Professional Documents
Culture Documents
Protein To Disease 2 2f3 Table 7 - Research 1
Protein To Disease 2 2f3 Table 7 - Research 1
Andersen’s Abode
● Condition on the autism spectrum
● Relatively rare, less than 200,000 cases per year
● It is chronic, lasts for years or lifetime
● Most with condition are socially awkward
● Generally have a specific subject in which they have an extreme passion
● Restricted interest in other subjects besides the passion
● Results in high levels of perseverance
● Very good at recognizing patterns and small details
● May be hypersensitive to lights, sounds, tastes
● May lead to clumsiness
● Hundreds of genetic variants contribute to occurrence
● Reduction in number of neurons fired
● Signs of persistent neurol inflammation
● Deforms/mutates/variates the neurexins, a family of synapse binding proteins
● Specifically affects three genes, NRXN1, NRXN2, and NRXN3 which all produce long
and short mRNA
● Impares spontaneous and evoked neurotransmitter release
● Dosage of NRXN1, specifically this gene, is extremely important for neurological
development
● eIF4E and 4E-BP2 are chemicals that regulate the eukaryotic translation and are
involved in the mRNA-ribosome binding of eukaryotic protein synthesis and are both
relatively uncommon. eIF4E initiates translation by binding to the messenger RNA
whereas 4E-BP2 blocks translation by inhibiting eIF4E
● The imbalance of these chemical in turn, lead to an imbalance of NLGN due to either a
decrease of 4E-BP2 or an increase in eIF4E. This shows that more NLGN1 is being
translated than needed making an imbalance in the proteins and leading to abnormal
brain functions
● Not a mutation in the mRNA, just an overabundance of eIF4E or a lack of 4E-BP2, which
regulates the translation of certain chemicals including NLGN1
● 3D model of protein here: http://www.rcsb.org/3d-view/3BIW/1
Derek’s Domicile
● Signs usually begin at 2 years old
● Struggle making eye contact, sometimes talk in a monotone voice
● Can dislike change
● Treated via social skills training, speech-language therapy, and cognitive behavioral
therapy
● Also treated with medicine
● Difficulties with day to day conversation as well as nonverbal conversation skills such as
distance, tone, and volume
● Brain affected
● Children with parents who have Aspergers gene are more likely to have it
● Controversial trial where Belgian doctors euthanize a woman with Asperger's
● A full cure may be impossible because autism can’t be cured
● Genes and exposure to chemicals during pregnancy increase risk
● Not life threatening disease, less need to cure it, less funding, rare
● Protein folding: primary, peptide bonds (cytoplasm), secondary bends folds up into alpha
helix or B sheets (rough ER), tertiary folded into 3D structure, determined by
hydrophobicity, makes domains (rough ER), and quaternary single peptides bond to
each other (golgi body)
● EIF4E DNA Sequence: ACCAAGAAGGTGGTTTATTCTAAGATAGGGTGGTTTACAG
● EIF4E mRNA Sequence:
UGGUUCUUCCACCAAAUAAGAUUCUAUCCCACCAAAUGUC
● NLGN1 DNA Sequence: TCACAAATCTGTAGGACAGGGGCAAAATGCTGCCAGCCTC
● NLGN1 mRNA Sequence:
AGUGUUUAGACAUCCUGUCCCCGUUUUACGACGGUCGGAG
Daniel’s Domain
● Proteins produced from these genes affect multiple aspects of brain development
● Production, growth, and organization of nerve cells
● Number of neurons that are produced
● Development or function of the connections between neurons where cell-to-cell
Communication takes place
● Cell projections that carry signals received at the synapses to the body of the neuron.
● Controlling the activity of other genes or proteins.
Sources
https://www.webmd.com/brain/autism/mental-health-aspergers-syndrome#1
https://www.autismspeaks.org/what-asperger-syndrome
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4161164/
https://www.spectrumnews.org/news/study-supports-flawed-protein-synthesis-theory-of-autism/
https://www.gstatic.com/healthricherkp/pdf/asperger_syndrome.pdf
http://www.autism-society.org/what-is/aspergers-syndrome/
Presentation Ideas:
● Podcast (one we chose to do)
● Video
● Poster