G Model

VETMIC-6299; No. of Pages 4

Veterinary Microbiology xxx (2013) xxx–xxx

Contents lists available at ScienceDirect

Veterinary Microbiology
journal homepage: www.elsevier.com/locate/vetmic

Ultrastructure of Ehrlichia mineirensis, a new member of the

Ehrlichia genus
Alejandro Cabezas-Cruz a,1, Marie Vancová a,1, Erich Zweygarth b,
Mucio Flavio Barbosa Ribeiro c, Libor Grubhoffer a, Lygia Maria Friche Passos d,c,*
a
University of South Bohemia, Faculty of Science and Biology Centre of the ASCR, Institute of Parasitology, České Budějovice, Czech Republic
b
Comparative Tropical Medicine and Parasitology, Ludwig-Maximilians-Universität München, Munich, Germany
c
Departamento de Parasitologia, ICB-UFMG, Belo Horizonte, Brazil
d
Departamento de Medicina Veterinaria Preventiva, INCT-Pecuária, Escola de Veterinária-UFMG, Belo Horizonte, Minas Gerais, Brazil

A R T I C L E I N F O A B S T R A C T

Article history: Recently, we reported the in vitro isolation and the molecular characterization of a new
Received 6 May 2013 species of Ehrlichia (Ehrlichia mineirensis) from haemolymph of Brazilian Rhipicephalus
Received in revised form 31 July 2013 (Boophilus) microplus ticks. This organism shows an ortholog of Ehrlichia canis major
Accepted 3 August 2013 immunogenic protein gp36 with a new structure of tandem repeats. In the present study,
we used electron microscopy (high pressure freezing and freeze substitution preparative
Keywords: techniques) to characterize morphologically this new agent growing in IDE8 tick cells. The
Ehrlichia mineirensis results showed that E. mineirensis shares ultrastructural features with other members of
Electron microscopy
the genus Ehrlichia (Ehrlichia muris, E. canis and Ehrlichia chaffeensis); typical
In vitro culture
parasitophorous vacuoles (morulae) contain electron-dense and reticulated Ehrlichiae
embedded inside a fibrillar matrix. We observed the characteristic Gram-negative-type
cell wall composed of both cytoplasmic and rippled outer membrane. We found organisms
undergoing binary fission and rarely altered cells with unusual invagination of the
cytoplasmic membrane.
ß 2013 Published by Elsevier B.V.

1. Introduction including Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia

Ehrlichiae are obligate intracytoplasmic Gram-nega-
tive, tick-borne bacteria belonging to the Anaplasmata-
ceae family. Ehrlichioses are considered as emerging
diseases in both humans and animals. At present, the
genus Ehrlichia consists of five recognized species,
* Corresponding author at: Departamento de Medicina Veterinária
Preventiva, Escola de Veterinária-UFMG Av. Antonio Carlos, 6627, CP 567,
Belo Horizonte, 30123-970, Minas Gerais, Brazil. Tel.: +55 (31) 34092075;
fax: +55 (31) 34092080.
E-mail addresses: alejandrocabezascruz@yahoo.es (A. Cabezas-Cruz),
vancova@paru.cas.cz (M. Vancová), zweygarthe@gmail.com (E. Zweygarth),
muciobr@icb.ufmg.br (M.F.B. Ribeiro), liborex@paru.cas.cz (L. Grubhoffer),
lygiapassos@yahoo.com, lygia@vet.ufmg.br (L.M.F. Passos).
1
Joint first authorship.
ewingii, Ehrlichia muris, and Ehrlichia ruminantium
(Dumler et al., 2001). The ultrastructure of members of
this genus has been previously characterized (Popov
et al., 1998; Bell-Sakyi et al., 2000). Recently, a new
species of the genus Ehrlichia was isolated from
haemolymph of Rhipicephalus (Boophilus) microplus
engorged females that were collected from naturally
infested cattle on a farm in the state of Minas Gerais,
Brazil and was called Ehrlichia mineirensis (Cabezas-Cruz
et al., 2012). The in vitro culture (Zweygarth et al., 2013)
and the molecular characterization of this agent were
previously reported (Cabezas-Cruz et al., 2012). The
present study aimed to further characterize morpholo-
gically this new organism through electron microscopy
using high pressure freezing and freeze substitution
preparative techniques.

