breakdown of muscle protein while Myostatin negatively regulates

hypertrophy processes (Langley et al. 2002; Hoffman and Nader 2004). Few studies have

investigated the effect of exercise on MAFBx and Myostatin expression in humans and the

specific response to resistance exercise is still to be determined. Nevertheless, preliminary

evidence implicates resistance exercise in the down-regulation of the mRNA content of both

MAFBx and Myostatin, almost certainly reducing their negative affects on subsequent

hypertrophy processes (Roth et al. 2003; Jones et al. 2004; Kim et al. 2005). The results from

this study provide evidence in support of such a contention.

In conclusion, an important component of this work was the elucidation of whether

familiar / unfamiliar exercise induced a suppressed or amplified acute response in subsets of

‘metabolic’ and ‘myogenic’ genes that are likely to be fundamental to specific exercise-

induced adaptation. A single endurance exercise bout produced comparative transcriptional

responses in metabolic genes while training history markedly altered the response of

myogenic genes. Few differences were evident following resistance exercise, however the

135
magnitude of exercise response was notably larger in endurance-trained subjects. A potential

limitation with regard to the interpretation of the current data set is the use of a single post-

exercise time point to evaluate the responses of the exercise-induced genes under

investigation. Muscle samples were collected 3 h after the completion of an exercise bout

because previous studies have reported that for the genes of interest determined in the present

investigation, transcriptional activation occurs primarily during the initial few hours of

recovery (Pilegaard et al. 2000; Psilander et al. 2003; Gavin et al. 2004; Matsakas et al. 2005;

Yang et al. 2005). The results from the present study indicate that independent of exercise

mode, the gene responses in skeletal muscle from endurance-trained athletes appears to be

more sensitive to alterations in the cellular milieu than strength-trained subjects. This may

indicate that a greater degree of muscle plasticity is conserved with regard to the acute mRNA

responses compared to their strength-trained counterparts. Alternatively, the chronic adaptive

state of muscle from strength-trained athletes may require a greater overload stimulus or

repeated bouts of exercise to increase the transcriptional activity of myogenic genes in

response to resistance exercise.

136
 Chapter Five

Summary and Conclusions

137
The principle aims of the studies undertaken for this thesis were to enhance our current

understanding of the molecular responses in skeletal muscle following resistance and

endurance training overload. Both rodent and human in vivo exercise models were employed

to elucidate the effect of overload frequency, exercise mode and muscle phenotype on these

responses. The aims of this thesis were to 1) systematically evaluate the time-course of a

spectrum of cellular and molecular markers specific to the regulation of muscle contractile

protein and subsequent hypertrophy, after the imposition of different resistance training protocols

and 2) to quantify the early response to divergent training stimuli in competitive athletes who

are highly specialised / adapted to a single discipline, and to establish the degree of

“signalling specificity” in these athletes.

The first study (Chapter 2) used a high-frequency model of training and evaluated the

subsequent time-course of signalling responses. Specifically, this study compared

conventional-frequency resistance training to a novel high-frequency “stacked” resistance

training regimen and examined the response of kinases implicated in hypertrophy,

inflammation and atrophy signalling pathways. Activation of intra-cellular signal transduction

in skeletal muscle following contractile activity is a transient response that promotes or

inhibits subsequent gene expression and adaptation. Consequently, the hypothesis of this

investigation was that if a subsequent exercise bout was performed while the anabolic

signalling response to an initial bout was still elevated, this could potentially extend the

duration and / or amplitude of the signal, “stacking” the adaptive response onto that initiated

previously. Contrary to the original hypothesis that “stacked” training would amplify and

extend the anabolic signalling response, the first novel finding from this study was an

extended inflammatory / atrophy signalling response after high-frequency work bouts.

Moreover, high-frequency work bouts induced a co-ordinated and sustained elevation of

inflammatory cytokine signalling. The results from this study suggest that in previously

138
untrained muscle high-frequency resistance training does not enhance the activation of

anabolic pathways and exacerbates inflammation and atrophy signal transduction.

Study one also provides new information on the effect of conventional resistance

training on inflammatory responses in skeletal muscle. In contrast to high-frequency

resistance training, after the initial bout of exercise conventional-frequency resistance training

induced a suppression of inflammatory signalling responses following subsequent exercise

bouts. Moreover, the signalling responses of inflammatory cytokines following three training

bouts were not significantly different to control values and after a further 48 h recovery

decreased below these levels. Thus, the capacity for exercise to induce a pro- or anti-

inflammatory effect in a frequency-dependent manner highlights the importance of recovery

in determining subsequent adaptive events and in promoting or inhibiting the specificity of

training adaptation. In addition, these results indicate a rapid reduction in the inflammatory

response with repeated bouts of exercise in previously untrained muscle. Such information

has important implications for disorders characterised by chronic skeletal muscle

inflammation (e.g. type 2 diabetes). Indeed, the reduction in TNFα signalling observed with

conventional training provides support for the capacity of habitual exercise to reduce the

activity of inflammatory pathways in skeletal muscle.

The second study (Chapter 3 and 4) compared the signalling and mRNA response of

highly-trained strength and endurance athletes to habitual and unfamiliar exercise.

Specifically, strength and endurance athletes undertook a bout of resistance or cycling

exercise, respectively, then “crossed-over” and performed a bout of exercise they do not

normally incorporate into their habitual training regimen. The distinct molecular events that

characterise adaptation to divergent exercise such as resistance and endurance training appear

to be incompatible. Therefore, the hypothesis was that when athletes undertook a training bout

in an unfamiliar exercise discipline, the adaptive phenotype of the muscle would abolish the

expected molecular response associated with the specificity of training. In contrast to this

139
hypothesis, the results from this study indicate “cross-over” to an unfamiliar exercise mode

does not prevent a training-specific adaptive response. However, prior training history had a

profound effect on signalling and mRNA responses to the habitual training modes.

AMPK has been implicated in an “aerobic” adaptation pathway resulting in increased

fat utilisation and mitochondrial biogenesis, while AKT has been identified as an important

regulator of hypertrophy and cell growth in skeletal muscle. The results from this study

provide new information demonstrating that when endurance athletes performed cycling there

was little activation of the AMPK pathway. Likewise, when strength-trained athletes

undertook resistance exercise there was little up-regulation of the AKT signalling pathways.

Conversely, when athletes “crossed-over” and performed a bout of unfamiliar exercise,

strength- and endurance-trained subjects significantly increased AMPK activation. The results

from this study also demonstrated that strength-trained athletes did not promote / inhibit

mRNA abundance of genes regulating muscle mass after resistance training but that cycling

induced a significant increase in the mRNA abundance of genes associated with aerobic

metabolism. Thus, it appears the adaptive phenotype resulting from chronic resistance training

retains a capacity to increase metabolic gene expression in response to endurance training.

Collectively, these findings have a number of important ramifications regarding our current

understanding of the specificity of exercise-induced adaptation responses.

Foremost, it appears that a single bout of habitual exercise in a highly adapted

phenotype is insufficient to induce significant increases in the molecular responses associated

with the desired exercise-specific adaptation. This highlights the importance of overload in

initiating mechanotransduction and subsequent primary and secondary messenger activation

to promote adaptation in elite athletes. Also, the increase in PGC-1α mRNA abundance

despite the lack of AMPK activation when endurance athletes undertook cycling indicates that

AMPK activity may not exclusively promote mitochondrial biogenesis but is a consequence

of intense contraction-induced overload. These findings raise the question of the putative role

140
of AMPK in the adaptation to endurance training. In addition, this study provides novel data

to show that prolonged cycling increases mRNA abundance of genes implicated in the

negative regulation of muscle mass. This suggests that endurance training may up-regulate

proteolysis and suppress hypertrophy thereby impairing the muscles capacity to increase

protein synthesis and muscle mass. Indeed, Akt has been implicated in down-regulating

ubiquitin-ligase atrophy processes by inhibiting the FoxO-MAFBx pathway. The lack of Akt

phosphorylation after cycling exercise was performed by strength-trained athletes likely

promoted the transcriptional activity of atrophy genes. Equally, the AMPK-mediated

inhibition of mTOR signalling and subsequent reductions in translational efficiency following

aerobic exercise may have exacerbated protein degradation and contributed to increased

MAFBx and Myostatin mRNA abundance in the strength athletes. Collectively, these data

provide potential mechanisms for adaptation interference, suggesting that the dominant

mechanism of interference with concurrent training is the negative effect of aerobic

metabolism on pathways regulating protein synthesis and degradation.

In conclusion, the aim of training is to provide an overload stimulus that generates

specific molecular responses to enhance the adaptive phenotype. In this regard, key regulators of

skeletal muscle adaptation are emerging that are likely to significantly contribute to

promoting the specificity of training responses, driving the muscle phenotype to either ends of

an adaptation continuum. Thus, endurance training should activate pathways to promote

adaptation toward enhanced oxidative capacity and resistance to fatigue during prolonged

contractile activity. Conversely, resistance training should up-regulate translational machinery

and satellite cell activity increasing protein synthesis and muscle cross-sectional area.

The results from the studies undertaken for this thesis provide novel information

regarding the effect of overload frequency, exercise mode and training history on the

molecular bases of training adaptation. However, several important questions remain that

should be addressed in future work. For example, a high-frequency training stimulus suppresses

141
the adaptive response in untrained subjects (Chapter 2), yet a single training bout of habitual

exercise undertaken by highly-trained athletes was insufficient to generate further adaptation

responses (Chapter 3). It is unclear how periods of high-frequency training might affect the

molecular adaptation response in trained athletes. Furthermore, the unique signalling events that

occur when trained individuals undertake exercise in an “unfamiliar” activity (i.e. “interference”)

is not well understood (Chapter 4). If “crossing over” to an alternate exercise mode interferes

with adaptive responses initiated during prior training sessions (i.e. concurrent training), this is

likely to suppress or limit the specific exercise response and produce a less than optimal

adaptation. Moreover, the effect of alternating endurance and resistance training sessions on

the strength-endurance adaptation continuum remains elusive.

The adaptation continuum provides a framework with which to assess the molecular

bases of training adaptation. However, this simplistic approach characterising the adaptation

to endurance and resistance training does not address the multifaceted nature of training

specificity. This is undoubtedly complicated by the addition of other training modes,

nutritional interventions and recovery modalities. Nonetheless, continued discovery of

mechanisms involved in regulating the adaptation response will enhance our understanding of

the specificity of training adaptation. Greater knowledge regarding exercise-induced

adaptation in skeletal muscle requires the application of innovative training interventions to

promote and extend our current understanding of adaptive events that may ultimately translate

to novel training practices for athletic endeavour. Understanding the specificity of training

adaptation is not only important for sport and exercise scientists but may also provide

therapeutic targets for the treatment of acute and chronic skeletal muscle diseases.

142
Chapter Eight

References

143
Abu Hatoum, O., Gross-Mesilaty, S., Breitschopf, K., Hoffman, A., Gonen, H., Ciechanover,
A., and Bengal, E. 1998. Degradation of Myogenic Transcription Factor MyoD by the
Ubiquitin Pathway In Vivo and In Vitro: Regulation by Specific DNA Binding. Mol.
Cell. Biol. 18: 5670-5677.
Adams, G.R., Cheng, D.C., Haddad, F., and Baldwin, K.M. 2004. Skeletal muscle
hypertrophy in response to isometric, lengthening, and shortening training bouts of
equivalent duration. J Appl Physiol 96: 1613-1618.
Adams, G.R., Haddad, F., and Baldwin, K.M. 1999. Time course of changes in markers of
myogenesis in overloaded rat skeletal muscles. J Appl Physiol 87: 1705-1712.
Adams, G.R., and McCue, S.A. 1998. Localized infusion of IGF-I results in skeletal muscle
hypertrophy in rats. J Appl Physiol 84: 1716-1722.
Adhihetty, P.J., Irrcher, I., Joseph, A.M., Ljubicic, V., and Hood, D.A. 2003. Plasticity of
skeletal muscle mitochondria in response to contractile activity. Exp Physiol 88: 99-
107.
Ahtiainen, J.P., Pakarinen, A., Alen, M., Kraemer, W.J., and Häkkinen, K. 2003. Muscle
hypertrophy, hormonal adaptations and strength development during strength training
in strength-trained and untrained men. Eur J Appl Physiol 89: 555-563.
Ai, H., Ihlemann, J., Hellsten, Y., Lauritzen, H.P.M.M., Hardie, D.G., Galbo, H., and Ploug,
T. 2002. Effect of fiber type and nutritional state on AICAR- and contraction-
stimulated glucose transport in rat muscle 10.1152/ajpendo.00167.2001. Am J Physiol
Endocrinol Metab 282: E1291-1300.
Akimoto, T., Pohnert, S.C., Li, P., Zhang, M., Gumbs, C., Rosenberg, P.B., Williams, R.S.,
and Yan, Z. 2005. Exercise Stimulates PGC-1α Transcription in Skeletal Muscle
through Activation of the p38 MAPK Pathway. J. Biol. Chem. 280: 19587-19593.
Akimoto, T., Ribar, T.J., Williams, R.S., and Yan, Z. 2004. Skeletal muscle adaptation in
response to voluntary running in Ca2+/calmodulin-dependent protein kinase IV-
deficient mice 10.1152/ajpcell.00248.2004. Am J Physiol Cell Physiol 287: C1311-
1319.
Alenghat, F.J., and Ingber, D.E. 2002. Mechanotransduction: All Signals Point to
Cytoskeleton, Matrix, and Integrins 10.1126/stke.2002.119.pe6. Sci. STKE 2002: pe6-.
Alessi, D.R., James, S.R., Downes, C.P., Holmes, A.B., Gaffney, P.R.J., Reese, C.B., and
Cohen, P. 1997. Characterization of a 3-phosphoinositide-dependent protein kinase
which phosphorylates and activates protein kinase Bα. Current Biology 7: 261-269.
Alessi, D.R., Kozlowski, M.T., Weng, Q.-P., Morrice, N., and Avruch, J. 1998. 3-
Phosphoinositide-dependent protein kinase 1 (PDK1) phosphorylates and activates the
p70 S6 kinase in vivo and in vitro. Current Biology 8: 69-81.
Ali, S.M., and Sabatini, D.M. 2005. Structure of S6 Kinase 1 Determines whether Raptor-
mTOR or Rictor-mTOR Phosphorylates Its Hydrophobic Motif Site. J. Biol. Chem.
280: 19445-19448.
Alkalay, I., Yaron, A., Hatzubai, A., Orian, A., Ciechanover, A., and Ben-Neriah, Y. 1995.
Stimulation-Dependent IκBα Phosphorylation Marks the NF-κB Inhibitor for
Degradation Via the Ubiquitin-Proteasome Pathway 10.1073/pnas.92.23.10599. PNAS
92: 10599-10603.
Allen, T., Byrd, R., and Smith, D. 1976. Hemodynamic consequences of circuit weight
training. Res Q 47: 229-306.
Altschul, S.F., Gish, W., Miller, W., Meyers, E.W., and Lipman, D.J. 1990. Basic Local
Alignment Search Tool. J Mol Biol 215: 403-410.
Arbogast, S., and Reid, M.B. 2004. Oxidant activity in skeletal muscle fibers is influenced by
temperature, CO2 level, and muscle-derived nitric oxide 10.1152/ajpregu.00072.2004.
Am J Physiol Regul Integr Comp Physiol 287: R698-705.