0378-1135/$ – see front matter ß 2013 Published by Elsevier B.V.

http://dx.doi.org/10.1016/j.vetmic.2013.08.001

Please cite this article in press as: Cabezas-Cruz, A., et al., Ultrastructure of Ehrlichia mineirensis, a new member of the
Ehrlichia genus. Vet. Microbiol. (2013), http://dx.doi.org/10.1016/j.vetmic.2013.08.001
G Model
VETMIC-6299; No. of Pages 4
2 A. Cabezas-Cruz et al. / Veterinary Microbiology xxx (2013) xxx–xxx
2. Materials and methods
2.1. In vitro cultivation
Maintenance of E. mineirensis cultures was carried out
with medium changes twice a week as previously
described (Zweygarth et al., 2013). Briefly, IDE8 cells were
maintained at 32 8C in L-15B medium (Munderloh and
Kurtti, 1989), supplemented with 5% heat-inactivated
foetal bovine serum, 10% tryptose phosphate broth, 0.1%
bovine lipoprotein concentrate (MP Biomedicals, Santa
Ana, CA, USA), 100 IU/ml penicillin and 100 mg/ml
streptomycin. Infected IDE8 cultures were propagated in
a modified L-15B medium as outlined above, further
supplemented with 0.1% NaHCO3 and 10 mM HEPES. The
pH of the medium was adjusted to 7.5 with 1 N NaOH.
Infected cultures were propagated at 34 8C in 25 cm2
plastic culture flasks in 5 ml of the medium under normal
atmospheric conditions. Smears were fixed with methanol,
stained with an 8% Giemsa solution for 30 min and
examined under oil immersion at 1000 magnifications.
When the cultures reached approximately 80% of infection,
they were collected for electron microscopy sample
processing.
2.2. Sample processing and electron microscopy
Cells were centrifuged and the pellet was immersed in a
20% BSA solution. Cells were immediately frozen using a
high pressure freezer (EMPACT2, Leica Microsystems,
Vienna, Austria). Freeze substitution was performed in a
medium containing 2% OsO4 in anhydrous acetone for 96 h
at 90 8C. Then the temperature was raised to 4 8C (4 8C/
1 h). The samples were rinsed three times in acetone,
infiltrated and embedded in Polybed 812 at room
temperature. Ultrathin sections were contrasted in etha-
nolic uranyl acetate and lead citrate solutions, and
observed in a JEOL 1010 TEM (JEOL Ltd.) at an accelerating
voltage of 80 kV. Images were captured using a Mega View
III camera (SIS GmbH).
2.3. PCR
A PCR was carried out (Cabezas-Cruz et al., 2012) on
DNA extracted with a commercial kit (Qiagen Inc. Valencia,
CA) from uninfected and Ehrlichia-infected IDE8 cultures.
The primers set consisting of 8F (50 AGTTTGATCATGGCT-
CAG) and 1448R (50 CCATGGCGTGACGGGCAGTGTG) was
used to amplify 1400 base pairs of E. mineirensis 16S rRNA
gene.
3. Results and discussion
3.1. Ultrastructure of E. mineirensis
Infection of cultures was confirmed by direct examina-
tion of Giemsa-stained cytocentrifuge smears and PCR.
Both, microscopic examination and PCR results confirmed
that E. mineirensis cells (Fig. 1) and DNA (data not shown)
were present in the infected IDE8 culture and absent from
the uninfected cells. Uninfected IDE8 cells contained
Please cite this article in press as: Cabezas-Cruz, A., et al., Ultrastructure of Ehrlichia mineirensis, a new member of the
Ehrlichia genus. Vet. Microbiol. (2013), http://dx.doi.org/10.1016/j.vetmic.2013.08.001
Fig. 1. Giemsa-stained cytocentrifuge smear of Ehrlichia mineirensis in
IDE8 cells. IDE8 cells heavily infected with E. mineirensis. Rickettsiae
contained within cytoplasmic vacuoles as well as rickettsiae released
from infected cells (arrows) are shown. Magnification, 1000.
vacuoles and inclusions similar to those previously
described as phagolysosomes (Blouin and Kocan, 1998)
(data not shown). The phagolysosomes and secondary
lysosomes were present in infected IDE8 cells too (Fig. 2A,
asterisks), however, they also contained membrane-lined
vacuoles containing up to 25 rickettsial organisms 0.4–
1.5 mm in diameter (Fig. 2A). We were able to show the
presence of both reticulated (Fig. 2A) and electron-dense
bodies (Fig. 2B) which have been described previously for
other members of the genus Ehrlichia (Popov et al., 1998;
Bell-Sakyi et al., 2000). The organisms were round and
oval shaped (Fig. 2A and B) and they had typical tri-layered
cytoplasmic and outer membranes, in some the outer
membrane was rippled (Fig. 2B inset). It is noteworthy to
mention that we did not find high rickettsial polymorph-
ism as was reported previously for E. ruminantium (Bell-
Sakyi et al., 2000). We observed numerous reticulate cells
of E. mineirensis undergoing binary fission (Fig. 2C).
Parasitophorous vacuoles were surrounded by mitochon-
dria (Fig. 2D), and cisterns of rough endoplasmic
reticulum (Fig. 2E). In several cases, organelles were in
tight contact with the vacuole membrane (Fig. 2D and E)
similarly to observations made by others (Dedonder et al.,
2012). Moreover, we observed bundles of microtubules
(Fig. 2D, inset, white arrows) surrounding the membrane
of morulae which may be important for the movement of
the rickettsia through the cytoplasm. Some rickettsial
colonies also contained tiny vesicles visible in the
interrickettsial space (Fig. 2B and D black arrows), as
has been described for Anaplasma marginale in IDE8 cells
(Blouin and Kocan, 1998). We also found cells with an
unusual structure (Fig. 3) that has not been previously
reported; such cells were observed only rarely. Further
studies should clarify the relevance of cells with this kind
of structure.
The establishment of E. mineirensis in tick cell culture
provides a source of material for the study of this pathogen
(Zweygarth et al., 2013). The use of this culture system will
increase our knowledge and understanding of E. mine-
irensis development in ticks. Here we showed the
G Model
VETMIC-6299; No. of Pages 4