144
Armand, A.-S., Launay, T., Gaspera, B.D., Charbonnier, F., Gallien, C.L., and Chanoine, C.
2003. Effects of eccentric treadmill running on mouse soleus:
degeneration/regeneration studied with Myf-5 and MyoD probes. Acta Physiol Scand
179: 75-84.
Aronson, D., Violan, M.A., Dufresne, S.D., Zangen, D., Fielding, R.A., and Goodyear, L.J.
1997. Exercise Stimulates the Mitogen-activated Protein Kinase Pathway in Human
Skeletal Muscle. J. Clin. Invest. 99: 1251-1257.
Aschenbach, W.G., Sakamoto, K., and Goodyear, L.J. 2004. 5' Adenosine monophosphate-
activated protein kinase, metabolism and exercise. Sports Med 34: 91-103.
Assoian, R.K. 2002. Common sense signalling. Nat Cell Biol 4: E187-E188.
Atherton, P.J., Babraj, J.A., Smith, K., Singh, J., Rennie, M.J., and Wackerhage, H. 2005.
Selective activation of AMPK-PGC-1α or PKB-TSC2-mTOR signaling can explain
specific adaptive responses to endurance or resistance training-like electrical muscle
stimulation. FASEB J.: 04-2179fje.
Baar, K., Blough, E., Dineen, B., and Esser, K. 1999. Transcriptional regulation in response to
exercise. Exerc Sport Sci Rev 27: 333-379.
Baar, K., and Esser, K. 1999. Phosphorylation of p70S6k correlates with increased skeletal
muscle mass following resistance exercise. Am J Physiol Cell Physiol 276: C120-
C127.
Baar, K., Wende, A.R., Jones, T.E., Marison, M., Nolte, L.A., Chen, M., Kelly, D.P., and
Holloszy, J.O. 2002. Adaptations of skeletal muscle to exercise: rapid increase in the
transcriptional coactivator PGC-1. FASEB J. 16: 1879-1886.
Bach, D., Pich, S., Soriano, F.X., Vega, N., Baumgartner, B., Oriola, J., Daugaard, J.R.,
Lloberas, J., Camps, M., Zierath, J.R., et al. 2003. Mitofusin-2 determines
mitochondrial network architecture and mitochondrial metabolism. J Biol Chem 278:
17190-17197.
Backer, J., Myers, M.J., Shoelson, S., Chin, D., Sun, X., Miralpeix, M., Hu, P., Margolis, B.,
Skolnik, E., and Schlessinger, J.e.a. 1992. Phosphatidylinositol 3'-kinase is activated
by association with IRS-1 during insulin stimulation. EMBO J 11: 3469-3479.
Bae, J.S., Jang, M.K., Hong, S., An, W.G., Choi, Y.H., Kim, H.D., and Cheong, J. 2003.
Phosphorylation of NF-κB by calmodulin-dependent kinase IV activates anti-apoptotic
gene expression. Biochem Biophys Res Commun 305: 1094-1098.
Balabinis, C.P., Moukas, M., Behrakis, P.K., Psarakis, C.H., and Vassiliou, M.P. 2003. Early
phase changes by concurrent endurance and strength training. J Strength Cond Res 17:
393-401.
Bamman, M.M., Shipp, J.R., Jiang, J., Gower, B.A., Hunter, G.R., Goodman, A., McLafferty,
C.L., Jr., and Urban, R.J. 2001. Mechanical load increases muscle IGF-I and androgen
receptor mRNA concentrations in humans. Am J Physiol Endocrinol Metab 280:
E383-390.
Bangsbo, J., Krustrup, P., Gonzalez-Alonso, J., and Saltin, B. 2001. ATP production and
efficiency of human skeletal muscle during intense exercise: effect of previous
exercise. Am J Physiol Endocrinol Metab 280: E956-964.
Bassel-Duby, R., and Olson, E.N. 2006. Signaling pathways in skeletal muscle remodeling.
Annu Rev Biochem 75: 19-37.
Bell, G.J., Syrotuik, D.G., Martin, T.P., Burnham, R., and Quinney, H.A. 2000. Effect of
concurrent strength and endurance training on skeletal muscle properties and hormone
concentrations in humans. Eur J Appl Physiol 81: 481-427.
Bengtsson, J., Gustafsson, T., Widegren, U., Jansson, E., and Sundberg, C.J. 2001.
Mitochondrial transcription factor A and respiratory complex IV increase in response
to exercise training in humans. Pflugers Arch 443: 61-66.

145
Bickel, C.S., Slade, J., Mahoney, E., Haddad, F., Dudley, G.A., and Adams, G.R. 2005. Time
course of molecular responses of human skeletal muscle to acute bouts of resistance
exercise. J Appl Physiol 98: 482-488.
Bickel, C.S., Slade, J.M., Haddad, F., Adams, G.R., and Dudley, G.A. 2003. Acute molecular
responses of skeletal muscle to resistance exercise in able-bodied and spinal cord-
injured subjects. J Appl Physiol 94: 2255-2262.
Bodine, S.C., Latres, E., Baumhueter, S., Lai, V.K.-M., Nunez, L., Clarke, B.A., Poueymirou,
W.T., Panaro, F.J., Na, E., Dharmarajan, K., et al. 2001a. Identification of Ubiquitin
Ligases Required for Skeletal Muscle Atrophy. Science 294: 1704-1708.
Bodine, S.C., Stitt, T.N., Gonzalez, M., Kline, W.O., Stover, G.L., Bauerlein, R., Zlotchenko,
E., Scrimgeour, A., Lawerence, J.C., Glass, D.J., et al. 2001b. Akt/mTOR pathway is a
crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in
vivo. Nat Cell Biol. 3: 1014-1019.
Bolster, D.R., Crozier, S.J., Kimball, S.R., and Jefferson, L.S. 2002. AMP-activated Protein
Kinase Suppresses Protein Synthesis in Rat Skeletal Muscle through Down-regulated
Mammalian Target of Rapamycin (mTOR) Signaling 10.1074/jbc.C200171200. J.
Biol. Chem. 277: 23977-23980.
Bolster, D.R., Kimball, S.R., and Jefferson, L.S. 2003a. Translational control mechanisms
modulate skeletal muscle gene expression during hypertrophy. Exerc Sport Sci Rev
31: 111-116.
Bolster, D.R., Kubica, N., Crozier, S.J., Williamson, D.L., Farrell, P.A., Kimball, S.R., and
Jefferson, L.S. 2003b. Immediate response of mammalian target of rapamycin
(mTOR)-mediated signalling following acute resistance exercise in rat skeletal
muscle. J Physiol (Lond) 553: 213-220.
Booth, F.W., and Baldwin, K.M. 1996. Muscle Plasticity: energy demand and supply
processes. In Handbook of Physiology. Section 12: Exercise: Regulation and
Intergration of Multiple Systems. (eds. L.B. Rowell, and J.T. Shepherd), pp. 1075-
1123. Oxford University Press, New York.
Booth, F.W., and Thomason, D.B. 1991. Molecular and cellular adaptation of muscle in
response to exercise: perspectives of various models. Physiol. Rev. 71: 541-585.
Booth, F.W., and Watson, P.A. 1985. Control of adaptations in protein levels in response to
exercise. Fed Proc 44: 2293-2300.
Boppart, M.D., Asp, S., Wojtaszewski, J.F.P., Fielding, R.A., Mohr, T., and Goodyear, L.J.
2000. Marathon running transiently increases c-Jun NH2-terminal kinase and p38γ
activities in human skeletal muscle. J Physiol (Lond) 526: 663-669.
Bosisio, D., Marazzi, I., Agresti, A., Shimizu, N., Bianchi, M., and Natoli, G. 2006. A hyper-
dynamic equilibrium between promoter-bound and nucleoplasmic dimers controls NF-
κB-dependent gene activity. EMBO J 25: 789-810.
Bouchard, C., Malina, R., and Pérusse, L. 1997. On the Horizon: Molecular Biology - a new
vista for exercise physiology. In Genetics of Fitness and Physical Performance, pp.
970-1050. Human Kinetics, Champaign, Il.
Bouchard, C., Rankinen, T., Chagnon, Y.C., Rice, T., Perusse, L., Gagnon, J., Borecki, I., An,
P., Leon, A.S., Skinner, J.S., et al. 2000. Genomic scan for maximal oxygen uptake
and its response to training in the HERITAGE Family Study. J Appl Physiol 88: 551-
559.
Browne, G.J., and Proud, C.G. 2002. Regulation of peptide-chain elongation in mammalian
cells. Eur J Biochem 269: 5360-5368.
Browne, G.J., and Proud, C.G. 2004. A Novel mTOR-Regulated Phosphorylation Site in
Elongation Factor 2 Kinase Modulates the Activity of the Kinase and Its Binding to
Calmodulin. Mol. Cell. Biol. 24: 2986-2997.
Brozinick Jr., J.T., and Birnbaum, M.J. 1998. Insulin, but Not Contraction, Activates
Akt/PKB in Isolated Rat Skeletal Muscle. J. Biol. Chem. 273: 14679-14682.

146
Bruss, M.D., Arias, E.B., Lienhard, G.E., and Cartee, G.D. 2005. Increased Phosphorylation
of Akt Substrate of 160 kDa (AS160) in Rat Skeletal Muscle in Response to Insulin or
Contractile Activity. Diabetes 54: 41-50.
Burnett, P.E., Barrow, R.K., Cohen, N.A., Snyder, S.H., and Sabatini, D.M. 1998. RAFT1
phosphorylation of the translational regulators p70 S6 kinase and 4E-BP1. PNAS 95:
1432-1437.
Byrd, S.K., McCutcheon, L.J., Hodgson, D.R., and Gollnick, P.D. 1989. Altered sarcoplasmic
reticulum function after high-intensity exercise. J Appl Physiol 67: 2072-2077.
Cai, D., Frantz, J.D., Tawa, J., Nicholas E., Melendez, P.A., Oh, B.-C., Lidov, H.G.W.,
Hasselgren, P.-O., Frontera, W.R., and Lee, J. 2004. IKKβ/NF-κB Activation Causes
Severe Muscle Wasting in Mice. Cell 119: 285-298.
Cai, S.-L., Tee, A.R., Short, J.D., Bergeron, J.M., Kim, J., Shen, J., Guo, R., Johnson, C.L.,
Kiguchi, K., and Walker, C.L. 2006. Activity of TSC2 is inhibited by AKT-mediated
phosphorylation and membrane partitioning 10.1083/jcb.200507119. J. Cell Biol. 173:
279-289.
Cannon, J.G., and St. Pierre, B.A. 1998. Cytokines in exertion-induced skeletal muscle injury.
Mol Cell Biochem 179: 159-167.
Carling, D., Zammit, V.A., and Hardie, D.G. 1987. A common bicyclic protein kinase
cascade inactivates the regulatory enzymes of fatty acid and cholesterol biosynthesis.
FEBS Letters 223: 217-222.
Carrero, P., Okamoto, K., Coumailleau, P., O'Brien, S., Tanaka, H., and Poellinger. 2000.
Redox-regulated recruitment of the transcriptional coactivators CREB-binding protein
and SRC-1 to hypoxia-inducible factor alpha. Mol Cell Biol 20: 402-415.
Carroll, S.L., Klein, M.G., and Schneider, M.F. 1995. Calcium transients in intact rat skeletal
muscle fibers in agarose gel. Am J Physiol Cell Physiol 269: C28-34.
Cartoni, R., Leger, B., Hock, M.B., Praz, M., Crettenand, A., Pich, S., Ziltener, J.-L., Luthi,
F., Deriaz, O., Zorzano, A., et al. 2005. Mitofusins 1/2 and ERRα expression are
increased in human skeletal muscle after physical exercise. J Physiol 567: 349-358.
Chakravarthy, M.V., Abraha, T.W., Schwartz, R.J., Fiorotto, M.L., and Booth, F.W. 2000a.
Insulin-like Growth Factor-I Extends in Vitro Replicative Life Span of Skeletal
Muscle Satellite Cells by Enhancing G1/S Cell Cycle Progression via the Activation
of Phosphatidylinositol 3'-Kinase/Akt Signaling Pathway. J. Biol. Chem. 275: 35942-
35952.
Chakravarthy, M.V., Davis, B.S., and Booth, F.W. 2000b. IGF-I restores satellite cell
proliferative potential in immobilized old skeletal muscle. J Appl Physiol 89: 1365-
1379.
Charge, S.B.P., and Rudnicki, M.A. 2004. Cellular and Molecular Regulation of Muscle
Regeneration. Physiol. Rev. 84: 209-238.
Chen, Z., Hagler, J., Palombella, V., Melandri, F., Scherer, D., Ballard, D., and Maniatis, T.
1995. Signal-induced site-specific phosphorylation targets IκBα to the ubiquitin-
proteasome pathway. Genes Dev 9: 1586-1597.
Chen, Z.J. 2005. Ubiquitin signalling in the NF-[kappa]B pathway. 7: 758-765.
Chen, Z.J., Bhoj, V., and Seth, R.B. 2006. Ubiquitin, TAK1 and IKK: is there a connection?
Cell Death Differ 13: 687-692.
Chen, Z.-P., McConell, G.K., Michell, B.J., Snow, R.J., Canny, B.J., and Kemp, B.E. 2000.
AMPK signaling in contracting human skeletal muscle: acetyl-CoA carboxylase and
NO synthase phosphorylation. Am J Physiol Endocrinol Metab 279: E1202-1206.
Chen, Z.-P., Stephens, T.J., Murthy, S., Canny, B.J., Hargreaves, M., Witters, L.A., Kemp,
B.E., and McConell, G.K. 2003. Effect of Exercise Intensity on Skeletal Muscle
AMPK Signaling in Humans. Diabetes 52: 2205-2212.

147
Chesley, A., MacDougall, J.D., Tarnopolsky, M.A., Atkinson, S.A., and Smith, K. 1992.
Changes in human muscle protein synthesis after resistance exercise. J Appl Physiol
73: 1383-1388.
Chin, E.R. 2005. Role of Ca2+/calmodulin-dependent kinases in skeletal muscle plasticity
10.1152/japplphysiol.00015.2005. J Appl Physiol 99: 414-423.
Chin, E.R., Olson, E.N., Richardson, J.A., Yang, Q., Humphries, C., Shelton, J.M., Wu, H.,
Zhu, W., Bassel-Duby, R., and Williams, R.S. 1998. A calcineurin-dependent
transcriptional pathway controls skeletal muscle fiber type 10.1101/gad.12.16.2499.
Genes Dev. 12: 2499-2509.
Clark, S.A., Chen, Z.-P., Murphy, K.T., Aughey, R.J., McKenna, M.J., Kemp, B.E., and
Hawley, J.A. 2004. Intensified exercise training does not alter AMPK signaling in
human skeletal muscle. Am J Physiol Endocrinol Metab 286: E737-743.
Cluberton, L.J., McGee, S.L., Murphy, R.M., and Hargreaves, M. 2005. Effect of
carbohydrate ingestion on exercise-induced alterations in metabolic gene expression. J
Appl Physiol 99: 1359-1363.
Connor, M.K., Irrcher, I., and Hood, D.A. 2001. Contractile Activity-induced Transcriptional
Activation of Cytochrome c Involves Sp1 and Is Proportional to Mitochondrial ATP
Synthesis in C2C12 Muscle Cells. J. Biol. Chem. 276: 15898-15904.
Cornelison, D.D.W., Olwin, B.B., Rudnicki, M.A., and Wold, B.J. 2000. MyoD-/- Satellite
Cells in Single-Fiber Culture Are Differentiation Defective and MRF4 Deficient. Dev
Biol 224: 122-137.
Cornelison, D.D.W., and Wold, B.J. 1997. Single-Cell Analysis of Regulatory Gene
Expression in Quiescent and Activated Mouse Skeletal Muscle Satellite Cells. Dev
Biol 191: 270-283.
Creer, A., Gallagher, P., Slivka, D., Jemiolo, B., Fink, W., and Trappe, S. 2005. Influence of
muscle glycogen availability on ERK1/2 and Akt signaling after resistance exercise in
human skeletal muscle. J Appl Physiol 99: 950-956.
Cross, D.A., Alessi, D.R., Cohen, P., Andjelkovich, M., and Hemmings, B.A. 1995. Inhibition
of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature. 378:
785-789.
Cuthbertson, D., Smith, K., Babraj, J., Leese, G., Waddell, T., Atherton, P., Wackerhage, H.,
Taylor, P.M., and Rennie, M.J. 2005. Anabolic signaling deficits underlie amino acid
resistance of wasting, aging muscle. FASEB J. 19: 422-424.
Czerwinski, S.M., Martin, J.M., and Bechtel, P.J. 1994. Modulation of IGF mRNA abundance
during stretch-induced skeletal muscle hypertrophy and regression. J Appl Physiol 76:
2026-2030.
Daitoku, H., Yamagata, K., Matsuzaki, H., Hatta, M., and Fukamizu, A. 2003. Regulation of
PGC-1 Promoter Activity by Protein Kinase B and the Forkhead Transcription Factor
FKHR. Diabetes 52: 642-649.
de Alvaro, C., Teruel, T., Hernandez, R., and Lorenzo, M. 2004. Tumor Necrosis Factorα
Produces Insulin Resistance in Skeletal Muscle by Activation of Inhibitor κB Kinase
in a p38 MAPK-dependent Manner. J. Biol. Chem. 279: 17070-17078.
Dehoux, M., Van Beneden, R., Pasko, N., Lause, P., Verniers, J., Underwood, L.,
Ketelslegers, J.-M., and Thissen, J.-P. 2004. Role of the Insulin-Like Growth Factor I
Decline in the Induction of Atrogin-1/MAFbx during Fasting and Diabetes.
Endocrinology 145: 4806-4812.
del Aguila, L.F., Claffey, K.P., and Kirwan, J.P. 1999. TNF-α impairs insulin signaling and
insulin stimulation of glucose uptake in C2C12 muscle cells. Am J Physiol Endocrinol
Metab 276: E849-855.
Del Aguila, L.F., Krishnan, R.K., Ulbrecht, J.S., Farrell, P.A., Correll, P.H., Lang, C.H.,
Zierath, J.R., and Kirwan, J.P. 2000. Muscle damage impairs insulin stimulation of

148
 IRS-1, PI 3-kinase, and Akt-kinase in human skeletal muscle. Am J Physiol
Endocrinol Metab 279: E206-212.
DeVol, D.L., Rotwein, P., Sadow, J.L., Novakofski, J., and Bechtel, P.J. 1990. Activation of
insulin-like growth factor gene expression during work-induced skeletal muscle
growth. Am J Physiol Endocrinol Metab 259: E89-95.
Dreyer, H.C., Fujita, S., Cadenas, J.G., Chinkes, D.L., Volpi, E., and Rasmussen, B.B. 2006.
Resistance exercise increases AMPK activity and reduces 4E-BP1 phosphorylation
and protein synthesis in human skeletal muscle. J Physiol (Lond) Epub ahead of
print: 2006.113175.
Du, J., Wang, X., Miereles, C., Bailey, J.L., Debigare, R., Zheng, B., Price, S.R., and Mitch,
W.E. 2004. Activation of caspase-3 is an initial step triggering accelerated muscle
proteolysis in catabolic conditions. J. Clin. Invest. 113: 115-123.
Dudley, G.A., and Djamil, R. 1985. Incompatibility of endurance- and strength-training
modes of exercise. J Appl Physiol 59: 1446-1451.
Dunn, S.E., Burns, J.L., and Michel, R.N. 1999. Calcineurin Is Required for Skeletal Muscle
Hypertrophy 10.1074/jbc.274.31.21908. J. Biol. Chem. 274: 21908-21912.
Dunn, S.E., Chin, E.R., and Michel, R.N. 2000. Matching of Calcineurin Activity to
Upstream Effectors Is Critical for Skeletal Muscle Fiber Growth
10.1083/jcb.151.3.663. J. Cell Biol. 151: 663-672.
Dupont-Versteegden, E.E., Fluckey, J.D., Knox, M., Gaddy, D., and Peterson, C.A. 2006.
Effect of flywheel-based resistance exercise on processes contributing to muscle
atrophy during unloading in adult rats. J Appl Physiol 101: 202-212.
Duran, A., Diaz-Meco, M., and Moscat, J. 2003. Essential role of RelA Ser311
phosphorylation by zetaPKC in NF-kappaB transcriptional activation. EMBO J 22:
3910-3918.
Durante, P.E., Mustard, K.J., Park, S.-H., Winder, W.W., and Hardie, D.G. 2002. Effects of
endurance training on activity and expression of AMP-activated protein kinase
isoforms in rat muscles. Am J Physiol Endocrinol Metab 283: E178-186.
Durham, W.J., Li, Y.-P., Gerken, E., Farid, M., Arbogast, S., Wolfe, R.R., and Reid, M.B.
2004. Fatiguing exercise reduces DNA binding activity of NF-κB in skeletal muscle
nuclei. J Appl Physiol 97: 1740-1745.
Eliasson, J., Elfegoun, T., Nilsson, J., Kohnke, R., Ekblom, B.T., and Blomstrand, E. 2006.
Maximal lengthening contractions increase p70S6 kinase phosphorylation in human
skeletal muscle in the absence of nutritional supply. Am J Physiol Endocrinol Metab
Epub ahead of print: 00141.02006.
Evans, W.J., Phinney, S.D., and Young, V.R. 1982. Suction applied to a muscle biopsy
maximizes sample size. Med Sci Sports Exerc 14: 101-102.
Farrell, P.A., Hernandez, J.M., Fedele, M.J., Vary, T.C., Kimball, S.R., and Jefferson, L.S.
2000. Eukaryotic initiation factors and protein synthesis after resistance exercise in
rats. J Appl Physiol 88: 1036-1042.
Ferguson, R.A., Ball, D., Krustrup, P., Aagaard, P., Kjar, M., Sargeant, A.J., Hellsten, Y., and
Bangsbo, J. 2001. Muscle oxygen uptake and energy turnover during dynamic
exercise at different contraction frequencies in humans. J Physiol (Lond) 536: 261-
271.
Fernandez-Celemin, L., Pasko, N., Blomart, V., and Thissen, J.-P. 2002. Inhibition of muscle
insulin-like growth factor I expression by tumor necrosis factor-α. Am J Physiol
Endocrinol Metab 283: E1279-1290.
Finck, B.N., and Kelly, D.P. 2006. PGC-1 coactivators: inducible regulators of energy
metabolism in health and disease. J. Clin. Invest. 116: 615-622.
Flück, M., and Hoppeler, H. 2003. Molecular basis of skeletal muscle plasticity-from gene to
form and function. Rev Physiol Biochem Pharmacol 146: 159-216.

149
Fluck, M., Waxham, M.N., Hamilton, M.T., and Booth, F.W. 2000. Skeletal muscle Ca2+-
independent kinase activity increases during either hypertrophy or running. J Appl
Physiol 88: 352-358.
Foulstone, E.J., Huser, C., Crown, A.L., Holly, J.M.P., and Stewart, C.E.H. 2004. Differential
signalling mechanisms predisposing primary human skeletal muscle cells to altered
proliferation and differentiation: roles of IGF-I and TNFa. Exp Cell Res 294: 223-235.
Freyssenet, D., Irrcher, I., Connor, M.K., Di Carlo, M., and Hood, D.A. 2004. Calcium-
regulated changes in the mitochondrial phenotype in skeletal muscle cells. Am J
Physiol Cell Physiol 286: C1053-1061.
Fritz, T., Kramer, D.K., Karlsson, H.K., Galuska, D., Engfeldt, P., Zierath, J.R., and Krook,
A. 2006. Low-intensity exercise increases skeletal muscle protein expression of
PPARδ and UCP3 in type 2 diabetic patients. Diabetes Metab Res Rev Epub ahead of
print.
Frøsig, C., Jørgensen, S.B., Hardie, D.G., Richter, E.A., and Wojtaszewski, J.F.P. 2004. 5'-
AMP-activated protein kinase activity and protein expression are regulated by
endurance training in human skeletal muscle. Am J Physiol Endocrinol Metab 286:
E411-E417.
Fry, A.C., Schilling, B.K., Staron, R.S., Hagerman, F.C., Hikida, R.S., and Thrush, J.T. 2003.
Muscle fiber characteristics and performance correlates of male Olympic-style
weightlifters. J Strength Cond Res 17: 746-754.
Fujii, N., Hayashi, T., Hirshman, M.F., Smith, J.T., Habinowski, S.A., Kaijser, L., Mu, J.,
Ljungqvist, O., Birnbaum, M.J., and Witters, L.A. 2000. Exercise Induces Isoform-
Specific Increase in 5'AMP-Activated Protein Kinase Activity in Human Skeletal
Muscle. Biochemical and Biophysical Research Communications 273: 1150-1155.
Funai, K., Parkington, J.D., Carambula, S., and Fielding, R.A. 2006. Age-associated decrease
in contraction-induced activation of downstream targets of Akt/mTor signaling in
skeletal muscle 10.1152/ajpregu.00277.2005. Am J Physiol Regul Integr Comp
Physiol 290: R1080-1086.
Galetic, I., Maira, S.-M., Andjelkovic, M., and Hemmings, B.A. 2003. Negative regulation of
ERK and Elk by protein kinase B modulates c-fos transcription. J Biol Chem 278:
4416-4423.
Gao, T., Furnari, F., and Newton, A.C. 2005. PHLPP: A Phosphatase that Directly
Dephosphorylates Akt, Promotes Apoptosis, and Suppresses Tumor Growth.
Molecular Cell 18: 13-24.
Gao, Z., Hwang, D., Bataille, F., Lefevre, M., York, D., Quon, M.J., and Ye, J. 2002. Serine
Phosphorylation of Insulin Receptor Substrate 1 by Inhibitor κB Kinase Complex. J.
Biol. Chem. 277: 48115-48121.
Garami, A., Zwartkruis, F.J.T., Nobukuni, T., Joaquin, M., Roccio, M., Stocker, H., Kozma,
S.C., Hafen, E., Bos, J.L., and Thomas, G. 2003. Insulin Activation of Rheb, a
Mediator of mTOR/S6K/4E-BP Signaling, Is Inhibited by TSC1 and 2. Molecular
Cell 11: 1457-1466.
Garcia-Martinez, C., Agell, N., Llovera, M., Lopez-Soriano, F.J., and Argiles, J.M. 1993.
Tumour necrosis factor-α increases the ubiquitinization of rat skeletal muscle proteins.
FEBS Letters 323: 211-214.
Garcia-Martinez, C., Llovera M., Agell N., Lopezsoriano F. J., and Argiles J. M. 1994.
Ubiquitin Gene Expression in Skeletal Muscle Is Increased by Tumor Necrosis Factor-
α. Biochemical and Biophysical Research Communications 201: 682-686.
Gavin, T.P., Robinson, C.B., Yeager, R.C., England, J.A., Nifong, L.W., and Hickner, R.C.
2004. Angiogenic growth factor response to acute systemic exercise in human skeletal
muscle. J Appl Physiol 96: 19-24.
Glass, D.J. 2003. Signalling pathways that mediate skeletal muscle hypertrophy and atrophy.
Nat Cell Biol 5: 87-90.

150
Glass, D.J. 2005. Skeletal muscle hypertrophy and atrophy signaling pathways. Int J Biochem
Cell Biol 37: 1974-1984.
Gleyzer, N., Vercauteren, K., and Scarpulla, R.C. 2005. Control of Mitochondrial
Transcription Specificity Factors (TFB1M and TFB2M) by Nuclear Respiratory
Factors (NRF-1 and NRF-2) and PGC-1 Family Coactivators. Mol. Cell. Biol. 25:
1354-1366.
Glowacki, S., Martin, S., Maurer, A., Baek, W., Green, J., and Crouse, S. 2004. Effects of
Resistance, Endurance, and Concurrent Exercise on Training Outcomes in Men. Med
Sci Sports Exerc 36: 2119-2127.
Goffart, S., and Wiesner, R.J. 2003. Regulation and co-ordination of nuclear gene expression
during mitochondrial biogenesis. Exp Physiol 88: 33-40.
Goldberg, A.L. 1968. Protein synthesis during work-induced growth of skeletal muscle. J Cell
Biol 36: 653-658.
Goldspink, G. 2003. Gene expression in muscle in response to exercise. J Muscle Res Cell
Motil 24: 121-126.
Gomes, M.D., Lecker, S.H., Jagoe, R.T., Navon, A., and Goldberg, A.L. 2001. Atrogin-1, a
muscle-specific F-box protein highly expressed during muscle atrophy. PNAS 98:
14440-14445.
Gordon, J.W., Rungi, A.A., Inagaki, H., and Hood, D.A. 2001. Plasiticity in Skeletal, Cardiac
and Smooth Muscle Selected Contribution: Effects of contractile activity on
mitochondrial transcription factor A expression in skeletal muscle. J Appl Physiol 90:
389-396.
Grifone, R., Laclef, C., Spitz, F., Lopez, S., Demignon, J., Guidotti, J.-E., Kawakami, K., Xu,
P.-X., Kelly, R., Petrof, B.J., et al. 2004. Six1 and Eya1 expression can reprogram
adult muscle from the slow-twitch phenotype into the fast-twitch phenotype. Mol Cell
Biol 24: 6253-6267.
Haddad, F., and Adams, G.R. 2002. Exercise effects on muscle insulin signaling and action.
Selected contribution: Acute cellular and molecular responses to resistance exercise. J
Appl Physiol 93: 394-403.
Haddad, F., Adams, G.R., Bodell, P.W., and Baldwin, K.M. 2006. Isometric resistance
exercise fails to counteract skeletal muscle atrophy processes during the initial stages
of unloading. J Appl Physiol 100: 433-441.
Hahn-Windgassen, A., Nogueira, V., Chen, C.-C., Skeen, J.E., Sonenberg, N., and Hay, N.
2005. Akt Activates the Mammalian Target of Rapamycin by Regulating Cellular
ATP Level and AMPK Activity 10.1074/jbc.M502876200. J. Biol. Chem. 280: 32081-
32089.
Häkkinen, K. 1989. Neuromuscular and hormonal adaptations during strength and power
training: A review. J Sports Med Phys Fitness 29: 9-26.
Häkkinen, K., Alen, M., Kraemer, W.J., Gorostiaga, E., Izquierdo, M., Rusko, H., Mikkola,
J., Häkkinen, A., Valkeinen, H., Kaarakainen, E., et al. 2003. Neuromuscular
adaptations during concurrent strength and endurance training versus strength training.
Eur J Appl Physiol 89: 42-52.
Hameed, M., Orrell, R.W., Cobbold, M., Goldspink, G., and Harridge, S.D.R. 2003.
Expression of IGF-I splice variants in young and old human skeletal muscle after high
resistance training. J Physiol 547: 247-254.
Hannan, K.M., Brandenburger, Y., Jenkins, A., Sharkey, K., Cavanaugh, A., Rothblum, L.,
Moss, T., Poortinga, G., McArthur, G.A., Pearson, R.B., et al. 2003. mTOR-
Dependent Regulation of Ribosomal Gene Transcription Requires S6K1 and Is
Mediated by Phosphorylation of the Carboxy-Terminal Activation Domain of the
Nucleolar Transcription Factor UBF. Mol. Cell. Biol. 23: 8862-8877.

151
Hansen, A.K., Fischer, C.P., Plomgaard, P., Andersen, J.L., Saltin, B., and Pedersen, B.K.
2005. Skeletal muscle adaptation: training twice every second day vs. training once
daily. J Appl Physiol 98: 93-99.
Hardie, D.G., and Sakamoto, K. 2006. AMPK: A Key Sensor of Fuel and Energy Status in
Skeletal Muscle 10.1152/physiol.00044.2005. Physiology 21: 48-60.
Hardie, D.G., Salt, I.P., Hawley, S.A., and Davies, S.P. 1999. AMP-activated protein kinase:
an ultrasensitive system for monitoring cellular energy charge. Biochem J 338: 717-
722.
Harrington, L.S., Findlay, G.M., and Lamb, R.F. 2005. Restraining PI3K: mTOR signalling
goes back to the membrane. Trends in Biochemical Sciences 30: 35-42.
Hawke, T.J., and Garry, D.J. 2001. Myogenic satellite cells: physiology to molecular biology.
J Appl Physiol 91: 534-551.
Hawley, J., Tipton, K., and Millard-Stafford, M. 2006. Promoting training adaptations
through nutritional interventions. J Sports Sci 24: 709-721.
Hawley, J.A. 2002. Adaptations of skeletal muscle to prolonged, intense endurance training.
Clin Exp Pharmacol Physiol 29: 218-222.
Hawley, J.A., and Noakes, T.D. 1992. Peak power output predicts maximal oxygen uptake
and performance time in trained cyclists. Eur J Appl Physiol Occup Physiol 65: 79-83.
Hawley, J.A., and Zierath, J. 2004. Integration of metabolic and mitogenic signal transduction
in skeletal muscle. Exerc Sport Sci Rev 32: 4-8.
Hawley, S.A., Pan, D.A., Mustard, K.J., Ross, L., Bain, J., Edelman, A.M., Frenguelli, B.G.,
and Hardie, D.G. 2005. Calmodulin-dependent protein kinase kinase-β is an
alternative upstream kinase for AMP-activated protein kinase. Cell Metabolism 2: 9-
19.
Hayashi, T., Hirshman, M., Kurth, E., Winder, W., and Goodyear, L. 1998. Evidence for 5'
AMP-activated protein kinase mediation of the effect of muscle contraction on glucose
transport. Diabetes 47: 1369-1373.
Hennessy, L.C., and Watson, A.W.S. 1994. The interference effects of training for strength
and endurance simultaneously. J Strength Cond Res 8: 12-19.
Heszele, M.F.C., and Price, S.R. 2004. Insulin-Like Growth Factor I: The Yin and Yang of
Muscle Atrophy 10.1210/en.2004-1037. Endocrinology 145: 4803-4805.
Hickson, R.C. 1980. Interference of strength development by simultaneously training for
strength and endurance. Eur J Appl Physiol Occup Physiol 45: 255-263.
Higginson, J., Wackerhage, H., Woods, N., Schjerling, P., Ratkevicius, A., Grunnet, N., and
Quistorff, B. 2002. Blockades of mitogen-activated protein kinase and calcineurin
both change fibre-type markers in skeletal muscle culture. Pflugers Arch 445: 437-
443.
Hildebrandt, A.L., Pilegaard, H., and Neufer, P.D. 2003. Differential transcriptional activation
of select metabolic genes in response to variations in exercise intensity and duration in
red and white skeletal muscle. Am J Physiol Endocrinol Metab Epub ahead of print:
00234.02003.
Hintz, C.S., Chi, M.M., Fell, R.D., Ivy, J.L., Kaiser, K.K., Lowry, C.V., and Lowry, O.H.
1982. Metabolite changes in individual rat muscle fibers during stimulation. Am J
Physiol Cell Physiol 242: C218-228.
Hishiya, A., Iemura, S., Natsume, T., Takayama, S., Ikeda, K., and Watanabe, K. 2006. A
novel ubiquitin-binding protein ZNF216 functioning in muscle atrophy. EMBO J. 25:
554-564.
Ho, R.C., Hirshman, M.F., Li, Y., Cai, D., Farmer, J.R., Aschenbach, W.G., Witczak, C.A.,
Shoelson, S.E., and Goodyear, L.J. 2005. Regulation of IκB kinase and NF-κB in
contracting adult rat skeletal muscle. Am J Physiol Cell Physiol 289: C794-801.
Hoffman, E.P., and Nader, G.A. 2004. Balancing muscle hypertrophy and atrophy. Nat Med
10: 584-585.