A. Cabezas-Cruz et al. / Veterinary Microbiology xxx (2013) xxx–xxx 3

Fig. 2. Electron micrograph of Ehrlichia mineirensis – infected IDE8 cells. (A) Cells containing phagolysosomes/secondary lysosomes (white asterisk) and
numerous vacuoles with bacteria. (B) Electron-dense bodies and small vesicles (black arrows) inside membrane-lined vacuoles. The inset shows in detail
the rippled membrane. (C) Reticulate cells undergoing binary fission. (D) The vacuole containing reticulate bodies that have ruffled outer membrane and
small vesicles (black arrows) is surrounded with mitochondria (Mi) and microtubules (detail in inset, white arrows). (E) A cisterna of endoplasmic reticulum
in tight contact with the membrane of the morulae.

successful ultrastructural characterization of this new et al., 2012) and present studies provide new insides in the
agent in IDE8 cells using electron microscopy. Even biology of this new species of the genus Ehrlichia.
thought further studies are needed to clarify the patho-
genic potential of this agent, our recent (Cabezas-Cruz Author’s contributions

AC-C, MV, LMFP, LG, EZ conceived and designed

research; AC-C and MV performed research and analyzed
data; EZ supervised the in vitro culture; AC-C and MV
wrote the paper; EZ, LG, LMFP, MFBR made critical
revisions to the manuscript.