152
Holloszy, J.O. 1967. Biochemical adaptations in muscle. Effects of exercise on mitochondrial
oxygen uptake and respiratory enzyme activity in skeletal muscle. J Biol Chem 242:
2278-2282.
Holloszy, J.O., and Coyle, E.F. 1984. Adaptations of skeletal muscle to endurance exercise
and their metabolic consequences. J Appl Physiol 56: 831-838.
Holloszy, J.O., Rennie, M.J., Hickson, R.C., Conlee, R.K., and Hagberg, J.M. 1977.
Physiological consequences of the biochemical adaptations to endurance exercise. Ann
N Y Acad Sci 301: 440-450.
Holloway, G.P., Green, H.J., Duhamel, T.A., Ferth, S., Moule, J.W., Ouyang, J., and Tupling,
A.R. 2005. Muscle sarcoplasmic reticulum Ca2+ cycling adaptations during 16 h of
heavy intermittent cycle exercise 10.1152/japplphysiol.01407.2004. J Appl Physiol
99: 836-843.
Hood, D.A. 2001. Plasticity in Skeletal, Cardiac, and Smooth Muscle Invited Review:
Contractile activity-induced mitochondrial biogenesis in skeletal muscle. J Appl
Physiol 90: 1137-1157.
Hood, D.A., Irrcher, I., Ljubicic, V., and Joseph, A.-M. 2006. Coordination of metabolic
plasticity in skeletal muscle. J Exp Biol 209: 2265-2275.
Hoppeler, H., and Flück, M. 2003. Plasticity of skeletal muscle mitochondria: Structure and
function. Med Sci Sports Exerc 35: 95-104.
Horman, S., Browne, G.J., Krause, U., Patel, J.V., Vertommen, D., Bertrand, L., Lavoinne,
A., Hue, L., Proud, C.G., and Rider, M.H. 2002. Activation of AMP-Activated Protein
Kinase Leads to the Phosphorylation of Elongation Factor 2 and an Inhibition of
Protein Synthesis. Current Biology 12: 1419-1423.
Hornberger, T., Stuppard, R., Conley, K., Fedele, M., Fiorotto, M., Chin, E., and Esser, K.A.
2004. Mechanical stimuli regulate rapamycin-sensitive signalling by a
phosphoinositide 3-kinase-, protein kinase B- and growth factor-independent
mechanism. Biochem J 380(pt3): 795-804.
Hornberger, T.A., Armstrong, D.D., Koh, T.J., Burkholder, T.J., and Esser, K.A. 2005a.
Intracellular signaling specificity in response to uniaxial vs. multiaxial stretch:
implications for mechanotransduction 10.1152/ajpcell.00207.2004. Am J Physiol Cell
Physiol 288: C185-194.
Hornberger, T.A., and Esser, K.A. 2004. Mechanotransduction and the regulation of protein
synthesis in skeletal muscle. Proc Nutr Soc 63: 331-335.
Hornberger, T.A., Mateja, R.D., Chin, E.R., Andrews, J.L., and Esser, K.A. 2005b. Aging
does not alter the mechanosensitivity of the p38, p70S6k, and JNK2 signaling
pathways in skeletal muscle 10.1152/japplphysiol.00870.2004. J Appl Physiol 98:
1562-1566.
Horne, L., Bell, G., Fisher, B., Warren, S., and Janowska-Wieczorek, A. 1997. Interaction
between cortisol and tumour necrosis factor with concurrent resistance and endurance
training. Clin J Sport Med 7: 247-251.
Houston, M.E. 2001. Biochemistry primer for exercise science, 2nd ed. Human Kinetics,
Campaign, Il.
Houten, S.M., and Auwerx, J. 2004. Turbocharging mitochondria. Cell 119: 5-7.
Hresko, R.C., and Mueckler, M. 2005. mTOR RICTOR Is the Ser473 Kinase for Akt/Protein
Kinase B in 3T3-L1 Adipocytes 10.1074/jbc.M508361200. J. Biol. Chem. 280:
40406-40416.
Hudson, E.R., Pan, D.A., James, J., Lucocq, J.M., Hawley, S.A., Green, K.A., Baba, O.,
Terashima, T., and Hardie, D.G. 2003. A Novel Domain in AMP-Activated Protein
Kinase Causes Glycogen Storage Bodies Similar to Those Seen in Hereditary Cardiac
Arrhythmias. Curr Biol 13: 861-866.

153
Hunter, G., Demment, R., and Miller, D. 1987. Development of strength and maximum
oxygen uptake during simultaneous training for strength and endurance. J Sports Med
Phys Fitness 27: 269-275.
Hunter, R.B., Stevenson, E., Koncarevic, A., Mitchell-Felton, H., Essig, D.A., and Kandarian,
S.C. 2002. Activation of an alternative NF-κB pathway in skeletal muscle during
disuse atrophy. Faseb J 16: 529-538.
Hurley, R.L., Anderson, K.A., Franzone, J.M., Kemp, B.E., Means, A.R., and Witters, L.A.
2005. The Ca2+/Calmodulin-dependent Protein Kinase Kinases Are AMP-activated
Protein Kinase Kinases 10.1074/jbc.M503824200. J. Biol. Chem. 280: 29060-29066.
Hurst, D., Taylor, E.B., Cline, T.D., Greenwood, L.J., Compton, C.L., Lamb, J.D., and
Winder, W.W. 2005. AMP-activated protein kinase kinase activity and
phosphorylation of AMP-activated protein kinase in contracting muscle of sedentary
and endurance-trained rats. Am J Physiol Endocrinol Metab 289: E710-715.
Ihlemann, J., Ploug, T., Hellsten, Y., and Galbo, H. 1999. Effect of tension on contraction-
induced glucose transport in rat skeletal muscle. Am J Physiol Endocrinol Metab 277:
E208-214.
Ingalls, C.P. 2004. Nature vs. nurture: can exercise really alter fibre type composition in
human skeletal muscle. J Appl Physiol 97: 1591-1592.
Inoki, K., Li, Y., Zhu, T., Wu, J., and Guan, K.L. 2002. TSC2 is phosphorylated and inhibited
by Akt and suppresses mTOR signalling. Nat Cell Biol 4: 648-657.
Irrcher, I., Adhihetty, P.J., Joseph, A.M., Ljubicic, V., and Hood, D.A. 2003. Regulation of
mitochondrial biogenesis in muscle by endurance exercise. Sports Med 33: 783-793.
Irrcher, I., and Hood, D.A. 2004. Regulation of Egr-1, SRF, and Sp1 mRNA expression in
contracting skeletal muscle cells. J Appl Physiol 97: 2207-2213.
Ishido, M., Kami, K., and Masuhara, M. 2004a. In vivo expression patterns of MyoD, p21,
and Rb proteins in myonuclei and satellite cells of denervated rat skeletal muscle. Am
J Physiol Cell Physiol 287: C484-493.
Ishido, M., Kami, K., and Masuhara, M. 2004b. Localization of MyoD, myogenin and cell
cycle regulatory factors in hypertrophying skeletal muscle. Acta Physiol Scand 180:
281-289.
Ivy, J.L., Chi, M.M., Hintz, C.S., Sherman, W.M., Hellendall, R.P., and Lowry, O.H. 1987.
Progressive metabolite changes in individual human muscle fibers with increasing
work rates. Am J Physiol Cell Physiol 252: C630-639.
Izquierdo, M., Hakkinen, K., Ibanez, J., Kraemer, W.J., and Gorostiaga, E.M. 2005. Effects of
combined resistance and cardiovascular training on strength, power, muscle cross-
sectional area, and endurance markers in middle-aged men. Eur J Appl Physiol 94: 70-
75.
Izquierdo, M., Ibanez, J., Hakkinen, K., Kraemer, W.J., Ruesta, M., and Gorostiaga, E.M.
2004. Maximal strength and power, muscle mass, endurance and serum hormones in
weightlifters and road cyclists. J Sports Sci 22: 465-478.
Jackman, R.W., and Kandarian, S.C. 2004. The molecular basis of skeletal muscle atrophy.
Am J Physiol Cell Physiol 287: C834-843.
Jacquemin, V., Furling, D., Bigot, A., Butler-Browne, G.S., and Mouly, V. 2004. IGF-1
induces human myotube hypertrophy by increasing cell recruitment. Experimental
Cell Research 299: 148-158.
Jefferson, L.S., Fabian, J.R., and Kimball, S.R. 1999. Glycogen synthase kinase-3 is the
predominant insulin-regulated eukaryotic initiation factor 2B kinase in skeletal
muscle. The International Journal of Biochemistry & Cell Biology 31: 191-200.
Jemiolo, B., and Trappe, S. 2004. Single muscle fiber gene expression in human skeletal
muscle: validation of internal control with exercise. Biochem Biophys Res Commun
320: 1043-1050.

154
Ji, L.L., Gomez-Cabrera, M.C., Steinhafel, N., and Vina, J. 2004. Acute exercise activates
nuclear factor NF-κB signaling pathway in rat skeletal muscle. Faseb J 18: 1499-
1506.
Jindra, M., Gaziova, I., Uhlirova, M., Okabe, M., Hiromi, Y., and Hirose, S. 2004.
Coactivator MBF1 preserves the redox-dependent AP-1 activity during oxidative
stress in Drosophila. EMBO J 23: 3538-3547.
Jones, N.C., Tyner, K.J., Nibarger, L., Stanley, H.M., Cornelison, D.D.W., Fedorov, Y.V.,
and Olwin, B.B. 2005. The p38α/β MAPK functions as a molecular switch to activate
the quiescent satellite cell. J. Cell Biol. 169: 105-116.
Jones, S.W., Hill, R.J., Krasney, P.A., O'Conner, B., Peirce, N., and Greenhaff, P.L. 2004.
Disuse atrophy and exercise rehabilitation in humans profoundly affects the
expression of genes associated with regulation of skeletal muscle mass. FASEB J 18:
1025-1027.
Jorgensen, S.B., Wojtaszewski, J.F.P., Viollet, B., Andreelli, F., Birk, J.B., Hellsten, Y.,
Schjerling, P., Vaulont, S., Neufer, P.D., Richter, E.A., et al. 2005. Effects of α-
AMPK knockout on exercise-induced gene activation in mouse skeletal muscle.
FASEB J.: 04-3144fje.
Kadi, F., Johansson, F., Johansson, R., Sjöström, M., and Henriksson, J. 2004. Effects of one
bout of endurance exercise on the expresion of myogenin in human quadriceps
muscle. Histochem Cell Biol 121: 329-334.
Kandarian, S., and Jackman, R. 2006. Intracellular signaling during skeletal muscle atrophy.
Muscle Nerve 33: 155-165.
Kanki, T., Ohgaki, K., Gaspari, M., Gustafsson, C.M., Fukuoh, A., Sasaki, N., Hamasaki, N.,
and Kang, D. 2004. Architectural Role of Mitochondrial Transcription Factor A in
Maintenance of Human Mitochondrial DNA. Mol. Cell. Biol. 24: 9823-9834.
Karlsson, H.K.R., Nilsson, P.-A., Nilsson, J., Chibalin, A.V., Zierath, J.R., and Blomstrand,
E. 2004. Branched-chain amino acids increase p70S6k phosphorylation in human
skeletal muscle after resistance exercise. Am J Physiol Endocrinol Metab 287: E1-7.
Kaushik, V.K., Young, M.E., Dean, D.J., Kurowski, T.G., Saha, A.K., and Ruderman, N.B.
2001. Regulation of fatty acid oxidation and glucose metabolism in rat soleus muscle:
effects of AICAR. Am J Physiol Endocrinol Metab 281: E335-340.
Kearns, J.D., Basak, S., Werner, S.L., Huang, C.S., and Hoffmann, A. 2006. IκBε provides
negative feedback to control NF-κB oscillations, signaling dynamics, and
inflammatory gene expression. J. Cell Biol. 173: 659-664.
Keren, A., Tamir, Y., and Bengal, E. 2006. The p38 MAPK signaling pathway: A major
regulator of skeletal muscle development. Molecular and Cellular Endocrinology In
Press, Corrected Proof.
Kim, D.-H., Sarbassov, D.D., Ali, S.M., Latek, R.R., Guntur, K.V.P., Erdjument-Bromage,
H., Tempst, P., and Sabatini, D.M. 2003. GβL, a Positive Regulator of the Rapamycin-
Sensitive Pathway Required for the Nutrient-Sensitive Interaction between Raptor and
mTOR. Molecular Cell 11: 895-904.
Kim, J.-S., Cross, J.M., and Bamman, M.M. 2005. Impact of resistance loading on myostatin
expression and cell cycle regulation in young and older men and women. Am J Physiol
Endocrinol Metab 288: E1110-1119.
Kimura, N., Tokunaga, C., Dalal, S., Richardson, C., Yoshino, K.-I., Hara, K., Kemp, B.E.,
Witters, L.A., Mimura, O., and Yonezawa, K. 2003. A possible linkage between
AMP-activated protein kinase (AMPK) and mammalian target of rapamycin (mTOR)
signalling pathway. Genes Cells 8: 65-79.
Koopman, R., Zorenc, A.H.G., Gransier, R.J.J., Cameron-Smith, D., and van Loon, L.J.C.
2006. Increase in S6K1 phosphorylation in human skeletal muscle following
resistance exercise occurs mainly in type II muscle fibers
10.1152/ajpendo.00530.2005. Am J Physiol Endocrinol Metab 290: E1245-1252.

155
Kosek, D.J., Kim, J.-s., Petrella, J.K., Cross, J.M., and Bamman, M.M. 2006. Efficacy of 3
D/WK resistance training on myofiber hypertrophy and myogenic mechanisms in
young versus older adults. J Appl Physiol Epub ahead of print: 01474.02005.
Kostek, M.C., Delmonico, M.J., Reichel, J.B., Roth, S.M., Douglass, L., Ferrell, R.E., and
Hurley, B.F. 2005. Muscle strength response to strength training is influenced by
insulin-like growth factor 1 genotype in older adults. J Appl Physiol 98: 2147-2154.
Kostyak, J.C., Kimball, S.R., Jefferson, L.S., and Farrell, P.A. 2001. Severe diabetes inhibits
resistance exercise-induced increase in eukaryotic initiation factor 2B activity. J Appl
Physiol 91: 79-84.
Koulmann, N., and Bigard, A. 2006. Interaction between signalling pathways involved in
skeletal muscle responses to endurance exercise. Pflugers Arch 452: 125-139.
Krisan, A.D., Collins, D.E., Crain, A.M., Kwong, C.C., Singh, M.K., Bernard, J.R., and
Yaspelkis, B.B., III. 2004. Resistance training enhances components of the insulin
signaling cascade in normal and high-fat-fed rodent skeletal muscle. J Appl Physiol
96: 1691-1700.
Krook, A., Widegren, U., Jiang, X.J., Henriksson, J., Wallberg-Henriksson, H., Alessi, D.,
and Zierath, J.R. 2000. Effects of exercise on mitogen- and stress-activated signal
transduction in human skeletal muscle. Am J Physiol Regul Integr Comp Physiol 279:
R1716-R1721.
Krustrup, P., Ferguson, R.A., Kjar, M., and Bangsbo, J. 2003. ATP and heat production in
human skeletal muscle during dynamic exercise: higher efficiency of anaerobic than
aerobic ATP resynthesis 10.1113/jphysiol.2002.035089. J Physiol (Lond) 549: 255-
269.
Kubica, N., Bolster, D.R., Farrell, P.A., Kimball, S.R., and Jefferson, L.S. 2005. Resistance
Exercise Increases Muscle Protein Synthesis and Translation of Eukaryotic Initiation
Factor 2Bε mRNA in a Mammalian Target of Rapamycin-dependent Manner. J Biol
Chem 280: 7570-7580.
Kubica, N., Kimball, S.R., Jefferson, L.S., and Farrell, P.A. 2004. Alterations in the
expression of mRNAs and proteins that code for species relevant to eIF2B activity
after an acute bout of resistance exercise 10.1152/japplphysiol.00962.2003. J Appl
Physiol 96: 679-687.
Kumar, A., and Boriek, A.M. 2003. Mechanical stress activates the nuclear factor-kappaB
pathway in skeletal muscle fibers: a possible role in Duchenne muscular dystrophy.
Faseb J 17: 386-396.
Kumar, A., Chaudhry, I., Reid, M.B., and Boriek, A.M. 2002. Distinct Signaling Pathways
Are Activated in Response to Mechanical Stress Applied Axially and Transversely to
Skeletal Muscle Fibers 10.1074/jbc.M203654200. J. Biol. Chem. 277: 46493-46503.
Lai, K.-M.V., Gonzalez, M., Poueymirou, W.T., Kline, W.O., Na, E., Zlotchenko, E., Stitt,
T.N., Economides, A.N., Yancopoulos, G.D., and Glass, D.J. 2004. Conditional
activation of Akt in adult skeletal muscle induces rapid hypertrophy. Mol Cell Biol 24:
9295-9304.
Lang, C.H., Frost, R.A., Nairn, A.C., MacLean, D.A., and Vary, T.C. 2002. TNF-α impairs
heart and skeletal muscle protein synthesis by altering translation initiation. Am J
Physiol Endocrinol Metab 282: E336-347.
Lang, C.H., Krawiec, B.J., Huber, D., McCoy, J.M., and Frost, R.A. 2006. Sepsis and
inflammatory insults downregulate IGFBP-5, but not IGFBP-4, in skeletal muscle via
a TNF-dependent mechanism. Am J Physiol Regul Integr Comp Physiol 290: R963-
972.
Langen, R.C.J., Van Der Velden, J.L.J., Schols, A.M.W.J., Kelders, M.C.J.M., Wouters,
E.F.M., and Janssen-Heinnger, Y.M.W. 2004. Tumor necrosis factor-α inhibits
myogenic differentiation through MyoD protein destabilization. FASEB J. 18: 227-
237.

156
Langley, B., Thomas, M., Bishop, A., Sharma, M., Gilmour, S., and Kambadur, R. 2002.
Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J
Biol Chem 277: 49831-49840.
Latres, E., Amini, A.R., Amini, A.A., Griffiths, J., Martin, F.J., Wei, Y., Lin, H.C.,
Yancopoulos, G.D., and Glass, D.J. 2005. Insulin-like Growth Factor-1 (IGF-1)
Inversely Regulates Atrophy-induced Genes via the Phosphatidylinositol 3-
Kinase/Akt/Mammalian Target of Rapamycin (PI3K/Akt/mTOR) Pathway. J. Biol.
Chem. 280: 2737-2744.
LeBlanc, P.J., Peters, S.J., Tunstall, R.J., Cameron-Smith, D., and Heigenhauser, G.J.F. 2004.
Effect of aerobic training on pyruvate dehydrogenase and pyruvate dehydrogenase
kinase in human skeletal muscle. J Physiol 557: 559-570.
Lecker, S.H., Jagoe, R.T., Gilbert, A., Gomes, M., Baracos, V., Bailey, J., Price, S.R., Mitch,
W.E., and Goldberg, A.L. 2004. Multiple types of skeletal muscle atrophy involve a
common program of changes in gene expression. FASEB J. 18: 39-51.
Lecker, S.H., Solomon, V., Mitch, W.E., and Goldberg, A.L. 1999. Muscle Protein
Breakdown and the Critical Role of the Ubiquitin-Proteasome Pathway in Normal and
Disease States. J. Nutr. 129: 227S-.
Lee, C.-H., Olson, P., and Evans, R.M. 2003. Minireview: Lipid Metabolism, Metabolic
Diseases, and Peroxisome Proliferator-Activated Receptors. Endocrinology 144:
2201-2207.
Lee, J.L., Kim, M., Park, H.-S., Kim, H.S., Jeon, M.J., Oh, K.S., Koh, E.H., Won, J.C., Kim,
M.-S., Oh, G.T., et al. 2006. AMPK activation increases fatty acid oxidation in
skeletal muscle by activating PPARα and PGC-1. Biochem Biophys Res Commun 340:
291-295.
Lee, S.-J., and McPherron, A.C. 2001. Regulation of myostatin activity and muscle growth.
PNAS 98: 9306-9311.
Leveritt, M.D., Abernethy, P.J., Barry, B., and Logan, P.A. 2003. Concurrent strength and
endurance training: the influence of dependent variable selection. J Strength Cond Res
17: 503-508.
Leveritt, M.D., Abernethy, P.J., Barry, B.K., and Logan, P.A. 1999. Concurrent strength and
endurance training: A review. Sports Med 28: 413-427.
Li, P., Akimoto, T., Zhang, M., Williams, R.S., and Yan, Z. 2006. Resident stem cells are not
required for exercise-induced fiber-type switching and angiogenesis but are necessary
for activity-dependent muscle growth. Am J Physiol Cell Physiol 290: C1461-1468.
Li, Y.-P., Chen, Y., John, J., Moylan, J., Jin, B., Mann, D.L., and Reid, M.B. 2005. TNF-α
acts via p38 MAPK to stimulate expression of the ubiquitin ligase atrogin1/MAFbx in
skeletal muscle. FASEB J. 19: 362-370.
Li, Y.-P., LECKER, S.H., CHEN, Y., WADDELL, I.D., GOLDBERG, A.L., and REID, M.B.
2003. TNF-α increases ubiquitin-conjugating activity in skeletal muscle by up-
regulating UbcH2/E220k. FASEB J. 17: 1048-1057.
Lin, J., Wu, H., Tarr, P.T., Zhang, C.-Y., Wu, Z., Boss, O., Michael, L.F., Puigserver, P.,
Isotani, E., Olson, E.N., et al. 2002. Transcriptional co-activator PGC-1α drives the
formation of slow-twitch muscle fibres. Nature 418: 797-801.
Lin, S.-J., and Guarente, L. 2003. Nicotinamide adenine dinucleotide, a metabolic regulator of
transcription, longevity and disease. Current Opinion in Cell Biology 15: 241-246.
Liu, Y., Shen, T., Randall, W.R., and Schneider, M.F. 2005. Signaling pathways in activity-
dependent fiber type plasticity in adult skeletal muscle. J Muscle Res Cell Motil 26:
13-21.
Lluis, F., Ballestar, E., Suelves, M., Esteller, M., and Munoz-Canoves, P. 2005. E47
phosphorylation by p38 MAPK promotes MyoD/E47 association and muscle-specific
gene transcription. EMBO J 24: 974-984.

157
Lluis, F., Perdiguero, E., Nebreda, A.R., and Munoz-Canoves, P. 2006. Regulation of skeletal
muscle gene expression by p38 MAP kinases. Trends in Cell Biology 16: 36-44.
Loughna, P.T., Izumo, S., Goldspink, G., and Nadal-Ginard, B. 1990. Disuse and passive
stretch cause rapid alterations in expression of developmental and adult contractile
protein genes in skeletal muscle. Development 109: 217-223.
Loughna, P.T., and Morgan, M.J. 1999. Passive stretch modulates denervation induced
alterations in skeletal muscle myosin heavy chain mRNA levels. Pflugers Achiv 439:
52-55.
Lund, S., Pryor, P.R., Ostergaard, S., Schmitz, O., Pedersen, O., and Holman, G.D. 1998.
Evidence against protein kinase B as a mediator of contraction-induced glucose
transport and GLUT4 translocation in rat skeletal muscle. FEBS Letters 425: 472-474.
Luquet, S., Lopez-Soriano, J., Holst, D., Fredenrich, A., Melki, J., Rassoulzadegan, M., and
Grimaldi, P.A. 2003. Peroxisome proliferator-activated receptor &delta; controls
muscle development and oxydative capability. FASEB J.: 03-0269fje.
Ma, L., Chen, Z., Erdjument-Bromage, H., Tempst, P., and Pandolfi, P.P. 2005.
Phosphorylation and Functional Inactivation of TSC2 by Erk: Implications for
Tuberous Sclerosis and Cancer Pathogenesis. Cell 121: 179-193.
MacDougall, J.D., Sale, D.G., Elder, G.C., and Sutton, J.R. 1982. Muscle ultrastructural
characteristics of elite powerlifters and bodybuilders. Eur J Appl Physiol Occup
Physiol 48: 117-126.
MacPherson, P., Dennis, R., and Faulkner, J. 1997. Sarcomere dynamics and contraction-
induced injury to maximally activated single muscle fibres from soleus muscles of
rats. J Physiol 500: 523-580.
Mahoney, D.J., Carey, K., Fu, M.-H., Snow, R., Cameron-Smith, D., Parise, G., and
Tarnopolsky, M.A. 2004. Real-time RT-PCR analysis of housekeeping genes in
human skeletal muscle following acute exercise. Physiol Genomics 18: 226-231.
Mahoney, D.J., Parise, G., Melov, S., Safdar, A., and Tarnopolsky, M.A. 2005. Analysis of
global mRNA expression in human skeletal muscle during recovery from endurance
exercise. FASEB J. 19: 1498-14500.
Maniura-Weber, K., Goffart, S., Garstka, H.L., Montoya, J., and Wiesner, R.J. 2004.
Transient overexpression of mitochondrial transcription factor A (TFAM) is sufficient
to stimulate mitochondrial DNA transcription, but not sufficient to increase mtDNA
copy number in cultured cells. Nucl. Acids Res. 32: 6015-6027.
Manning, B.D., and Cantley, L.C. 2003. Rheb fills a GAP between TSC and TOR. Trends
Biochem Sci 28: 573-576.
Markuns, J.F., Wojtaszewski, J.F.P., and Goodyear, L.J. 1999. Insulin and Exercise Decrease
Glycogen Synthase Kinase-3 Activity by Different Mechanisms in Rat Skeletal
Muscle. J. Biol. Chem. 274: 24896-24900.
Matsakas, A., Friedel, A., Hertrampf, T., and Diel, P. 2005. Short-term endurance training
results in a muscle-specific decrease of myostatin mRNA content in the rat. Acta
Physiol Scand 183: 299-307.
Matsunaga, S., Inashima, S., Tsuchimochi, H., Yamada, T., Hazama, T., and Wada, M. 2002.
Altered sarcoplasmic reticulum function in rat diaphragm after high-intensity exercise.
Acta Physiol Scand 176: 227-232.
Matsuzaki, H., Daitoku, H., Hatta, M., Tanaka, K., and Fukamizu, A. 2003. Insulin-induced
phosphorylation of FKHR (Foxo1) targets to proteasomal degradation. PNAS 100:
11285-11290.
Matuszczak, Y., Farid, M., Jones, J., Lansdowne, S., Smith, M.A., Taylor, A.A., and Reid,
M.B. 2005. Effects of N-acetylcysteineon glutathione oxidation and fatigue during
handgrip exercise. Muscle Nerve 32: 633-638.

158
McCarthy, J.P., Agre, J.C., Graf, B.K., Pozniak, M.A., and Vailas, A.C. 1995. Compatibility
of adaptive responses with combining strength and endurance training. Med Sci Sports
Exerc 27: 429-436.
McCarthy, J.P., Pozniak, M.A., and Agre, J.C. 2002. Neuromuscular adaptations to
concurrent strength and endurance training. Med Sci Sports Exerc 34: 511-519.
McConell, G.K., Lee-Young, R.S., Chen, Z.-P., Stepto, N.K., Huynh, N.N., Stephens, T.J.,
Canny, B.J., and Kemp, B.E. 2005. Short-term exercise training in humans reduces
AMPK signalling during prolonged exercise independent of muscle glycogen. J
Physiol (Lond) 568: 665-676.
McCroskery, S., Thomas, M., Maxwell, L., Sharma, M., and Kambadur, R. 2003. Myostatin
negatively regulates satellite cell activation and self-renewal. J. Cell Biol. 162: 1135-
1147.
McCully, K.K., and Faulkner, J.A. 1985. Injury to skeletal muscle fibers of mice following
lengthening contractions. J Appl Physiol 59: 119-126.
McGee, S.L., and Hargreaves, M. 2004. Exercise and Myocyte Enhancer Factor 2 Regulation
in Human Skeletal Muscle. Diabetes 53: 1208-1214.
McNally, E.M. 2004. Powerful Genes - Myostatin regulation of human muscle mass. N Engl
J Med 350: 2642-2644.
McPherron, A.C., and Lee, S.-J. 1997. Double muscling in cattle due to mutations in the
myostatin gene. PNAS 94: 12457-12461.
Medved, I., Brown, M.J., Bjorksten, A.R., Leppik, J.A., Sostaric, S., and McKenna, M.J.
2003. N-acetylcysteine infusion alters blood redox status but not time to fatigue during
intense exercise in humans 10.1152/japplphysiol.00884.2002. J Appl Physiol 94:
1572-1582.
Medved, I., Brown, M.J., Bjorksten, A.R., Murphy, K.T., Petersen, A.C., Sostaric, S., Gong,
X., and McKenna, M.J. 2004. N-acetylcysteine enhances muscle cysteine and
glutathione availability and attenuates fatigue during prolonged exercise in endurance-
trained individuals 10.1152/japplphysiol.00371.2004. J Appl Physiol 97: 1477-1485.
Merrill, G.F., Kruth, E.J., Hardie, D.G., and Winder, W.W. 1997. AICA riboside increases
AMP-activated protein kinase, fatty acid oxidation, and glucose uptake in rat muscle.
Am J Physiol Endocrinol Metab 273: E1107-1112.
Michel, R.N., Dunn, S.E., and Chin, E.R. 2004. Calcineurin and skeletal muscle growth. Proc
Nutr Soc 63: 341-349.
Millet, G.P., Jaouen, B., Borrani, F., and Candau, R. 2002. Effects of concurrent endurance
and strength training on running economy and VO2 kinetics. Med Sci Sports Exerc 34:
1351-1359.
Mitchell, P.O., and Pavlath, G.K. 2004. Skeletal muscle atrophy leads to loss and dysfunction
of muscle precursor cells. Am J Physiol Cell Physiol 287: C1753-1762.
Moelling, K., Schad, K., Bosse, M., Zimmermann, S., and Schweneker, M. 2002. Regulation
of Raf-Akt cross-talk. J Biol Chem 277: 31099-31106.
Montagne, J., Stewart, M.J., Stocker, H., Hafen, E., Kozma, S.C., and Thomas, G. 1999.
Drosophila S6 Kinase: A Regulator of Cell Size. Science 285: 2126-2129.
Murgia, M., Serrano, A.L., Calabria, E., Pallafacchina, G., Lomo, T., and Schiaffino, S. 2000.
Ras is involved in nerve-activity-dependent regulation of muscle genes. Nat Cell Biol
2: 142-147.
Murphy, L.O., MacKeigan, J.P., and Blenis, J. 2004. A network of immediate early gene
products propogates subtle differences in mitogen-activated protein kinase signal
amplitude and duration. Mol Cell Biol 24: 144-153.
Murphy, L.O., Smith, S., Chen, R.-H., Fingar, D.C., and Blenis, J. 2002. Molecular
interpretation of ERK signal duration by immediate early gene products. Nat Cell Biol
4: 556-564.