Funding

This research was supported by POSTICK ITN (Post-

graduate training network for capacity building to control
ticks and tick-borne diseases) within the FP7-PEOPLE – ITN
programme (EU Grant No. 238511), by TE 01020118 and by
the GACR Z60220518. The funder had no role in study
design, data collection and analysis, decision to publish, or
preparation of the manuscript.

Competing interests
Fig. 3. Ehrlichia mineirensis with an unusual morphological structure. The
figure shows a cell with an invagination of the membrane, small vesicles The authors have declared that no competing interests
are shown (arrow). exist.

Please cite this article in press as: Cabezas-Cruz, A., et al., Ultrastructure of Ehrlichia mineirensis, a new member of the
Ehrlichia genus. Vet. Microbiol. (2013), http://dx.doi.org/10.1016/j.vetmic.2013.08.001
G Model
VETMIC-6299; No. of Pages 4

4 A. Cabezas-Cruz et al. / Veterinary Microbiology xxx (2013) xxx–xxx

Acknowledgements
The authors thank Dr Ulrike G. Munderloh (University
of Minnesota, USA) for permission to use the IDE8 cell line.
References
Bell-Sakyi, L., Paxton, E., Munderloh, U., Sumption, K., 2000. Growth of
Cowdria ruminantium, the causative agent of heartwater, in a tick cell
line. J. Clin. Microbiol. 38, 1238–1240.
Blouin, E., Kocan, K., 1998. Morphology and development of Anaplasma
marginale (Rickettsiales: Anaplasmataceae) in cultured Ixodes scapu-
laris (Acari: Ixodidae) cells. J. Med. Entomol. 33, 656–664.
Cabezas-Cruz, A., Zweygarth, E., Ribeiro, M., da Silveira, J., de la Fuente, J.,
Grubhoffer, L., Valdés, J., Passos, L., 2012. New species of Ehrlichia
isolated from Rhipicephalus (Boophilus) microplus shows an ortholog
of the E. canis major immunogenic glycoprotein gp36 with a new
sequence of tandem repeats. Parasit. Vectors 5, 291.
Dedonder, S., Cheng, C., Willard, L., Boyle, D., Ganta, R., 2012. Transmis-
sion electron microscopy reveals distinct macrophage- and tick
cell-specific morphological stages of Ehrlichia chaffeensis. PLoS
ONE 7, e36749.
Dumler, S., Barbet, A., Bekker, C., Dasch, G., Palmer, G., Ray Stuart, Rikihisa,
Y., Rurangirwa, F., 2001. Reorganization of genera in the families
Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: uni-
fication of some species of Ehrlichia with Anaplasma, Cowdria with
Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new
species combinations and designation of Ehrlichia equi and ‘HGE
agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst.
Evol. Microbiol. 51, 2145–2165.
Munderloh, U., Kurtti, T., 1989. Formulation of medium for tick cell
culture. Exp. Appl. Acarol. 7, 219–229.
Popov, V., Han, V., Chen, S., Dumler, J., Feng, H., Andreadisj, T., Tesh, R.,
Walker, D., 1998. Ultrastructural differentiation of the genogroups in
the genus Ehrlichia. J. Med. Microbiol. 47, 235–251.
Zweygarth, E., Schöl, H., Lis, K., Cabezas-Cruz, A., Thiel, C., Silaghi, C.,
Ribeiro, M., Passos, L., 2013. In vitro culture of a novel genotype of
Ehrlichia sp. from Brazil. Transbound Emerg. Dis. (in press).

Please cite this article in press as: Cabezas-Cruz, A., et al., Ultrastructure of Ehrlichia mineirensis, a new member of the
Ehrlichia genus. Vet. Microbiol. (2013), http://dx.doi.org/10.1016/j.vetmic.2013.08.001