159
Murphy, R.M., Watt, K.K.O., Cameron-Smith, D., Gibbons, C.J., and Snow, R.J. 2003.
Effects of creatine supplementation on housekeeping genes in human skeletal muscle
using real-time RT-PCR. Physiol. Genomics 12: 163-174.
Musaro, A., McCullagh, K., Paul, A., Houghton, L., Dobrowolny, G., Molinaro, M., Barton,
E.R., L Sweeney, H., and Rosenthal, N. 2001. Localized Igf-1 transgene expression
sustains hypertrophy and regeneration in senescent skeletal muscle. 27: 195-200.
Musaro, A., McCullagh, K.J.A., Naya, F.J., Olson, E.N., and Rosenthal, N. 1999. IGF-1
induces skeletal myocyte hypertrophy through calcineurin in association with GATA-
2 and NF-ATc1. Nature 400: 581-585.
Musi, N., Hayashi, T., Fujii, N., Hirshman, M.F., Witters, L.A., and Goodyear, L.J. 2001.
AMP-activated protein kinase activity and glucose uptake in rat skeletal muscle. Am J
Physiol Endocrinol Metab 280: E677-684.
Nader, G.A. 2005. Molecular determinants of skeletal muscle mass: getting the "AKT"
together. Int J Biochem Cell Biol 37: 1985-1996.
Nader, G.A., and Esser, K.A. 2001. Intracellular signaling specificity in skeletal muscle in
response to different modes of exercise. J Appl Physiol 90: 1936-1942.
Nader, G.A., McLoughlin, T.J., and Esser, K.A. 2005. mTOR function in skeletal muscle
hypertrophy: increased ribosomal RNA via cell cycle regulators
10.1152/ajpcell.00165.2005. Am J Physiol Cell Physiol 289: C1457-1465.
Nairn, A., and Palfrey, H. 1987. Identification of the major Mr 100,000 substrate for
calmodulin- dependent protein kinase III in mammalian cells as elongation factor-2. J.
Biol. Chem. 262: 17299-17303.
Nakano, Hamada, Hayashi, Yonemitsu, Miyamoto, Toyoda, Tanaka, Masuzaki, Ebihara,
Ogawa, et al. 2006. 2 Isoform-specific activation of 5'adenosine monophosphate-
activated protein kinase by 5-aminoimidazole-4-carboxamide-1-d-ribonucleoside at a
physiological level activates glucose transport and increases glucose transporter 4 in
mouse skeletal muscle. Metabolism 55: 300-308.
Natoli, G., Saccani, S., Bosisio, D., and Marazzi, I. 2005. Interactions of NF-κB with
chromatin: the art of being at the right place at the right time. Nat Immunol 6: 439-
445.
Nave, B.T., Ouwens, M., Withers, D.J., Alessi, D.R., and Shepherd, P.R. 1999. Mammalian
target of rapamycin is a direct target for protein kinase B: identification of a
convergence point for opposing effects of insulin and amino-acid deficiency on
protein translation. Biochem J 344: 427-431.
Naya, F.J., Mercer, B., Shelton, J., Richardson, J.A., Williams, R.S., and Olson, E.N. 2000.
Stimulation of Slow Skeletal Muscle Fiber Gene Expression by Calcineurin in Vivo
10.1074/jbc.275.7.4545. J. Biol. Chem. 275: 4545-4548.
Nelson, A.G., Arnall, D.A., Loy, S.F., Silvester, L.J., and Conlee, R.K. 1990. Consequences
of combining strength and endurance training regimens. Phys Ther 70: 287-297.
Neufer, P.D., and Dohm, G.L. 1993. Exercise induces a transient increase in transcription of
the GLUT-4 gene in skeletal muscle. Am J Physiol Cell Physiol 265: C1597-1603.
Nielsen, J.N., Frøsig, C., Sajan, M.P., Miura, A., Standaert, M.L., Graham, D.A.,
Wojtaszewski, J.F.P., Farese, R.V., and Richter, E.A. 2003a. Increased atypical PKC
activity in endurance-trained human skeletal muscle. Biochem Biophys Res Commun
312: 1147-1153.
Nielsen, J.N., Mustard, K.J.W., Graham, D.A., Yu, H., MacDonald, C.S., Pilegaard, H.,
Goodyear, L.J., Hardie, D.G., Richter, E.A., and Wojtaszewski, J.F.P. 2003b. 5'-AMP-
activated protein kinase activity and subunit expression in exercise-trained human
skeletal muscle. J Appl Physiol 94: 631-641.
Norrbom, J., Sundberg, C.J., Ameln, H., Kraus, W.E., Jansson, E., and Gustafsson, T. 2003.
PGC-1α mRNA expression is influenced by metabolic perturbation in exercising
human skeletal muscle. J Appl Physiol 96: 189-194.

160
Oberkofler, H., Esterbauer, H., Linnemayr, V., Strosberg, A.D., Krempler, F., and Patsch, W.
2002. Peroxisome Proliferator-activated Receptor PPARγ Coactivator-1 Recruitment
Regulates PPAR Subtype Specificity. J. Biol. Chem. 277: 16750-16757.
Ohanna, M., Sobering, A.K., Lapointe, T., Lorenzo, L., Praud, C., Petroulakis, E., Sonenberg,
N., Kelly, P.A., Sotiropoulos, A., and Pende, M. 2005. Atrophy of S6K1-/- skeletal
muscle cells reveals distinct mTOR effectors for cell cycle and size control. Nat Cell
Biol. 7: 286-294.
Olson, E.N., and Williams, R.S. 2000. Calcineurin Signaling and Muscle Remodeling. Cell
101: 689-692.
Ostrowski, K., Rohde, T., Asp, S., Schjerling, P., and Pedersen, B.K. 1999. Pro- and anti-
inflammatory cytokine balance in strenuous exercise in humans. J Physiol 515: 287-
291.
Park, I.-H., Erbay, E., Nuzzi, P., and Chen, J. 2005. Skeletal myocyte hypertrophy requires
mTOR kinase activity and S6K1. Experimental Cell Research 309: 211-219.
Parkington, J.D., LeBrasseur, N.K., Siebert, A.P., and Fielding, R.A. 2004. Contraction-
mediated mTOR, p70S6k, and ERK1/2 phosphorylation in aged skeletal muscle. J
Appl Physiol 97: 243-248.
Parkington, J.D., Siebert, A.P., LeBrasseur, N.K., and Fielding, R.A. 2003. Differential
activation of mTOR signaling by contractile activity in skeletal muscle. Am J Physiol
Regul Integr Comp Physiol 285: R1086-1090.
Parsons, S.A., Millay, D.P., Wilkins, B.J., Bueno, O.F., Tsika, G.L., Neilson, J.R., Liberatore,
C.M., Yutzey, K.E., Crabtree, G.R., Tsika, R.W., et al. 2004. Genetic Loss of
Calcineurin Blocks Mechanical Overload-induced Skeletal Muscle Fiber Type
Switching but Not Hypertrophy 10.1074/jbc.M313800200. J. Biol. Chem. 279: 26192-
26200.
Pavitt, G.D. 2005. eIF2B, a mediator of general and gene-specific translational control.
Biochem Soc Trans 33: 1487-1492.
Perkins, N.D., and Gilmore, T.D. 2006. Good cop, bad cop: the different faces of NF-κB. Cell
Death Differ 13: 759-772.
Petersen, A.M.W., and Pedersen, B.K. 2005. The anti-inflammatory effect of exercise. J Appl
Physiol 98: 1154-1162.
Petrella, J.K., Kim, J.-s., Cross, J.M., Kosek, D.J., and Bamman, M.M. 2006. Efficacy of
myonuclear addition may explain differential myofiber growth among resistance
trained young and older men and women. Am J Physiol Endocrinol Metab Epub
ahead of print: 00190.02006.
Phillips, S.M., Tipton, K.D., Aarsland, A., Wolf, S.E., and Wolfe, R.R. 1997. Mixed muscle
protein synthesis and breakdown after resistance exercise in humans. Am J Physiol
Endocrinol Metab 36: E99-E107.
Pilegaard, H., Ordway, G.A., Saltin, B., and Neufer, P.D. 2000. Transcriptional regulation of
gene expression in human skeletal muscle during recovery from exercise. Am J
Physiol Endocrinol Metab 279: E806-E814.
Pilegaard, H., Osada, T., Andersen, L.T., Helge, J.W., Saltin, B., and Neufer, P.D. 2005.
Substrate availability and transcriptional regulation of metabolic genes in human
skeletal muscle during recovery from exercise. Metabolism 54: 1048-1055.
Plomgaard, P., Bouzakri, K., Krogh-Madsen, R., Mittendorfer, B., Zierath, J.R., and Pedersen,
B.K. 2005. Tumor Necrosis Factor-α Induces Skeletal Muscle Insulin Resistance in
Healthy Human Subjects via Inhibition of Akt Substrate 160 Phosphorylation.
Diabetes 54: 2939-2945.
Psilander, N., Damsgaard, R., and Pilegaard, H. 2003. Resistance exercise alters MRF and
IGF-1 mRNA content in human skeletal muscle. J Appl Physiol 95: 1038-1044.

161
Pullen, N., Dennis, P.B., Andjelkovic, M., Dufner, A., Kozma, S.C., Hemmings, B.A., and
Thomas, G. 1998. Phosphorylation and Activation of p70s6k by PDK1. Science 279:
707-710.
Putman, C., Xu, X., Gillies, E., MacLean, I., and Bell, G. 2004. Effects of strength, endurance
and combined training on myosin heavy chain content and fibre-type distribution in
humans. Eur J Appl Physiol 92: 376 - 384.
Rasmussen, B.B., and Winder, W.W. 1997. Effect of exercise intensity on skeletal muscle
malonyl-CoA and acetyl-CoA carboxylase. J Appl Physiol 83: 1104-1109.
Rauch, C., and Loughna, P.T. 2005. Static stretch promotes MEF2A nuclear translocation and
expression of neonatal myosin heavy chain in C2C12 myocytes in a calcineurin- and
p38-dependent manner 10.1152/ajpcell.00346.2004. Am J Physiol Cell Physiol 288:
C593-605.
Raue, U., Slivka, D., Jemiolo, B., Hollon, C., and Trappe, S. 2006. Myogenic gene expression
at rest and after a bout of resistance exercise in young (18-30 yr) and old (80-89 yr)
women. J Appl Physiol 101: 53-59.
Raught, B., Peiretti, F., Gingras, A., Livingstone, M., Shahbazian, D., Mayeur, G.,
Polakiewicz, R., Sonenberg, N., and Hershey, J. 2004. Phosphorylation of eucaryotic
translation initiation factor 4B Ser422 is modulated by S6 kinases. EMBO J 23: 1761-
1769.
Reid, M.B. 2005. Response of the ubiquitin-proteasome pathway to changes in muscle
activity. Am J Physiol Regul Integr Comp Physiol 288: R1423-1431.
Reisz-Porszasz, S., Bhasin, S., Artaza, J.N., Shen, R., Sinha-Hikim, I., Hogue, A., Fielder,
T.J., and Gonzalez-Cadavid, N.F. 2003. Lower skeletal muscle mass in male
transgenic mice with muscle-specific over expression of myostatin. Am J Physiol
Endocrinol Metab 285: E876-888.
Rena, G., Woods, Y.L., Prescott, A.R., Peggie, M., Unterman, T.G., Williams, M.R., and
Cohen, P. 2002. Two novel phosphorylation sites on FKHR that are critical for its
nuclear exclusion. EMBO J. 21: 2263-2271.
Rennie, M.J., and Tipton, K.D. 2000. Protein and amino acid metabolism during and after
exercise and the effects of nutrition. Annu Rev Nutr 20: 457-483.
Rennie, M.J., Wackerhage, H., Spangenburg, E.E., and Booth, F.W. 2004. Control of the size
of the human muscle mass. Annu Rev Physiol 66: 799-828.
Reynolds, I., Thomas H., Reid, P., Larkin, L.M., and Dengel, D.R. 2004. Effects of aerobic
exercise training on the protein kinase B (PKB)/mammalian target of rapamycin
(mTOR) signaling pathway in aged skeletal muscle. Experimental Gerontology 39:
379-385.
Reynolds, T.H., IV, Bodine, S.C., and Lawrence, J.C., Jr. 2002. Control of Ser2448
Phosphorylation in the Mammalian Target of Rapamycin by Insulin and Skeletal
Muscle Load. J. Biol. Chem. 277: 17657-17662.
Richter, J.D., and Sonenberg, N. 2005. Regulation of cap-dependent translation by eIF4E
inhibitory proteins. 433: 477-480.
Riedy, M., Moore, R.L., and Gollnick, P.D. 1985. Adaptive response of hypertrophied
skeletal muscle to endurance training. J Appl Physiol 59: 127-131.
Ririe, K.M., Rasmussen, R.P., and Wittwer, C.T. 1997. Product Differentiation by Analysis of
DNA Melting Curves during the Polymerase Chain Reaction. Anal Biochem 245: 154-
160.
Rommel, C., Bodine, S.C., Clarke, B.A., Rossman, R., Nunez, L., Stitt, T.N., Yancopoulos,
G.D., and Glass, D.J. 2001. Mediation of IGF-1-induced skeletal myotube
hypertrophy by PI(3)K/Akt/mTOR and PI(3)K/Akt/GSK3 pathways. Nat Cell Biol 3:
1009-1013.

162
Rommel, C., Clarke, B.A., Zimmermann, S., Nuñez, L., Rossman, R., Reid, K., Moelling, K.,
Yancopoulos, G.D., and Glass, D.J. 1999. Differientiation stage-specific inhibition of
the Raf-MEK-ERK pathway by Akt. Science 286: 1738-1741.
Rose, A.J., Broholm, C., Kiillerich, K., Finn, S.G., Proud, C.G., Rider, M.H., Richter, E.A.,
and Kiens, B. 2005. Exercise rapidly increases eukaryotic elongation factor 2
phosphorylation in skeletal muscle of men 10.1113/jphysiol.2005.097154. J Physiol
(Lond) 569: 223-228.
Rose, A.J., and Hargreaves, M. 2003. Exercise increases Ca2+-calmodulin-dependent protein
kinase II activity in human skeletal muscle 10.1113/jphysiol.2003.054171. J Physiol
(Lond) 553: 303-309.
Rose, A.J., Kiens, B., and Richter, E.A. 2006. Ca2+-calmodulin dependent protein kinase
expression and signalling in skeletal muscle during exercise
10.1113/jphysiol.2006.111757. J Physiol (Lond): jphysiol.2006.111757.
Roth, S.M., Martel, G.F., Ferrell, R.E., Metter, E.J., Hurley, B.F., and Rogers, M.A. 2003.
Myostatin gene expression is reduced in humans with heavy-resistance strength
training. Exp Biol Med 228: 706-709.
Roux, P.P., and Blenis, J. 2004. ERK and p38 MAPK-activated protein kinases: a family of
protein kinases with diverse biological functions. Microbiol Mol Biol Rev 68: 320-
344.
Russell, A.P., Hesselink, M.K.C., Lo, S.K., and Schrauwen, P. 2005. Regulation of metabolic
transcriptional co-activators and transcription factors with acute exercise. FASEB J.:
04-3168fje.
Ruvinsky, I., and Meyuhas, O. 2006. Ribosomal protein S6 phosphorylation: from protein
synthesis to cell size. Trends Biochem Sci 31: 342-348.
Ryazanov, A.G. 1987. Ca2+/calmodulin-dependent phosphorylation of elongation factor 2.
FEBS Letters 214: 331-334.
Sacheck, J.M., Ohtsuka, A., McLary, S.C., and Goldberg, A.L. 2004. IGF-I stimulates muscle
growth by suppressing protein breakdown and expression of atrophy-related ubiquitin
ligases, atrogin-1 and MuRF1. Am J Physiol Endocrinol Metab 287: E591-E601.
Sakamoto, K., Arnolds, D.E.W., Ekberg, I., Thorell, A., and Goodyear, L.J. 2004a. Exercise
regulates Akt and glycogen synthase kinase-3 activities in human skeletal muscle.
Biochem Biophys Res Commun 319: 419-425.
Sakamoto, K., Aschenbach, W.G., Hirshman, M.F., and Goodyear, L.J. 2003. Akt signaling in
skeletal muscle: regulation by exercise and passive stretch. Am J Physiol Endocrinol
Metab 285: E1081-1088.
Sakamoto, K., and Goodyear, L.J. 2002. Exercise Effects on Muscle Insulin Signaling and
Action: Invited Review: Intracellular signaling in contracting skeletal muscle. J Appl
Physiol 93: 369-383.
Sakamoto, K., Goransson, O., Hardie, D.G., and Alessi, D.R. 2004b. Activity of LKB1 and
AMPK-related kinases in skeletal muscle: effects of contraction, phenformin, and
AICAR 10.1152/ajpendo.00074.2004. Am J Physiol Endocrinol Metab 287: E310-
317.
Sakamoto, K., Hirshman, M.F., Aschenbach, W.G., and Goodyear, L.J. 2002. Contraction
Regulation of Akt in Rat Skeletal Muscle. J. Biol. Chem. 277: 11910-11917.
Sakamoto, K., McCarthy, A., Smith, D., Green, K.A., Hardie, D.G., Ashworth, A., and Alessi,
A.R. 2005. Deficiency of LKB1 in skeletal muscle prevents AMPK activation and
glucose uptake during contraction. EMBO J 24: 1810-1820.
Sakuma, K., Nishikawa, J., Nakao, R., Watanabe, K., Totsuka, T., Nakano, H., Sano, M., and
Yasuhara, M. 2003. Calcineurin is a potent regulator for skeletal muscle regeneration
by association with NFATc1 and GATA-2. Acta Neuropathol 105: 271-280.
Saltin, B. 1969. Oxygen uptake and cardiac output during maximal treadmill and bicycle
exercise. Mal Cardiovasc 10: 393-399.

163
Sanders Williams, R., and Neufer, P.D. 1996. Regulation of gene expression in skeletal
muscle by contractile activity. In Handbook of Physiology. Section 12: Exercise:
Regulation and Intergration of Multiple Systems. (eds. L.B. Rowell, and J.T.
Shepherd). Oxford University Press, New York.
Sandri, M., Podhorska-Okolow, M., Geromel, V., Rizzi, C., Arslan, P., Franceschi, C., and
Carraro, U. 1997. Exercise induces myonuclear ubiquitination and apoptosis in
dystrophin-deficient muscle of mice. J Neuropathol Exp Neurol 56: 45-57.
Sandri, M., Sandri, C., Gilbert, A., Skurk, C., Calabria, E., Picard, A., Walsh, K., Schiaffino,
S., Lecker, S.H., and Goldberg, A.L. 2004. Foxo Transcription Factors Induce the
Atrophy-Related Ubiquitin Ligase Atrogin-1 and Cause Skeletal Muscle Atrophy. Cell
117: 399-412.
Santel, A., Frank, S., Gaume, B., Herrler, M., Youle, R.J., and Fuller, M.T. 2003. Mitofusin-1
protein is a generally expressed mediator of mitochondrial fusion in mammalian cells.
J Cell Sci 116: 2763-2774.
Santel, A., and Fuller, M. 2001. Control of mitochondrial morphology by a human mitofusin.
J Cell Sci 114: 867-874.
Sarbassov, D.D., Ali, S.M., Kim, D.-H., Guertin, D.A., Latek, R.R., Erdjument-Bromage, H.,
Tempst, P., and Sabatini, D.M. 2004. Rictor, a Novel Binding Partner of mTOR,
Defines a Rapamycin-Insensitive and Raptor-Independent Pathway that Regulates the
Cytoskeleton. Current Biology 14: 1296-1302.
Sarbassov, D.D., Ali, S.M., and Sabatini, D.M. 2005a. Growing roles for the mTOR pathway.
Current Opinion in Cell Biology. 17: 596-603.
Sarbassov, D.D., Ali, S.M., Sengupta, S., Sheen, J.-H., Hsu, P.P., Bagley, A.F., Markhard,
A.L., and Sabatini, D.M. 2006. Prolonged Rapamycin Treatment Inhibits mTORC2
Assembly and Akt/PKB. Molecular Cell 22: 159-168.
Sarbassov, D.D., Guertin, D.A., Ali, S.M., and Sabatini, D.M. 2005b. Phosphorylation and
Regulation of Akt/PKB by the Rictor-mTOR Complex. Science 307: 1098-1101.
Sartorelli, V., and Fulco, M. 2004. Molecular and Cellular Determinants of Skeletal Muscle
Atrophy and Hypertrophy. Sci STKE 2004: re11-.
Scarpulla, R.C. 2002. Transcriptional activators and coactivators in the nuclear control of
mitochondrial function in mammalian cells. Gene 286: 81-89.
Scarpulla, R.C. 2006. Nuclear control of respiratory gene expression in mammalian cells. J
Cell Biochem 97: 673-683.
Scherer, D., Brockman, J., Chen, Z., Maniatis, T., and Ballard, D. 1995. Signal-Induced
Degradation of IκBα Requires Site-Specific Ubiquitination. PNAS 92: 11259-11263.
Schertzer, J.D., Green, H.J., Duhamel, T.A., and Tupling, A.R. 2003. Mechanisms underlying
increases in SR Ca2+-ATPase activity after exercise in rat skeletal muscle
10.1152/ajpendo.00190.2002. Am J Physiol Endocrinol Metab 284: E597-610.
Schertzer, J.D., Green, H.J., Fowles, J.R., Duhamel, T.A., and Tupling, A.R. 2004. Effects of
prolonged exercise and recovery on sarcoplasmic reticulum Ca2+ cycling properties in
rat muscle homogenates. Acta Physiol Scand 180: 195-208.
Schieke, S.M., Phillips, D., McCoy, J.P., Jr, Aponte, A.M., Shen, R.-F., Balaban, R.S., and
Finkel, T. 2006. The mTOR pathway regulates mitochondrial oxygen consumption
and oxidative capacity. J. Biol. Chem. Epub ahead of print.
Schuelke, M., Wagner, K.R., Stolz, L.E., Hubner, C., Riebel, T., Komen, W., Braun, T.,
Tobin, J.F., and Lee, S.-J. 2004. Myostatin mutation associated with gross
hypertrophy in a child. N Engl J Med 350: 2682-2688.
Schwabe, R.F., and Sakurai, H. 2005. IKKβ phosphorylates p65 at S468 in transactivaton
domain 2. FASEB J.: 05-3736fje.
Scicchitano, B.M., Spath, L., Musaro, A., Molinaro, M., Rosenthal, N., Nervi, C., and
Adamo, S. 2005. Vasopressin-dependent Myogenic Cell Differentiation Is Mediated

164
 by Both Ca2+/Calmodulin-dependent Kinase and Calcineurin Pathways
10.1091/mbc.E05-01-0055. Mol. Biol. Cell 16: 3632-3641.
Scott, P.H., Brunn, G.J., Kohn, A.D., Roth, R.A., and Lawrence, J.C., Jr. 1998. Evidence of
insulin-stimulated phosphorylation and activation of the mammalian target of
rapamycin mediated by a protein kinase B signaling pathway. PNAS 95: 7772-7777.
Shahbazian, D., Roux, P.P., Mieulet, V., Cohen, M.S., Raught, B., Taunton, J., Hershey, J.W.,
Blenis, J., Pende, M., and Sonenberg, N. 2006. The mTOR/PI3K and MAPK
pathways converge on eIF4B to control its phosphorylation and activity. EMBO J 25:
2781-2791.
Shen, W.-H., Boyle, D.W., Wisniowski, P., Bade, A., and Liechty, E.A. 2005. Insulin and
IGF-I stimulate the formation of the eukaryotic initiation factor 4F complex and
protein synthesis in C2C12 myotubes independent of availability of external amino
acids. J Endocrinol 185: 275-289.
Sherwood, D.J., Dufresne, S.D., Markuns, J.F., Cheatham, B., Moller, D.E., Aronson, D., and
Goodyear, L.J. 1999. Differential regulation of MAP kinase, p70S6K, and Akt by
contraction and insulin in rat skeletal muscle. Am J Physiol Endocrinol Metab 276:
E870-878.
Shima, H., Pende, M., Chen, Y., Fumagalli, S., Thomas, G., and Kozma, S. 1998. Disruption
of the p70(s6k)/p85(s6k) gene reveals a small mouse phenotype and a new functional
S6 kinase. EMBO J 17: 6649-6659.
Short, K.R., Vittone, J.L., Bigelow, M.L., Proctor, D.N., Rizza, R.A., Coenen-Schimke, J.M.,
and Nair, K.S. 2003. Impact of aerobic exercise training on age-related changes in
insulin sensitivity and muscle oxidative capacity. Diabetes 52: 1888-1896.
Simone, C., Forcales, C.S., Hill, D.A., Imbalzano, A.N., Latella, L., and Puri, P.L. 2004. p38
pathway targets SWI-SNF chromatin-remodeling complex to muscle-specific loci. Nat
Genet 36: 738-742.
Siu, P.M., Donley, D.A., Bryner, R.W., and Alway, S.E. 2004. Myogenin and oxidative
enzyme gene expression levels are elevated in rat soleus muscles after endurance
training. J Appl Physiol Epub ahead of print: 00534.02003.
Sleeman, M., Wortley, K., Lai, K., Gowen, L., Kintner, J., Kline, W., Garcia, K., Stitt, T.,
Yancopoulos, G., Wiegand, S., et al. 2005. Absence of the lipid phosphatase SHIP2
confers resistance to dietary obesity. Nat Med 11: 199-205.
Smith, M.A., and Reid, M.B. 2006. Redox modulation of contractile function in respiratory
and limb skeletal muscle. Respiratory Physiology & Neurobiology In Press,
Corrected Proof.
Song, Y.H., Godard, M., Li, Y., Richmond, S.R., Rosenthal, N., and Delafontaine, P. 2005.
Insulin-Like Growth Factor I–Mediated Skeletal Muscle Hypertrophy Is Characterized
by Increased mTOR-p70S6K Signaling without Increased Akt Phosphorylation. J
Investig Med 53: 135-142.
Soriano, F.X., Liesa, M., Bach, D., Chan, D.C., Palacin, M., and Zorzano, A. 2006. Evidence
for a Mitochondrial Regulatory Pathway Defined by Peroxisome Proliferator-
Activated Receptor-γ Coactivator-1α, Estrogen-Related Receptor-α, and Mitofusin 2.
Diabetes 55: 1783-1791.
Southgate, R.J., Bruce, C.R., Carey, A.L., Steinberg, G.R., Walder, K., Monks, R., Watt,
M.J., Hawley, J.A., Birnbaum, M.J., and Febbraio, M.A. 2005. PGC-1&alpha; gene
expression is down-regulated by Akt-mediated phosphorylation and nuclear exclusion
of FoxO1 in insulin-stimulated skeletal muscle. FASEB J. 19: 2072-2074.
Spangenburg, E.E., Abraha, T., Childs, T.E., Pattison, J.S., and Booth, F.W. 2002. Skeletal
muscle IGF-binding protein-3 and -5 expressions are age, muscle and load dependent.
Am J Physiol Endocrinol Metab 284: E340-E350.

165
Spangenburg, E.E., and McBride, T.A. 2006. Inhibition of stretch-activated channels during
eccentric muscle contraction attenuates p70S6K activation
10.1152/japplphysiol.00619.2005. J Appl Physiol 100: 129-135.
Spriet, L.L. 2002. Regulation of skeletal muscle fat oxidation during exercise in humans. Med
Sci Sports Exerc 34: 1477-1484.
Sriwijitkamol, A., Christ-Roberts, C., Berria, R., Eagan, P., Pratipanawatr, T., DeFronzo,
R.A., Mandarino, L.J., and Musi, N. 2006. Reduced Skeletal Muscle Inhibitor of κBβ
Content Is Associated With Insulin Resistance in Subjects With Type 2 Diabetes:
Reversal by Exercise Training. Diabetes 55: 760-767.
Sriwijitkamol, A., Ivy, J.L., Christ-Roberts, C., DeFronzo, R.A., Mandarino, L.J., and Musi,
N. 2005. LKB1-AMPK Signaling in Muscle from Obese Insulin Resistant Zucker Rats
and Effects of Training 10.1152/ajpendo.00429.2005. Am J Physiol Endocrinol
Metab: 00429.02005.
Steinbrecher, K.A., Wilson, W., III, Cogswell, P.C., and Baldwin, A.S. 2005. Glycogen
Synthase Kinase 3β Functions To Specify Gene-Specific, NF-κB-Dependent
Transcription. Mol. Cell. Biol. 25: 8444-8455.
Stephens, L., Anderson, K., Stokoe, D., Erdjument-Bromage, H., Painter, G.F., Holmes, A.B.,
Gaffney, P.R.n.J., Reese, C.B., McCormick, F., Tempst, P., et al. 1998. Protein Kinase
B Kinases That Mediate Phosphatidylinositol 3,4,5-Trisphosphate-Dependent
Activation of Protein Kinase B 10.1126/science.279.5351.710. Science 279: 710-714.
Stephens, T.J., Chen, Z.-P., Canny, B.J., Michell, B.J., Kemp, B.E., and McConell, G.K.
2002. Progressive increase in human skeletal muscle AMPKα 2 activity and ACC
phosphorylation during exercise 10.1152/ajpendo.00101.2001. Am J Physiol
Endocrinol Metab 282: E688-694.
Stitt, T.N., Drujan, D., Clarke, B.A., Panaro, F., Timofeyva, Y., Kline, W.O., Gonzalez, M.,
Yancopoulos, G.D., and Glass, D.J. 2004. The IGF/PI3K/Akt pathway prevents
expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO
transcription factors. Mol Cell 14: 395-403.
Stofan, D.A., Callahan, L.A., DiMarco, A.F., Nethery, D.E., and Supinski, G.S. 2000.
Modulation of Release of Reactive Oxygen Species by the Contracting Diaphragm.
Am. J. Respir. Crit. Care Med. 161: 891-898.
Stone, J., Brannon, T., Haddad, F., Qin, A., and Baldwin, K.M. 1996. Adaptive responses of
hypertrophying skeletal muscle to endurance training. J Appl Physiol 81: 665-672.
Stupka, N., Tarnopolsky, M.A., Yardley, N.J., and Phillips, S.M. 2001. Cellular adaptation to
repeated eccentric exercise-induced muscle damage. J Appl Physiol 91: 1669-1678.
Suelves, M., Lluis, F., Ruiz, V., Nebreda, A.R., and Munoz-Canoves, P. 2004.
Phosphorylation of MRF4 transactivation domain by p38 mediates repression of
specific myogenic genes. EMBO J 23: 365-375.
Sugden, M.C., and Holness, M.J. 2003. Recent advances in mechanisms regulating glucose
oxidation at the level of the pyruvate dehydrogenase complex by PDKs. Am J Physiol
Endocrinol Metab 284: E855-862.
Takano, A., Usui, I., Haruta, T., Kawahara, J., Uno, T., Iwata, M., and Kobayashi, M. 2001.
Mammalian Target of Rapamycin Pathway Regulates Insulin Signaling via
Subcellular Redistribution of Insulin Receptor Substrate 1 and Integrates Nutritional
Signals and Metabolic Signals of Insulin. Mol. Cell. Biol. 21: 5050-5062.
Talmadge, R., Otis, J., Rittler, M., Garcia, N., Spencer, S., Lees, S., and Naya, F. 2004.
Calcineurin activation influences muscle phenotype in a muscle-specific fashion. BMC
Cell Biol 5:28.
Tang, X., Powelka, A.M., Soriano, N.A., Czech, M.P., and Guilherme, A. 2005. PTEN, but
Not SHIP2, Suppresses Insulin Signaling through the Phosphatidylinositol 3-
Kinase/Akt Pathway in 3T3-L1 Adipocytes 10.1074/jbc.M501949200. J. Biol. Chem.
280: 22523-22529.

166
Taniguchi, C., Emanuelli, B., and Kahn, C. 2006. Critical nodes in signalling pathways:
insights into insulin action. Nat Rev Mol Cell Biol 7: 85-96.
Taylor, E.B., Lamb, J.D., Hurst, R.W., Chesser, D.G., Ellingson, W.J., Greenwood, L.J.,
Porter, B.B., Herway, S.T., and Winder, W.W. 2005. Endurance training increases
skeletal muscle LKB1 and PGC-1α protein abundance: effects of time and intensity
10.1152/ajpendo.00237.2005. Am J Physiol Endocrinol Metab 289: E960-968.
Tee, A.R., Fingar, D.C., Manning, B.D., Kwiatkowski, D.J., Cantley, L.C., and Blenis, J.
2002. Tuberous sclerosis complex-1 and -2 gene products function together to inhibit
mammalian target of rapamycin (mTOR)-mediated downstream signaling. PNAS 99:
13571-13576.
Terada, S., Goto, M., Kato, M., Kawanaka, K., Shimokawa, T., and Tabata, I. 2002. Effects of
low-intensity prolonged exercise on PGC-1 mRNA expression in rat epitrochlearis
muscle. Biochemical and Biophysical Research Communications 296: 350-354.
Terada, S., Kawanaka, K., Goto, M., Shimokawa, T., and Tabata, I. 2005. Effects of high-
intensity intermittent swimming on PGC-1α protein expression in rat skeletal muscle.
Acta Physiol Scand 184: 59-65.
Terada, S., and Tabata, I. 2003. Effects of acute bouts of running and swimming exercise on
PGC-1α protein expression in rat epitrochlearis and soleus muscle. Am J Physiol
Endocrinol Metab 286: E208-216.
Teran-Garcia, M., Rankinen, T., Koza, R.A., Rao, D.C., and Bouchard, C. 2005. Endurance
training-induced changes in insulin sensitivity and gene expression. Am J Physiol
Endocrinol Metab 288: E1168-1178.
Tergaonkar, V., Correa, R.G., Ikawa, M., and Verma, I.M. 2005. Distinct roles of I[kappa]B
proteins in regulating constitutive NF-κB activity. 7: 921-923.
Thomas, M., Langley, B., Berry, C., Sharma, M., Kirk, S., Bass, J., and Kambadur, R. 2000.
Myostatin, a Negative Regulator of Muscle Growth, Functions by Inhibiting Myoblast
Proliferation. J. Biol. Chem. 275: 40235-40243.
Thompson, H.S., Maynard, E.B., Morales, E.R., and Scordilis, S.P. 2003. Exercise-induced
HSP27, HSP70 and MAPK responses in human skeletal muscle. Acta Physiol Scand
178: 61-72.
Thomson, D.M., and Gordon, S.E. 2006. Impaired Overload-induced Muscle Growth is
associated with Diminished Translational Signaling in Aged Rat Fast-twitch Skeletal
Muscle 10.1113/jphysiol.2006.107490. J Physiol (Lond): jphysiol.2006.107490.
Thong, F.S.L., Derave, W., UrsØ, B., Kiens, B., and Richter, E.A. 2003. Prior exercise
increases basal and insulin-induced p38 mitogen activated protein kinase
phosphorylation in human skeletal muscle. J Appl Physiol 94: 2337-2341.
Thorell, A., Hirshman, M.F., Nygren, J., Jorfeldt, L., Wojtaszewski, J.F.P., Dufresne, S.D.,
Horton, E.S., Ljungqvist, O., and Goodyear, L.J. 1999. Exercise and insulin cause
GLUT-4 translocation in human skeletal muscle. Am J Physiol Endocrinol Metab 277:
E733-741.
Tidball, J.G. 2005. Mechanical signal transduction in skeletal muscle growth and adaptation
10.1152/japplphysiol.01178.2004. J Appl Physiol 98: 1900-1908.
Tintignac, L.A., Lagirand, J., Batonnet, S., Sirri, V., Leibovitch, M.P., and Leibovitch, S.A.
2005. Degradation of MyoD Mediated by the SCF (MAFbx) Ubiquitin Ligase. J. Biol.
Chem. 280: 2847-2856.
Tischler, M.E., Rosenberg, S., Satarug, S., Henriksen, E., Kirby, C., Tome, M., and Chase, P.
1990. Different mechanisms of increased proteolysis in atrophy induced by
denervation or unweighting of rat soleus muscle. Metabolism 39: 756-763.
Toyoda, T., Tanaka, S., Ebihara, K., Masuzaki, H., Hosoda, K., Sato, K., Fushiki, T., Nakao,
K., and Hayashi, T. 2006. Low-intensity contraction activates the α1-isoform of 5'-
AMP-activated protein kinase in rat skeletal muscle 10.1152/ajpendo.00395.2005. Am
J Physiol Endocrinol Metab 290: E583-590.

167
Tseng, B.S., Kasper, C.E., and Edgerton, V.R. 1994. Cytoplasm-to-nucleus ratios and
succinate dehydrogenase activities in adult rat slow and fast muscle fibers. Cell Tissue
Res 275: 39-49.
Tseng, B.S., Marsh, D.R., Hamilton, M.T., and Booth, F.W. 1995. Strength and aerobic
training attenuate muscle wasting and improve resistance to the development of
disability with aging. J Gerontol A Biol Sci Med Sci 50A: 113-119.
Tunstall, R.J., Mehan, K.A., Wadley, G.D., Collier, G.R., Bonen, A., Hargreaves, M., and
Cameron-Smith, D. 2002. Exercise training increases lipid metabolism gene
expression in human skeletal muscle. Am J Physiol Endocrinol Metab 283: E66-E72.
Turinsky, J., and Damrau-Abney, A. 1999. Akt kinases and 2-deoxyglucose uptake in rat
skeletal muscles in vivo: study with insulin and exercise. Am J Physiol Regul Integr
Comp Physiol 276: R277-282.
Vandenburgh, H.H., Karlisch, P., Shansky, J., and Feldstein, R. 1991. Insulin and IGF-I
induce pronounced hypertrophy of skeletal myofibers in tissue culture. Am J Physiol
Cell Physiol 260: C475-484.
Vary, T.C. 2006. IGF-I stimulates protein synthesis in skeletal muscle through multiple
signaling pathways during sepsis. Am J Physiol Regul Integr Comp Physiol 290:
R313-321.
Vary, T.C., Deiter, G., and Kimball, S.R. 2002. Phosphorylation of eukaryotic initiation factor
eIF2Bε in skeletal muscle during sepsis 10.1152/ajpendo.00171.2002. Am J Physiol
Endocrinol Metab 283: E1032-1039.
Vary, T.C., and Lynch, C.J. 2006. Meal feeding enhances formation of eIF4F in skeletal
muscle: role of increased eIF4E availability and eIF4G phosphorylation
10.1152/ajpendo.00460.2005. Am J Physiol Endocrinol Metab 290: E631-642.
Vashisht Gopal, Y., Arora, T., and Van Dyke, M. 2006. Tumor necrosis factor-alpha depletes
histone deacetylase 1 protein through IKK2. EMBO Rep 7: 291-296.
Vega, R.B., Huss, J.M., and Kelly, D.P. 2000. The Coactivator PGC-1 Cooperates with
Peroxisome Proliferator-Activated Receptorα in Transcriptional Control of Nuclear
Genes Encoding Mitochondrial Fatty Acid Oxidation Enzymes. Mol. Cell. Biol. 20:
1868-1876.
Vissing, K., Andersen, J.L., Harridge, S.D.R., Sandri, C., Hartkopp, A., Kjaer, M., and
Schjerling, P. 2005. Gene expression of myogenic factors and phenotype-specific
markers in electrically stimulated muscle of paraplegics. J Appl Physiol 99: 164-172.
Vissing, K., Andersen, J.L., and Schjerling, P. 2004. Are exercise-induced genes induced by
exercise? FASEB J.: 04-2084fje.
Vyas, D.R., Spangenburg, E.E., Abraha, T.W., Childs, T.E., and Booth, F.W. 2002. GSK-3β
negatively regulates skeletal myotube hypertrophy. Am J Physiol Cell Physiol 283:
C545-551.
Wadley, G.D., Lee-Young, R.S., Canny, B.J., Wasuntarawat, C., Chen, Z.P., Hargreaves, M.,
Kemp, B.E., and McConell, G.K. 2006. Effect of exercise intensity and hypoxia on
skeletal muscle AMPK signaling and substrate metabolism in humans. Am J Physiol
Endocrinol Metab 290: E694-702.
Wadley, G.D., Tunstall, R.J., Sanigorski, A., Collier, G.R., Hargreaves, M., and Cameron-
Smith, D. 2001. Differential effects of exercise on insulin-signaling gene expression in
human skeletal muscle. J Appl Physiol 90: 436-440.
Wagner, K.R., Liu, X., Chang, X., and Allen, R.E. 2005. Muscle regeneration in the
prolonged absence of myostatin. PNAS 102: 2519-2524.
Wang, X., Beugnet, A., Murakami, M., Yamanaka, S., and Proud, C.G. 2005. Distinct
Signaling Events Downstream of mTOR Cooperate To Mediate the Effects of Amino
Acids and Insulin on Initiation Factor 4E-Binding Proteins. Mol. Cell. Biol. 25: 2558-
2572.

168
Wang, X., Li, W., Williams, M., Terada, N., Alessi, D., and Proud, C. 2001. Regulation of
elongation factor 2 kinase by p90(RSK1) and p70 S6 kinase. EMBO J 20: 4370-4379.
Wang, Y., Zhang, C., Yu, R.T., Cho, H.K., Nelson, M.C., Bayuga-Ocampo, C.R., Ham, J.,
Kang, H., and Evans, R.M. 2004. Regulation of muscle fiber type and running
endurance by PPARδ. PLoS Biol 2: e294.
Welsh, G.I., Stokes, C.M., Wang, X., Sakaue, H., Ogawa, W., Kasuga, M., and Proud, C.G.
1997. Activation of translation initiation factor eIF2B by insulin requires phosphatidyl
inositol 3-kinase. FEBS Letters 410: 418-422.
Wick, M.J., Dong, L.Q., Riojas, R.A., Ramos, F.J., and Liu, F. 2000. Mechanism of
Phosphorylation of Protein Kinase B/Akt by a Constitutively Active 3-
Phosphoinositide-dependent Protein Kinase-1 10.1074/jbc.M003937200. J. Biol.
Chem. 275: 40400-40406.
Widegren, U., Jiang, X.J., Krook, A., Chibalin, A.V., Björnholm, M., Tally, M., Roth, R.A.,
Henriksson, J., Wallberg-Henriksson, H., and Zierath, J.R. 1998. Divergent effects of
exercise on metabolic and mitogenic signaling pathways in human skeletal muscle.
FASEB J. 12: 1379-1389.
Widegren, U., Ryder, J.W., and Zierath, J.R. 2001. Mitogen-activated protein kinase signal
transduction in skeletal muscle: effects of exercise and muscle contraction. Acta
Physiol Scand 172: 227-238.
Williams, R.S., and Neufer, P.D. 1996. Regulation of gene expression in skeletal muscle by
contractile activity. In Handbook of Physiology. Section 12: Exercise: Regulation and
Intergration of Multiple Systems. (eds. L.B. Rowell, and J.T. Shepherd), pp. 1124-
1150. Oxford University Press, New York.
Williamson, D., Gallagher, P., Harber, M., Hollon, C., and Trappe, S. 2003. Mitogen-
activated protein kinase (MAPK) pathway activation: effects of age and acute exercise
on human skeletal muscle. J Physiol 547: 977-987.
Williamson, D.L., Bolster, D.R., Kimball, S.R., and Jefferson, L.S. 2006a. Time course
changes in signaling pathways and protein synthesis in C2C12 myotubes following
AMPK activation by AICAR. Am J Physiol Endocrinol Metab 291: E80-89.
Williamson, D.L., Gallagher, P.M., Carroll, C.C., Raue, U., and Trappe, S.W. 2001.
Reduction in hybrid single muscle fiber proportions with resistance training in
humans. J Appl Physiol 91: 1955-1961.
Williamson, D.L., Kimball, S.R., and Jefferson, L.S. 2005. Acute treatment with TNF-α
attenuates insulin-stimulated protein synthesis in cultures of C2C12 myotubes through
a MEK1-sensitive mechanism. Am J Physiol Endocrinol Metab 289: E95-104.
Williamson, D.L., Kubica, N., Kimball, S.R., and Jefferson, L.S. 2006b. Exercise-induced
alterations in ERK1/2 and mTOR signaling to regulatory mechanisms of mRNA
translation in mouse muscle. J Physiol (Lond): jphysiol.2005.103481.
Willoughby, D.S. 2004. Effects of heavy resistance training on myostatin mRNA and protein
expression. Med Sci Sports Exerc 36: 574-582.
Willoughby, D.S., and Nelson, M.J. 2002. Myosin heavy-chain mRNA expression after a
single session of heavy-resistance exercise. Med Sci Sports Exerc 34: 1262-1269.
Willoughby, D.S., Taylor, M., and Taylor, L. 2003. Glucocorticoid receptor and ubiquitin
expression after repeated eccentric exercise. Med Sci Sports Exerc 35: 2023-2031.
Wilson, C., Hargreaves, M., and Howlett, K.F. 2006. Exercise does not alter subcellular
localization, but increases phosphorylation of insulin-signaling proteins in human
skeletal muscle. Am J Physiol Endocrinol Metab 290: E341-346.
Winder, W.W. 2001. Energy-sensing and signaling by AMP-activated protein kinase in
skeletal muscle. J Appl Physiol 91: 1017-1028.
Witters, L.A., Kemp, B.E., and Means, A.R. 2006. Chutes and Ladders: the search for protein
kinases that act on AMPK. Trends in Biochemical Sciences CELEBRATING 30
YEARS OF TiBS 31: 13-16.

169
Wojtaszewski, J.F.P., Birk, J.B., Frosig, C., Holten, M., Pilegaard, H., and Dela, F. 2005.
5'AMP activated protein kinase expression in human skeletal muscle: effects of
strength training and type 2 diabetes. J Physiol (Lond) 564: 563-573.
Wojtaszewski, J.F.P., Higaki, Y., Hirshman, M.F., Michael, M.D., Dufresne, S.D., Kahn,
C.R., and Goodyear, L.J. 1999. Exercise modulates postreceptor insulin signaling and
glucose transport in muscle-specific insulin receptor knockout mice. J. Clin. Invest.
104: 1257-1264.
Wojtaszewski, J.F.P., MacDonald, C., Nielsen, J.N., Hellsten, Y., Hardie, D.G., Kemp, B.E.,
Kiens, B., and Richter, E.A. 2003. Regulation of 5'AMP-activated protein kinase
activity and substrate utilization in exercising human skeletal muscle. Am J Physiol
Endocrinol Metab 284: E813-822.
Wojtaszewski, J.F.P., Nielsen, P., Hansen, B.F., Richter, E.A., and Kiens, B. 2000. Isoform-
specific and exercise intensity-dependent activation of 5'-AMP-activated protein
kinase in human skeletal muscle. J Physiol (Lond) 528: 221-226.
Woods, A., Dickerson, K., Heath, R., Hong, S.-P., Momcilovic, M., Johnstone, S.R., Carlson,
M., and Carling, D. 2005. Ca2+/calmodulin-dependent protein kinase kinase-β acts
upstream of AMP-activated protein kinase in mammalian cells. Cell Metabolism 2:
21-33.
Wretman, C., Lionikas, A., Widegren, U., Lännergren, J., Westerblad, H., and Henriksson, J.
2001. Effects of concentric and eccentric contractions on phosphorylation of
MAPKerk1/2 and MAPKp38 in isolated rat skeletal muscle. J Physiol 535.1: 155-164.
Wu, H., Kanatous, S.B., Thurmond, F.A., Gallardo, T., Isotani, E., Bassel-Duby, R., and
Williams, R.S. 2002. Regulation of Mitochondrial Biogenesis in Skeletal Muscle by
CaMK 10.1126/science.1071163. Science 296: 349-352.
Wu, H., Naya, F., McKinsey, T., Mercer, B., Shelton, J., Chin, E., Simard, A., Michel, R.,
Bassel-Duby, R., Olson, E., et al. 2000a. MEF2 responds to multiple calcium-
regulated signals in the control of skeletal muscle fiber type. EMBO J 19: 1963-1973.
Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti,
S., Lowell, B., Scarpulla, R.C., et al. 1999. Mechanisms Controlling Mitochondrial
Biogenesis and Respiration through the Thermogenic Coactivator PGC-1. Cell 98:
115-124.
Wu, Z., Woodring, P.J., Bhakta, K.S., Tamura, K., Wen, F., Feramisco, J.R., Karin, M.,
Wang, J.Y.J., and Puri, P.L. 2000b. p38 and extracellular signal-regulated kinases
regulate the myogenic program at multiple steps. Mol Cell Biol 20: 3951-3964.
Wyke, S., and Tisdale, M. 2005. NF-κB mediates proteolysis-inducing factor induced protein
degradation and expression of the ubiquitin-proteasome system in skeletal muscle. Br
J Cancer 92: 711-721.
Xanthoudakis, S., Miao, G., Wang, F., Pan, Y.C., and Curran, T. 1992. Redox activation of
Fos-Jun DNA binding activity is mediated by a DNA repair enzyme. EMBO J 11:
3323-3335.
Yang, Y., Creer, A., Jemiolo, B., and Trappe, S. 2005. Time course of myogenic and
metabolic gene expression in response to acute exercise in human skeletal muscle. J
Appl Physiol 98: 1745-1752.
Yang, Y., Jemiolo, B., and Trappe, S.W. 2006. Proteolytic mRNA Expression in Response to
Acute Resistance Exercise in Human Single Skeletal Muscle Fibers. J Appl Physiol
Epub ahead of print: 00438.02006.
Yu, M., Blomstrand, E., Chibalin, A.V., Krook, A., and Zierath, J.R. 2001. Marathon running
increases ERK 1/2 and p38 MAP kinase signalling to downstream targets in human
skeletal muscle. J Physiol 536: 273-282.
Yu, M., Stepto, N.K., Chibalin, A.V., Fryer, L.G.D., Carling, D., Krook, A., Hawley, J.A.,
and Zierath, J.R. 2003. Metabolic and mitogenic signal transduction in human skeletal
muscle after intense cycling exercise. J Physiol 546: 327-335.

170
Zammit, P.S., Golding, J.P., Nagata, Y., Hudon, V., Partridge, T.A., and Beauchamp, J.R.
2004. Muscle satellite cells adopt divergent fates: a mechanism for self-renewal? J
Cell Biol 166: 347-357.
Zhao, M., New, L., Kravchenko, V.V., Kato, Y., Gram, H., Di Padova, F., Olson, E.N.,
Ulevitch, R.J., and Han, J. 1999. Regulation of the MEF2 family of transcription
factors by p38. Mol Cell Biol 19: 21-30.
Zierath, J.R., and Hawley, J.A. 2004. Skeletal muscle fiber type: influence on contractile and
metabolic properties. PLoS Biol 2: e348.
Zong, H., Ren, J.M., Young, L.H., Pypaert, M., Mu, J., Birnbaum, M.J., and Shulman, G.I.
2002. AMP kinase is required for mitochondrial biogenesis in skeletal muscle in
response to chronic energy deprivation. PNAS 99: 15983-15987.

171